The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP031290	Lactobacillus rhamnosus GG chromosome, complete genome	3010116	405975	526431	3010116	transposase	Faecalibacterium_phage(15.0%)	103	NA	NA
AXI93412.1|405975_406992_-|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	33.4	1.2e-35
AXI93413.1|408137_408995_+	transketolase	NA	NA	NA	NA	NA
AXI93414.1|408987_410004_+	alpha-ketoacid dehydrogenase subunit beta	NA	NA	NA	NA	NA
AXI93415.1|410195_411050_+	ROK family protein	NA	NA	NA	NA	NA
AXI93416.1|411099_411858_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
AXI93417.1|412098_412572_+	PTS mannose transporter subunit IIAB	NA	NA	NA	NA	NA
AXI93418.1|412576_412906_+	PTS fructose transporter subunit IIB	NA	NA	NA	NA	NA
AXI93419.1|412930_414037_+	PTS fructose transporter subunit IIC	NA	NA	NA	NA	NA
AXI93420.1|414200_415217_+|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	33.4	1.2e-35
AXI93421.1|415297_416113_+	class II fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
AXI93422.1|416134_417028_+	ketose-bisphosphate aldolase	NA	NA	NA	NA	NA
AXI93423.1|417572_418049_-	PTS mannose/fructose/sorbose transporter subunit IIB	NA	NA	NA	NA	NA
AXI93424.1|418020_418449_-	PTS mannose transporter subunit IIB	NA	NA	NA	NA	NA
AXI93425.1|418466_420155_-	PTS mannose transporter subunit IICD	NA	NA	NA	NA	NA
AXI93426.1|420194_420905_-	transaldolase	NA	NA	NA	NA	NA
AXI93427.1|421096_422140_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
AXI93428.1|422378_423293_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AXI93429.1|423325_423676_+	PRD domain-containing protein	NA	NA	NA	NA	NA
AXI93430.1|423677_424040_+	DUF2620 domain-containing protein	NA	NA	NA	NA	NA
AXI93431.1|424100_425396_+	hypothetical protein	NA	NA	NA	NA	NA
AXI93432.1|425425_426310_+	phosphotriesterase-related protein	NA	NA	NA	NA	NA
AXI93433.1|426302_427409_+	aminotransferase	NA	NA	NA	NA	NA
AXI93434.1|427399_428572_+	YhfX family PLP-dependent enzyme	NA	NA	NA	NA	NA
AXI93435.1|428573_429803_+	phosphopentomutase	NA	NA	NA	NA	NA
AXI93436.1|430130_430967_+	DNA-directed RNA polymerase subunit delta	NA	NA	NA	NA	NA
AXI93437.1|431049_431610_+	ECF-type riboflavin transporter substrate-binding protein	NA	NA	NA	NA	NA
AXI93438.1|431611_433312_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	34.8	3.8e-18
AXI93439.1|433308_434136_+	energy-coupling factor transporter transmembrane protein EcfT	NA	NA	NA	NA	NA
AXI93440.1|434159_434456_+	hypothetical protein	NA	NA	NA	NA	NA
AXI93441.1|434487_435621_-	o-succinylbenzoate synthase	NA	NA	NA	NA	NA
AXI93442.1|436450_438265_+	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
AXI93443.1|438734_439646_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	33.0	8.4e-20
AXI93444.1|439987_440638_+	recombinase family protein	NA	M9Q1K0	Clostridium_phage	37.6	1.5e-18
AXI93445.1|440643_440928_+	cytosolic protein	NA	NA	NA	NA	NA
AXI93446.1|441666_441882_+	hypothetical protein	NA	NA	NA	NA	NA
AXI93447.1|442005_442404_+	pyridoxamine 5'-phosphate oxidase family protein	NA	NA	NA	NA	NA
AXI93448.1|442874_443954_-	class C sortase	NA	NA	NA	NA	NA
AXI93449.1|444027_445032_-	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
AXI93450.1|445034_445760_-	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
AXI93451.1|445752_448440_-	VWA domain-containing protein	NA	NA	NA	NA	NA
AXI93452.1|448580_449597_+|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	33.4	1.2e-35
AXI93453.1|450275_450833_-	hypothetical protein	NA	NA	NA	NA	NA
AXI93454.1|451871_453659_-	DNA helicase UvrD	NA	U5PSZ2	Bacillus_phage	25.9	1.7e-08
AXI93455.1|453655_455746_-	ATP-dependent endonuclease	NA	NA	NA	NA	NA
AXI93456.1|455863_457360_-|transposase	IS5-like element ISLrh2 family transposase	transposase	NA	NA	NA	NA
AXI93457.1|457653_457905_+|transposase	IS3 family transposase	transposase	Q6J1X3	Lactobacillus_phage	92.8	1.1e-35
AXI93458.1|457958_458750_+|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	98.9	2.0e-147
AXI93459.1|459083_459935_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	37.1	1.3e-43
AXI93460.1|460136_460484_-|transposase	transposase	transposase	NA	NA	NA	NA
AXI93461.1|460535_460799_-	hypothetical protein	NA	NA	NA	NA	NA
AXI93462.1|460858_463681_-	cation-transporting P-type ATPase	NA	M1IAU8	Acanthocystis_turfacea_Chlorella_virus	27.7	3.1e-73
AXI93463.1|464785_465940_-	cation:proton antiporter	NA	NA	NA	NA	NA
AXI93464.1|466446_467234_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXI93465.1|467283_467958_-|transposase	IS6 family transposase	transposase	A0A0N9RU54	Staphylococcus_phage	51.8	1.2e-58
AXI95777.1|468040_468142_-	hypothetical protein	NA	NA	NA	NA	NA
AXI95778.1|468800_470357_-	ClC family H(+)/Cl(-) exchange transporter	NA	NA	NA	NA	NA
AXI93466.1|470707_471628_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.0	5.3e-22
AXI93467.1|471662_472916_-	MFS transporter	NA	NA	NA	NA	NA
AXI93468.1|473014_474511_+|transposase	IS5-like element ISLrh2 family transposase	transposase	NA	NA	NA	NA
AXI93469.1|474512_475835_-	M20/M25/M40 family metallo-hydrolase	NA	NA	NA	NA	NA
AXI93470.1|477194_480173_+	beta-galactosidase subunit alpha	NA	L0N6M2	Herpes_simplex_virus	34.3	1.5e-147
AXI93471.1|480205_481687_+	amino acid permease	NA	NA	NA	NA	NA
AXI93472.1|481834_483292_+	amino acid permease	NA	NA	NA	NA	NA
AXI93473.1|483559_484414_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AXI93474.1|484574_486791_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AXI93475.1|487024_488224_+	MFS transporter	NA	NA	NA	NA	NA
AXI93476.1|488247_489678_+	amidohydrolase	NA	NA	NA	NA	NA
AXI93477.1|489763_490825_-	hypothetical protein	NA	NA	NA	NA	NA
AXI93478.1|490821_491574_-	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	33.0	1.9e-22
AXI93479.1|491583_492462_-	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AXI93480.1|492475_493144_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
AXI93481.1|493140_493827_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
AXI93482.1|494295_495033_-	hypothetical protein	NA	NA	NA	NA	NA
AXI95779.1|495268_495514_-	hypothetical protein	NA	NA	NA	NA	NA
AXI93483.1|495759_496305_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AXI93484.1|496421_496574_+	YvrJ family protein	NA	NA	NA	NA	NA
AXI93485.1|496585_497350_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A2P1CCE6	Lactobacillus_phage	52.0	2.3e-47
AXI93486.1|497570_498368_-	hypothetical protein	NA	NA	NA	NA	NA
AXI93487.1|498618_499122_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AXI93488.1|499129_500191_+	ABC transporter permease	NA	NA	NA	NA	NA
AXI93489.1|500195_500885_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.1	2.8e-28
AXI93490.1|501173_502544_-	FAD-dependent oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	26.6	1.2e-09
AXI93491.1|502790_503609_-	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
AXI93492.1|503731_504004_-	type II toxin-antitoxin system mRNA interferase toxin, RelE/StbE family	NA	NA	NA	NA	NA
AXI93493.1|504152_504917_-	DUF4111 domain-containing protein	NA	NA	NA	NA	NA
AXI95780.1|505326_505755_-	hypothetical protein	NA	NA	NA	NA	NA
AXI93494.1|507588_509007_-|transposase	IS5-like element ISLrh3 family transposase	transposase	NA	NA	NA	NA
AXI93495.1|509271_509553_+	hypothetical protein	NA	NA	NA	NA	NA
AXI93496.1|509531_510389_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AXI93497.1|510598_511615_+	linear amide C-N hydrolase	NA	M1H9I8	Acanthocystis_turfacea_Chlorella_virus	28.8	8.4e-21
AXI93498.1|511794_512760_-	hypothetical protein	NA	NA	NA	NA	NA
AXI93499.1|513030_514725_-	oleate hydratase	NA	NA	NA	NA	NA
AXI95781.1|514736_514865_-	hypothetical protein	NA	NA	NA	NA	NA
AXI93500.1|514953_515520_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AXI93501.1|515609_515978_-	PTS-dependent dihydroxyacetone kinase phosphotransferase subunit DhaM	NA	NA	NA	NA	NA
AXI93502.1|516253_516835_-	dihydroxyacetone kinase subunit L	NA	NA	NA	NA	NA
AXI93503.1|516821_517841_-	dihydroxyacetone kinase subunit DhaK	NA	NA	NA	NA	NA
AXI93504.1|518034_518463_-	dihydroneopterin aldolase	NA	NA	NA	NA	NA
AXI93505.1|518921_519605_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.9	1.1e-24
AXI93506.1|519611_520784_-	ABC transporter	NA	NA	NA	NA	NA
AXI93507.1|521183_522680_-|transposase	IS5-like element ISLrh2 family transposase	transposase	NA	NA	NA	NA
AXI93508.1|524050_524887_-	Rgg/GadR/MutR family transcriptional regulator	NA	NA	NA	NA	NA
AXI93509.1|524934_526431_-|transposase	IS5-like element ISLrh2 family transposase	transposase	NA	NA	NA	NA
>prophage 2
CP031290	Lactobacillus rhamnosus GG chromosome, complete genome	3010116	1102532	1142258	3010116	tail,terminase,integrase,head,portal,holin,capsid	Lactobacillus_phage(85.42%)	60	1092391:1092404	1129246:1129259
1092391:1092404	attL	CATGGCTGATACTG	NA	NA	NA	NA
AXI94019.1|1102532_1103717_-|integrase	site-specific integrase	integrase	A0A0P0I3D2	Lactobacillus_phage	99.2	7.3e-226
AXI94020.1|1103887_1104094_+	hypothetical protein	NA	NA	NA	NA	NA
AXI94021.1|1104061_1105063_-	hypothetical protein	NA	A0A1S5SA20	Streptococcus_phage	23.3	4.4e-06
AXI94022.1|1105173_1105377_-	hypothetical protein	NA	A0A0P0IQK8	Lactobacillus_phage	85.1	8.6e-26
AXI94023.1|1105400_1105826_-	pyridoxamine 5'-phosphate oxidase family protein	NA	A0A0P0I7K6	Lactobacillus_phage	94.3	2.5e-59
AXI94024.1|1106208_1106430_+	hypothetical protein	NA	NA	NA	NA	NA
AXI94025.1|1106430_1107186_-	hypothetical protein	NA	NA	NA	NA	NA
AXI94026.1|1107292_1107994_-	DUF3862 domain-containing protein	NA	A9D9J1	Lactobacillus_prophage	39.3	5.1e-25
AXI94027.1|1108053_1108476_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A1B0YA58	Lactobacillus_phage	93.5	5.1e-73
AXI94028.1|1108465_1108804_-	helix-turn-helix domain-containing protein	NA	A0A0P0IZG9	Lactobacillus_phage	98.2	6.6e-55
AXI94029.1|1108938_1109181_+	XRE family transcriptional regulator	NA	A0A0P0HRP5	Lactobacillus_phage	95.0	4.6e-34
AXI94030.1|1109177_1109426_+	hypothetical protein	NA	NA	NA	NA	NA
AXI94031.1|1109422_1109650_-	hypothetical protein	NA	NA	NA	NA	NA
AXI94032.1|1109961_1110510_+	hypothetical protein	NA	A0A1B0YE60	Lactobacillus_phage	97.8	1.0e-97
AXI94033.1|1110488_1110719_+	DNA-binding protein	NA	A0A1B0Y6A3	Lactobacillus_phage	98.6	5.5e-37
AXI94034.1|1110862_1111090_+	hypothetical protein	NA	NA	NA	NA	NA
AXI94035.1|1111296_1112172_+	recombinase RecT	NA	A0A1X9I5N6	Streptococcus_phage	52.2	5.7e-58
AXI94036.1|1112191_1112956_+	hypothetical protein	NA	A0A0P0IZH9	Lactobacillus_phage	54.0	4.0e-76
AXI94037.1|1112971_1113928_+	DnaD domain protein	NA	A0A1B0Y2R2	Lactobacillus_phage	90.9	2.0e-128
AXI94038.1|1113940_1114426_+	single-stranded DNA-binding protein	NA	U5U726	Lactobacillus_phage	86.3	8.8e-61
AXI94039.1|1114443_1114659_+	XRE family transcriptional regulator	NA	A0A0P0IJY1	Lactobacillus_phage	91.4	6.1e-30
AXI94040.1|1114655_1114847_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AXI94041.1|1115216_1115666_+	hypothetical protein	NA	B4XYT0	Lactobacillus_phage	93.2	6.2e-69
AXI94042.1|1115712_1115967_+	hypothetical protein	NA	A0A0P0IQP0	Lactobacillus_phage	94.0	4.6e-37
AXI94043.1|1115963_1116365_+	RusA family crossover junction endodeoxyribonuclease	NA	A8YQM5	Lactobacillus_phage	71.5	2.6e-50
AXI94044.1|1116377_1116842_+	endonuclease	NA	A0A0P0IXF6	Lactobacillus_phage	98.0	7.2e-20
AXI94045.1|1116853_1117039_+	hypothetical protein	NA	Q6J1V0	Lactobacillus_phage	88.5	5.1e-25
AXI94046.1|1117035_1117542_+	DUF1642 domain-containing protein	NA	Q8LTB6	Lactobacillus_phage	72.9	8.6e-59
AXI94047.1|1117531_1117711_+	hypothetical protein	NA	NA	NA	NA	NA
AXI94048.1|1117697_1117901_+	hypothetical protein	NA	NA	NA	NA	NA
AXI94049.1|1117890_1118322_+	hypothetical protein	NA	C1KFE8	Lactobacillus_virus	69.9	1.1e-49
AXI95814.1|1118315_1118681_+	hypothetical protein	NA	C1KFE5	Lactobacillus_virus	58.0	3.2e-31
AXI94050.1|1118677_1118917_+	hypothetical protein	NA	NA	NA	NA	NA
AXI94051.1|1118966_1119149_+	hypothetical protein	NA	A0A0P0I365	Lactobacillus_phage	61.7	1.6e-15
AXI95815.1|1119154_1119226_+	hypothetical protein	NA	NA	NA	NA	NA
AXI94052.1|1119443_1119872_+	transcriptional regulator	NA	NA	NA	NA	NA
AXI94053.1|1120899_1122048_+	hypothetical protein	NA	B4XYU0	Lactobacillus_phage	98.7	2.4e-221
AXI94054.1|1122060_1122603_+	endonuclease	NA	B4XYU1	Lactobacillus_phage	100.0	1.1e-107
AXI94055.1|1122595_1122916_+	ribonucleoside-diphosphate reductase	NA	A8YQN5	Lactobacillus_phage	92.4	9.0e-54
AXI94056.1|1122952_1123486_+|terminase	terminase small subunit	terminase	A0A0P0IUY4	Lactobacillus_phage	94.1	2.7e-63
AXI94057.1|1123463_1124819_+|terminase	PBSX family phage terminase large subunit	terminase	A4L7R3	Lactococcus_phage	59.1	4.9e-149
AXI94058.1|1124823_1126251_+|portal	phage portal protein	portal	A0A0P0IJV3	Lactobacillus_phage	90.6	2.7e-243
AXI94059.1|1126216_1127209_+|head	phage head morphogenesis protein	head	A0A0P0ID43	Lactobacillus_phage	95.5	6.2e-178
AXI94060.1|1127333_1127990_+	DUF4355 domain-containing protein	NA	A0A0P0ID10	Lactobacillus_phage	80.0	4.3e-58
AXI94061.1|1128005_1129019_+|capsid	capsid protein	capsid	A0A0A7RVZ1	Clostridium_phage	26.5	3.1e-23
AXI94062.1|1129246_1129621_+	hypothetical protein	NA	A0A0P0IZF6	Lactobacillus_phage	91.9	3.2e-58
1129246:1129259	attR	CATGGCTGATACTG	NA	NA	NA	NA
AXI94063.1|1129625_1129928_+	hypothetical protein	NA	A0A0P0HRN0	Lactobacillus_phage	93.0	6.3e-49
AXI94064.1|1129924_1130290_+	HK97 gp10 family phage protein	NA	A0A0P0IUZ3	Lactobacillus_phage	96.7	2.0e-57
AXI94065.1|1130290_1130695_+	DUF3168 domain-containing protein	NA	A0A0P0I3C8	Lactobacillus_phage	98.5	3.0e-70
AXI94066.1|1130706_1131309_+|tail	phage tail protein	tail	A0A0P0ID88	Lactobacillus_phage	93.5	2.4e-100
AXI94067.1|1131395_1131728_+	hypothetical protein	NA	A0A0P0IQQ6	Lactobacillus_phage	94.5	2.4e-49
AXI94068.1|1131832_1132186_+	hypothetical protein	NA	A0A0P0I7N9	Lactobacillus_phage	96.6	5.3e-55
AXI94069.1|1132178_1135268_+|tail	phage tail tape measure protein	tail	A0A0P0IJD2	Lactobacillus_phage	88.0	1.4e-263
AXI94070.1|1135270_1137259_+|tail	phage tail family protein	tail	B4XYQ4	Lactobacillus_phage	85.9	0.0e+00
AXI95816.1|1137255_1139766_+|tail	phage tail protein	tail	B4XYQ5	Lactobacillus_phage	82.6	0.0e+00
AXI94071.1|1139775_1140099_+	phage infection protein	NA	B4XYQ6	Lactobacillus_phage	98.1	1.1e-51
AXI94072.1|1140091_1140223_+	XkdX family protein	NA	A0A0P0HRS7	Lactobacillus_phage	97.7	2.5e-18
AXI94073.1|1140252_1140546_+	hypothetical protein	NA	B4XYQ7	Lactobacillus_phage	94.8	5.3e-45
AXI94074.1|1140535_1140949_+|holin	phage holin	holin	A0A0P0IDC6	Lactobacillus_phage	97.9	1.4e-43
AXI94075.1|1140959_1142258_+	LysM peptidoglycan-binding domain-containing protein	NA	B4XYQ9	Lactobacillus_phage	99.1	1.2e-232
>prophage 3
CP031290	Lactobacillus rhamnosus GG chromosome, complete genome	3010116	1495543	1584586	3010116	tail,tRNA,terminase,transposase,integrase,capsid,portal,holin,head	Lactobacillus_phage(37.14%)	87	1528327:1528386	1562939:1563099
AXI94399.1|1495543_1496842_-|tRNA	asparagine--tRNA ligase	tRNA	M1PB22	Moumouvirus	28.2	2.9e-50
AXI94400.1|1496865_1498041_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
AXI94401.1|1498093_1498585_-	hypothetical protein	NA	NA	NA	NA	NA
AXI94402.1|1498662_1498845_-	hypothetical protein	NA	NA	NA	NA	NA
AXI94403.1|1498859_1501661_-	DNA helicase	NA	A0A1X9I5C8	Streptococcus_phage	33.3	1.1e-54
AXI94404.1|1501704_1505415_-	helicase-exonuclease AddAB subunit AddA	NA	S5MMD7	Bacillus_phage	22.2	6.4e-18
AXI94405.1|1505411_1508951_-	ATP-dependent helicase	NA	NA	NA	NA	NA
AXI94406.1|1509365_1510301_+	mevalonate kinase	NA	NA	NA	NA	NA
AXI94407.1|1510308_1511313_+	diphosphomevalonate decarboxylase	NA	NA	NA	NA	NA
AXI94408.1|1511278_1512313_+	type 2 isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
AXI94409.1|1512419_1513751_-	RNA methyltransferase	NA	NA	NA	NA	NA
AXI94410.1|1513737_1514694_-	hypothetical protein	NA	NA	NA	NA	NA
AXI94411.1|1514690_1514873_-	alpha-galactosidase	NA	NA	NA	NA	NA
AXI94412.1|1514895_1515639_-	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AXI94413.1|1515754_1516105_-	metal-sulfur cluster assembly factor	NA	NA	NA	NA	NA
AXI95837.1|1516138_1516327_-	4-oxalocrotonate tautomerase	NA	NA	NA	NA	NA
AXI94414.1|1516534_1516669_-	Malolactic regulator	NA	NA	NA	NA	NA
AXI94415.1|1516784_1518290_-	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
AXI94416.1|1518255_1519986_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	24.3	1.5e-06
AXI94417.1|1520360_1521155_-	Nif3-like dinuclear metal center hexameric protein	NA	NA	NA	NA	NA
AXI94418.1|1521141_1521852_-|tRNA	tRNA (adenine-N(1))-methyltransferase	tRNA	NA	NA	NA	NA
AXI94419.1|1522040_1523291_-	RNA polymerase sigma factor RpoD	NA	F4YCU2	Synechococcus_phage	38.9	1.1e-38
AXI94420.1|1523304_1525074_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	31.4	8.2e-56
AXI94421.1|1525259_1527329_-|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
AXI94422.1|1527330_1528227_-|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
1528327:1528386	attL	TGCGCGGTTCCACCCTACTTCAGATAGACCGAATCTACCTGCAGCTTTGTCATTTGGTTC	NA	NA	NA	NA
AXI94423.1|1528632_1529802_-|integrase	site-specific integrase	integrase	A0A2P0ZL94	Lactobacillus_phage	31.8	2.6e-42
AXI94424.1|1529844_1530171_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AXI94425.1|1530277_1530460_+	hypothetical protein	NA	NA	NA	NA	NA
AXI94426.1|1531006_1531393_-	hypothetical protein	NA	NA	NA	NA	NA
AXI94427.1|1531583_1532738_-	LysM peptidoglycan-binding domain-containing protein	NA	Q6J1W8	Lactobacillus_phage	66.2	9.9e-143
AXI94428.1|1532740_1533073_-|holin	phage holin	holin	Q3L0R7	Lactobacillus_rhamnosus_Lc-Nu-like_prophage	100.0	2.0e-32
AXI94429.1|1533085_1533319_-	DNA primase	NA	Q3L0R9	Lactobacillus_rhamnosus_Lc-Nu-like_prophage	98.7	2.6e-34
AXI94430.1|1533343_1533475_-	XkdX family protein	NA	Q3L0S0	Lactobacillus_rhamnosus_Lc-Nu-like_prophage	90.7	4.2e-18
AXI94431.1|1533467_1533791_-	phage infection protein	NA	B4XYQ6	Lactobacillus_phage	99.1	5.0e-52
AXI94432.1|1533800_1536734_-|tail	phage tail protein	tail	B4XYQ5	Lactobacillus_phage	68.7	1.1e-311
AXI94433.1|1536739_1538797_-|tail	phage tail protein	tail	Q6J1X4	Lactobacillus_phage	48.1	1.3e-153
AXI95838.1|1538797_1542964_-|tail	phage tail protein	tail	A8YQJ9	Lactobacillus_phage	79.4	0.0e+00
AXI94434.1|1542969_1543200_-	hypothetical protein	NA	Q3L0S5	Lactobacillus_rhamnosus_Lc-Nu-like_prophage	98.7	5.0e-38
AXI94435.1|1543177_1543528_-|tail	phage tail protein	tail	Q6J1X6	Lactobacillus_phage	95.7	2.2e-53
AXI94436.1|1543682_1544318_-|tail	phage tail protein	tail	Q3L0S7	Lactobacillus_rhamnosus_Lc-Nu-like_prophage	89.6	9.1e-98
AXI94437.1|1544318_1544699_-	DUF806 family protein	NA	Q3L0S8	Lactobacillus_rhamnosus_Lc-Nu-like_prophage	92.9	9.0e-61
AXI94438.1|1544695_1545115_-	HK97 gp10 family phage protein	NA	Q3L0S9	Lactobacillus_rhamnosus_Lc-Nu-like_prophage	90.6	1.9e-64
AXI94439.1|1545117_1545462_-|head,tail	head-tail adaptor protein	head,tail	A8YQJ4	Lactobacillus_phage	85.8	1.1e-49
AXI94440.1|1545451_1545742_-	hypothetical protein	NA	NA	NA	NA	NA
AXI94441.1|1545813_1547742_-|capsid	phage major capsid protein	capsid	A0A2P0ZLF9	Lactobacillus_phage	46.1	1.2e-68
AXI94442.1|1547741_1548842_-|portal	phage portal protein	portal	Q9AZM4	Lactococcus_phage	43.6	9.6e-79
AXI94443.1|1548838_1549021_-	DUF1056 family protein	NA	NA	NA	NA	NA
AXI94444.1|1549144_1551037_-|terminase	terminase large subunit	terminase	A0A0M7RDK9	Lactobacillus_phage	44.0	3.5e-153
AXI94445.1|1551030_1551495_-|terminase	phage terminase small subunit P27 family	terminase	B8R648	Lactobacillus_phage	39.7	3.1e-23
AXI94446.1|1551976_1552537_-	recombinase family protein	NA	A0A1J1J8Z4	Escherichia_phage	44.2	2.5e-35
AXI94447.1|1552769_1552946_+	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
AXI94448.1|1552942_1553692_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
AXI94449.1|1553757_1555254_+|transposase	IS5-like element ISLrh2 family transposase	transposase	NA	NA	NA	NA
AXI94450.1|1555348_1555795_+	hypothetical protein	NA	NA	NA	NA	NA
AXI94451.1|1555910_1556189_-	hypothetical protein	NA	NA	NA	NA	NA
AXI94452.1|1556181_1556622_-	HNH endonuclease	NA	B8R694	Lactobacillus_phage	54.0	9.3e-25
AXI94453.1|1556720_1557125_-	single-stranded DNA-binding protein	NA	L0P8Q2	Lactobacillus_phage	40.0	1.4e-14
AXI94454.1|1557111_1557879_-	hypothetical protein	NA	NA	NA	NA	NA
AXI94455.1|1557879_1558086_-	hypothetical protein	NA	NA	NA	NA	NA
AXI94456.1|1558146_1558749_-	hypothetical protein	NA	M1NMU3	Moumouvirus	33.8	5.9e-14
AXI94457.1|1559134_1560373_-	hypothetical protein	NA	NA	NA	NA	NA
AXI94458.1|1560411_1560639_-	hypothetical protein	NA	NA	NA	NA	NA
AXI94459.1|1563217_1563745_-	N-acetyltransferase	NA	NA	NA	NA	NA
1562939:1563099	attR	TGCGCGGTTCCACCCTACTTCAGATAGACCGAATCTACCTGCAGCTTTGTCATTTGGTTCGAAAACGCCAATCACATTCACCACCATCAGGCTTACACTATCCCTGACTCGCTTGGGTTTGGTACAAATGCGACCCTTTTTCTCATCACCGATTCAATTTC	NA	NA	NA	NA
AXI94460.1|1563841_1564471_-	ABC-2 transporter permease	NA	NA	NA	NA	NA
AXI94461.1|1564467_1565181_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.6	1.7e-12
AXI94462.1|1565835_1566147_-	hypothetical protein	NA	NA	NA	NA	NA
AXI94463.1|1566297_1567113_-	DNA repair protein RecO	NA	NA	NA	NA	NA
AXI94464.1|1567112_1568015_-	GTPase Era	NA	NA	NA	NA	NA
AXI95839.1|1568011_1568401_-	cytidine deaminase	NA	NA	NA	NA	NA
AXI94465.1|1568404_1568803_-	diacylglycerol kinase family protein	NA	NA	NA	NA	NA
AXI94466.1|1568786_1569245_-	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
AXI94467.1|1569248_1570235_-	PhoH family protein	NA	L7TP00	Rhizobium_phage	45.2	3.2e-49
AXI94468.1|1570801_1571245_-	GatB/YqeY domain-containing protein	NA	A0A0K2FLI9	Brevibacillus_phage	39.0	9.7e-14
AXI94469.1|1571263_1571440_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
AXI94470.1|1571712_1572543_+	kinase/pyrophosphorylase	NA	NA	NA	NA	NA
AXI94471.1|1572539_1573427_-	deoxyribonuclease IV	NA	A0A2H4UU70	Bodo_saltans_virus	27.0	2.1e-20
AXI94472.1|1573574_1574495_-	YitT family protein	NA	NA	NA	NA	NA
AXI94473.1|1574799_1575246_-	peptide-methionine (R)-S-oxide reductase	NA	NA	NA	NA	NA
AXI94474.1|1575331_1577137_-|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
AXI94475.1|1577138_1578422_-|tRNA	histidine--tRNA ligase	tRNA	NA	NA	NA	NA
AXI94476.1|1578525_1578747_+	hypothetical protein	NA	NA	NA	NA	NA
AXI94477.1|1578975_1580484_-	ABC transporter permease	NA	NA	NA	NA	NA
AXI94478.1|1580480_1581356_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	31.0	5.4e-24
AXI94479.1|1581555_1582002_+	hypothetical protein	NA	NA	NA	NA	NA
AXI94480.1|1582089_1583412_+	N-acetylmuramoyl-L-alanine amidase	NA	J9PV86	Bacillus_phage	30.2	3.0e-10
AXI94481.1|1583513_1584140_-	HAD family hydrolase	NA	NA	NA	NA	NA
AXI94482.1|1584139_1584586_-|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
>prophage 4
CP031290	Lactobacillus rhamnosus GG chromosome, complete genome	3010116	2108750	2115623	3010116		Lactococcus_phage(33.33%)	9	NA	NA
AXI94929.1|2108750_2109680_-	DUF4065 domain-containing protein	NA	Q9AZG0	Lactococcus_phage	38.1	4.5e-53
AXI94930.1|2109691_2110018_-	hypothetical protein	NA	Q9AZG1	Lactococcus_phage	39.6	4.8e-10
AXI94931.1|2110311_2110812_-	QueT transporter family protein	NA	E7DN70	Pneumococcus_phage	29.3	4.7e-09
AXI94932.1|2110928_2111642_-	3-oxoacyl-ACP reductase	NA	NA	NA	NA	NA
AXI94933.1|2111638_2111863_-	DUF2829 domain-containing protein	NA	G3MBC9	Bacillus_virus	40.4	4.3e-10
AXI95863.1|2112143_2112455_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AXI94934.1|2112702_2113341_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
AXI94935.1|2113585_2114569_-	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	33.0	1.7e-10
AXI94936.1|2114570_2115623_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.9	5.7e-20
>prophage 5
CP031290	Lactobacillus rhamnosus GG chromosome, complete genome	3010116	2406728	2521562	3010116	transposase,tRNA,portal,protease,bacteriocin	Bacillus_phage(21.05%)	114	NA	NA
AXI95177.1|2406728_2407559_-|protease	YhfC family intramembrane metalloprotease	protease	NA	NA	NA	NA
AXI95178.1|2407572_2408589_-	hypothetical protein	NA	NA	NA	NA	NA
AXI95179.1|2408585_2408972_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AXI95180.1|2409103_2410732_-	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
AXI95181.1|2411229_2412546_-	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
AXI95182.1|2413646_2414762_-	PIN/TRAM domain-containing protein	NA	NA	NA	NA	NA
AXI95183.1|2414782_2416147_-	DNA repair protein RadA	NA	NA	NA	NA	NA
AXI95184.1|2416166_2416706_-	dUTP diphosphatase	NA	J9PV85	Bacillus_phage	48.0	4.4e-37
AXI95878.1|2416845_2416971_-	acetyltransferase	NA	NA	NA	NA	NA
AXI95879.1|2416967_2417150_-	alpha-galactosidase	NA	NA	NA	NA	NA
AXI95185.1|2417346_2417637_+	N-acetyltransferase	NA	NA	NA	NA	NA
AXI95186.1|2417931_2419251_+	aminopeptidase	NA	R4TV59	Phaeocystis_globosa_virus	35.8	2.3e-63
AXI95187.1|2419395_2420742_+	aminopeptidase	NA	R4TV59	Phaeocystis_globosa_virus	38.5	1.3e-72
AXI95188.1|2420958_2422059_+	ABC transporter permease	NA	NA	NA	NA	NA
AXI95189.1|2422058_2423252_+	ABC transporter permease	NA	NA	NA	NA	NA
AXI95190.1|2423265_2424141_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.9	2.1e-12
AXI95191.1|2424292_2426347_+|portal	portal protein	portal	A7K9V6	Acanthocystis_turfacea_chlorella_virus	32.9	2.1e-63
AXI95192.1|2426553_2429184_-	pyruvate, phosphate dikinase	NA	H8YJB7	Vibrio_phage	38.9	2.8e-84
AXI95193.1|2429483_2430071_-	CBS domain-containing protein	NA	NA	NA	NA	NA
AXI95194.1|2430242_2430914_-	2,3-bisphosphoglycerate-dependent phosphoglycerate mutase	NA	NA	NA	NA	NA
AXI95195.1|2431071_2432190_+	bacitracin ABC transporter permease	NA	NA	NA	NA	NA
AXI95196.1|2432208_2432493_+	chromosome partitioning protein ParB	NA	NA	NA	NA	NA
AXI95197.1|2432738_2433854_-	lactate oxidase	NA	NA	NA	NA	NA
AXI95198.1|2434016_2434226_-	CsbD family protein	NA	NA	NA	NA	NA
AXI95199.1|2434791_2434980_-	hypothetical protein	NA	NA	NA	NA	NA
AXI95200.1|2434991_2435189_-	hypothetical protein	NA	NA	NA	NA	NA
AXI95201.1|2435983_2436241_-	hypothetical protein	NA	NA	NA	NA	NA
AXI95202.1|2436430_2436637_-	hypothetical protein	NA	NA	NA	NA	NA
AXI95203.1|2436865_2437081_-	hypothetical protein	NA	NA	NA	NA	NA
AXI95204.1|2437650_2438883_+	MFS transporter	NA	NA	NA	NA	NA
AXI95205.1|2438952_2440209_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	55.6	6.0e-109
AXI95206.1|2440289_2441126_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	41.9	7.4e-47
AXI95207.1|2441574_2441760_-	hypothetical protein	NA	NA	NA	NA	NA
AXI95208.1|2442336_2442879_-	hypothetical protein	NA	NA	NA	NA	NA
AXI95209.1|2443108_2443933_-	class C sortase	NA	NA	NA	NA	NA
AXI95210.1|2443939_2445493_-	isopeptide-forming domain-containing fimbrial protein	NA	NA	NA	NA	NA
AXI95211.1|2445483_2446839_-	pilus assembly protein	NA	NA	NA	NA	NA
AXI95212.1|2446840_2449771_-	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
AXI95213.1|2450066_2450624_-	hypothetical protein	NA	NA	NA	NA	NA
AXI95214.1|2450792_2452001_-	DUF2075 domain-containing protein	NA	NA	NA	NA	NA
AXI95215.1|2452193_2453249_+	DUF2974 domain-containing protein	NA	NA	NA	NA	NA
AXI95216.1|2453541_2454189_+	XRE family transcriptional regulator	NA	A0A0S2MVM8	Bacillus_phage	38.7	2.2e-06
AXI95217.1|2454319_2454652_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
AXI95218.1|2454648_2455434_+	hypothetical protein	NA	NA	NA	NA	NA
AXI95219.1|2455477_2456254_+	hypothetical protein	NA	NA	NA	NA	NA
AXI95220.1|2456281_2456572_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
AXI95221.1|2456699_2457782_+	aldo/keto reductase	NA	NA	NA	NA	NA
AXI95222.1|2457807_2457990_-	hypothetical protein	NA	NA	NA	NA	NA
AXI95223.1|2458084_2459440_-	threonine/serine exporter family protein	NA	NA	NA	NA	NA
AXI95224.1|2459616_2460027_-	hypothetical protein	NA	NA	NA	NA	NA
AXI95225.1|2460087_2461467_-|bacteriocin	bacteriocin secretion accessory protein	bacteriocin	NA	NA	NA	NA
AXI95226.1|2461479_2463672_-	peptide cleavage/export ABC transporter	NA	W8CYL7	Bacillus_phage	25.5	3.6e-37
AXI95227.1|2463920_2464055_-	peptide pheromone	NA	NA	NA	NA	NA
AXI95228.1|2464230_2465544_+	GHKL domain-containing protein	NA	NA	NA	NA	NA
AXI95229.1|2465536_2466325_+	LytR domain-containing response regulator	NA	NA	NA	NA	NA
AXI95880.1|2467061_2467247_+|bacteriocin	ComC/BlpC family peptide pheromone/bacteriocin	bacteriocin	NA	NA	NA	NA
AXI95230.1|2467963_2468146_-	hypothetical protein	NA	NA	NA	NA	NA
AXI95231.1|2468668_2468914_-	hypothetical protein	NA	NA	NA	NA	NA
AXI95232.1|2469163_2469463_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
AXI95233.1|2469639_2469798_-|bacteriocin	class IIb bacteriocin, lactobin A/cerein 7B family	bacteriocin	NA	NA	NA	NA
AXI95234.1|2469951_2470179_+	hypothetical protein	NA	NA	NA	NA	NA
AXI95235.1|2470266_2470452_-|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
AXI95236.1|2470511_2470697_-	hypothetical protein	NA	NA	NA	NA	NA
AXI95237.1|2471083_2471269_-	hypothetical protein	NA	NA	NA	NA	NA
AXI95238.1|2471318_2472125_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
AXI95239.1|2472202_2472385_-	hypothetical protein	NA	NA	NA	NA	NA
AXI95240.1|2472445_2472886_-	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
AXI95241.1|2472940_2474368_-	MFS transporter	NA	A0A0M3UL24	Mycobacterium_phage	26.4	6.1e-33
AXI95242.1|2474541_2474874_-	hypothetical protein	NA	NA	NA	NA	NA
AXI95243.1|2475164_2475506_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
AXI95244.1|2475680_2476634_-	aldo/keto reductase	NA	NA	NA	NA	NA
AXI95245.1|2477104_2477839_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
AXI95246.1|2477868_2479014_+	NADH-dependent flavin oxidoreductase	NA	NA	NA	NA	NA
AXI95247.1|2479038_2479356_-	SHOCT domain-containing protein	NA	NA	NA	NA	NA
AXI95248.1|2479405_2480785_-	class II fumarate hydratase	NA	NA	NA	NA	NA
AXI95882.1|2480959_2481703_-	hypothetical protein	NA	NA	NA	NA	NA
AXI95883.1|2481780_2481972_+	Malolactic regulator	NA	NA	NA	NA	NA
AXI95249.1|2481883_2482156_+	alpha-galactosidase	NA	NA	NA	NA	NA
AXI95250.1|2482133_2482271_-	hypothetical protein	NA	NA	NA	NA	NA
AXI95881.1|2482254_2483832_-	divalent metal cation transporter	NA	NA	NA	NA	NA
AXI95251.1|2484261_2486979_+	HAD family hydrolase	NA	M1HJQ2	Paramecium_bursaria_Chlorella_virus	27.4	1.6e-58
AXI95252.1|2487267_2487633_+	hypothetical protein	NA	NA	NA	NA	NA
AXI95253.1|2487947_2489318_-	MFS transporter	NA	NA	NA	NA	NA
AXI95254.1|2489351_2490881_-	copper oxidase	NA	NA	NA	NA	NA
AXI95255.1|2490984_2491179_+	hypothetical protein	NA	NA	NA	NA	NA
AXI95256.1|2491294_2491936_+	cation transporter	NA	NA	NA	NA	NA
AXI95257.1|2492055_2492388_+	ArsR family transcriptional regulator	NA	NA	NA	NA	NA
AXI95258.1|2492478_2493420_-	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AXI95259.1|2493416_2494310_-	metal ABC transporter permease	NA	NA	NA	NA	NA
AXI95260.1|2494306_2495050_-	metal ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.4	6.8e-12
AXI95261.1|2495390_2495660_-	30S ribosomal protein S14	NA	NA	NA	NA	NA
AXI95262.1|2495744_2495864_-	hypothetical protein	NA	NA	NA	NA	NA
AXI95263.1|2496061_2496979_+	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AXI95264.1|2497257_2497899_+	NAD-dependent epimerase/dehydratase family protein	NA	NA	NA	NA	NA
AXI95265.1|2498026_2498536_-	hypothetical protein	NA	NA	NA	NA	NA
AXI95266.1|2498876_2499779_+	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AXI95267.1|2499973_2500123_+	hypothetical protein	NA	NA	NA	NA	NA
AXI95268.1|2500764_2500911_-	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
AXI95269.1|2501650_2502001_-	CrcB family protein	NA	A0A2H4J148	uncultured_Caudovirales_phage	37.8	3.8e-05
AXI95270.1|2501994_2502405_-	CrcB family protein	NA	NA	NA	NA	NA
AXI95271.1|2502908_2504423_-	MFS transporter	NA	NA	NA	NA	NA
AXI95272.1|2505060_2507784_+	alpha-L-rhamnosidase	NA	NA	NA	NA	NA
AXI95273.1|2507796_2507979_-	hypothetical protein	NA	NA	NA	NA	NA
AXI95274.1|2507989_2508964_-	aliphatic sulfonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AXI95275.1|2508953_2510486_-	acyl-CoA synthetase	NA	Q75ZG1	Hepacivirus	28.8	2.0e-29
AXI95276.1|2510436_2511678_-	acyltransferase	NA	NA	NA	NA	NA
AXI95277.1|2511674_2512376_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	39.4	8.1e-31
AXI95278.1|2512368_2513187_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
AXI95279.1|2513427_2514096_-|tRNA	tRNA ligase	tRNA	NA	NA	NA	NA
AXI95280.1|2514786_2516622_-	ABC transporter ATP-binding protein	NA	F2Y1V6	Organic_Lake_phycodnavirus	25.2	3.3e-07
AXI95281.1|2516608_2518399_-	ABC transporter ATP-binding protein	NA	F2Y1V6	Organic_Lake_phycodnavirus	26.0	8.2e-11
AXI95282.1|2518623_2519808_-	MFS transporter	NA	NA	NA	NA	NA
AXI95283.1|2520180_2521074_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	33.7	1.9e-37
AXI95284.1|2521025_2521562_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 6
CP031290	Lactobacillus rhamnosus GG chromosome, complete genome	3010116	2933307	2959667	3010116	terminase,portal,integrase,transposase	Lactobacillus_phage(25.0%)	32	2948928:2948948	2963057:2963077
AXI95676.1|2933307_2933844_+|transposase	transposase	transposase	NA	NA	NA	NA
AXI95677.1|2933795_2934689_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	33.7	1.9e-37
AXI95678.1|2934882_2936277_-	aspartate ammonia-lyase	NA	NA	NA	NA	NA
AXI95913.1|2936423_2936999_-	thymidylate synthase	NA	NA	NA	NA	NA
AXI95679.1|2937112_2937532_-	DUF2992 family protein	NA	NA	NA	NA	NA
AXI95680.1|2937815_2938106_-	hypothetical protein	NA	NA	NA	NA	NA
AXI95681.1|2938199_2938448_-	hypothetical protein	NA	NA	NA	NA	NA
AXI95682.1|2939894_2941220_-	malate permease	NA	A0A140XAH4	Dickeya_phage	52.9	2.1e-16
AXI95683.1|2941366_2942902_+	sensor histidine kinase	NA	NA	NA	NA	NA
AXI95684.1|2942898_2943588_+	two-component system response regulator DcuR	NA	NA	NA	NA	NA
AXI95914.1|2943773_2944289_-	hypothetical protein	NA	NA	NA	NA	NA
AXI95685.1|2944537_2944930_+	hypothetical protein	NA	NA	NA	NA	NA
AXI95686.1|2945162_2946017_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
AXI95915.1|2946339_2946726_-	hypothetical protein	NA	NA	NA	NA	NA
AXI95687.1|2946910_2947591_-	type 1 glutamine amidotransferase	NA	NA	NA	NA	NA
AXI95688.1|2947769_2948699_-	haloacid dehalogenase-like hydrolase	NA	NA	NA	NA	NA
2948928:2948948	attL	CTATTCTGGGTGGTCAGGGGA	NA	NA	NA	NA
AXI95689.1|2949045_2950203_-|integrase	site-specific integrase	integrase	A0A2P0ZL94	Lactobacillus_phage	33.2	1.3e-46
AXI95690.1|2950320_2950932_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AXI95691.1|2951046_2951259_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AXI95692.1|2951283_2951559_+	DNA-binding protein	NA	NA	NA	NA	NA
AXI95693.1|2951626_2951848_+	hypothetical protein	NA	NA	NA	NA	NA
AXI95694.1|2951958_2952150_+	hypothetical protein	NA	NA	NA	NA	NA
AXI95695.1|2952194_2952467_+	hypothetical protein	NA	NA	NA	NA	NA
AXI95696.1|2952463_2952652_+	hypothetical protein	NA	NA	NA	NA	NA
AXI95697.1|2952635_2953463_+	DNA replication protein	NA	Q854C1	Mycobacterium_phage	34.9	4.5e-12
AXI95698.1|2953455_2954880_+	virulence protein	NA	A0A1W6JQD6	Staphylococcus_phage	37.6	6.6e-64
AXI95699.1|2955159_2955582_+	hypothetical protein	NA	NA	NA	NA	NA
AXI95700.1|2955612_2956038_+	HNH endonuclease	NA	D2JLE2	Staphylococcus_phage	40.5	7.1e-14
AXI95701.1|2956162_2956633_+|terminase	phage terminase small subunit P27 family	terminase	NA	NA	NA	NA
AXI95702.1|2956629_2958333_+|terminase	terminase large subunit	terminase	E9LUI0	Lactobacillus_phage	40.6	5.4e-121
AXI95703.1|2958298_2958478_+	hypothetical protein	NA	NA	NA	NA	NA
AXI95704.1|2958482_2959667_+|portal	phage portal protein	portal	A0A2H4JB06	uncultured_Caudovirales_phage	34.4	2.4e-59
2963057:2963077	attR	CTATTCTGGGTGGTCAGGGGA	NA	NA	NA	NA
