The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP030125	Streptococcus suis strain HA1003 chromosome, complete genome	2229183	31573	41829	2229183		Synechococcus_phage(33.33%)	7	NA	NA
AXI66596.1|31573_35293_+	phosphoribosylformylglycinamidine synthase	NA	A6N228	Microbacterium_phage	28.1	7.3e-38
AXI66597.1|35295_36750_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	34.9	2.1e-57
AXI66598.1|36806_37829_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3FGG1	Synechococcus_phage	40.8	8.7e-58
AXI66599.1|37825_38377_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	38.0	9.5e-27
AXI66600.1|38386_39934_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase PurH	NA	Q58MG4	Prochlorococcus_phage	47.6	1.7e-73
AXI66601.1|40052_41315_+	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
AXI66602.1|41340_41829_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	45.8	3.2e-18
>prophage 2
CP030125	Streptococcus suis strain HA1003 chromosome, complete genome	2229183	611627	629222	2229183		Streptococcus_phage(85.71%)	16	NA	NA
AXI67114.1|611627_612650_+	phosphate starvation-inducible protein PhoH	NA	W8D063	Erwinia_phage	48.6	3.3e-49
AXI67115.1|612639_613143_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AXI67116.1|613189_613828_-	MBL fold metallo-hydrolase	NA	A0A1X9I5D3	Streptococcus_phage	98.1	4.3e-124
AXI67117.1|613935_616404_+	bifunctional DnaQ family exonuclease/ATP-dependent helicase	NA	A0A1X9I5C8	Streptococcus_phage	97.9	0.0e+00
AXI67118.1|616703_617780_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	99.4	6.7e-194
AXI67119.1|617844_619083_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	95.1	5.3e-211
AXI67120.1|619092_619878_+	pyrroline-5-carboxylate reductase	NA	A0A1X9I6T5	Streptococcus_phage	93.1	2.7e-128
AXI67121.1|619900_620305_-	TetR/AcrR family transcriptional regulator	NA	A0A1X9I6A2	Streptococcus_phage	97.8	7.9e-63
AXI67122.1|620431_621283_+	fatty acid-binding protein DegV	NA	A0A1X9I5J4	Streptococcus_phage	97.9	2.5e-151
AXI67123.1|621537_622797_-	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	98.8	3.3e-240
AXI67124.1|622919_623654_+	peroxide stress protein YaaA	NA	A0A1X9I5I0	Streptococcus_phage	97.2	1.6e-117
AXI67125.1|623755_625195_+	LytR family transcriptional regulator	NA	A0A1X9I5X1	Streptococcus_phage	91.6	2.4e-207
AXI67126.1|625210_625900_+	capsular biosynthesis protein CpsC	NA	A0A1X9I5E1	Streptococcus_phage	91.3	5.2e-107
AXI67127.1|625909_626596_+	tyrosine protein kinase	NA	A0A1X9I5D6	Streptococcus_phage	94.9	4.7e-108
AXI67128.1|626634_627366_+	tyrosine protein phosphatase	NA	NA	NA	NA	NA
AXI67129.1|627395_629222_+	polysaccharide biosynthesis protein	NA	A0A1V0SAI8	Catovirus	28.0	3.5e-25
>prophage 3
CP030125	Streptococcus suis strain HA1003 chromosome, complete genome	2229183	1093043	1248753	2229183	tail,capsid,terminase,portal,head,holin,transposase,protease	Streptococcus_phage(90.27%)	157	NA	NA
AXI67532.1|1093043_1093295_-|holin	holin	holin	NA	NA	NA	NA
AXI67533.1|1093551_1094316_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
AXI67534.1|1094383_1095067_-	noncanonical pyrimidine nucleotidase, YjjG family	NA	NA	NA	NA	NA
AXI67535.1|1095500_1096250_-	translation initiation factor 2	NA	NA	NA	NA	NA
AXI67536.1|1096685_1098965_-	DNA helicase PcrA	NA	A7KV33	Bacillus_phage	41.1	5.5e-129
AXI67537.1|1099305_1100673_-	NADH oxidase	NA	NA	NA	NA	NA
AXI67538.1|1100858_1101197_-	hypothetical protein	NA	NA	NA	NA	NA
AXI67539.1|1101363_1103154_+	oligoendopeptidase F	NA	A0A1X9I5X5	Streptococcus_phage	98.8	0.0e+00
AXI68591.1|1103177_1103570_-	hypothetical protein	NA	NA	NA	NA	NA
AXI67540.1|1103792_1104743_-	2,6-dichloro-p-hydroquinone 1,2-dioxygenase	NA	NA	NA	NA	NA
AXI67541.1|1104874_1105582_-	aquaporin family protein	NA	M1HJ77	Paramecium_bursaria_Chlorella_virus	29.8	7.2e-19
AXI67542.1|1105595_1107425_-	type 1 glycerol-3-phosphate oxidase	NA	NA	NA	NA	NA
AXI67543.1|1107500_1109015_-	glycerol kinase	NA	NA	NA	NA	NA
AXI67544.1|1109243_1110707_-	DNA-binding protein	NA	NA	NA	NA	NA
AXI67545.1|1110696_1112049_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
AXI67546.1|1112349_1113285_-	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
AXI67547.1|1113357_1114434_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
AXI67548.1|1114602_1115697_-	glycerol dehydrogenase	NA	NA	NA	NA	NA
AXI67549.1|1115817_1116774_-	glycerol dehydrogenase	NA	NA	NA	NA	NA
AXI67550.1|1116805_1117474_-	fructose-6-phosphate aldolase	NA	A0A0C5AMY8	Cyanophage	31.5	1.7e-22
AXI67551.1|1117488_1119933_-	formate C-acetyltransferase/glycerol dehydratase family glycyl radical enzyme	NA	A0A2H4YEI2	Aeromonas_phage	47.2	4.9e-06
AXI67552.1|1120084_1121386_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
AXI67553.1|1121398_1121704_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
AXI67554.1|1121736_1122060_-	PTS lactose/cellobiose transporter subunit IIA	NA	NA	NA	NA	NA
AXI67555.1|1122250_1123222_-	sugar-binding transcriptional regulator	NA	NA	NA	NA	NA
AXI67556.1|1123234_1123978_-	DeoR family transcriptional regulator	NA	NA	NA	NA	NA
AXI67557.1|1124109_1124886_+	glycyl-radical enzyme activating protein	NA	NA	NA	NA	NA
AXI67558.1|1125180_1125468_-	DUF1905 domain-containing protein	NA	NA	NA	NA	NA
AXI67559.1|1125476_1126130_-	DNA alkylation repair protein	NA	NA	NA	NA	NA
AXI67560.1|1126119_1126629_-	N-acetyltransferase	NA	NA	NA	NA	NA
AXI67561.1|1126629_1127247_-	DUF5052 family protein	NA	A0A2K9VCV0	Lactobacillus_phage	51.5	4.9e-48
AXI67562.1|1127404_1128247_+|protease	PrsW family intramembrane metalloprotease	protease	NA	NA	NA	NA
AXI67563.1|1128516_1129833_-	FAD-containing oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	40.8	6.5e-90
AXI67564.1|1130048_1130858_+|protease	PrsW family intramembrane metalloprotease	protease	NA	NA	NA	NA
AXI67565.1|1130901_1132572_-	formate--tetrahydrofolate ligase	NA	NA	NA	NA	NA
AXI67566.1|1132866_1133568_+	phosphopantothenate--cysteine ligase	NA	NA	NA	NA	NA
AXI67567.1|1133560_1134109_+	phosphopantothenoylcysteine decarboxylase	NA	A0A068EHP1	Penguinpox_virus	36.7	2.4e-22
AXI67568.1|1134095_1134665_+	ECF transporter S component	NA	NA	NA	NA	NA
AXI67569.1|1134755_1136474_+	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	99.1	0.0e+00
AXI67570.1|1136957_1137230_-	hypothetical protein	NA	NA	NA	NA	NA
AXI67571.1|1137226_1138669_-	copper oxidase	NA	NA	NA	NA	NA
AXI67572.1|1138735_1139932_-	YVTN family beta-propeller repeat-containing protein	NA	NA	NA	NA	NA
AXI68592.1|1139980_1142062_-	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	29.3	3.8e-60
AXI67573.1|1142341_1142548_-	heavy-metal-associated domain-containing protein	NA	NA	NA	NA	NA
AXI67574.1|1143160_1143607_-	CopY/TcrY family copper transport repressor	NA	NA	NA	NA	NA
AXI67575.1|1144065_1144404_-	transcriptional regulator	NA	E4ZFI8	Streptococcus_phage	33.3	1.7e-10
AXI67576.1|1144416_1145043_-	cadmium transporter	NA	NA	NA	NA	NA
AXI67577.1|1145114_1145255_+	hypothetical protein	NA	NA	NA	NA	NA
AXI68593.1|1145405_1146758_-	recombinase family protein	NA	E4ZFN9	Streptococcus_phage	93.8	2.3e-247
AXI67578.1|1146660_1147902_-	recombinase family protein	NA	A0A1B0RXM0	Streptococcus_phage	96.9	2.6e-229
AXI67579.1|1148124_1149594_-	peptidoglycan-binding protein LysM	NA	A0A1B0RXL4	Streptococcus_phage	98.2	8.7e-277
AXI67580.1|1149600_1149996_-|holin	holin	holin	A0A1B0RXK5	Streptococcus_phage	100.0	2.9e-46
AXI67581.1|1149973_1150342_-	hypothetical protein	NA	A0A1B0RXE8	Streptococcus_phage	98.4	9.0e-66
AXI67582.1|1150347_1150554_-	hypothetical protein	NA	A0A1X9I679	Streptococcus_phage	100.0	8.7e-26
AXI67583.1|1150566_1155114_-	matrix-binding protein EbhB	NA	M1PSL7	Streptococcus_phage	92.9	0.0e+00
AXI67584.1|1155113_1155836_-|tail	phage tail protein	tail	A0A1B0RXL3	Streptococcus_phage	98.3	1.9e-131
AXI67585.1|1155832_1158691_-|tail	phage tail tape measure protein	tail	A0A1B0RXL6	Streptococcus_phage	98.6	2.7e-242
AXI67586.1|1158873_1159293_-	hypothetical protein	NA	D0R0E2	Streptococcus_phage	100.0	2.1e-71
AXI67587.1|1159303_1159873_-|tail	phage tail protein	tail	A0A1B0RXE2	Streptococcus_phage	99.5	3.8e-103
AXI67588.1|1159874_1160201_-	hypothetical protein	NA	A0A1B0RXK6	Streptococcus_phage	96.3	7.0e-54
AXI67589.1|1160207_1160576_-	HK97 gp10 family phage protein	NA	D0R0D9	Streptococcus_phage	92.6	1.4e-42
AXI67590.1|1160568_1160907_-|head,tail	head-tail adaptor protein	head,tail	M1NSD6	Streptococcus_phage	97.3	2.4e-57
AXI67591.1|1160906_1161167_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1B0RXK2	Streptococcus_phage	97.7	1.0e-39
AXI67592.1|1161166_1162372_-|capsid	phage major capsid protein	capsid	A0A1B0RXF4	Streptococcus_phage	99.3	2.7e-228
AXI67593.1|1162390_1163086_-|protease	Clp protease ClpP	protease	M1PLE5	Streptococcus_phage	98.7	1.1e-125
AXI67594.1|1163078_1164362_-|portal	phage portal protein	portal	A0A1B0RXD8	Streptococcus_phage	100.0	1.3e-249
AXI67595.1|1164419_1164764_-	hypothetical protein	NA	A0A1B0RXK0	Streptococcus_phage	97.4	4.6e-56
AXI67596.1|1164900_1165239_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A1B0RXL8	Streptococcus_phage	99.1	1.3e-55
AXI67597.1|1165238_1165541_-	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	A0A1B0RXK3	Streptococcus_phage	100.0	1.2e-47
AXI67598.1|1165600_1167193_-|terminase	terminase large subunit	terminase	E4ZFM0	Streptococcus_phage	99.1	0.0e+00
AXI67599.1|1167189_1167663_-|terminase	phage terminase small subunit P27 family	terminase	A0A1X9I6K0	Streptococcus_phage	98.7	4.5e-86
AXI67600.1|1167714_1167945_-	hypothetical protein	NA	A0A1X9I697	Streptococcus_phage	98.7	2.0e-39
AXI67601.1|1167946_1168159_-	DUF4314 domain-containing protein	NA	A0A1X9I6A3	Streptococcus_phage	97.1	3.4e-33
AXI67602.1|1168160_1168409_-	hypothetical protein	NA	D0R0C7	Streptococcus_phage	96.3	3.7e-39
AXI67603.1|1168481_1169762_-	DNA (cytosine-5-)-methyltransferase	NA	M1NSK8	Streptococcus_phage	99.1	7.4e-248
AXI67604.1|1169758_1171015_-	DNA modification methylase	NA	E4ZFL4	Streptococcus_phage	98.1	2.7e-242
AXI67605.1|1170986_1171448_-	helix-turn-helix domain-containing protein	NA	M1Q209	Streptococcus_phage	96.1	2.2e-85
AXI67606.1|1171747_1172113_-	HNH endonuclease	NA	Q6DMV2	Streptococcus_phage	94.2	6.2e-67
AXI67607.1|1172114_1173152_-	methionine adenosyltransferase	NA	Q6DMV3	Streptococcus_phage	95.7	4.5e-187
AXI67608.1|1173196_1173379_-	hypothetical protein	NA	A0A1B0RXC3	Streptococcus_phage	100.0	5.9e-26
AXI67609.1|1173467_1173695_-	hypothetical protein	NA	A0A1X9I6K4	Streptococcus_phage	94.7	3.9e-35
AXI67610.1|1173887_1174364_-	hypothetical protein	NA	A0A1B0RXB9	Streptococcus_phage	100.0	2.5e-84
AXI67611.1|1174356_1175733_-	ATP-dependent helicase	NA	A0A1B0RXH8	Streptococcus_phage	96.9	1.6e-256
AXI67612.1|1175713_1175995_-	VRR-NUC domain-containing protein	NA	A0A1B0RXC4	Streptococcus_phage	94.6	3.7e-43
AXI67613.1|1176344_1178627_-	DNA primase	NA	M1NSF0	Streptococcus_phage	88.2	0.0e+00
AXI67614.1|1179024_1179348_+	hypothetical protein	NA	M1PSP3	Streptococcus_phage	90.4	1.7e-44
AXI67615.1|1179340_1180462_+	DUF2800 domain-containing protein	NA	A0A1X9I6D8	Streptococcus_phage	95.2	2.0e-209
AXI67616.1|1180466_1181015_+	DUF2815 family protein	NA	A0A1X9I6C5	Streptococcus_phage	100.0	3.2e-99
AXI67617.1|1181249_1183205_+	hypothetical protein	NA	A0A1X9I6L4	Streptococcus_phage	96.6	0.0e+00
AXI67618.1|1183243_1183813_-	hypothetical protein	NA	A0A1X9I6B5	Streptococcus_phage	100.0	1.6e-106
AXI67619.1|1184208_1186095_-	XRE family transcriptional regulator	NA	A0A1X9I6C7	Streptococcus_phage	100.0	0.0e+00
AXI67620.1|1186224_1186527_+	hypothetical protein	NA	A0A1X9I6D3	Streptococcus_phage	99.0	3.5e-47
AXI67621.1|1186560_1187247_-|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.6	2.0e-127
AXI67622.1|1187909_1189349_-	bifunctional aminoglycoside N-acetyltransferase AAC(6')-Ie/aminoglycoside O-phosphotransferase APH(2'')-Ia	NA	A0A1X9I6C2	Streptococcus_phage	100.0	3.8e-285
AXI67623.1|1189349_1189715_-	GNAT family N-acetyltransferase	NA	A0A0N7GFH7	Staphylococcus_phage	100.0	6.2e-67
AXI67624.1|1189882_1190746_-	aminoglycoside nucleotidyltransferase ANT(6)-Ia	NA	A0A1X9I6F2	Streptococcus_phage	100.0	8.7e-168
AXI67625.1|1191777_1191861_-	23S rRNA methyltransferase attenuator leader peptide ErmL	NA	NA	NA	NA	NA
AXI67626.1|1191909_1192149_-	peptide-binding protein	NA	A0A1X9I6D5	Streptococcus_phage	81.5	6.8e-22
AXI68594.1|1192268_1192553_-	topoisomerase	NA	A0A1X9I6W8	Streptococcus_phage	93.0	2.3e-40
AXI67627.1|1192562_1192694_-	hypothetical protein	NA	E4ZFP9	Streptococcus_phage	90.7	8.2e-14
AXI67628.1|1192698_1193436_-	23S rRNA (adenine(2058)-N(6))-methyltransferase Erm(B)	NA	E4ZFQ0	Streptococcus_phage	100.0	3.7e-135
AXI67629.1|1193560_1193644_-	23S rRNA methyltransferase attenuator leader peptide ErmL	NA	NA	NA	NA	NA
AXI67630.1|1193752_1193923_-	DNA recombinase	NA	A0A1X9I6E4	Streptococcus_phage	100.0	5.7e-23
AXI67631.1|1194554_1195142_-	hypothetical protein	NA	NA	NA	NA	NA
AXI67632.1|1195110_1195599_-	hypothetical protein	NA	Q9AZD6	Lactococcus_phage	63.4	8.1e-54
AXI68595.1|1195921_1197238_-	recombinase family protein	NA	D0R0F3	Streptococcus_phage	94.7	8.1e-242
AXI67633.1|1197176_1198418_-	recombinase family protein	NA	A0A1X9I6J1	Streptococcus_phage	91.8	7.4e-221
AXI67634.1|1198640_1200110_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A1X9I678	Streptococcus_phage	92.4	6.2e-259
AXI67635.1|1200116_1200512_-|holin	holin	holin	A0A1B0RXK5	Streptococcus_phage	100.0	2.9e-46
AXI67636.1|1200489_1200858_-	hypothetical protein	NA	A0A1B0RXE8	Streptococcus_phage	99.2	4.1e-66
AXI67637.1|1200863_1201070_-	hypothetical protein	NA	A0A1B0RXF3	Streptococcus_phage	100.0	3.3e-25
AXI67638.1|1201082_1205630_-	matrix-binding protein EbhB	NA	A0A1X9I747	Streptococcus_phage	96.0	0.0e+00
AXI67639.1|1205631_1206354_-|tail	phage tail protein	tail	A0A1X9I6T8	Streptococcus_phage	98.8	1.2e-133
AXI67640.1|1206350_1209209_-|tail	phage tail tape measure protein	tail	D0R0E3	Streptococcus_phage	96.1	9.7e-232
AXI67641.1|1209391_1209811_-	hypothetical protein	NA	A0A1B0RXM7	Streptococcus_phage	98.6	1.1e-70
AXI67642.1|1209821_1210391_-|tail	phage tail protein	tail	A0A1B0RXE2	Streptococcus_phage	99.5	3.8e-103
AXI67643.1|1210392_1210719_-	hypothetical protein	NA	E4ZFM8	Streptococcus_phage	92.6	7.8e-53
AXI67644.1|1210725_1211094_-	HK97 gp10 family phage protein	NA	A0A1B0RXJ7	Streptococcus_phage	97.5	1.9e-47
AXI67645.1|1211086_1211425_-|head,tail	head-tail adaptor protein	head,tail	A0A1B0RXJ6	Streptococcus_phage	94.6	2.0e-56
AXI67646.1|1211424_1211685_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1B0RXK2	Streptococcus_phage	96.5	1.7e-39
AXI67647.1|1211684_1212890_-|capsid	phage major capsid protein	capsid	M1Q1R5	Streptococcus_phage	99.0	6.1e-228
AXI67648.1|1212908_1213604_-|protease	Clp protease ClpP	protease	M1PLE5	Streptococcus_phage	96.1	5.2e-123
AXI67649.1|1213596_1214880_-|portal	phage portal protein	portal	E4ZFM3	Streptococcus_phage	99.3	1.9e-248
AXI67650.1|1214937_1215282_-	hypothetical protein	NA	M1NSE1	Streptococcus_phage	99.1	1.7e-58
AXI67651.1|1215419_1215758_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A1B0RXD2	Streptococcus_phage	96.4	2.8e-53
AXI67652.1|1215757_1216060_-	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	A0A1B0RXK3	Streptococcus_phage	96.0	1.6e-44
AXI67653.1|1216119_1217712_-|terminase	terminase large subunit	terminase	A0A1X9I6B3	Streptococcus_phage	99.4	0.0e+00
AXI67654.1|1217708_1218182_-|terminase	phage terminase small subunit P27 family	terminase	A0A1B0RXI5	Streptococcus_phage	99.4	5.9e-86
AXI67655.1|1218232_1218463_-	hypothetical protein	NA	A0A1X9I697	Streptococcus_phage	98.7	1.2e-39
AXI67656.1|1218464_1218677_-	DUF4314 domain-containing protein	NA	A0A1B0RXJ2	Streptococcus_phage	98.6	1.2e-33
AXI67657.1|1218678_1218927_-	hypothetical protein	NA	A0A1B0RXJ1	Streptococcus_phage	96.3	2.8e-39
AXI67658.1|1218999_1220280_-	DNA (cytosine-5-)-methyltransferase	NA	M1NSK8	Streptococcus_phage	99.3	4.3e-248
AXI67659.1|1222359_1222821_-	helix-turn-helix domain-containing protein	NA	M1Q209	Streptococcus_phage	99.3	4.3e-89
AXI67660.1|1223120_1223486_-	HNH endonuclease	NA	M1PLL8	Streptococcus_phage	95.9	4.3e-68
AXI67661.1|1223487_1224525_-	methionine adenosyltransferase	NA	M1PG62	Streptococcus_phage	98.0	1.6e-192
AXI67662.1|1224569_1224752_-	hypothetical protein	NA	A0A1B0RXC3	Streptococcus_phage	100.0	5.9e-26
AXI67663.1|1224950_1225454_-	hypothetical protein	NA	M1PSN8	Streptococcus_phage	100.0	6.7e-88
AXI67664.1|1225446_1226823_-	ATP-dependent helicase	NA	M1Q214	Streptococcus_phage	100.0	6.7e-263
AXI67665.1|1226803_1227085_-	VRR-NUC domain-containing protein	NA	M1PFY8	Streptococcus_phage	100.0	5.5e-47
AXI67666.1|1227431_1229714_-	DNA primase	NA	M1NSF0	Streptococcus_phage	98.4	0.0e+00
AXI67667.1|1230131_1230455_+	hypothetical protein	NA	A0A1X9I6V4	Streptococcus_phage	100.0	8.2e-47
AXI67668.1|1230447_1231569_+	DUF2800 domain-containing protein	NA	A0A1X9I6D8	Streptococcus_phage	100.0	1.7e-219
AXI67669.1|1231573_1232122_+	DUF2815 family protein	NA	A0A1X9I6C5	Streptococcus_phage	100.0	3.2e-99
AXI67670.1|1232355_1234311_+	hypothetical protein	NA	D0R0B0	Streptococcus_phage	97.1	0.0e+00
AXI67671.1|1234350_1234956_-	hypothetical protein	NA	NA	NA	NA	NA
AXI67672.1|1235364_1237233_-	ImmA/IrrE family metallo-endopeptidase	NA	E4ZFJ9	Streptococcus_phage	79.6	5.6e-297
AXI67673.1|1237336_1238167_+	hypothetical protein	NA	NA	NA	NA	NA
AXI67674.1|1238417_1239755_+	DNA cytosine methyltransferase	NA	Q7Y4B5	Escherichia_virus	33.8	5.3e-47
AXI67675.1|1239841_1240531_+	helix-turn-helix transcriptional regulator	NA	M1PG82	Streptococcus_phage	94.8	2.2e-121
AXI67676.1|1240533_1240752_+	hypothetical protein	NA	D0R0A4	Streptococcus_phage	92.9	5.6e-31
AXI67677.1|1241379_1242066_+|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	98.7	2.2e-126
AXI67678.1|1242576_1244544_-	ABC-F type ribosomal protection protein OptrA	NA	A0A2K9L3Z8	Tupanvirus	28.5	1.8e-51
AXI67679.1|1244874_1245780_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AXI67680.1|1245804_1246542_-	23S rRNA (adenine(2058)-N(6))-methyltransferase Erm(B)	NA	E4ZFQ0	Streptococcus_phage	99.6	2.4e-134
AXI68596.1|1246666_1246705_-	hypothetical protein	NA	NA	NA	NA	NA
AXI67681.1|1246835_1247006_-	DNA recombinase	NA	A0A1X9I6E4	Streptococcus_phage	100.0	5.7e-23
AXI67682.1|1247397_1248753_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	E4ZFI6	Streptococcus_phage	98.2	6.2e-253
>prophage 4
CP030125	Streptococcus suis strain HA1003 chromosome, complete genome	2229183	1405910	1422000	2229183		Streptococcus_phage(88.24%)	19	NA	NA
AXI67824.1|1405910_1406738_+	exodeoxyribonuclease III	NA	M1PSC0	Streptococcus_phage	100.0	2.9e-152
AXI67825.1|1407133_1408033_+	cation transporter	NA	M1Q1N9	Streptococcus_phage	99.0	3.7e-161
AXI67826.1|1408049_1408403_-	arsenate reductase family protein	NA	M1PLC0	Streptococcus_phage	100.0	1.9e-60
AXI67827.1|1408386_1408893_-	cysteine methyltransferase	NA	M1PFU9	Streptococcus_phage	95.8	2.3e-91
AXI67828.1|1408895_1410077_-	phosphoglycerate dehydrogenase	NA	M1NSB9	Streptococcus_phage	100.0	9.2e-221
AXI67829.1|1410130_1410688_-	GNAT family N-acetyltransferase	NA	M1PSC3	Streptococcus_phage	94.6	2.0e-93
AXI67830.1|1410687_1411779_-	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	99.7	7.0e-207
AXI67831.1|1412247_1413111_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	97.6	2.2e-155
AXI67832.1|1413112_1413430_-	DNA replication initiation control protein YabA	NA	M1PFV3	Streptococcus_phage	100.0	3.1e-54
AXI67833.1|1413449_1414334_-	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	98.6	5.6e-154
AXI67834.1|1414330_1414969_-	dTMP kinase	NA	M1PSC7	Streptococcus_phage	97.6	1.0e-112
AXI67835.1|1415409_1416276_+	YitT family protein	NA	M1Q1P6	Streptococcus_phage	99.7	4.6e-153
AXI67836.1|1416312_1417584_-	toxic anion resistance protein	NA	M1PLC8	Streptococcus_phage	100.0	3.8e-212
AXI67837.1|1417589_1418417_-	hypothetical protein	NA	M1PFV6	Streptococcus_phage	98.2	3.0e-133
AXI67838.1|1418510_1419167_-	CBS domain-containing protein	NA	M1NSC5	Streptococcus_phage	99.1	2.1e-113
AXI67839.1|1419250_1420006_-	DNA integration/recombination/inversion protein	NA	NA	NA	NA	NA
AXI67840.1|1420158_1420356_-	hypothetical protein	NA	NA	NA	NA	NA
AXI67841.1|1420525_1421236_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.7	2.6e-16
AXI67842.1|1421235_1422000_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.3	2.8e-16
>prophage 5
CP030125	Streptococcus suis strain HA1003 chromosome, complete genome	2229183	1425638	1444370	2229183	protease,integrase	Streptococcus_phage(94.74%)	24	1424583:1424601	1448343:1448361
1424583:1424601	attL	TTTCTCCTTTGTAAGCCTT	NA	NA	NA	NA
AXI67847.1|1425638_1425953_+	DUF961 domain-containing protein	NA	A0A1S5SF38	Streptococcus_phage	100.0	5.2e-54
AXI67848.1|1425968_1426355_+	DUF961 domain-containing protein	NA	A0A1S5SF96	Streptococcus_phage	100.0	3.0e-64
AXI67849.1|1426383_1427769_+	ATP-binding protein	NA	A0A1S5SFB5	Streptococcus_phage	99.8	4.2e-265
AXI67850.1|1427771_1427924_+	conjugal transfer protein	NA	NA	NA	NA	NA
AXI67851.1|1427946_1429152_+	Cro/Cl family transcriptional regulator	NA	A0A1S5SEX3	Streptococcus_phage	99.8	7.0e-232
AXI67852.1|1429194_1429416_+	hypothetical protein	NA	A0A1S5SEY0	Streptococcus_phage	100.0	4.3e-31
AXI67853.1|1429532_1430030_+	antirestriction protein ArdA	NA	A0A1S5SF25	Streptococcus_phage	100.0	1.7e-91
AXI67854.1|1430004_1430511_+	conjugal transfer protein	NA	A0A1S5SEX7	Streptococcus_phage	100.0	8.6e-91
AXI67855.1|1430494_1432942_+	ATP/GTP-binding protein	NA	A0A1S5SF64	Streptococcus_phage	100.0	0.0e+00
AXI67856.1|1432944_1435122_+	YtxH domain-containing protein	NA	A0A1S5SF30	Streptococcus_phage	100.0	0.0e+00
AXI67857.1|1435118_1436120_+	peptidase P60	NA	A0A1S5SEZ8	Streptococcus_phage	100.0	5.0e-191
AXI67858.1|1436116_1437052_+	conjugal transfer protein	NA	A0A1S5SF22	Streptococcus_phage	99.0	7.7e-170
AXI67859.1|1437326_1437413_+	tetracycline resistance protein	NA	NA	NA	NA	NA
AXI67860.1|1437428_1439348_+	tetracycline resistance ribosomal protection protein Tet(M)	NA	A0A1S5SF82	Streptococcus_phage	98.7	0.0e+00
AXI67861.1|1439448_1439634_+	conjugal transfer protein	NA	D0R0F6	Streptococcus_phage	67.9	3.9e-17
AXI67862.1|1439693_1440047_-	XRE family transcriptional regulator	NA	A0A1S5SFA6	Streptococcus_phage	100.0	1.3e-58
AXI68603.1|1440251_1440323_+	hypothetical protein	NA	NA	NA	NA	NA
AXI67863.1|1440551_1440974_+	sigma-70 family RNA polymerase sigma factor	NA	A0A1S5SEW0	Streptococcus_phage	100.0	2.5e-72
AXI67864.1|1440970_1441201_+	helix-turn-helix domain-containing protein	NA	A0A1S5SEX1	Streptococcus_phage	100.0	2.7e-36
AXI67865.1|1441426_1441678_-	hypothetical protein	NA	NA	NA	NA	NA
AXI67866.1|1441661_1441865_+	excisionase	NA	A0A1S5SF07	Streptococcus_phage	100.0	4.0e-31
AXI67867.1|1441946_1443164_+|integrase	site-specific integrase	integrase	A0A1S5SEW7	Streptococcus_phage	100.0	3.7e-233
AXI67868.1|1443380_1443653_-	DUF2129 domain-containing protein	NA	NA	NA	NA	NA
AXI67869.1|1443779_1444370_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	56.7	1.5e-54
1448343:1448361	attR	TTTCTCCTTTGTAAGCCTT	NA	NA	NA	NA
>prophage 6
CP030125	Streptococcus suis strain HA1003 chromosome, complete genome	2229183	1930138	2002852	2229183	tail,tRNA,capsid,terminase,portal,head,holin,integrase,protease	Streptococcus_phage(62.79%)	85	1959648:1959671	1997660:1997683
AXI68281.1|1930138_1930246_-|holin	putative holin-like toxin	holin	NA	NA	NA	NA
AXI68282.1|1930463_1930934_-	hypothetical protein	NA	NA	NA	NA	NA
AXI68283.1|1930959_1931397_-	hypothetical protein	NA	NA	NA	NA	NA
AXI68284.1|1931390_1932380_-	DhaKLM operon coactivator DhaQ	NA	NA	NA	NA	NA
AXI68285.1|1932390_1932936_-	dihydroxyacetone kinase transcriptional activator DhaS	NA	NA	NA	NA	NA
AXI68286.1|1933082_1934072_+	dihydroxyacetone kinase subunit DhaK	NA	NA	NA	NA	NA
AXI68287.1|1934082_1934658_+	dihydroxyacetone kinase subunit L	NA	NA	NA	NA	NA
AXI68288.1|1934654_1935029_+	PTS-dependent dihydroxyacetone kinase phosphotransferase subunit DhaM	NA	NA	NA	NA	NA
AXI68289.1|1935038_1935749_+	aquaporin family protein	NA	M1HBN0	Acanthocystis_turfacea_Chlorella_virus	34.5	7.7e-29
AXI68290.1|1935828_1937691_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
AXI68291.1|1937924_1939184_-|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
AXI68292.1|1939193_1940000_-	CDP-archaeol synthase	NA	NA	NA	NA	NA
AXI68293.1|1940009_1940765_-	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	41.3	1.1e-20
AXI68294.1|1940878_1941202_-	preprotein translocase subunit YajC	NA	NA	NA	NA	NA
AXI68295.1|1941311_1942604_-	adenylosuccinate synthase	NA	L7Y4J5	Megavirus	36.2	2.8e-69
AXI68296.1|1942967_1945199_+	bifunctional glutamate--cysteine ligase/glutathione synthetase	NA	NA	NA	NA	NA
AXI68297.1|1946029_1949149_+	nuclease	NA	NA	NA	NA	NA
AXI68298.1|1949228_1950095_+	Hsp33 family molecular chaperone HslO	NA	NA	NA	NA	NA
AXI68299.1|1950087_1951092_+|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
AXI68300.1|1951187_1951679_-	cytidyltransferase	NA	A0A291I9M1	Lactobacillus_phage	38.8	1.1e-23
AXI68301.1|1951767_1951866_+	hypothetical protein	NA	NA	NA	NA	NA
AXI68622.1|1951990_1952410_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AXI68302.1|1952496_1954947_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	H6X3M6	Enterobacteria_phage	40.1	6.3e-123
AXI68303.1|1954950_1955409_-	CtsR family transcriptional regulator	NA	NA	NA	NA	NA
AXI68304.1|1955677_1956016_+	thiol reductase thioredoxin	NA	NA	NA	NA	NA
AXI68305.1|1956015_1956642_+	GNAT family acetyltransferase	NA	NA	NA	NA	NA
AXI68623.1|1956608_1956824_-	hypothetical protein	NA	NA	NA	NA	NA
AXI68306.1|1957134_1958175_-	elongation factor Ts	NA	NA	NA	NA	NA
AXI68307.1|1958330_1959107_-	30S ribosomal protein S2	NA	NA	NA	NA	NA
1959648:1959671	attL	TTGGTGGGCAAATGGTGGGCAAAT	NA	NA	NA	NA
AXI68308.1|1960050_1960242_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AXI68309.1|1960325_1961732_-|holin	holin	holin	A1EAB6	Streptococcus_phage	73.6	9.8e-177
AXI68310.1|1961819_1962062_-|holin	phage holin	holin	M1PSK5	Streptococcus_phage	96.2	2.1e-39
AXI68311.1|1962067_1962346_-	hypothetical protein	NA	M1NSI3	Streptococcus_phage	100.0	2.8e-43
AXI68312.1|1962524_1962959_-	DUF1366 domain-containing protein	NA	W6LMT1	Streptococcus_phage	39.6	2.6e-19
AXI68313.1|1962971_1965029_-	hypothetical protein	NA	K4K7M8	Streptococcus_phage	76.9	1.7e-294
AXI68314.1|1965042_1968522_-	hypothetical protein	NA	M1IFB6	Streptococcus_phage	52.7	2.8e-132
AXI68315.1|1968518_1969238_-|tail	phage tail protein	tail	A0A1B1P761	Bacillus_phage	42.7	4.1e-46
AXI68316.1|1969256_1972661_-|tail	phage tail tape measure protein	tail	J7KDT4	Streptococcus_phage	51.0	4.9e-97
AXI68317.1|1972879_1973212_-	hypothetical protein	NA	NA	NA	NA	NA
AXI68318.1|1973224_1973815_-|tail	phage tail protein	tail	NA	NA	NA	NA
AXI68319.1|1973825_1974248_-	hypothetical protein	NA	A0A1B1P769	Bacillus_phage	44.5	6.4e-23
AXI68320.1|1974252_1974624_-	hypothetical protein	NA	NA	NA	NA	NA
AXI68321.1|1974586_1974964_-|head,tail	phage head-tail adapter protein	head,tail	NA	NA	NA	NA
AXI68322.1|1974956_1975256_-|head,tail	phage gp6-like head-tail connector protein	head,tail	NA	NA	NA	NA
AXI68323.1|1975270_1975558_-	hypothetical protein	NA	NA	NA	NA	NA
AXI68324.1|1975575_1976766_-|capsid	phage major capsid protein	capsid	R4IBU5	Listeria_phage	33.2	1.3e-49
AXI68325.1|1976771_1977503_-|protease	Clp protease ClpP	protease	D2XR17	Bacillus_phage	41.8	9.9e-40
AXI68326.1|1977438_1978698_-|portal	phage portal protein	portal	A0A1S7FYX7	Listeria_phage	37.8	2.1e-74
AXI68327.1|1978727_1978979_-	hypothetical protein	NA	NA	NA	NA	NA
AXI68328.1|1978988_1980641_-|terminase	terminase large subunit	terminase	E2ELI2	Clostridium_phage	44.0	1.7e-132
AXI68329.1|1980624_1980972_-|terminase	terminase	terminase	A0A1S7FYW6	Listeria_phage	35.4	9.6e-09
AXI68330.1|1981094_1981424_-	HNH endonuclease	NA	A0A1S7FZ53	Listeria_phage	49.0	1.8e-20
AXI68331.1|1981420_1981711_-	hypothetical protein	NA	NA	NA	NA	NA
AXI68332.1|1981877_1982453_-|integrase	site-specific integrase	integrase	A0A1S5SFL0	Streptococcus_phage	42.7	1.1e-30
AXI68333.1|1982581_1983046_-	hypothetical protein	NA	A0A1P8VVT5	Streptococcus_phage	85.1	6.9e-71
AXI68334.1|1983381_1983777_-	hypothetical protein	NA	A0A1L2JYR5	Streptococcus_phage	67.5	7.7e-39
AXI68335.1|1983760_1984030_-	hypothetical protein	NA	NA	NA	NA	NA
AXI68336.1|1984026_1984296_-	hypothetical protein	NA	NA	NA	NA	NA
AXI68337.1|1984305_1984722_-	Single-stranded DNA-binding protein 1	NA	C5J996	Streptococcus_phage	81.3	1.7e-57
AXI68338.1|1984718_1984985_-	hypothetical protein	NA	NA	NA	NA	NA
AXI68339.1|1984981_1985185_-	hypothetical protein	NA	A0A1X9I737	Streptococcus_phage	92.4	4.8e-29
AXI68340.1|1985361_1985766_-	hypothetical protein	NA	M1PLH5	Streptococcus_phage	92.6	5.7e-37
AXI68341.1|1985905_1986430_-	hypothetical protein	NA	A0A1X9I640	Streptococcus_phage	55.0	2.9e-33
AXI68342.1|1986380_1986737_-	hypothetical protein	NA	M1NRW0	Streptococcus_phage	84.7	6.9e-55
AXI68343.1|1986747_1987422_-	site-specific DNA-methyltransferase	NA	A0A1S5S9L2	Streptococcus_phage	79.0	1.5e-106
AXI68624.1|1987414_1988881_-	DNA (cytosine-5-)-methyltransferase	NA	A0A1X9I6Y5	Streptococcus_phage	71.2	2.3e-184
AXI68344.1|1989195_1989945_-	site-specific DNA-methyltransferase	NA	A0A1S5SE41	Streptococcus_phage	94.8	4.0e-137
AXI68345.1|1989934_1990114_-	hypothetical protein	NA	B0YL92	Streptococcus_virus	55.6	1.4e-11
AXI68346.1|1990280_1990472_-	hypothetical protein	NA	A0A1S5SEM5	Streptococcus_phage	53.2	8.6e-12
AXI68347.1|1990458_1991427_-	replication protein	NA	Q7Y4K5	Streptococcus_phage	70.8	2.6e-56
AXI68348.1|1991577_1991832_-	hypothetical protein	NA	NA	NA	NA	NA
AXI68349.1|1991833_1992016_-	hypothetical protein	NA	NA	NA	NA	NA
AXI68350.1|1992012_1992297_-	DNA-binding protein	NA	A0A1P8VVZ3	Streptococcus_phage	86.2	2.2e-43
AXI68351.1|1992339_1992684_-	hypothetical protein	NA	A0A1P8VVU1	Streptococcus_phage	66.7	1.1e-33
AXI68352.1|1992807_1993005_-	hypothetical protein	NA	NA	NA	NA	NA
AXI68353.1|1993084_1993792_+	hypothetical protein	NA	NA	NA	NA	NA
AXI68354.1|1993785_1994058_-	hypothetical protein	NA	Q7Y4L1	Streptococcus_phage	73.7	5.9e-06
AXI68355.1|1994132_1994384_+	hypothetical protein	NA	A0A097BY83	Enterococcus_phage	50.6	6.2e-18
AXI68356.1|1994378_1994576_-	hypothetical protein	NA	NA	NA	NA	NA
AXI68357.1|1994642_1994843_-	XRE family transcriptional regulator	NA	A0A1X9I583	Streptococcus_phage	100.0	9.6e-30
AXI68358.1|1995028_1995409_+	transcriptional regulator	NA	A0A1X9I5A1	Streptococcus_phage	92.9	7.6e-60
AXI68359.1|1995415_1995802_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A1X9I5R2	Streptococcus_phage	87.4	3.5e-60
AXI68360.1|1995853_1996456_+	DUF4190 domain-containing protein	NA	A0A182BQD0	Lactococcus_phage	53.3	1.3e-21
AXI68361.1|1996588_1997659_+|integrase	site-specific integrase	integrase	B3GVW7	Streptococcus_phage	47.9	3.3e-92
AXI68362.1|1997773_2002852_-|protease	serine protease	protease	NA	NA	NA	NA
1997660:1997683	attR	TTGGTGGGCAAATGGTGGGCAAAT	NA	NA	NA	NA
