The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP025803	Sulfitobacter sp. SK011 chromosome, complete genome	4190786	2435508	2477219	4190786	transposase,integrase	uncultured_Mediterranean_phage(33.33%)	28	2425619:2425665	2470251:2470297
2425619:2425665	attL	ACTGTTAATCAATTGGTCGTAGGTTCGATCCCTACCGCCGGAGCCAT	NA	NA	NA	NA
AXI42586.1|2435508_2436894_+|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
AXI42587.1|2437235_2439110_-	hypothetical protein	NA	NA	NA	NA	NA
AXI42588.1|2439979_2440861_-	sulfurtransferase	NA	NA	NA	NA	NA
AXI42589.1|2441179_2441695_-	fasciclin	NA	NA	NA	NA	NA
AXI42590.1|2442329_2443370_+	hypothetical protein	NA	NA	NA	NA	NA
AXI42591.1|2443661_2444168_+	aldehyde-activating protein	NA	NA	NA	NA	NA
AXI42592.1|2444478_2445198_+	pyrroline-5-carboxylate reductase	NA	NA	NA	NA	NA
AXI42593.1|2445276_2446627_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
AXI42594.1|2447063_2448230_+	hypothetical protein	NA	NA	NA	NA	NA
AXI42595.1|2448235_2451772_+	hypothetical protein	NA	NA	NA	NA	NA
AXI42596.1|2451816_2452155_+	hypothetical protein	NA	NA	NA	NA	NA
AXI42597.1|2452316_2452652_+	hypothetical protein	NA	NA	NA	NA	NA
AXI42598.1|2453386_2455102_+	adenylate cyclase	NA	NA	NA	NA	NA
AXI42599.1|2455354_2456737_+|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
AXI42600.1|2457036_2457816_+	ion transporter	NA	NA	NA	NA	NA
AXI42601.1|2457893_2458124_-	hypothetical protein	NA	NA	NA	NA	NA
AXI42602.1|2458155_2459418_-	adenylate/guanylate cyclase domain-containing response regulator	NA	A0A1B1IWY2	uncultured_Mediterranean_phage	40.6	4.7e-29
AXI42603.1|2459414_2459804_-	response regulator	NA	NA	NA	NA	NA
AXI42604.1|2459813_2463026_-	hypothetical protein	NA	NA	NA	NA	NA
AXI42605.1|2463394_2464780_-|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
AXI42606.1|2465212_2467588_-	hypothetical protein	NA	K4HZY1	Acidithiobacillus_phage	40.7	8.1e-91
AXI42607.1|2468020_2468713_-	hypothetical protein	NA	NA	NA	NA	NA
AXI42608.1|2468709_2470074_-|integrase	integrase	integrase	A0A221SAN4	Ralstonia_phage	35.1	1.1e-42
AXI42609.1|2471006_2471702_+	oxidoreductase	NA	NA	NA	NA	NA
2470251:2470297	attR	ACTGTTAATCAATTGGTCGTAGGTTCGATCCCTACCGCCGGAGCCAT	NA	NA	NA	NA
AXI42610.1|2471726_2472419_+	YecA family protein	NA	NA	NA	NA	NA
AXI42611.1|2472694_2473204_+	isoprenylcysteine carboxylmethyltransferase family protein	NA	NA	NA	NA	NA
AXI42612.1|2474230_2475622_-	adenylate/guanylate cyclase domain-containing protein	NA	NA	NA	NA	NA
AXI42613.1|2475836_2477219_+|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
>prophage 2
CP025803	Sulfitobacter sp. SK011 chromosome, complete genome	4190786	4178076	4187433	4190786		Cedratvirus(16.67%)	8	NA	NA
AXI44053.1|4178076_4179672_+	phosphoglycerate dehydrogenase	NA	A0A1M7XU89	Cedratvirus	38.8	5.7e-48
AXI44054.1|4179726_4180473_+	serine/threonine protein phosphatase	NA	A0A1V0EF12	Caulobacter_phage	38.2	2.1e-29
AXI44055.1|4180537_4181524_-	acyl-CoA synthetase	NA	NA	NA	NA	NA
AXI44550.1|4181572_4182613_-	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	64.7	1.7e-13
AXI44056.1|4182609_4183797_-	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	25.6	6.8e-22
AXI44057.1|4183977_4185156_+	acetyl-CoA C-acyltransferase	NA	NA	NA	NA	NA
AXI44058.1|4185152_4186685_-	2-polyprenylphenol 6-hydroxylase	NA	A0A2P0VMP1	Tetraselmis_virus	23.7	2.5e-16
AXI44059.1|4186686_4187433_-	bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE	NA	A0A097BYE1	Leuconostoc_phage	30.6	6.6e-07
