The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP021788	Xanthomonas oryzae pv. oryzae strain PXO61 chromosome, complete genome	4980838	7736	54569	4980838	protease,transposase	Ralstonia_phage(30.0%)	46	NA	NA
AXI15934.1|7736_8573_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
AXI15935.1|8759_9566_+	peptidase	NA	NA	NA	NA	NA
AXI15936.1|9842_11036_+	hypothetical protein	NA	NA	NA	NA	NA
AXI15937.1|11189_11861_+	energy transducer TonB	NA	NA	NA	NA	NA
AXI15938.1|11945_12707_+	biopolymer transporter ExbB	NA	NA	NA	NA	NA
AXI15939.1|12753_13176_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
AXI15940.1|13179_13593_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
AXI15941.1|13888_14656_-	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
AXI15942.1|14666_14936_-	hypothetical protein	NA	NA	NA	NA	NA
AXI15943.1|15010_16471_-	cardiolipin synthase	NA	NA	NA	NA	NA
AXI15944.1|17117_18128_-	fructose 1,6-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	37.8	9.5e-49
AXI15945.1|18399_19602_-	aromatic amino acid aminotransferase	NA	NA	NA	NA	NA
AXI15946.1|19743_21882_+	TonB-dependent receptor	NA	A0A1B0VCF0	Salmonella_phage	40.9	5.3e-65
AXI19444.1|22092_22386_+	hypothetical protein	NA	NA	NA	NA	NA
AXI15947.1|22502_23048_+	hypothetical protein	NA	NA	NA	NA	NA
AXI15948.1|23161_24142_-|transposase	IS5/IS1182 family transposase	transposase	A0A077K814	Ralstonia_phage	55.8	1.6e-88
AXI15949.1|24189_25356_-	alpha-hydroxy-acid oxidizing enzyme	NA	NA	NA	NA	NA
AXI15950.1|25502_26069_-	protein-S-isoprenylcysteine methyltransferase	NA	NA	NA	NA	NA
AXI15951.1|27543_28752_+	trans-2-enoyl-CoA reductase	NA	NA	NA	NA	NA
AXI15952.1|29379_30402_-	sugar kinase	NA	NA	NA	NA	NA
AXI15953.1|30688_30970_+	TonB-dependent receptor	NA	NA	NA	NA	NA
AXI15954.1|30982_31222_-	hypothetical protein	NA	NA	NA	NA	NA
AXI15955.1|31224_32193_+|transposase	IS5 family transposase ISXo1	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
AXI15956.1|32545_33817_+	hypothetical protein	NA	NA	NA	NA	NA
AXI15957.1|33828_34521_+	hypothetical protein	NA	G3M9Y6	Bacillus_virus	24.2	4.4e-05
AXI15958.1|34708_35095_-	hypothetical protein	NA	K4I1H9	Acidithiobacillus_phage	67.3	2.8e-33
AXI15959.1|35122_36499_-|transposase	IS5/IS1182 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	56.5	9.2e-79
AXI15960.1|39125_39458_+	dihydrolipoamide acyltransferase	NA	NA	NA	NA	NA
AXI15961.1|39511_39754_-	hypothetical protein	NA	NA	NA	NA	NA
AXI15962.1|39695_40019_-	hypothetical protein	NA	NA	NA	NA	NA
AXI15963.1|40149_40536_-	hypothetical protein	NA	NA	NA	NA	NA
AXI15964.1|40484_41465_-|transposase	IS5 family transposase ISXoo7	transposase	A0A077K814	Ralstonia_phage	55.9	5.3e-89
AXI15965.1|41824_42076_+	hypothetical protein	NA	NA	NA	NA	NA
AXI15966.1|42083_43373_+	ATP-dependent helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.2	2.1e-40
AXI15967.1|43812_44148_-	hypothetical protein	NA	NA	NA	NA	NA
AXI15968.1|44422_44854_-	hypothetical protein	NA	NA	NA	NA	NA
AXI15969.1|45202_46612_-	pyridine nucleotide-disulfide oxidoreductase	NA	NA	NA	NA	NA
AXI15970.1|47929_48190_-	hypothetical protein	NA	NA	NA	NA	NA
AXI15971.1|48206_48539_-	hypothetical protein	NA	NA	NA	NA	NA
AXI19445.1|48538_48751_-	hypothetical protein	NA	NA	NA	NA	NA
AXI15972.1|48831_48996_-	hypothetical protein	NA	NA	NA	NA	NA
AXI15973.1|49355_50570_-|transposase	IS4/IS5 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	33.4	1.8e-54
AXI15974.1|50594_51020_-	hypothetical protein	NA	NA	NA	NA	NA
AXI15975.1|51090_51888_+|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
AXI15976.1|52693_53509_-	type IV secretion protein Rhs	NA	NA	NA	NA	NA
AXI15977.1|53570_54569_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
>prophage 2
CP021788	Xanthomonas oryzae pv. oryzae strain PXO61 chromosome, complete genome	4980838	78438	133776	4980838	transposase	Ralstonia_phage(71.43%)	50	NA	NA
AXI15992.1|78438_78885_-|transposase	transposase	transposase	NA	NA	NA	NA
AXI15993.1|78917_79178_+	hypothetical protein	NA	NA	NA	NA	NA
AXI19448.1|79196_81755_-	Ion channel protein	NA	NA	NA	NA	NA
AXI15994.1|81939_82281_+	hypothetical protein	NA	NA	NA	NA	NA
AXI15995.1|84496_86050_+	hypothetical protein	NA	NA	NA	NA	NA
AXI15996.1|86513_87077_-	lytic transglycosylase	NA	A0A0K2QQJ4	Ralstonia_phage	38.5	4.4e-11
AXI15997.1|87452_87872_+	hypothetical protein	NA	NA	NA	NA	NA
AXI15998.1|88334_89303_+|transposase	IS5 family transposase ISXo1	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
AXI15999.1|89770_91588_-	EscC/YscC/HrcC family type III secretion system outer membrane ring protein	NA	NA	NA	NA	NA
AXI16000.1|91670_92501_-	EscT/YscT/HrcT family type III secretion system export apparatus protein	NA	NA	NA	NA	NA
AXI16001.1|92497_93007_-	type III secretion protein HrpB7	NA	NA	NA	NA	NA
AXI16002.1|92999_94328_-	EscN/YscN/HrcN family type III secretion system ATPase	NA	NA	NA	NA	NA
AXI16003.1|94317_95019_-	ATP-dependent helicase HrpB	NA	NA	NA	NA	NA
AXI16004.1|95003_95633_-	type III secretion protein HrpB4	NA	NA	NA	NA	NA
AXI16005.1|95640_96402_-	EscJ/YscJ/HrcJ family type III secretion inner membrane ring protein	NA	NA	NA	NA	NA
AXI16006.1|96403_96796_-	type III secretion protein HrpB2	NA	NA	NA	NA	NA
AXI16007.1|96829_97285_-	serine kinase	NA	NA	NA	NA	NA
AXI16008.1|97499_98579_+	EscU/YscU/HrcU family type III secretion system export apparatus switch protein	NA	NA	NA	NA	NA
AXI16009.1|98587_100510_+	EscV/YscV/HrcV family type III secretion system export apparatus protein	NA	NA	NA	NA	NA
AXI16010.1|100509_101151_+	type III secretion protein HpaP	NA	NA	NA	NA	NA
AXI16011.1|101243_102197_+	aldolase	NA	NA	NA	NA	NA
AXI16012.1|102183_102828_+	EscR/YscR/HrcR family type III secretion system export apparatus protein	NA	NA	NA	NA	NA
AXI16013.1|102832_103093_+	EscS/YscS/HrcS family type III secretion system export apparatus protein	NA	NA	NA	NA	NA
AXI16014.1|103089_103917_+	4-hydroxyphenylacetate catabolism regulator HpaA	NA	NA	NA	NA	NA
AXI16015.1|103913_104852_+	serine kinase	NA	NA	NA	NA	NA
AXI16016.1|104861_105104_+	serine kinase	NA	NA	NA	NA	NA
AXI16017.1|105235_105466_+	serine kinase	NA	NA	NA	NA	NA
AXI16018.1|105520_105991_+	4-hydroxyphenylacetate 3-monooxygenase	NA	NA	NA	NA	NA
AXI16019.1|108386_108833_-	hypothetical protein	NA	NA	NA	NA	NA
AXI16020.1|110533_111502_+|transposase	IS5 family transposase ISXo1	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
AXI16021.1|111628_112864_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
AXI16022.1|113034_114471_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AXI16023.1|114542_115526_-|transposase	IS5/IS1182 family transposase	transposase	A0A077K814	Ralstonia_phage	61.2	7.5e-99
AXI16024.1|115896_117132_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
AXI16025.1|117567_119940_+	serine kinase	NA	NA	NA	NA	NA
AXI19449.1|120815_122444_+	type III secretion system effector XopAE	NA	NA	NA	NA	NA
AXI16026.1|123001_123385_-	hypothetical protein	NA	NA	NA	NA	NA
AXI16027.1|123381_123867_-	hypothetical protein	NA	NA	NA	NA	NA
AXI16028.1|123870_124233_-	hypothetical protein	NA	NA	NA	NA	NA
AXI16029.1|124349_125786_-	heat-shock protein	NA	W5SAB9	Pithovirus	30.7	1.5e-10
AXI16030.1|126027_126879_+	histidine biosynthesis protein HisIE	NA	NA	NA	NA	NA
AXI16031.1|127338_127656_-	ATP-binding protein	NA	NA	NA	NA	NA
AXI16032.1|127961_128849_-	TIGR01777 family protein	NA	NA	NA	NA	NA
AXI19450.1|129049_129529_-	hypothetical protein	NA	NA	NA	NA	NA
AXI16033.1|129555_130506_+|transposase	IS5/IS1182 family transposase	transposase	A0A077K814	Ralstonia_phage	61.9	3.0e-97
AXI16034.1|130619_130805_-	hypothetical protein	NA	NA	NA	NA	NA
AXI16035.1|130896_131169_-	hypothetical protein	NA	NA	NA	NA	NA
AXI16036.1|131209_131491_-	hypothetical protein	NA	NA	NA	NA	NA
AXI16037.1|131629_132688_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
AXI16038.1|132828_133776_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.7	6.6e-44
>prophage 3
CP021788	Xanthomonas oryzae pv. oryzae strain PXO61 chromosome, complete genome	4980838	138432	226823	4980838	tRNA,transposase,protease	Acidithiobacillus_phage(22.22%)	50	NA	NA
AXI16043.1|138432_139389_+|transposase	IS30 family transposase IS1112a	transposase	Q9MBM9	Staphylococcus_prophage	35.2	2.1e-42
AXI16044.1|139363_139834_-	hypothetical protein	NA	NA	NA	NA	NA
AXI16045.1|140025_141273_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AXI16046.1|141642_141897_+	hypothetical protein	NA	NA	NA	NA	NA
AXI16047.1|142495_143185_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.7	1.3e-36
AXI16048.1|143197_144355_+	hypothetical protein	NA	NA	NA	NA	NA
AXI16049.1|144367_145678_+	ABC transporter permease	NA	NA	NA	NA	NA
AXI19451.1|147553_147805_-|transposase	transposase	transposase	NA	NA	NA	NA
AXI16050.1|148257_148659_-	addiction module toxin RelE	NA	NA	NA	NA	NA
AXI16051.1|148682_148913_-	type II toxin-antitoxin system prevent-host-death family antitoxin	NA	NA	NA	NA	NA
AXI16052.1|148979_149642_-	hemolysin III	NA	NA	NA	NA	NA
AXI19452.1|149916_152325_+	helicase	NA	A0A1B1IUF6	uncultured_Mediterranean_phage	36.0	1.5e-07
AXI16053.1|152321_154148_+	exonuclease	NA	NA	NA	NA	NA
AXI16054.1|154636_156781_-	avirulence protein	NA	NA	NA	NA	NA
AXI16055.1|156971_158129_-	ROK family protein	NA	NA	NA	NA	NA
AXI16056.1|158301_160890_+	TonB-dependent receptor	NA	NA	NA	NA	NA
AXI16057.1|160900_161686_+	Tat pathway signal protein	NA	NA	NA	NA	NA
AXI19453.1|161999_163139_-	saccharopine dehydrogenase	NA	NA	NA	NA	NA
AXI19454.1|163633_163801_-	amino acid transporter	NA	NA	NA	NA	NA
AXI16058.1|164289_164595_+	hypothetical protein	NA	NA	NA	NA	NA
AXI16059.1|164582_164876_-	hypothetical protein	NA	NA	NA	NA	NA
AXI19455.1|164924_166088_-	DNA topoisomerase	NA	A0A0U2TSJ7	Niemeyer_virus	35.2	1.7e-38
AXI16060.1|166234_166615_+	Elastase inhibitor AFLEI Flags: Precursor	NA	NA	NA	NA	NA
AXI16061.1|166816_171289_+	glutamate synthase large subunit	NA	NA	NA	NA	NA
AXI16062.1|171483_172965_+	glutamate synthase small subunit	NA	NA	NA	NA	NA
AXI16063.1|174202_175201_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
AXI16064.1|176603_177402_-|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
AXI16065.1|177640_179023_-|transposase	IS5/IS1182 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	53.7	4.7e-75
AXI16066.1|180424_181492_-	LacI family transcriptional regulator	NA	NA	NA	NA	NA
AXI19456.1|181447_181645_+	hypothetical protein	NA	NA	NA	NA	NA
AXI16067.1|182151_182463_+	hypothetical protein	NA	NA	NA	NA	NA
AXI16068.1|182401_182626_-	hypothetical protein	NA	NA	NA	NA	NA
AXI19457.1|182583_182844_-	metallophosphatase family protein	NA	NA	NA	NA	NA
AXI16069.1|183047_185231_-	1,4-alpha-glucan branching enzyme	NA	NA	NA	NA	NA
AXI16070.1|185242_188593_-	maltose alpha-D-glucosyltransferase	NA	NA	NA	NA	NA
AXI16071.1|188589_191706_-	alpha-amylase	NA	NA	NA	NA	NA
AXI16072.1|198787_200170_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AXI16073.1|200326_201847_-|protease	ATP-dependent protease	protease	NA	NA	NA	NA
AXI16074.1|201863_202142_-	hypothetical protein	NA	NA	NA	NA	NA
AXI19458.1|202331_202670_+	transcriptional regulator	NA	NA	NA	NA	NA
AXI16075.1|203282_205268_+	beta-N-acetylglucosaminidase	NA	NA	NA	NA	NA
AXI16076.1|206186_206999_+	hypothetical protein	NA	NA	NA	NA	NA
AXI16077.1|207191_207803_+	hypothetical protein	NA	NA	NA	NA	NA
AXI16078.1|208219_209077_-	polyamine aminopropyltransferase	NA	A0A1C9C533	Heterosigma_akashiwo_virus	31.5	2.9e-14
AXI16079.1|209314_211201_+	arginine decarboxylase	NA	NA	NA	NA	NA
AXI16080.1|211766_213143_+|transposase	IS5/IS1182 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.1	2.7e-78
AXI19459.1|216337_218491_+	hypothetical protein	NA	A0A077K801	Ralstonia_phage	28.5	2.0e-27
AXI16081.1|220174_220438_+	PAAR domain-containing protein	NA	A4JWV5	Burkholderia_virus	43.4	4.4e-06
AXI16082.1|222696_224385_+	hypothetical protein	NA	NA	NA	NA	NA
AXI16083.1|224918_226823_-|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG	tRNA	NA	NA	NA	NA
>prophage 4
CP021788	Xanthomonas oryzae pv. oryzae strain PXO61 chromosome, complete genome	4980838	269764	318010	4980838	transposase	Staphylococcus_prophage(25.0%)	35	NA	NA
AXI16113.1|269764_269986_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	50.8	1.6e-09
AXI16114.1|270907_271441_-	hypothetical protein	NA	NA	NA	NA	NA
AXI16115.1|272823_272955_-	hypothetical protein	NA	NA	NA	NA	NA
AXI16116.1|274256_275315_-	hydroxyacid dehydrogenase	NA	A0A2K9L339	Tupanvirus	45.7	3.0e-77
AXI16117.1|275300_275507_+	hypothetical protein	NA	NA	NA	NA	NA
AXI16118.1|275622_276696_+	cellulase	NA	NA	NA	NA	NA
AXI16119.1|277458_278511_+	cellulase	NA	NA	NA	NA	NA
AXI16120.1|279158_280289_+	cellulase	NA	NA	NA	NA	NA
AXI16121.1|281612_282002_+	hypothetical protein	NA	NA	NA	NA	NA
AXI16122.1|282209_282416_+	hypothetical protein	NA	NA	NA	NA	NA
AXI16123.1|282647_283616_+|transposase	IS5/IS1182 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
AXI16124.1|283869_286032_+	lytic murein transglycosylase	NA	NA	NA	NA	NA
AXI16125.1|287943_288546_+	biliverdin-producing heme oxygenase	NA	NA	NA	NA	NA
AXI16126.1|288542_290447_+	phytochrome	NA	Q6XLU9	Feldmannia_irregularis_virus	27.7	3.9e-19
AXI16127.1|299325_299586_-	hypothetical protein	NA	NA	NA	NA	NA
AXI16128.1|299766_300582_+	formamidopyrimidine-DNA glycosylase	NA	A0A127AWE5	Bacillus_phage	27.3	6.3e-19
AXI16129.1|300928_301990_-|transposase	DDE transposase	transposase	NA	NA	NA	NA
AXI16130.1|301995_302415_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXI19462.1|302180_302759_+	hypothetical protein	NA	NA	NA	NA	NA
AXI16131.1|304557_305616_-	hypothetical protein	NA	NA	NA	NA	NA
AXI16132.1|305626_305917_-	anti-sigma B factor antagonist	NA	NA	NA	NA	NA
AXI16133.1|305906_306569_-	organic solvent ABC transporter	NA	NA	NA	NA	NA
AXI16134.1|306565_307117_-	outer membrane lipid asymmetry maintenance protein MlaD	NA	NA	NA	NA	NA
AXI16135.1|307128_307878_-	ABC transporter permease	NA	NA	NA	NA	NA
AXI16136.1|307877_308672_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.8	1.7e-08
AXI16137.1|309056_309344_+	hypothetical protein	NA	NA	NA	NA	NA
AXI16138.1|309362_309920_-	N-acetyltransferase	NA	NA	NA	NA	NA
AXI16139.1|309937_310936_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
AXI16140.1|311747_312704_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	34.4	2.9e-39
AXI16141.1|312748_313195_+|transposase	transposase	transposase	NA	NA	NA	NA
AXI19463.1|312960_313539_+	hypothetical protein	NA	NA	NA	NA	NA
AXI16142.1|313577_314376_-|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
AXI16143.1|314507_315722_+|transposase	IS4/IS5 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	33.4	4.1e-54
AXI16144.1|315781_316612_+|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
AXI16145.1|316774_318010_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
>prophage 5
CP021788	Xanthomonas oryzae pv. oryzae strain PXO61 chromosome, complete genome	4980838	323479	367280	4980838	tRNA,transposase	Acidithiobacillus_phage(50.0%)	31	NA	NA
AXI16149.1|323479_323926_+|transposase	transposase	transposase	NA	NA	NA	NA
AXI19465.1|323691_324270_+	hypothetical protein	NA	NA	NA	NA	NA
AXI16150.1|324322_324907_-	gluconokinase	NA	NA	NA	NA	NA
AXI16151.1|325064_326447_+	MFS transporter	NA	NA	NA	NA	NA
AXI19466.1|326449_328849_+	NdvB protein	NA	NA	NA	NA	NA
AXI16152.1|328952_331595_-	hypothetical protein	NA	NA	NA	NA	NA
AXI16153.1|332001_332202_+	hypothetical protein	NA	NA	NA	NA	NA
AXI19467.1|332342_335792_+	hybrid sensor histidine kinase/response regulator	NA	NA	NA	NA	NA
AXI16154.1|335984_336569_-	hypothetical protein	NA	NA	NA	NA	NA
AXI16155.1|337045_337822_-	transcriptional regulator	NA	NA	NA	NA	NA
AXI16156.1|338002_339304_+	L-fucose:H+ symporter permease	NA	NA	NA	NA	NA
AXI19468.1|339300_339666_+	L-fucose mutarotase	NA	NA	NA	NA	NA
AXI16157.1|340102_341584_+|transposase	IS5/IS1182 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	66.0	2.7e-100
AXI16158.1|341743_342742_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
AXI16159.1|343568_345731_+	type III secretion system effector protein	NA	NA	NA	NA	NA
AXI16160.1|345857_348026_-	dipeptidyl carboxypeptidase II	NA	NA	NA	NA	NA
AXI19469.1|348399_348585_-	hypothetical protein	NA	NA	NA	NA	NA
AXI16161.1|348663_349293_-	acyltransferase	NA	NA	NA	NA	NA
AXI16162.1|349295_349727_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
AXI16163.1|349819_350362_+	hypothetical protein	NA	NA	NA	NA	NA
AXI16164.1|350457_351147_-	pseudouridylate synthase	NA	NA	NA	NA	NA
AXI16165.1|351433_351823_-	cupin	NA	NA	NA	NA	NA
AXI16166.1|351936_353610_-	ubiquinone biosynthesis protein UbiB	NA	E5EQY1	Bathycoccus_sp._RCC1105_virus	28.6	3.1e-28
AXI16167.1|353606_354251_-	SCP2 domain-containing protein	NA	NA	NA	NA	NA
AXI16168.1|354260_354455_-	hypothetical protein	NA	NA	NA	NA	NA
AXI16169.1|357935_358220_+	hypothetical protein	NA	NA	NA	NA	NA
AXI16170.1|358571_359370_-|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
AXI19470.1|359429_360008_-|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
AXI16171.1|359773_360220_-|transposase	transposase	transposase	NA	NA	NA	NA
AXI16172.1|364147_365146_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
AXI16173.1|366173_367280_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 6
CP021788	Xanthomonas oryzae pv. oryzae strain PXO61 chromosome, complete genome	4980838	519228	576395	4980838	tRNA,transposase	Hokovirus(25.0%)	46	NA	NA
AXI19488.1|519228_520440_+|tRNA	tyrosine--tRNA ligase	tRNA	NA	NA	NA	NA
AXI16287.1|528066_530376_-	hybrid sensor histidine kinase/response regulator	NA	A0A1V0SGX0	Hokovirus	40.8	7.7e-46
AXI19489.1|530376_532203_-	response regulator receiver protein	NA	NA	NA	NA	NA
AXI16288.1|532385_533012_-	DUF4126 domain-containing protein	NA	NA	NA	NA	NA
AXI16289.1|533152_533890_+	hypothetical protein	NA	NA	NA	NA	NA
AXI16290.1|533893_534121_+	hypothetical protein	NA	NA	NA	NA	NA
AXI16291.1|534133_534343_+	hypothetical protein	NA	NA	NA	NA	NA
AXI16292.1|534362_534809_+|transposase	transposase	transposase	NA	NA	NA	NA
AXI19490.1|534574_535153_+|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
AXI16293.1|535231_535618_+	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	50.9	1.1e-24
AXI16294.1|536544_537825_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
AXI16295.1|538131_539022_+	NADH pyrophosphatase	NA	NA	NA	NA	NA
AXI16296.1|539095_539986_+	hypothetical protein	NA	NA	NA	NA	NA
AXI16297.1|540307_540715_-	hypothetical protein	NA	NA	NA	NA	NA
AXI16298.1|540717_541098_-	hypothetical protein	NA	NA	NA	NA	NA
AXI16299.1|541152_541440_-	hypothetical protein	NA	NA	NA	NA	NA
AXI16300.1|541558_543481_-	MFS transporter	NA	NA	NA	NA	NA
AXI16301.1|545872_548086_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
AXI16302.1|548311_548893_-	hypothetical protein	NA	NA	NA	NA	NA
AXI16303.1|548889_550083_-	chromosome segregation protein SMC	NA	NA	NA	NA	NA
AXI16304.1|550235_551525_-	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
AXI16305.1|551545_552160_-	hypothetical protein	NA	NA	NA	NA	NA
AXI16306.1|552159_553395_-	ATPase	NA	A0A077SLJ9	Escherichia_phage	25.9	1.3e-20
AXI16307.1|553444_555028_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/inosine monophosphate cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	45.6	2.6e-61
AXI16308.1|555393_555720_+	CDP-alcohol phosphatidyltransferase	NA	NA	NA	NA	NA
AXI16309.1|555845_556247_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
AXI16310.1|556567_557566_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
AXI16311.1|557562_557961_+	phosphatase	NA	NA	NA	NA	NA
AXI16312.1|557957_558956_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
AXI16313.1|559005_559290_-	hypothetical protein	NA	NA	NA	NA	NA
AXI16314.1|559607_559880_-	Fis family transcriptional regulator	NA	NA	NA	NA	NA
AXI19491.1|559986_560832_-	hypothetical protein	NA	NA	NA	NA	NA
AXI16315.1|561542_561920_-	transcriptional regulator	NA	NA	NA	NA	NA
AXI16316.1|562063_562579_+	hypothetical protein	NA	NA	NA	NA	NA
AXI19492.1|562725_563667_-	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
AXI16317.1|565534_565900_+	hypothetical protein	NA	NA	NA	NA	NA
AXI16318.1|566038_567406_-	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
AXI19493.1|567441_567849_-	four helix bundle protein	NA	NA	NA	NA	NA
AXI16319.1|567881_568367_-	acetyl-CoA carboxylase biotin carboxyl carrier protein subunit	NA	NA	NA	NA	NA
AXI16320.1|568465_568912_-	type II 3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
AXI16321.1|569237_569432_-	hypothetical protein	NA	NA	NA	NA	NA
AXI16322.1|569751_572076_-	cytochrome C biogenesis protein	NA	NA	NA	NA	NA
AXI16323.1|572081_572414_-	divalent-cation tolerance protein CutA	NA	NA	NA	NA	NA
AXI16324.1|572597_573596_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
AXI19494.1|574030_575458_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AXI16325.1|575879_576395_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
>prophage 7
CP021788	Xanthomonas oryzae pv. oryzae strain PXO61 chromosome, complete genome	4980838	736819	849404	4980838	tRNA,transposase	Enterobacteria_phage(15.38%)	99	NA	NA
AXI16469.1|736819_737041_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXI16470.1|737037_738036_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
AXI16471.1|738097_738676_+|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
AXI16472.1|740177_740363_-	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
AXI19505.1|740411_741683_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AXI16473.1|741890_743720_+	glutamine--fructose-6-phosphate aminotransferase	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	43.5	1.3e-133
AXI16474.1|744101_744575_+	hypothetical protein	NA	NA	NA	NA	NA
AXI16475.1|744806_745382_+	hypothetical protein	NA	NA	NA	NA	NA
AXI16476.1|745387_745834_+|transposase	transposase	transposase	NA	NA	NA	NA
AXI19506.1|745599_746178_+	hypothetical protein	NA	NA	NA	NA	NA
AXI19507.1|746293_747328_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	32.8	8.0e-43
AXI16477.1|747544_748069_-	lactoylglutathione lyase	NA	NA	NA	NA	NA
AXI16478.1|748225_749332_-	copper resistance protein B	NA	NA	NA	NA	NA
AXI19508.1|749328_751155_-	copper resistance protein CopA	NA	NA	NA	NA	NA
AXI16479.1|751262_751679_-	copper homeostasis protein	NA	NA	NA	NA	NA
AXI16480.1|751814_752918_+	cysteine synthase	NA	NA	NA	NA	NA
AXI16481.1|752961_754986_+	oligopeptidase A	NA	NA	NA	NA	NA
AXI16482.1|755159_755981_+	hypothetical protein	NA	NA	NA	NA	NA
AXI16483.1|756094_757303_-	beta-ketoacyl-[acyl-carrier-protein] synthase I	NA	NA	NA	NA	NA
AXI16484.1|757302_757818_-	beta-hydroxydecanoyl-ACP dehydratase	NA	NA	NA	NA	NA
AXI16485.1|757816_758164_+	hypothetical protein	NA	NA	NA	NA	NA
AXI16486.1|758163_759243_+	DNA polymerase IV	NA	NA	NA	NA	NA
AXI16487.1|759384_760035_+	phosphoglycolate phosphatase, bacterial	NA	NA	NA	NA	NA
AXI16488.1|760346_760745_-	transcriptional regulator	NA	NA	NA	NA	NA
AXI16489.1|760741_761224_-	diguanylate cyclase	NA	NA	NA	NA	NA
AXI16490.1|761548_762223_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
AXI16491.1|762337_762673_-	hypothetical protein	NA	NA	NA	NA	NA
AXI16492.1|762865_763219_-	6-carboxytetrahydropterin synthase QueD	NA	NA	NA	NA	NA
AXI16493.1|763180_763360_+	GTP-binding protein	NA	NA	NA	NA	NA
AXI16494.1|763631_765014_-	RNA helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	36.3	1.4e-55
AXI16495.1|765106_765232_+	fumarylacetoacetate hydrolase	NA	NA	NA	NA	NA
AXI19509.1|765393_766383_+	2-keto-4-pentenoate hydratase	NA	NA	NA	NA	NA
AXI16496.1|766426_767053_+	maleylacetoacetate isomerase	NA	NA	NA	NA	NA
AXI16497.1|767391_768531_-	type IV pili twitching motility protein PilT	NA	NA	NA	NA	NA
AXI16498.1|768623_769007_+	hypothetical protein	NA	NA	NA	NA	NA
AXI16499.1|769003_769894_+	hypothetical protein	NA	NA	NA	NA	NA
AXI16500.1|770235_770454_+	hypothetical protein	NA	NA	NA	NA	NA
AXI19510.1|770695_772066_+	cystathionine beta-synthase	NA	A0A1X9I5F1	Streptococcus_phage	38.8	2.6e-49
AXI16501.1|772156_773350_+	cystathionine beta-lyase	NA	NA	NA	NA	NA
AXI16502.1|773396_774197_+	methyltransferase	NA	H8ZJI6	Ostreococcus_tauri_virus	28.0	3.5e-06
AXI16503.1|774231_775308_+	NAD-dependent dehydratase	NA	A0A1V0SG19	Hokovirus	21.8	4.9e-11
AXI16504.1|776339_777266_+	glycosyltransferase	NA	NA	NA	NA	NA
AXI16505.1|777286_777577_+	hypothetical protein	NA	NA	NA	NA	NA
AXI16506.1|777567_778731_+	glycosyl transferase	NA	NA	NA	NA	NA
AXI16507.1|778736_779789_+	acyltransferase	NA	A9YX16	Burkholderia_phage	33.9	1.5e-41
AXI16508.1|779788_781195_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AXI19511.1|781510_782695_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	45.4	1.0e-41
AXI16509.1|783224_784538_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.6	3.8e-13
AXI16510.1|784527_785346_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
AXI16511.1|785568_786510_-	electron transfer flavoprotein subunit alpha/FixB family protein	NA	NA	NA	NA	NA
AXI16512.1|786509_787256_-	EtfB protein	NA	NA	NA	NA	NA
AXI19512.1|787481_788537_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	48.0	4.3e-84
AXI16513.1|788592_789480_+	glucose-1-phosphate thymidylyltransferase	NA	I7I009	Enterobacteria_phage	58.2	2.2e-94
AXI16514.1|789476_790034_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	47.5	2.3e-44
AXI16515.1|790030_790939_+	NAD(P)-dependent oxidoreductase	NA	I7HXC9	Enterobacteria_phage	35.1	1.8e-27
AXI16516.1|791055_792459_-	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	29.6	2.5e-47
AXI16517.1|792505_793852_-	phosphomannomutase/phosphoglucomutase	NA	A0A127AWJ1	Bacillus_phage	26.9	2.6e-33
AXI16518.1|793985_794717_+	succinyl-CoA--3-ketoacid-CoA transferase	NA	NA	NA	NA	NA
AXI16519.1|794716_795346_+	succinyl-CoA--3-ketoacid-CoA transferase	NA	NA	NA	NA	NA
AXI16520.1|795449_796418_+|transposase	IS5 family transposase ISXo1	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
AXI16521.1|796563_798651_-	hypothetical protein	NA	NA	NA	NA	NA
AXI19513.1|798647_800297_-	electron transfer flavoprotein-ubiquinone oxidoreductase	NA	NA	NA	NA	NA
AXI16522.1|800412_801021_+	alpha-ketoglutarate-dependent dioxygenase AlkB	NA	A0A2K9L0M4	Tupanvirus	31.4	1.8e-23
AXI16523.1|801414_801645_+	hypothetical protein	NA	NA	NA	NA	NA
AXI16524.1|801571_802216_-	ABC transporter	NA	NA	NA	NA	NA
AXI16525.1|802212_803139_-	MCE family protein	NA	NA	NA	NA	NA
AXI16526.1|803141_803984_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	30.1	9.1e-13
AXI16527.1|804069_805182_-	ABC transporter permease	NA	NA	NA	NA	NA
AXI16528.1|805351_806599_+	hypothetical protein	NA	NA	NA	NA	NA
AXI16529.1|806660_807122_-	DNA-binding protein	NA	NA	NA	NA	NA
AXI16530.1|807264_808959_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
AXI16531.1|809070_809475_-	DUF4124 domain-containing protein	NA	NA	NA	NA	NA
AXI16532.1|809606_810380_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
AXI16533.1|810390_810858_+	alanine acetyltransferase	NA	NA	NA	NA	NA
AXI19514.1|810863_811337_+	ribosomal-protein-alanine N-acetyltransferase	NA	NA	NA	NA	NA
AXI19515.1|811763_813215_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AXI19516.1|813318_814692_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AXI16534.1|814904_815873_-|transposase	IS5/IS1182 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	9.6e-99
AXI16535.1|816022_817405_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AXI19517.1|817574_819620_+	lytic murein transglycosylase	NA	A0A0H3V0Q1	Geobacillus_virus	36.7	8.2e-15
AXI16536.1|822516_823314_+|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
AXI16537.1|823966_824281_-	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AXI16538.1|824467_825569_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	40.7	1.6e-41
AXI16539.1|825468_826011_-	hypothetical protein	NA	NA	NA	NA	NA
AXI16540.1|826195_826498_-	hypothetical protein	NA	NA	NA	NA	NA
AXI16541.1|826505_829448_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	34.6	3.2e-129
AXI16542.1|829655_830081_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
AXI16543.1|830121_830427_-	hypothetical protein	NA	NA	NA	NA	NA
AXI16544.1|830426_831899_-	cytosol aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	37.2	6.2e-49
AXI16545.1|832006_833089_+	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
AXI19518.1|833085_834192_+	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
AXI16546.1|834606_835074_-	RDD family protein	NA	NA	NA	NA	NA
AXI19519.1|835500_836472_+	site-specific tyrosine recombinase XerD	NA	G1JX48	Mycobacterium_phage	27.9	6.4e-18
AXI16547.1|836925_837723_+	hypothetical protein	NA	NA	NA	NA	NA
AXI19520.1|837962_838229_-	hypothetical protein	NA	NA	NA	NA	NA
AXI16548.1|838121_842174_+	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	56.9	7.5e-121
AXI16549.1|842431_842695_+	hypothetical protein	NA	NA	NA	NA	NA
AXI16550.1|843151_846949_+	hypothetical protein	NA	NA	NA	NA	NA
AXI19521.1|848447_849404_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	34.9	2.4e-41
>prophage 8
CP021788	Xanthomonas oryzae pv. oryzae strain PXO61 chromosome, complete genome	4980838	874677	935593	4980838	transposase,protease	Ralstonia_phage(18.18%)	48	NA	NA
AXI16570.1|874677_875646_+|transposase	IS5 family transposase ISXo1	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
AXI16571.1|877384_877675_-	CRISPR-associated endonuclease Cas2	NA	NA	NA	NA	NA
AXI16572.1|877689_878724_-	subtype I-C CRISPR-associated endonuclease Cas1	NA	NA	NA	NA	NA
AXI16573.1|878726_879359_-	CRISPR-associated protein Cas4	NA	NA	NA	NA	NA
AXI16574.1|879378_880245_-	type I-C CRISPR-associated protein Cas7/Csd2	NA	NA	NA	NA	NA
AXI16575.1|880241_882086_-	type I-C CRISPR-associated protein Cas8c/Csd1	NA	NA	NA	NA	NA
AXI16576.1|882082_882757_-	type I-C CRISPR-associated protein Cas5	NA	NA	NA	NA	NA
AXI16577.1|882884_885176_-	CRISPR-associated helicase/endonuclease Cas3	NA	NA	NA	NA	NA
AXI16578.1|885254_886253_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
AXI16579.1|886643_887219_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
AXI16580.1|887331_887841_+	hypothetical protein	NA	NA	NA	NA	NA
AXI16581.1|887939_888134_+	50S ribosomal protein L32	NA	NA	NA	NA	NA
AXI16582.1|888223_889201_+	3-oxoacyl-ACP synthase III	NA	NA	NA	NA	NA
AXI16583.1|889430_889871_+	MEKHLA domain-containing protein	NA	NA	NA	NA	NA
AXI16584.1|890148_891093_+	malonyl CoA-acyl carrier protein transacylase	NA	NA	NA	NA	NA
AXI16585.1|891175_891919_+	beta-ketoacyl-ACP reductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	29.7	5.2e-12
AXI16586.1|892123_892363_+	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	44.6	5.9e-10
AXI16587.1|892504_893740_+	beta-ketoacyl-[acyl-carrier-protein] synthase II	NA	NA	NA	NA	NA
AXI16588.1|893910_895266_+	aminodeoxychorismate synthase, component I	NA	NA	NA	NA	NA
AXI16589.1|895326_896400_+	aminodeoxychorismate lyase	NA	NA	NA	NA	NA
AXI16590.1|896396_897356_+	DNA polymerase III subunit delta'	NA	NA	NA	NA	NA
AXI16591.1|897352_897706_+	pilus assembly protein PilZ	NA	NA	NA	NA	NA
AXI19523.1|899552_899879_+	hypothetical protein	NA	NA	NA	NA	NA
AXI16592.1|900114_901713_-	propionate catabolism operon regulatory protein PrpR	NA	NA	NA	NA	NA
AXI16593.1|901858_902755_+	methylisocitrate lyase	NA	NA	NA	NA	NA
AXI16594.1|902830_903985_+	2-methylcitrate synthase	NA	NA	NA	NA	NA
AXI16595.1|904179_906771_+	Fe/S-dependent 2-methylisocitrate dehydratase AcnD	NA	NA	NA	NA	NA
AXI16596.1|907314_907512_-	hypothetical protein	NA	NA	NA	NA	NA
AXI16597.1|907503_908703_+	2-methylaconitate cis-trans isomerase PrpF	NA	NA	NA	NA	NA
AXI16598.1|909202_911419_+	TonB-dependent receptor	NA	NA	NA	NA	NA
AXI16599.1|911497_912496_+	nucleoside hydrolase	NA	NA	NA	NA	NA
AXI16600.1|913767_916755_+	TonB-dependent receptor	NA	NA	NA	NA	NA
AXI16601.1|916929_917877_+	glycerophosphodiester phosphodiesterase	NA	M1HTS7	Paramecium_bursaria_Chlorella_virus	28.5	4.9e-07
AXI16602.1|918375_918912_+	hypothetical protein	NA	NA	NA	NA	NA
AXI16603.1|918871_920302_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AXI16604.1|920646_921609_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.1	2.2e-42
AXI16605.1|921742_922303_-	bacterioferritin	NA	NA	NA	NA	NA
AXI16606.1|922345_922828_-	peroxiredoxin	NA	A0A1D8KSL1	Synechococcus_phage	36.2	3.1e-21
AXI16607.1|922990_923467_+	heat-shock protein	NA	NA	NA	NA	NA
AXI16608.1|923877_924777_+	cytochrome C biogenesis protein	NA	A0A2L0UZR4	Agrobacterium_phage	27.7	5.9e-18
AXI16609.1|925016_925403_+	response regulator	NA	W8CYM9	Bacillus_phage	31.8	9.6e-10
AXI16610.1|926032_927160_+	HflK protein	NA	NA	NA	NA	NA
AXI16611.1|927159_928023_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
AXI16612.1|928316_928502_+	hypothetical protein	NA	NA	NA	NA	NA
AXI16613.1|928839_930132_+	adenylosuccinate synthetase	NA	W5S5V7	Pithovirus	37.5	8.4e-74
AXI16614.1|930457_933130_+	aminopeptidase	NA	A0A0P0IY26	Acinetobacter_phage	28.0	2.6e-77
AXI16615.1|933323_934106_-	hypothetical protein	NA	NA	NA	NA	NA
AXI19524.1|934216_935593_-|transposase	IS5/IS1182 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	54.4	5.0e-77
>prophage 9
CP021788	Xanthomonas oryzae pv. oryzae strain PXO61 chromosome, complete genome	4980838	974280	1093820	4980838	integrase,transposase,protease	Ralstonia_phage(23.08%)	92	1026017:1026035	1094947:1094965
AXI16642.1|974280_975279_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
AXI16643.1|975733_976225_+	hypothetical protein	NA	NA	NA	NA	NA
AXI16644.1|977416_977767_-	hypothetical protein	NA	NA	NA	NA	NA
AXI16645.1|977903_979160_-	6-phosphofructokinase	NA	NA	NA	NA	NA
AXI16646.1|979319_979883_+	adenylate kinase	NA	A0A1B4XWI3	Tenacibaculum_phage	31.4	3.6e-13
AXI19526.1|980249_981608_+	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
AXI16647.1|981607_982204_+|protease	ATP-dependent protease	protease	NA	NA	NA	NA
AXI16648.1|982350_983235_+	hypothetical protein	NA	NA	NA	NA	NA
AXI16649.1|985216_985831_+	glutathione S-transferase	NA	NA	NA	NA	NA
AXI16650.1|985913_986900_-	malate dehydrogenase	NA	NA	NA	NA	NA
AXI16651.1|987015_987510_-	peptidyl-prolyl cis-trans isomerase	NA	A0A1V0SCU1	Indivirus	52.3	5.5e-26
AXI16652.1|987754_989584_+	translational GTPase TypA	NA	NA	NA	NA	NA
AXI16653.1|989602_990073_+	hypothetical protein	NA	NA	NA	NA	NA
AXI16654.1|990995_992123_-	hypothetical protein	NA	NA	NA	NA	NA
AXI16655.1|992223_993606_-	3-deoxy-7-phosphoheptulonate synthase class II	NA	NA	NA	NA	NA
AXI16656.1|993853_995977_+	TonB-dependent receptor	NA	NA	NA	NA	NA
AXI16657.1|996505_997024_-	disulfide bond formation protein B	NA	NA	NA	NA	NA
AXI16658.1|998893_999295_+	hypothetical protein	NA	K4ICS3	Acidithiobacillus_phage	42.7	2.2e-17
AXI16659.1|999347_1000583_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
AXI16660.1|1001196_1002087_-	hypothetical protein	NA	NA	NA	NA	NA
AXI16661.1|1002176_1002317_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
AXI16662.1|1003144_1003447_-	hypothetical protein	NA	K4I1H9	Acidithiobacillus_phage	64.3	1.0e-19
AXI16663.1|1003791_1004760_+|transposase	IS5/IS1182 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	5.6e-99
AXI16664.1|1006739_1007033_+	hypothetical protein	NA	NA	NA	NA	NA
AXI16665.1|1007036_1008272_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
AXI16666.1|1009254_1010706_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AXI19527.1|1011319_1012243_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	33.1	1.3e-36
AXI16667.1|1013272_1014271_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
AXI16668.1|1014572_1016150_+	chlamydia polymorphic membrane family protein	NA	NA	NA	NA	NA
AXI19528.1|1016217_1016796_-	hypothetical protein	NA	NA	NA	NA	NA
AXI16669.1|1016561_1017008_-|transposase	transposase	transposase	NA	NA	NA	NA
AXI16670.1|1019649_1020618_-|transposase	IS5/IS1182 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
AXI16671.1|1020878_1021340_-	cell wall hydrolase	NA	NA	NA	NA	NA
AXI16672.1|1021888_1022131_-	glycerophosphodiester phosphodiesterase	NA	NA	NA	NA	NA
AXI19529.1|1022124_1022703_-	hypothetical protein	NA	NA	NA	NA	NA
AXI16673.1|1022468_1022915_-|transposase	transposase	transposase	NA	NA	NA	NA
AXI16674.1|1022920_1023652_-	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	37.5	1.1e-06
AXI16675.1|1025471_1026224_+|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
1026017:1026035	attL	GCGACAGCGGCTACACCGG	NA	NA	NA	NA
AXI16676.1|1026225_1027224_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
AXI16677.1|1027454_1028462_+	isocitrate dehydrogenase	NA	NA	NA	NA	NA
AXI16678.1|1028605_1029367_-	hypothetical protein	NA	NA	NA	NA	NA
AXI16679.1|1030006_1030309_-	hypothetical protein	NA	NA	NA	NA	NA
AXI16680.1|1031765_1032074_+	hypothetical protein	NA	K4I1H9	Acidithiobacillus_phage	63.1	1.4e-16
AXI16681.1|1032684_1033977_+	trigger factor	NA	NA	NA	NA	NA
AXI16682.1|1034069_1034696_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	57.4	1.0e-56
AXI16683.1|1034820_1036107_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	59.9	9.0e-137
AXI16684.1|1036250_1038722_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.2	1.7e-224
AXI16685.1|1038935_1039208_+	HU family DNA-binding protein	NA	A7KV42	Bacillus_phage	64.0	2.2e-21
AXI16686.1|1040039_1042010_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
AXI16687.1|1042715_1043894_-	lytic transglycosylase	NA	NA	NA	NA	NA
AXI16688.1|1043890_1044658_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
AXI16689.1|1044670_1045327_+	hypothetical protein	NA	NA	NA	NA	NA
AXI16690.1|1045354_1045807_+	ribonuclease HI	NA	A0A1Q2U2R0	Vibrio_phage	55.4	2.8e-40
AXI16691.1|1045815_1046550_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	40.4	8.7e-36
AXI16692.1|1046985_1047690_-	protein phosphatase	NA	NA	NA	NA	NA
AXI16693.1|1048608_1049145_-	hypothetical protein	NA	NA	NA	NA	NA
AXI16694.1|1049626_1049938_+	DNA methyltransferase	NA	B7SYF3	Stenotrophomonas_phage	71.4	2.6e-37
AXI16695.1|1050036_1050237_+	hypothetical protein	NA	NA	NA	NA	NA
AXI16696.1|1050632_1053356_+	type VI secretion protein	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	30.2	2.8e-71
AXI19530.1|1053423_1055574_+	hypothetical protein	NA	A0A077K801	Ralstonia_phage	28.2	2.0e-27
AXI16697.1|1057586_1059791_+	hypothetical protein	NA	A0A077K801	Ralstonia_phage	29.7	5.9e-19
AXI16698.1|1059787_1061482_+	hypothetical protein	NA	NA	NA	NA	NA
AXI16699.1|1061478_1061742_+	PAAR domain-containing protein	NA	A4JWV5	Burkholderia_virus	43.4	7.5e-06
AXI16700.1|1061803_1064011_+	hypothetical protein	NA	A0A077K801	Ralstonia_phage	28.2	2.0e-19
AXI16701.1|1064007_1065687_+	hypothetical protein	NA	NA	NA	NA	NA
AXI16702.1|1065683_1065947_+	PAAR domain-containing protein	NA	A4JWV5	Burkholderia_virus	43.4	7.5e-06
AXI16703.1|1066008_1066566_+	hypothetical protein	NA	NA	NA	NA	NA
AXI16704.1|1066615_1067614_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
AXI19531.1|1067712_1068399_-|integrase	integrase	integrase	A0A077KET4	Ralstonia_phage	51.8	2.3e-54
AXI16705.1|1068509_1068914_+	hypothetical protein	NA	A0A1C9C5K8	Heterosigma_akashiwo_virus	35.9	5.0e-17
AXI16706.1|1069124_1070174_-	ADP-heptose--LPS heptosyltransferase	NA	NA	NA	NA	NA
AXI16707.1|1070194_1070944_+	3-deoxy-D-manno-octulosonic acid kinase	NA	NA	NA	NA	NA
AXI16708.1|1070943_1071693_+	MBL fold metallo-hydrolase	NA	A0A0A0RUN7	Bacillus_phage	26.0	2.4e-09
AXI16709.1|1071692_1072724_+	GTP 3',8-cyclase MoaA	NA	NA	NA	NA	NA
AXI16710.1|1072741_1073101_+	DUF4440 domain-containing protein	NA	NA	NA	NA	NA
AXI16711.1|1073125_1073623_+	cyclic pyranopterin monophosphate synthase MoaC	NA	NA	NA	NA	NA
AXI16712.1|1073619_1073865_+	molybdopterin synthase sulfur carrier subunit	NA	NA	NA	NA	NA
AXI16713.1|1073861_1074308_+	molybdopterin-converting factor chain 2	NA	NA	NA	NA	NA
AXI16714.1|1074869_1076966_+	DNA polymerase III subunit gamma/tau	NA	E7DN81	Pneumococcus_phage	40.7	4.1e-46
AXI16715.1|1076972_1077293_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
AXI16716.1|1077390_1077984_+	recombination protein RecR	NA	NA	NA	NA	NA
AXI16717.1|1078085_1078436_+	histidine triad nucleotide-binding protein	NA	NA	NA	NA	NA
AXI16718.1|1078555_1079089_-	hypothetical protein	NA	NA	NA	NA	NA
AXI16719.1|1079085_1081038_-	hypothetical protein	NA	NA	NA	NA	NA
AXI16720.1|1081030_1081987_-	DUF58 domain-containing protein	NA	NA	NA	NA	NA
AXI16721.1|1081992_1082946_-	MoxR family ATPase	NA	NA	NA	NA	NA
AXI16722.1|1082984_1084853_+	hypothetical protein	NA	NA	NA	NA	NA
AXI16723.1|1086368_1086884_+	peptide deformylase	NA	NA	NA	NA	NA
AXI19532.1|1088631_1089378_+	cellulase	NA	NA	NA	NA	NA
AXI16724.1|1089994_1091596_-	rhamnogalacturonase B	NA	NA	NA	NA	NA
AXI16725.1|1091956_1092142_-	hypothetical protein	NA	NA	NA	NA	NA
AXI16726.1|1092584_1093820_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
1094947:1094965	attR	CCGGTGTAGCCGCTGTCGC	NA	NA	NA	NA
>prophage 10
CP021788	Xanthomonas oryzae pv. oryzae strain PXO61 chromosome, complete genome	4980838	1157638	1220046	4980838	transposase	Orpheovirus(25.0%)	54	NA	NA
AXI16777.1|1157638_1158436_+|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
AXI16778.1|1158584_1158884_+	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
AXI16779.1|1159012_1161184_+	bifunctional GTP diphosphokinase/guanosine-3',5'-bis(diphosphate) 3'-diphosphatase	NA	A0A2I2L310	Orpheovirus	38.8	2.8e-13
AXI16780.1|1161263_1161644_+	RidA family protein	NA	NA	NA	NA	NA
AXI16781.1|1161664_1163818_+	DNA helicase RecG	NA	NA	NA	NA	NA
AXI16782.1|1163943_1164882_+	nucleoside hydrolase	NA	NA	NA	NA	NA
AXI16783.1|1164953_1165196_+	50S ribosomal protein L31 type B	NA	NA	NA	NA	NA
AXI19541.1|1165409_1166699_+	citrate (Si)-synthase	NA	NA	NA	NA	NA
AXI16784.1|1167076_1167727_-	hypothetical protein	NA	NA	NA	NA	NA
AXI16785.1|1168036_1170559_-	peptidase	NA	NA	NA	NA	NA
AXI16786.1|1170681_1171740_+	pilus assembly protein PilM	NA	NA	NA	NA	NA
AXI16787.1|1171739_1172498_+	fimbrial protein	NA	NA	NA	NA	NA
AXI16788.1|1172494_1173160_+	fimbrial protein	NA	NA	NA	NA	NA
AXI16789.1|1173156_1173690_+	fimbrial protein	NA	NA	NA	NA	NA
AXI16790.1|1173709_1175659_+	type IV pilus secretin PilQ	NA	NA	NA	NA	NA
AXI16791.1|1175729_1176528_-|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
AXI16792.1|1176670_1177906_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
AXI16793.1|1178820_1179345_-	hypothetical protein	NA	NA	NA	NA	NA
AXI16794.1|1179633_1180653_+	MoxR family ATPase	NA	NA	NA	NA	NA
AXI16795.1|1180673_1181636_+	DUF58 domain-containing protein	NA	NA	NA	NA	NA
AXI16796.1|1181638_1182100_+	DUF4381 domain-containing protein	NA	NA	NA	NA	NA
AXI16797.1|1182096_1183104_+	hypothetical protein	NA	NA	NA	NA	NA
AXI16798.1|1183100_1184903_+	hypothetical protein	NA	NA	NA	NA	NA
AXI16799.1|1184899_1186657_+	hypothetical protein	NA	NA	NA	NA	NA
AXI16800.1|1186952_1187270_+	hypothetical protein	NA	NA	NA	NA	NA
AXI16801.1|1187467_1188748_+	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
AXI16802.1|1188967_1190968_+	transketolase	NA	NA	NA	NA	NA
AXI16803.1|1191218_1191773_+	outer membrane receptor protein	NA	NA	NA	NA	NA
AXI16804.1|1191786_1192503_-	endopeptidase	NA	A0A0M5M794	Arthrobacter_phage	34.2	2.7e-05
AXI16805.1|1192505_1193498_-	murein L,D-transpeptidase	NA	NA	NA	NA	NA
AXI16806.1|1193817_1196532_-	TonB-dependent receptor	NA	NA	NA	NA	NA
AXI16807.1|1196651_1197827_-	hypothetical protein	NA	NA	NA	NA	NA
AXI16808.1|1197961_1199920_-	acetyl-CoA hydrolase	NA	NA	NA	NA	NA
AXI19542.1|1200095_1200743_+	thermostable hemolysin	NA	NA	NA	NA	NA
AXI16809.1|1200739_1202239_+	long-chain acyl-CoA synthetase	NA	NA	NA	NA	NA
AXI16810.1|1202235_1202910_+	biliverdin-producing heme oxygenase	NA	NA	NA	NA	NA
AXI16811.1|1202909_1203749_+	short chain dehydrogenase	NA	NA	NA	NA	NA
AXI16812.1|1203729_1203993_+	hypothetical protein	NA	NA	NA	NA	NA
AXI16813.1|1204415_1205114_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	35.0	9.8e-29
AXI19543.1|1205131_1206493_+	two-component sensor histidine kinase	NA	NA	NA	NA	NA
AXI16814.1|1206592_1206958_+	transcriptional regulator	NA	NA	NA	NA	NA
AXI16815.1|1206947_1208264_+	energy transducer TonB	NA	NA	NA	NA	NA
AXI16816.1|1208260_1208845_+	hypothetical protein	NA	NA	NA	NA	NA
AXI16817.1|1209187_1209802_-	molybdenum ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.0	2.1e-19
AXI16818.1|1209801_1210494_-	molybdate ABC transporter permease	NA	NA	NA	NA	NA
AXI16819.1|1210504_1211281_-	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AXI19544.1|1211351_1212182_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
AXI16820.1|1212195_1212969_-	endonuclease	NA	NA	NA	NA	NA
AXI16821.1|1212979_1213177_+	hypothetical protein	NA	NA	NA	NA	NA
AXI16822.1|1216187_1216484_+	hypothetical protein	NA	NA	NA	NA	NA
AXI19545.1|1216839_1217841_+	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
AXI16823.1|1218201_1218648_+|transposase	transposase	transposase	NA	NA	NA	NA
AXI19546.1|1218413_1218992_+|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
AXI16824.1|1219047_1220046_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
>prophage 11
CP021788	Xanthomonas oryzae pv. oryzae strain PXO61 chromosome, complete genome	4980838	1224623	1292803	4980838	transposase,protease	Xanthomonas_phage(46.15%)	54	NA	NA
AXI16827.1|1224623_1225607_-|transposase	IS5/IS1182 family transposase	transposase	A0A077K814	Ralstonia_phage	60.8	2.2e-98
AXI16828.1|1225780_1227868_-	hypothetical protein	NA	NA	NA	NA	NA
AXI16829.1|1228019_1228679_+	serine/threonine protein kinase	NA	NA	NA	NA	NA
AXI16830.1|1228759_1229557_+|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
AXI16831.1|1229579_1229759_+	hypothetical protein	NA	NA	NA	NA	NA
AXI16832.1|1229777_1230182_+	hypothetical protein	NA	NA	NA	NA	NA
AXI16833.1|1230215_1230575_+	hypothetical protein	NA	NA	NA	NA	NA
AXI16834.1|1230818_1231691_-	ion transporter	NA	NA	NA	NA	NA
AXI16835.1|1231763_1232990_+	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	25.1	4.0e-17
AXI16836.1|1233234_1233852_-	hydrolase	NA	NA	NA	NA	NA
AXI16837.1|1235412_1236996_+	flavin monoamine oxidase	NA	NA	NA	NA	NA
AXI16838.1|1236992_1237418_+	cytochrome C biogenesis protein CcdA	NA	NA	NA	NA	NA
AXI16839.1|1237442_1237946_+	hypothetical protein	NA	NA	NA	NA	NA
AXI16840.1|1239388_1239838_+	azurin	NA	NA	NA	NA	NA
AXI16841.1|1243228_1244518_-	glutamate-1-semialdehyde 2,1-aminomutase	NA	NA	NA	NA	NA
AXI16842.1|1246528_1247983_+	hypothetical protein	NA	NA	NA	NA	NA
AXI16843.1|1248479_1249349_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.2	1.4e-29
AXI16844.1|1249370_1250042_-	hypothetical protein	NA	A0A0P0I4A4	Acinetobacter_phage	38.9	5.2e-27
AXI16845.1|1250038_1250260_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
AXI16846.1|1253663_1253963_-	hypothetical protein	NA	A0A1W6DY99	Xanthomonas_phage	91.3	1.9e-45
AXI16847.1|1253966_1254161_-	hypothetical protein	NA	A0A1W6DXV7	Xanthomonas_phage	80.6	2.5e-19
AXI16848.1|1256126_1256327_-	hypothetical protein	NA	A0A1D6ZIV0	Xanthomonas_phage	97.4	1.9e-17
AXI16849.1|1256330_1256525_-	hypothetical protein	NA	A0A1W6DXV7	Xanthomonas_phage	79.0	1.3e-18
AXI16850.1|1261467_1261767_-	hypothetical protein	NA	A0A1W6DY99	Xanthomonas_phage	92.4	6.4e-46
AXI16851.1|1261770_1261965_-	hypothetical protein	NA	A0A1W6DXV7	Xanthomonas_phage	82.3	3.9e-20
AXI16852.1|1266160_1266865_-	C-type cytochrome biogenesis protein	NA	NA	NA	NA	NA
AXI19549.1|1266864_1267362_-	cytochrome c-type biogenesis protein CcmH	NA	NA	NA	NA	NA
AXI16853.1|1267361_1267904_-	thiol:disulfide interchange protein	NA	NA	NA	NA	NA
AXI16854.1|1267900_1269889_-	c-type cytochrome biogenesis protein CcmF	NA	NA	NA	NA	NA
AXI16855.1|1269952_1270423_-	cytochrome c-type biogenesis protein CcmE 1	NA	NA	NA	NA	NA
AXI16856.1|1270419_1270626_-	heme exporter protein CcmD	NA	NA	NA	NA	NA
AXI16857.1|1270622_1271381_-	heme ABC transporter permease	NA	NA	NA	NA	NA
AXI16858.1|1271391_1272717_-|protease	serine protease	protease	A0A217EQY2	Bacillus_phage	39.2	2.4e-23
AXI16859.1|1272713_1273475_-	hypothetical protein	NA	NA	NA	NA	NA
AXI19550.1|1273366_1273948_-	RNA polymerase subunit sigma-70	NA	NA	NA	NA	NA
AXI19551.1|1274011_1274800_-	hypothetical protein	NA	NA	NA	NA	NA
AXI16860.1|1275242_1275635_-	cytochrome C	NA	NA	NA	NA	NA
AXI16861.1|1275660_1277001_-	cytochrome C	NA	NA	NA	NA	NA
AXI19552.1|1277084_1277615_-	cytochrome-c oxidase	NA	NA	NA	NA	NA
AXI16862.1|1278009_1278441_+	dTDP-6-deoxy-3,4-keto-hexulose isomerase	NA	NA	NA	NA	NA
AXI16863.1|1278437_1279109_+	sugar O-acyltransferase	NA	NA	NA	NA	NA
AXI16864.1|1279112_1280066_+	hypothetical protein	NA	NA	NA	NA	NA
AXI16865.1|1280052_1280985_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AXI16866.1|1280984_1282097_+	aminotransferase	NA	E5ES42	Bathycoccus_sp._RCC1105_virus	28.4	8.3e-30
AXI16867.1|1282093_1283347_+	O-antigen translocase	NA	NA	NA	NA	NA
AXI16868.1|1283343_1284294_+	glycosyl transferase	NA	NA	NA	NA	NA
AXI19553.1|1284290_1285424_+	hypothetical protein	NA	NA	NA	NA	NA
AXI16869.1|1285469_1286321_+	chain-length determining protein	NA	NA	NA	NA	NA
AXI16870.1|1286601_1287444_+	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AXI19554.1|1287456_1288692_+	amidohydrolase	NA	NA	NA	NA	NA
AXI16871.1|1288688_1289387_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AXI16872.1|1289508_1290639_+	glycosyl transferase	NA	NA	NA	NA	NA
AXI16873.1|1290635_1291748_+	hexosyltransferase	NA	NA	NA	NA	NA
AXI16874.1|1291846_1292803_-|transposase	IS30 family transposase IS1112a	transposase	Q9MBM9	Staphylococcus_prophage	35.2	2.1e-42
>prophage 12
CP021788	Xanthomonas oryzae pv. oryzae strain PXO61 chromosome, complete genome	4980838	1333033	1344808	4980838	tRNA	Pseudomonas_phage(22.22%)	13	NA	NA
AXI19563.1|1333033_1334710_+	2-polyprenylphenol 6-hydroxylase	NA	E5EQ95	Micromonas_sp._RCC1109_virus	27.2	3.3e-38
AXI16905.1|1334798_1335440_+	LexA repressor 2	NA	A0A1W6JNS2	Morganella_phage	40.2	2.4e-13
AXI16906.1|1335612_1336647_+	DNA recombination/repair protein RecA	NA	A0A0S2MVG1	Bacillus_phage	60.7	6.2e-112
AXI16907.1|1336695_1336899_-	hypothetical protein	NA	NA	NA	NA	NA
AXI16908.1|1336949_1337438_+	regulatory protein RecX	NA	NA	NA	NA	NA
AXI16909.1|1337539_1340188_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	39.6	3.7e-84
AXI16910.1|1340327_1340540_+	carbon storage regulator	NA	J7I430	Pseudomonas_phage	76.5	1.3e-13
AXI16911.1|1341250_1341670_+	helix-turn-helix domain-containing protein	NA	A0A1W6JTD5	Pseudomonas_phage	57.4	2.1e-34
AXI19564.1|1342057_1342357_+	hypothetical protein	NA	NA	NA	NA	NA
AXI16912.1|1342542_1343238_+	DNA helicase	NA	E5DV83	Deep-sea_thermophilic_phage	41.0	5.6e-16
AXI16913.1|1343242_1343992_+	isopentenyl transferase	NA	NA	NA	NA	NA
AXI16914.1|1344235_1344466_+	hypothetical protein	NA	D5LH07	Escherichia_phage	63.8	4.7e-20
AXI16915.1|1344508_1344808_+	endolysin	NA	A0A1W6JT17	Escherichia_phage	66.7	1.5e-15
>prophage 13
CP021788	Xanthomonas oryzae pv. oryzae strain PXO61 chromosome, complete genome	4980838	1392980	1472509	4980838	tRNA,transposase	uncultured_Caudovirales_phage(43.75%)	57	NA	NA
AXI16956.1|1392980_1393682_-|transposase	transposase	transposase	A9YX10	Burkholderia_phage	32.9	1.9e-16
AXI16957.1|1396488_1397436_+	DNA-binding protein	NA	NA	NA	NA	NA
AXI16958.1|1397759_1398815_+	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	39.7	8.8e-05
AXI16959.1|1399018_1400536_+|tRNA	lysine--tRNA ligase	tRNA	A0A2K9KZX5	Tupanvirus	39.9	3.8e-86
AXI16960.1|1400677_1401814_+	two-component system response regulator	NA	NA	NA	NA	NA
AXI16961.1|1401815_1402154_+	hypothetical protein	NA	NA	NA	NA	NA
AXI16962.1|1402178_1404356_+	hybrid sensor histidine kinase/response regulator	NA	A0A1V0SGX0	Hokovirus	32.8	3.0e-47
AXI16963.1|1404367_1405237_-	enoyl-CoA hydratase	NA	NA	NA	NA	NA
AXI16964.1|1405413_1407096_-	long-chain fatty acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	26.8	7.1e-33
AXI16965.1|1407745_1410514_-	aconitate hydratase	NA	NA	NA	NA	NA
AXI16966.1|1410661_1410910_+	AbrB family transcriptional regulator	NA	NA	NA	NA	NA
AXI16967.1|1410906_1411317_+	VapC toxin family PIN domain ribonuclease	NA	NA	NA	NA	NA
AXI16968.1|1411382_1413974_+	aconitate hydratase B	NA	NA	NA	NA	NA
AXI16969.1|1414327_1415143_+	2-succinyl-6-hydroxy-2, 4-cyclohexadiene-1-carboxylate synthase	NA	NA	NA	NA	NA
AXI19571.1|1415798_1418042_-	bifunctional diguanylate cyclase/phosphodiesterase	NA	NA	NA	NA	NA
AXI16970.1|1418150_1419227_-	chemotaxis response regulator protein-glutamate methylesterase	NA	NA	NA	NA	NA
AXI16971.1|1419223_1419820_-	chemoreceptor glutamine deamidase CheD	NA	NA	NA	NA	NA
AXI16972.1|1419816_1420683_-	chemotaxis protein CheR	NA	NA	NA	NA	NA
AXI16973.1|1420934_1423334_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	58.3	7.9e-09
AXI19572.1|1423412_1423757_-	hypothetical protein	NA	NA	NA	NA	NA
AXI16974.1|1423976_1424775_-|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
AXI16975.1|1425623_1426106_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
AXI16976.1|1426241_1427039_-	pilus assembly protein PilZ	NA	NA	NA	NA	NA
AXI16977.1|1427108_1427318_-	hypothetical protein	NA	NA	NA	NA	NA
AXI16978.1|1427996_1430258_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	54.5	1.3e-10
AXI16979.1|1430651_1432913_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.9	9.3e-12
AXI19573.1|1436265_1438377_-	chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	41.2	4.6e-13
AXI16980.1|1439105_1441352_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	41.2	2.9e-13
AXI16981.1|1441592_1442591_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
AXI16982.1|1443054_1445397_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	63.2	4.5e-09
AXI16983.1|1445410_1446172_-	transporter	NA	NA	NA	NA	NA
AXI16984.1|1446487_1447177_-	chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	36.2	2.2e-12
AXI16985.1|1448925_1449138_+	hypothetical protein	NA	NA	NA	NA	NA
AXI16986.1|1449277_1451287_-	chemotaxis protein CheA	NA	NA	NA	NA	NA
AXI16987.1|1451320_1451686_-	response regulator	NA	W8CYM9	Bacillus_phage	39.3	2.7e-14
AXI16988.1|1451682_1451991_-	anti-anti-sigma factor	NA	NA	NA	NA	NA
AXI16989.1|1452091_1453114_-	chemotaxis protein	NA	NA	NA	NA	NA
AXI16990.1|1453110_1453893_-	ParA family protein	NA	Q8JL10	Natrialba_phage	37.7	1.0e-13
AXI16991.1|1453894_1454869_-	flagellar motor protein MotD	NA	NA	NA	NA	NA
AXI16992.1|1454875_1455616_-	flagellar motor protein	NA	NA	NA	NA	NA
AXI16993.1|1455704_1456058_-	hypothetical protein	NA	NA	NA	NA	NA
AXI16994.1|1456054_1456546_-	TonB-dependent receptor	NA	NA	NA	NA	NA
AXI16995.1|1456592_1456985_-	TonB-dependent receptor	NA	NA	NA	NA	NA
AXI16996.1|1457136_1457844_-	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	51.2	8.4e-52
AXI16997.1|1457919_1458120_-	hypothetical protein	NA	NA	NA	NA	NA
AXI16998.1|1458268_1460074_-	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
AXI16999.1|1460328_1460781_-	hypothetical protein	NA	NA	NA	NA	NA
AXI17000.1|1461275_1461464_+	hypothetical protein	NA	NA	NA	NA	NA
AXI19574.1|1461830_1464872_+	TonB-dependent receptor	NA	NA	NA	NA	NA
AXI17001.1|1466337_1467306_+|transposase	IS5/IS1182 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
AXI17002.1|1467805_1468441_-	hypothetical protein	NA	NA	NA	NA	NA
AXI17003.1|1468502_1468880_-	hypothetical protein	NA	NA	NA	NA	NA
AXI17004.1|1468878_1469130_+	hypothetical protein	NA	NA	NA	NA	NA
AXI17005.1|1469126_1469543_+	hypothetical protein	NA	NA	NA	NA	NA
AXI17006.1|1470459_1470675_-	hypothetical protein	NA	NA	NA	NA	NA
AXI17007.1|1470647_1472066_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AXI17008.1|1472194_1472509_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 14
CP021788	Xanthomonas oryzae pv. oryzae strain PXO61 chromosome, complete genome	4980838	1499215	1586789	4980838	tRNA,transposase	Ralstonia_phage(16.67%)	54	NA	NA
AXI17021.1|1499215_1500451_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
AXI17022.1|1500811_1501780_-|transposase	IS5 family transposase ISXo1	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
AXI19576.1|1502446_1503583_-	carbohydrate porin	NA	NA	NA	NA	NA
AXI17023.1|1503901_1505644_-	PTS fructose transporter subunit EIIBC	NA	NA	NA	NA	NA
AXI17024.1|1505802_1506759_-	1-phosphofructokinase	NA	NA	NA	NA	NA
AXI17025.1|1506755_1509272_-	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	28.5	6.3e-09
AXI17026.1|1509432_1510428_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
AXI17027.1|1511101_1512100_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
AXI17028.1|1513075_1516246_-	multidrug efflux RND transporter permease subunit	NA	NA	NA	NA	NA
AXI17029.1|1516258_1517563_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AXI17030.1|1517577_1518237_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AXI17031.1|1523804_1524044_+	hypothetical protein	NA	NA	NA	NA	NA
AXI17032.1|1523985_1524969_+|transposase	IS5/IS1182 family transposase	transposase	A0A077K814	Ralstonia_phage	61.5	1.5e-99
AXI17033.1|1525093_1526080_-	two-component system response regulator	NA	W8CYM9	Bacillus_phage	26.8	2.8e-05
AXI17034.1|1526113_1530208_-	hybrid sensor histidine kinase/response regulator	NA	A0A1V0SGX0	Hokovirus	28.4	1.1e-55
AXI17035.1|1530349_1531654_-	DUF445 domain-containing protein	NA	NA	NA	NA	NA
AXI17036.1|1531824_1532679_-	plasmid replication/partition related protein	NA	A0A1B1INV8	uncultured_Mediterranean_phage	39.8	6.4e-14
AXI19577.1|1532845_1535983_+	hypothetical protein	NA	NA	NA	NA	NA
AXI17037.1|1536043_1537396_-	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
AXI17038.1|1537450_1537783_-	hypothetical protein	NA	NA	NA	NA	NA
AXI17039.1|1537925_1539650_+	MFS transporter	NA	NA	NA	NA	NA
AXI17040.1|1539656_1540502_+	sulfurtransferase FdhD	NA	NA	NA	NA	NA
AXI17041.1|1540498_1542847_+	CbbBc protein	NA	NA	NA	NA	NA
AXI17042.1|1542806_1543115_+	hypothetical protein	NA	NA	NA	NA	NA
AXI17043.1|1543420_1544701_+	MFS transporter	NA	NA	NA	NA	NA
AXI17044.1|1545008_1546253_-	diguanylate cyclase response regulator	NA	A0A127AWB9	Bacillus_phage	36.4	2.5e-19
AXI17045.1|1546389_1547706_-	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
AXI17046.1|1547705_1549085_-	glutamine synthetase	NA	NA	NA	NA	NA
AXI17047.1|1549992_1551378_+	glutamine synthetase	NA	NA	NA	NA	NA
AXI17048.1|1553506_1554709_+	HlyD family secretion protein	NA	NA	NA	NA	NA
AXI17049.1|1554705_1556292_+	EmrB/QacA family drug resistance transporter	NA	NA	NA	NA	NA
AXI17050.1|1556278_1557790_+	hypothetical protein	NA	NA	NA	NA	NA
AXI17051.1|1557935_1559183_+	polyamine ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	35.3	1.2e-24
AXI17052.1|1559118_1559481_+	hypothetical protein	NA	NA	NA	NA	NA
AXI19578.1|1560482_1560893_-	hypothetical protein	NA	NA	NA	NA	NA
AXI19579.1|1561147_1562512_+	succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
AXI17053.1|1562663_1563665_-	magnesium transporter CorA	NA	NA	NA	NA	NA
AXI17054.1|1563680_1564961_-	hypothetical protein	NA	NA	NA	NA	NA
AXI17055.1|1564957_1565836_-	magnesium/cobalt efflux protein	NA	NA	NA	NA	NA
AXI17056.1|1565930_1566449_-	hypothetical protein	NA	NA	NA	NA	NA
AXI17057.1|1566448_1566934_-	endoribonuclease YbeY	NA	NA	NA	NA	NA
AXI17058.1|1566988_1567651_-	hypothetical protein	NA	NA	NA	NA	NA
AXI17059.1|1568062_1569049_-	PhoH family protein	NA	W8D063	Erwinia_phage	47.7	2.5e-46
AXI17060.1|1569472_1570927_-|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
AXI17061.1|1572862_1573849_+	transglycosylase	NA	A0A0H3V0Q1	Geobacillus_virus	56.0	1.3e-29
AXI17062.1|1574378_1575023_+	ubiquinol-cytochrome c reductase iron-sulfur subunit	NA	NA	NA	NA	NA
AXI17063.1|1575022_1576282_+	cytochrome b	NA	NA	NA	NA	NA
AXI19580.1|1576289_1577033_+	cytochrome c1	NA	NA	NA	NA	NA
AXI17064.1|1577425_1578061_+	stringent starvation protein A	NA	NA	NA	NA	NA
AXI17065.1|1578139_1578580_+	stringent starvation protein B	NA	A0A1S5R3H3	Pseudomonas_phage	46.2	9.3e-25
AXI17066.1|1578612_1578939_+	hypothetical protein	NA	NA	NA	NA	NA
AXI17067.1|1579149_1579566_-	hypothetical protein	NA	NA	NA	NA	NA
AXI17068.1|1584058_1585057_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
AXI19581.1|1585604_1586789_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	45.4	1.0e-41
>prophage 15
CP021788	Xanthomonas oryzae pv. oryzae strain PXO61 chromosome, complete genome	4980838	1589794	1650608	4980838	tRNA,transposase,protease	Microcystis_phage(10.0%)	55	NA	NA
AXI17071.1|1589794_1589929_+|transposase	transposase	transposase	NA	NA	NA	NA
AXI17072.1|1590435_1590837_-	histone-like nucleoid-structuring protein	NA	NA	NA	NA	NA
AXI17073.1|1591249_1591600_+	hypothetical protein	NA	NA	NA	NA	NA
AXI17074.1|1591463_1591853_+	ATP-dependent DNA ligase	NA	NA	NA	NA	NA
AXI17075.1|1591928_1593020_-	ribonuclease D	NA	NA	NA	NA	NA
AXI17076.1|1593291_1595127_+	serine/threonine kinase	NA	A0A075BSL8	Microcystis_phage	32.9	5.6e-23
AXI17077.1|1596407_1597670_+	virulence factor	NA	NA	NA	NA	NA
AXI17078.1|1597965_1599303_-	exodeoxyribonuclease VII large subunit	NA	A0A1V0SD82	Indivirus	36.2	1.3e-37
AXI17079.1|1599359_1599806_+|transposase	transposase	transposase	NA	NA	NA	NA
AXI19584.1|1599571_1600150_+|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
AXI17080.1|1600264_1601332_-|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
AXI17081.1|1601356_1602844_+	bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
AXI17082.1|1602840_1603341_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
AXI17083.1|1603393_1605127_+	N-acetylmuramoyl-L-alanine amidase	NA	A6XML1	Bacillus_virus	28.4	4.1e-15
AXI17084.1|1605264_1607142_+	DNA mismatch repair protein MutL	NA	A0A1B2LRQ5	Wolbachia_phage	35.2	1.4e-85
AXI17085.1|1607141_1608083_+	hypothetical protein	NA	NA	NA	NA	NA
AXI17086.1|1608116_1609088_+	TraB/GumN family protein	NA	NA	NA	NA	NA
AXI19585.1|1609261_1609837_-	polyhydroxyalkanoate synthesis repressor PhaR	NA	NA	NA	NA	NA
AXI17087.1|1609996_1610737_-	beta-ketoacyl-ACP reductase	NA	NA	NA	NA	NA
AXI17088.1|1610824_1611724_-|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
AXI17089.1|1611821_1612700_+|protease	protease HtpX	protease	NA	NA	NA	NA
AXI17090.1|1612799_1614869_-	PAS domain S-box protein	NA	NA	NA	NA	NA
AXI17091.1|1615092_1616274_-	aminoacetone oxidase family FAD-binding enzyme	NA	NA	NA	NA	NA
AXI17092.1|1616270_1616819_-	hypothetical protein	NA	NA	NA	NA	NA
AXI17093.1|1616889_1617375_-	DUF188 domain-containing protein	NA	NA	NA	NA	NA
AXI17094.1|1617644_1617854_+	cold-shock protein	NA	A0A1X9IGI9	Lactococcus_phage	62.3	2.8e-16
AXI17095.1|1618024_1618723_+	glutathione S-transferase	NA	NA	NA	NA	NA
AXI19586.1|1618923_1619799_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
AXI17096.1|1620082_1621639_+	hypothetical protein	NA	NA	NA	NA	NA
AXI17097.1|1621736_1622297_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	43.2	1.6e-29
AXI17098.1|1622399_1623776_-	ATP-dependent RNA helicase	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	31.4	1.6e-54
AXI17099.1|1623865_1625761_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	26.8	1.4e-48
AXI17100.1|1626209_1626635_-	barnase inhibitor	NA	NA	NA	NA	NA
AXI17101.1|1626631_1627072_-	ribonuclease	NA	NA	NA	NA	NA
AXI17102.1|1627326_1627938_+	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	69.8	1.1e-79
AXI17103.1|1628190_1629024_-	inositol monophosphatase	NA	NA	NA	NA	NA
AXI17104.1|1629142_1629907_+	RNA methyltransferase	NA	NA	NA	NA	NA
AXI19587.1|1629967_1630888_+	metal-binding protein	NA	NA	NA	NA	NA
AXI17105.1|1630884_1633002_+	GGDEF domain-containing protein	NA	NA	NA	NA	NA
AXI17106.1|1633220_1634249_-	EF-P beta-lysylation protein EpmB	NA	NA	NA	NA	NA
AXI17107.1|1634350_1634917_+	elongation factor P	NA	NA	NA	NA	NA
AXI19588.1|1635075_1635912_+	hypothetical protein	NA	NA	NA	NA	NA
AXI17108.1|1635919_1637269_+	N-ethylammeline chlorohydrolase	NA	NA	NA	NA	NA
AXI17109.1|1637299_1638019_+	bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase	NA	NA	NA	NA	NA
AXI19589.1|1638092_1638797_+	phosphoglycolate phosphatase	NA	NA	NA	NA	NA
AXI17110.1|1638825_1639515_+	phytoene/squalene synthase family protein	NA	NA	NA	NA	NA
AXI17111.1|1639731_1641402_-	polygalacturonase	NA	NA	NA	NA	NA
AXI17112.1|1642683_1642923_+	hypothetical protein	NA	NA	NA	NA	NA
AXI17113.1|1642990_1644172_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
AXI17114.1|1646047_1647016_-|transposase	IS5/IS1182 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
AXI17115.1|1647053_1648472_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AXI17116.1|1648695_1649184_+	general stress protein	NA	NA	NA	NA	NA
AXI17117.1|1649555_1649819_+	hypothetical protein	NA	NA	NA	NA	NA
AXI19590.1|1649844_1650423_-|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
AXI17118.1|1650188_1650608_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 16
CP021788	Xanthomonas oryzae pv. oryzae strain PXO61 chromosome, complete genome	4980838	1658557	1714920	4980838	tRNA,transposase	Ralstonia_phage(41.67%)	41	NA	NA
AXI17126.1|1658557_1659988_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.5	1.1e-42
AXI17127.1|1660158_1660653_+	hypothetical protein	NA	NA	NA	NA	NA
AXI17128.1|1660965_1661991_+	acetylornithine carbamoyltransferase	NA	NA	NA	NA	NA
AXI17129.1|1662062_1663304_+	argininosuccinate synthase	NA	NA	NA	NA	NA
AXI17130.1|1663545_1663998_+	N-acetyltransferase	NA	NA	NA	NA	NA
AXI17131.1|1664003_1665104_+	acetylornithine deacetylase	NA	NA	NA	NA	NA
AXI17132.1|1665143_1666487_+	acetylglutamate kinase	NA	NA	NA	NA	NA
AXI17133.1|1667099_1668050_+	N-acetyl-gamma-glutamyl-phosphate reductase	NA	NA	NA	NA	NA
AXI17134.1|1668173_1669469_+	argininosuccinate lyase	NA	NA	NA	NA	NA
AXI17135.1|1669465_1669834_+	cupin	NA	NA	NA	NA	NA
AXI17136.1|1669833_1670094_+	hypothetical protein	NA	NA	NA	NA	NA
AXI17137.1|1670107_1671262_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	37.8	1.2e-47
AXI17138.1|1671426_1672671_+	gamma-glutamyl-phosphate reductase	NA	A0A1X9I5D4	Streptococcus_phage	45.1	2.5e-91
AXI17139.1|1673037_1674951_+	glutaryl-7-ACA acylase	NA	NA	NA	NA	NA
AXI17140.1|1674931_1676197_-	MFS transporter	NA	NA	NA	NA	NA
AXI17141.1|1676417_1676528_-	cytochrome bd-I oxidase subunit CydX	NA	NA	NA	NA	NA
AXI17142.1|1677284_1678253_+|transposase	IS5/IS1182 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
AXI19592.1|1678412_1679369_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.3	1.8e-41
AXI19591.1|1679884_1681621_+	thiol reductant ABC exporter subunit CydD	NA	W8CYL7	Bacillus_phage	26.2	1.8e-15
AXI17143.1|1683689_1684658_+|transposase	IS5/IS1182 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	9.6e-99
AXI17144.1|1684782_1685928_-	DDE endonuclease	NA	NA	NA	NA	NA
AXI17145.1|1685934_1686933_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
AXI19593.1|1687692_1687869_+	hypothetical protein	NA	NA	NA	NA	NA
AXI17146.1|1687911_1688097_-	hypothetical protein	NA	NA	NA	NA	NA
AXI17147.1|1688339_1688582_+	hypothetical protein	NA	NA	NA	NA	NA
AXI17148.1|1688657_1688918_+	hypothetical protein	NA	NA	NA	NA	NA
AXI17149.1|1689422_1689884_-	cytochrome C biogenesis protein CcsA	NA	NA	NA	NA	NA
AXI17150.1|1689892_1690285_-	cytochrome C	NA	NA	NA	NA	NA
AXI19594.1|1690507_1691242_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AXI17151.1|1691260_1691623_+	cation transporter	NA	NA	NA	NA	NA
AXI17152.1|1695132_1697604_+	AcrB/AcrD/AcrF family protein	NA	S5VTK5	Leptospira_phage	21.9	4.4e-47
AXI17153.1|1697643_1698201_+	AcrB/AcrD/AcrF family protein	NA	NA	NA	NA	NA
AXI17154.1|1698556_1698748_-	hypothetical protein	NA	NA	NA	NA	NA
AXI17155.1|1700513_1701482_-|transposase	IS5/IS1182 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	5.6e-99
AXI17156.1|1703545_1704514_+|transposase	IS5 family transposase ISXo1	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
AXI17157.1|1704665_1705415_+	hypothetical protein	NA	NA	NA	NA	NA
AXI17158.1|1705444_1710685_+	type IV secretion protein Rhs	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	39.8	1.6e-09
AXI17159.1|1710824_1711886_+|transposase	DDE transposase	transposase	NA	NA	NA	NA
AXI17160.1|1711908_1712334_+	hypothetical protein	NA	NA	NA	NA	NA
AXI17161.1|1712428_1713397_-|transposase	IS5/IS1182 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	8.7e-100
AXI19595.1|1713546_1714920_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
>prophage 17
CP021788	Xanthomonas oryzae pv. oryzae strain PXO61 chromosome, complete genome	4980838	1796612	1844419	4980838	tRNA,protease,transposase	uncultured_Mediterranean_phage(11.11%)	38	NA	NA
AXI17233.1|1796612_1797749_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
AXI17234.1|1797745_1798204_-	NUDIX hydrolase	NA	NA	NA	NA	NA
AXI17235.1|1798454_1798775_+|protease	ATP-dependent Clp protease adaptor ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	1.0e-12
AXI17236.1|1798918_1801201_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	44.6	8.7e-175
AXI19599.1|1801481_1801700_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
AXI19600.1|1801780_1802533_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
AXI17237.1|1802666_1803068_-	hypothetical protein	NA	NA	NA	NA	NA
AXI17238.1|1803101_1803296_-	cinnamoyl-CoA reductase	NA	NA	NA	NA	NA
AXI17239.1|1803960_1805082_-	N-acetyltransferase	NA	NA	NA	NA	NA
AXI17240.1|1805139_1806108_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.5	5.9e-64
AXI17241.1|1806391_1808752_+	DNA translocase FtsK	NA	G1D482	Mycobacterium_virus	45.8	2.5e-84
AXI17242.1|1808914_1810843_+	transglutaminase	NA	NA	NA	NA	NA
AXI19601.1|1810949_1811579_+	outer membrane lipoprotein carrier protein LolA	NA	NA	NA	NA	NA
AXI17243.1|1811691_1815858_-	type III effector	NA	NA	NA	NA	NA
AXI19602.1|1816094_1817471_+	recombination factor protein RarA	NA	G3MBE0	Bacillus_virus	38.1	8.9e-74
AXI17244.1|1817502_1817829_-	hypothetical protein	NA	NA	NA	NA	NA
AXI17245.1|1817825_1818233_-	fluoride ion transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	49.1	5.7e-21
AXI17246.1|1818264_1818615_-	hypothetical protein	NA	NA	NA	NA	NA
AXI17247.1|1818611_1819943_-	voltage-gated chloride channel protein	NA	A0A1X9I5Z9	Streptococcus_phage	35.2	1.5e-41
AXI17248.1|1820263_1821469_-	acetyl-CoA acetyltransferase	NA	NA	NA	NA	NA
AXI17249.1|1821626_1823999_-	3-hydroxyacyl-CoA dehydrogenase	NA	NA	NA	NA	NA
AXI17250.1|1824023_1824656_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AXI17251.1|1824874_1825300_+	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	41.7	1.1e-19
AXI17252.1|1825318_1826524_+	23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN	NA	NA	NA	NA	NA
AXI17253.1|1826534_1827323_+	type IV pilus biogenesis/stability protein PilW	NA	NA	NA	NA	NA
AXI17254.1|1827319_1828180_+	hypothetical protein	NA	NA	NA	NA	NA
AXI17255.1|1828250_1828889_+	hypothetical protein	NA	NA	NA	NA	NA
AXI17256.1|1828885_1830106_+	outer membrane assembly lipoprotein YfgL	NA	NA	NA	NA	NA
AXI17257.1|1830116_1831514_+	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
AXI17258.1|1831828_1833049_+	molybdopterin molybdenumtransferase MoeA	NA	NA	NA	NA	NA
AXI17259.1|1834656_1834854_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXI17260.1|1834923_1835163_+	hypothetical protein	NA	NA	NA	NA	NA
AXI17261.1|1835430_1836399_-|transposase	IS5/IS1182 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
AXI17262.1|1838543_1838903_+	hypothetical protein	NA	NA	NA	NA	NA
AXI17263.1|1840391_1841390_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
AXI17264.1|1841490_1841637_+	hypothetical protein	NA	NA	NA	NA	NA
AXI17265.1|1841633_1842791_-	molybdopterin biosynthesis protein MoeB	NA	NA	NA	NA	NA
AXI17266.1|1843024_1844419_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
>prophage 18
CP021788	Xanthomonas oryzae pv. oryzae strain PXO61 chromosome, complete genome	4980838	1851711	1892830	4980838	tRNA,transposase	uncultured_Mediterranean_phage(28.57%)	37	NA	NA
AXI17272.1|1851711_1852743_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
AXI17273.1|1853022_1853409_-|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
AXI17274.1|1853366_1853813_-|transposase	transposase	transposase	NA	NA	NA	NA
AXI19605.1|1854182_1854815_-	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
AXI17275.1|1854965_1855433_+	TonB-dependent receptor	NA	NA	NA	NA	NA
AXI17276.1|1855462_1857709_+	TonB-dependent receptor	NA	NA	NA	NA	NA
AXI17277.1|1857705_1858827_+	phytase	NA	NA	NA	NA	NA
AXI17278.1|1861041_1861266_+	hypothetical protein	NA	NA	NA	NA	NA
AXI17279.1|1861482_1861770_+	hypothetical protein	NA	NA	NA	NA	NA
AXI17280.1|1862160_1862868_+	hypothetical protein	NA	NA	NA	NA	NA
AXI17281.1|1862938_1863253_+	hypothetical protein	NA	NA	NA	NA	NA
AXI17282.1|1863212_1864709_-	lysine 6-aminotransferase	NA	NA	NA	NA	NA
AXI17283.1|1864832_1865264_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
AXI19606.1|1865450_1866521_+|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
AXI17284.1|1866590_1867736_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	46.2	2.2e-86
AXI17285.1|1867867_1868221_+	preprotein translocase subunit YajC	NA	NA	NA	NA	NA
AXI17286.1|1868417_1870262_+	protein translocase subunit SecD	NA	NA	NA	NA	NA
AXI17287.1|1870356_1871325_+	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	30.3	1.4e-28
AXI17288.1|1871405_1871768_-	recombinase	NA	NA	NA	NA	NA
AXI17289.1|1874455_1875829_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AXI19607.1|1876024_1877209_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	44.8	5.0e-41
AXI17290.1|1877259_1878321_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXI19608.1|1878557_1880006_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AXI17291.1|1879947_1880589_-	ribonuclease T	NA	NA	NA	NA	NA
AXI17292.1|1880866_1881280_-	hypothetical protein	NA	NA	NA	NA	NA
AXI17293.1|1881412_1882123_-	phosphate transport system regulatory protein PhoU	NA	NA	NA	NA	NA
AXI17294.1|1882251_1883082_-	phosphate ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	32.6	5.5e-18
AXI17295.1|1883104_1883974_-	phosphate ABC transporter, permease protein PstA	NA	NA	NA	NA	NA
AXI17296.1|1883973_1884948_-	phosphate ABC transporter permease subunit PstC	NA	NA	NA	NA	NA
AXI17297.1|1885060_1886152_-	phosphate ABC transporter substrate-binding protein PstS	NA	E3SKK5	Synechococcus_phage	39.7	1.1e-47
AXI19609.1|1886339_1887413_-	phosphate ABC transporter substrate-binding protein PstS	NA	M4SNR3	Cyanophage	38.4	5.0e-48
AXI17298.1|1887547_1888798_-	porin	NA	NA	NA	NA	NA
AXI17299.1|1889137_1889458_+	hypothetical protein	NA	NA	NA	NA	NA
AXI17300.1|1889604_1890018_+	hypothetical protein	NA	NA	NA	NA	NA
AXI17301.1|1890021_1891257_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
AXI17302.1|1891328_1891715_+|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
AXI17303.1|1891861_1892830_+|transposase	IS5 family transposase ISXo1	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
>prophage 19
CP021788	Xanthomonas oryzae pv. oryzae strain PXO61 chromosome, complete genome	4980838	1983453	2106252	4980838	transposase,protease	Bacillus_phage(16.67%)	93	NA	NA
AXI17362.1|1983453_1984830_+|transposase	IS5/IS1182 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.3	1.6e-62
AXI17363.1|1987385_1988564_+	N-acetylmuramoyl-L-alanine amidase	NA	M1IEI0	Bacillus_phage	39.6	1.9e-08
AXI17364.1|1988601_1989522_+	GTP cyclohydrolase I FolE2	NA	NA	NA	NA	NA
AXI17365.1|1990137_1991505_+	polynucleotide adenylyltransferase PcnB	NA	A0A1B1IVF3	uncultured_Mediterranean_phage	37.9	9.9e-25
AXI17366.1|1991508_1991994_+	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
AXI17367.1|1992029_1992845_+	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	A0A0N7HVJ8	Ostreococcus_lucimarinus_virus	34.1	1.6e-30
AXI17368.1|1992841_1993684_+	pantoate--beta-alanine ligase	NA	NA	NA	NA	NA
AXI17369.1|1993862_1994243_+	aspartate 1-decarboxylase	NA	NA	NA	NA	NA
AXI17370.1|1994239_1995754_+	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
AXI17371.1|1995912_1996257_+	prevent-host-death protein	NA	NA	NA	NA	NA
AXI17372.1|1996260_1996884_+	hypothetical protein	NA	NA	NA	NA	NA
AXI17373.1|1997118_1999074_-	alkaline phosphatase	NA	NA	NA	NA	NA
AXI19618.1|1999507_2002120_+	1,4-beta-D-glucan glucohydrolase	NA	NA	NA	NA	NA
AXI19620.1|2002112_2002370_-	hypothetical protein	NA	NA	NA	NA	NA
AXI19619.1|2002379_2003942_+	sodium transporter	NA	A0A240F3J2	Aeromonas_phage	39.5	2.7e-87
AXI17374.1|2004186_2006043_-	sensor domain-containing phosphodiesterase	NA	NA	NA	NA	NA
AXI19621.1|2007369_2009559_-	glycosyl hydrolase	NA	NA	NA	NA	NA
AXI17375.1|2009687_2011466_-	peptidase M14	NA	NA	NA	NA	NA
AXI17376.1|2012667_2013276_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
AXI17377.1|2013689_2013878_-	hypothetical protein	NA	NA	NA	NA	NA
AXI19622.1|2014061_2014376_+	N-acetyltransferase	NA	NA	NA	NA	NA
AXI17378.1|2014426_2015260_+	hypothetical protein	NA	NA	NA	NA	NA
AXI17379.1|2015326_2015827_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AXI19623.1|2015918_2016497_-	hypothetical protein	NA	NA	NA	NA	NA
AXI17380.1|2016658_2017159_-	RNA polymerase sigma factor	NA	NA	NA	NA	NA
AXI17381.1|2018683_2019397_+	hypothetical protein	NA	NA	NA	NA	NA
AXI17382.1|2019648_2019888_+	hypothetical protein	NA	NA	NA	NA	NA
AXI17383.1|2022344_2022830_+	glutathione peroxidase	NA	A0A1S7DM81	Molluscum_contagiosum_virus	36.2	2.8e-14
AXI17384.1|2022980_2023760_-	ferredoxin--NADP reductase	NA	NA	NA	NA	NA
AXI17385.1|2023948_2025829_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	38.0	2.3e-24
AXI17386.1|2026162_2027680_+	fumarate hydratase	NA	NA	NA	NA	NA
AXI17387.1|2027998_2028451_+	glutathione S-transferase	NA	NA	NA	NA	NA
AXI17388.1|2028879_2030013_-	phospholipase	NA	NA	NA	NA	NA
AXI19624.1|2031713_2032595_+	hypothetical protein	NA	NA	NA	NA	NA
AXI17389.1|2033358_2034333_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	39.6	2.0e-19
AXI17390.1|2034499_2034733_+	hypothetical protein	NA	NA	NA	NA	NA
AXI19625.1|2036627_2037206_-|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
AXI17391.1|2036971_2037418_-|transposase	transposase	transposase	NA	NA	NA	NA
AXI17392.1|2038536_2038746_+	hypothetical protein	NA	NA	NA	NA	NA
AXI17393.1|2038956_2042352_-	histidine kinase	NA	A0A1V0SGX0	Hokovirus	27.8	2.9e-25
AXI17394.1|2042566_2042947_-	response regulator	NA	NA	NA	NA	NA
AXI17395.1|2043534_2043966_+	hypothetical protein	NA	NA	NA	NA	NA
AXI17396.1|2043962_2044166_+	hypothetical protein	NA	NA	NA	NA	NA
AXI17397.1|2044181_2044628_+|transposase	transposase	transposase	NA	NA	NA	NA
AXI19626.1|2044393_2044972_+|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
AXI17398.1|2045005_2046382_-|transposase	IS5/IS1182 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.5	1.3e-77
AXI17399.1|2046602_2047262_-	2-dehydro-3-deoxyphosphogluconate aldolase	NA	NA	NA	NA	NA
AXI17400.1|2047317_2049234_-	phosphogluconate dehydratase	NA	NA	NA	NA	NA
AXI17401.1|2049336_2050056_-	6-phosphogluconolactonase	NA	NA	NA	NA	NA
AXI17402.1|2051055_2052486_-	glucose-6-phosphate dehydrogenase	NA	A0A222YYZ2	Synechococcus_phage	34.5	2.2e-67
AXI17403.1|2052916_2054014_+	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	30.1	2.2e-22
AXI17404.1|2054142_2055015_-	folate-binding protein YgfZ	NA	NA	NA	NA	NA
AXI19627.1|2054958_2055225_+	DUF1674 domain-containing protein	NA	NA	NA	NA	NA
AXI17405.1|2055284_2055680_+	succinate dehydrogenase, cytochrome b556 subunit	NA	NA	NA	NA	NA
AXI17406.1|2055676_2056063_+	succinate dehydrogenase, hydrophobic membrane anchor protein	NA	NA	NA	NA	NA
AXI17407.1|2056097_2057888_+	succinate dehydrogenase flavoprotein subunit	NA	NA	NA	NA	NA
AXI17408.1|2057891_2058101_+	hypothetical protein	NA	NA	NA	NA	NA
AXI17409.1|2058117_2058900_+	succinate dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
AXI17410.1|2059010_2059259_+	succinate dehydrogenase assembly factor 2 family protein	NA	NA	NA	NA	NA
AXI17411.1|2059209_2059662_+	hypothetical protein	NA	NA	NA	NA	NA
AXI17412.1|2059685_2060927_+	lipoprotein-releasing system transmembrane subunit LolC	NA	NA	NA	NA	NA
AXI17413.1|2060919_2061654_+	lipoprotein-releasing system ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	34.5	1.0e-31
AXI17414.1|2061654_2061837_+	hypothetical protein	NA	NA	NA	NA	NA
AXI17415.1|2063047_2064046_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
AXI17416.1|2064266_2066675_+	DNA internalization-related competence protein ComEC/Rec2	NA	NA	NA	NA	NA
AXI17417.1|2066703_2067366_+	biopolymer transporter ExbB	NA	NA	NA	NA	NA
AXI17418.1|2067369_2067834_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
AXI17419.1|2067830_2069600_+	lipid A export ATP-binding/permease MsbA	NA	W8CYL7	Bacillus_phage	28.0	9.4e-52
AXI17420.1|2069596_2070637_+	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
AXI17421.1|2070928_2071708_+	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
AXI19628.1|2071704_2072169_+	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
AXI17422.1|2072111_2073611_+	hypothetical protein	NA	NA	NA	NA	NA
AXI17423.1|2073607_2075464_+	excinuclease ABC subunit C	NA	NA	NA	NA	NA
AXI17424.1|2075463_2076096_+	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
AXI17425.1|2076570_2077077_-	glyoxalase	NA	NA	NA	NA	NA
AXI17426.1|2077243_2078143_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.1	2.8e-36
AXI19629.1|2078193_2079378_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	44.8	5.0e-41
AXI17427.1|2079686_2083787_+	type IV secretion protein Rhs	NA	NA	NA	NA	NA
AXI17428.1|2083764_2084763_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
AXI17429.1|2085611_2086673_-|transposase	DDE transposase	transposase	NA	NA	NA	NA
AXI17430.1|2087337_2088294_+|transposase	IS30 family transposase IS1112a	transposase	Q9MBM9	Staphylococcus_prophage	35.2	2.1e-42
AXI17431.1|2089548_2090220_-	hypothetical protein	NA	A0A0P0I4A4	Acinetobacter_phage	38.9	5.2e-27
AXI17432.1|2090216_2090438_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
AXI19630.1|2090611_2094310_-	avirulence protein	NA	NA	NA	NA	NA
AXI17433.1|2094851_2095151_-	hypothetical protein	NA	A0A1W6DY99	Xanthomonas_phage	91.3	1.9e-45
AXI17434.1|2095154_2095349_-	hypothetical protein	NA	A0A1W6DXV7	Xanthomonas_phage	82.3	3.9e-20
AXI17435.1|2095579_2095966_-|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
AXI17436.1|2095923_2096370_-|transposase	transposase	transposase	NA	NA	NA	NA
AXI17437.1|2100410_2100710_-	hypothetical protein	NA	A0A1W6DY99	Xanthomonas_phage	91.3	1.9e-45
AXI17438.1|2100713_2100908_-	hypothetical protein	NA	A0A1W6DXV7	Xanthomonas_phage	80.6	2.5e-19
AXI17439.1|2104471_2105341_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.2	1.4e-29
AXI17440.1|2105362_2106034_-	hypothetical protein	NA	A0A0P0I4A4	Acinetobacter_phage	38.9	5.2e-27
AXI17441.1|2106030_2106252_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
>prophage 20
CP021788	Xanthomonas oryzae pv. oryzae strain PXO61 chromosome, complete genome	4980838	2115927	2176923	4980838	tRNA,transposase	Xanthomonas_phage(79.17%)	64	NA	NA
AXI17446.1|2115927_2116113_+	hypothetical protein	NA	A0A1W6DXV6	Xanthomonas_phage	93.4	8.6e-25
AXI17447.1|2116112_2116316_+	hypothetical protein	NA	A0A1W6DXK4	Xanthomonas_phage	70.3	6.1e-16
AXI17448.1|2116451_2117525_+	replication protein	NA	S0F3F7	Stenotrophomonas_phage	40.9	5.0e-64
AXI17449.1|2117629_2117929_+	single-stranded DNA-binding protein	NA	S0F3B2	Stenotrophomonas_phage	54.2	3.4e-23
AXI17450.1|2118292_2118532_+	hypothetical protein	NA	NA	NA	NA	NA
AXI17451.1|2118668_2120123_+	hypothetical protein	NA	A0A1D6ZIU5	Xanthomonas_phage	40.2	4.0e-40
AXI17452.1|2120124_2120445_+	hypothetical protein	NA	NA	NA	NA	NA
AXI17453.1|2121621_2121852_+	hypothetical protein	NA	A0A1D6ZIU7	Xanthomonas_phage	55.6	2.0e-10
AXI17454.1|2121915_2122317_+	DUF4124 domain-containing protein	NA	A0A077JCA3	Xanthomonas_phage	64.3	3.9e-38
AXI17455.1|2122256_2122571_-	hypothetical protein	NA	A0A1W6DY99	Xanthomonas_phage	91.7	8.1e-15
AXI17456.1|2122960_2123221_-	hypothetical protein	NA	NA	NA	NA	NA
AXI17457.1|2123420_2123804_+	hypothetical protein	NA	A0A1D6ZIV0	Xanthomonas_phage	100.0	1.7e-70
AXI17458.1|2123975_2124623_-	conjugal transfer protein	NA	A0A1D6ZIU7	Xanthomonas_phage	100.0	3.0e-120
AXI17459.1|2124624_2125812_-	hypothetical protein	NA	A0A1D6ZIU8	Xanthomonas_phage	100.0	2.8e-217
AXI17460.1|2125811_2126141_-	hypothetical protein	NA	A0A1D6ZIU0	Xanthomonas_phage	100.0	3.8e-55
AXI17461.1|2126140_2127589_-	hypothetical protein	NA	A0A1D6ZIU5	Xanthomonas_phage	100.0	1.3e-253
AXI17462.1|2127683_2127914_-	methyltransferase	NA	A0A1D6ZIT7	Xanthomonas_phage	100.0	1.7e-30
AXI17463.1|2127925_2128129_-	hypothetical protein	NA	A0A1D6ZIU2	Xanthomonas_phage	100.0	9.8e-30
AXI17464.1|2128132_2128429_-	DNA-binding protein	NA	A0A1D6ZIU6	Xanthomonas_phage	100.0	3.6e-49
AXI19631.1|2128425_2129466_-	replication initiation protein	NA	A0A1D6ZIT9	Xanthomonas_phage	100.0	8.2e-205
AXI17465.1|2129618_2129831_-	hypothetical protein	NA	A0A1D6ZIV2	Xanthomonas_phage	98.6	1.1e-26
AXI17466.1|2129830_2130016_-	hypothetical protein	NA	A0A1D6ZIV1	Xanthomonas_phage	100.0	1.4e-27
AXI17467.1|2130896_2131079_-	antitoxin	NA	NA	NA	NA	NA
AXI17468.1|2131200_2131410_-	hypothetical protein	NA	NA	NA	NA	NA
AXI17469.1|2131554_2132001_+|transposase	transposase	transposase	NA	NA	NA	NA
AXI17470.1|2131958_2132345_+|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
AXI17471.1|2132677_2133646_+|transposase	IS5 family transposase ISXo1	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
AXI17472.1|2133756_2134332_+	hypothetical protein	NA	NA	NA	NA	NA
AXI17473.1|2134728_2134971_-	hypothetical protein	NA	NA	NA	NA	NA
AXI17474.1|2134945_2135458_-	hypothetical protein	NA	NA	NA	NA	NA
AXI17475.1|2135560_2136007_+|transposase	transposase	transposase	NA	NA	NA	NA
AXI19632.1|2135772_2136351_+	hypothetical protein	NA	NA	NA	NA	NA
AXI17476.1|2136800_2137208_-	hypothetical protein	NA	NA	NA	NA	NA
AXI17477.1|2137571_2141369_+	avirulence protein	NA	NA	NA	NA	NA
AXI17478.1|2141637_2141832_+	hypothetical protein	NA	A0A1W6DXV7	Xanthomonas_phage	80.6	2.5e-19
AXI17479.1|2141835_2142135_+	hypothetical protein	NA	A0A1W6DY99	Xanthomonas_phage	91.3	1.9e-45
AXI17480.1|2147397_2148174_-	imidazole glycerol phosphate synthase cyclase subunit	NA	NA	NA	NA	NA
AXI17481.1|2148167_2148902_-	1-(5-phosphoribosyl)-5-[(5- phosphoribosylamino)methylideneamino]imidazole-4- carboxamide isomerase	NA	NA	NA	NA	NA
AXI17482.1|2148898_2149501_-	imidazole glycerol phosphate synthase subunit HisH	NA	NA	NA	NA	NA
AXI17483.1|2149497_2150625_-	bifunctional imidazole glycerol-phosphate dehydratase/histidinol phosphatase	NA	NA	NA	NA	NA
AXI17484.1|2150621_2151713_-	histidinol-phosphate transaminase	NA	NA	NA	NA	NA
AXI17485.1|2151709_2153005_-	histidinol dehydrogenase	NA	NA	NA	NA	NA
AXI17486.1|2153001_2153916_-	ATP phosphoribosyltransferase	NA	NA	NA	NA	NA
AXI17487.1|2153925_2154252_-	DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
AXI17488.1|2154565_2155363_+|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
AXI17489.1|2155876_2157289_-|tRNA	histidine--tRNA ligase	tRNA	A0A2K9L6G5	Tupanvirus	28.2	3.0e-40
AXI17490.1|2158553_2159297_-	hypothetical protein	NA	NA	NA	NA	NA
AXI17491.1|2159399_2160704_-	threonine synthase	NA	NA	NA	NA	NA
AXI17492.1|2160793_2161180_+	ethyl tert-butyl ether degradation protein EthD	NA	NA	NA	NA	NA
AXI17493.1|2161903_2163112_-	tannase/feruloyl esterase family alpha/beta hydrolase	NA	NA	NA	NA	NA
AXI17494.1|2163036_2163348_-	tannase/feruloyl esterase family alpha/beta hydrolase	NA	NA	NA	NA	NA
AXI17495.1|2163348_2163603_-	hypothetical protein	NA	NA	NA	NA	NA
AXI17496.1|2164115_2165084_-	homoserine kinase	NA	NA	NA	NA	NA
AXI17497.1|2165080_2167588_-	bifunctional aspartate kinase/homoserine dehydrogenase I	NA	NA	NA	NA	NA
AXI17498.1|2168267_2168630_-	tryptophan-rich sensory protein	NA	NA	NA	NA	NA
AXI17499.1|2168891_2170424_+	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
AXI17500.1|2171012_2171297_+	hypothetical protein	NA	NA	NA	NA	NA
AXI17501.1|2171293_2172067_+	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AXI17502.1|2172072_2173128_+	dihydroorotate dehydrogenase (quinone)	NA	NA	NA	NA	NA
AXI17503.1|2173124_2174177_+	UDP-N-acetylenolpyruvoylglucosamine reductase	NA	NA	NA	NA	NA
AXI19633.1|2174212_2175082_+	EamA family transporter	NA	NA	NA	NA	NA
AXI17504.1|2175117_2175276_+	pyridoxal phosphate biosynthetic protein	NA	NA	NA	NA	NA
AXI17505.1|2175272_2175407_+	aspartate racemase	NA	NA	NA	NA	NA
AXI19634.1|2175966_2176923_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.8	2.4e-41
>prophage 21
CP021788	Xanthomonas oryzae pv. oryzae strain PXO61 chromosome, complete genome	4980838	2257903	2372408	4980838	tRNA,transposase,protease	Ralstonia_phage(26.32%)	88	NA	NA
AXI17566.1|2257903_2258902_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
AXI17567.1|2258922_2259726_-	amidohydrolase	NA	NA	NA	NA	NA
AXI17568.1|2259865_2261014_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
AXI17569.1|2261240_2261885_+	cytochrome c biogenesis ATP-binding export protein CcmA	NA	G3M9Y6	Bacillus_virus	25.9	3.1e-13
AXI17570.1|2261881_2262577_+	heme exporter protein CcmB	NA	NA	NA	NA	NA
AXI17571.1|2262671_2263424_+	heme ABC transporter permease	NA	NA	NA	NA	NA
AXI17572.1|2263420_2263591_+	heme exporter protein CcmD	NA	NA	NA	NA	NA
AXI17573.1|2263587_2264058_+	cytochrome c-type biogenesis protein CcmE 2	NA	NA	NA	NA	NA
AXI19641.1|2264226_2266164_+	c-type cytochrome biogenesis protein CcmF	NA	NA	NA	NA	NA
AXI17574.1|2266197_2266758_+	thiol:disulfide interchange protein	NA	NA	NA	NA	NA
AXI19642.1|2266775_2267186_+	cytochrome C biogenesis protein	NA	NA	NA	NA	NA
AXI17575.1|2267179_2268199_+	cytochrome C biogenesis protein	NA	NA	NA	NA	NA
AXI17576.1|2268331_2268601_-	hypothetical protein	NA	NA	NA	NA	NA
AXI17577.1|2268488_2270360_-	hypothetical protein	NA	NA	NA	NA	NA
AXI17578.1|2270356_2270656_-	hypothetical protein	NA	NA	NA	NA	NA
AXI17579.1|2270690_2272109_-	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
AXI17580.1|2272317_2273559_+	D-3-phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	48.4	1.7e-103
AXI17581.1|2273714_2274302_-	NUDIX hydrolase	NA	NA	NA	NA	NA
AXI17582.1|2274438_2275920_+	amino acid permease	NA	NA	NA	NA	NA
AXI17583.1|2275996_2277427_+	amino acid permease	NA	NA	NA	NA	NA
AXI17584.1|2277515_2278193_+	methylthioribulose 1-phosphate dehydratase	NA	NA	NA	NA	NA
AXI17585.1|2278204_2278771_+	acireductone dioxygenase	NA	NA	NA	NA	NA
AXI17586.1|2278773_2279472_+	acireductone synthase	NA	NA	NA	NA	NA
AXI17587.1|2279800_2280886_+	peptidase C13	NA	NA	NA	NA	NA
AXI19643.1|2282615_2284037_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AXI17588.1|2291719_2295442_+	avirulence protein	NA	NA	NA	NA	NA
AXI17589.1|2295710_2295905_+	hypothetical protein	NA	A0A1W6DXV7	Xanthomonas_phage	82.3	3.9e-20
AXI17590.1|2295908_2296208_+	hypothetical protein	NA	A0A1W6DY99	Xanthomonas_phage	92.4	6.4e-46
AXI17591.1|2301315_2302329_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AXI17592.1|2302428_2303013_+	FMN-dependent NADH-azoreductase	NA	NA	NA	NA	NA
AXI17593.1|2303076_2304045_+|transposase	IS5/IS1182 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	5.6e-99
AXI17594.1|2304257_2305655_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AXI17595.1|2306016_2306814_+|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
AXI17596.1|2306964_2308314_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	51.6	4.5e-94
AXI17597.1|2308320_2309085_+	energy transducer TonB	NA	NA	NA	NA	NA
AXI19644.1|2309445_2309913_+	hypothetical protein	NA	NA	NA	NA	NA
AXI17598.1|2311198_2311555_-	hypothetical protein	NA	NA	NA	NA	NA
AXI17599.1|2312378_2313347_-|transposase	IS5/IS1182 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
AXI17600.1|2313349_2313577_+	hypothetical protein	NA	NA	NA	NA	NA
AXI17601.1|2314345_2315344_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
AXI17602.1|2317573_2318572_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
AXI17603.1|2318764_2319562_+|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
AXI17604.1|2319549_2319732_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AXI17605.1|2319842_2320811_-|transposase	IS5/IS1182 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	1.5e-99
AXI17606.1|2320848_2322267_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AXI17607.1|2322479_2323448_-|transposase	IS5/IS1182 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	1.9e-99
AXI17608.1|2324308_2325508_+	homoserine O-acetyltransferase	NA	NA	NA	NA	NA
AXI17609.1|2325656_2325839_+	hypothetical protein	NA	NA	NA	NA	NA
AXI17610.1|2326160_2327636_+|transposase	IS5/IS1182 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	66.8	2.9e-99
AXI19645.1|2327690_2328875_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	44.8	5.0e-41
AXI17611.1|2328985_2329237_+	hypothetical protein	NA	NA	NA	NA	NA
AXI17612.1|2329286_2330285_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
AXI17613.1|2331637_2332606_-|transposase	IS5/IS1182 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	1.9e-99
AXI17614.1|2332764_2333112_-	hypothetical protein	NA	NA	NA	NA	NA
AXI19646.1|2333139_2333718_-	hypothetical protein	NA	NA	NA	NA	NA
AXI17615.1|2333483_2333930_-|transposase	transposase	transposase	NA	NA	NA	NA
AXI17616.1|2333935_2334697_-	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
AXI19647.1|2335029_2335359_-	aldehyde-activating protein	NA	NA	NA	NA	NA
AXI17617.1|2335767_2336565_+|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
AXI17618.1|2336776_2339305_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	34.0	4.0e-64
AXI19648.1|2339871_2341317_-	acetylhydrolase	NA	M1HKG7	Acanthocystis_turfacea_Chlorella_virus	25.8	1.8e-08
AXI19649.1|2341270_2341495_+	hypothetical protein	NA	NA	NA	NA	NA
AXI17619.1|2341688_2341829_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
AXI19650.1|2341828_2342977_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
AXI17620.1|2343098_2344094_+	ArsR family transcriptional regulator	NA	A0A2H4J145	uncultured_Caudovirales_phage	46.9	3.7e-05
AXI17621.1|2344090_2345230_+	5-methyltetrahydrofolate--homocysteine methyltransferase	NA	A0A140XBC7	Dickeya_phage	66.7	2.2e-17
AXI17622.1|2345372_2348126_+	methionine synthase	NA	NA	NA	NA	NA
AXI17623.1|2348512_2349718_-	AGE family epimerase/isomerase	NA	NA	NA	NA	NA
AXI17624.1|2349714_2350773_-	carbohydrate kinase	NA	NA	NA	NA	NA
AXI17625.1|2350697_2352008_-	MFS transporter	NA	NA	NA	NA	NA
AXI19651.1|2352021_2353197_-	transcriptional regulator	NA	NA	NA	NA	NA
AXI17626.1|2353337_2354183_-	transporter	NA	NA	NA	NA	NA
AXI17627.1|2354516_2355269_-	nucleoprotein/polynucleotide-associated enzyme	NA	NA	NA	NA	NA
AXI17628.1|2355269_2355506_-	protein SlyX	NA	NA	NA	NA	NA
AXI17629.1|2355498_2356848_-	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	40.4	2.4e-79
AXI17630.1|2356873_2357839_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
AXI17631.1|2357930_2358488_-	glutathione peroxidase	NA	NA	NA	NA	NA
AXI17632.1|2358873_2359236_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AXI17633.1|2359232_2360108_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.9	3.3e-13
AXI17634.1|2360104_2361091_+	ABC transporter permease	NA	NA	NA	NA	NA
AXI17635.1|2361100_2361937_+	hypothetical protein	NA	NA	NA	NA	NA
AXI17636.1|2361890_2362184_+	hypothetical protein	NA	NA	NA	NA	NA
AXI17637.1|2362569_2362992_+	hypothetical protein	NA	NA	NA	NA	NA
AXI19652.1|2363114_2364518_-	class II fumarate hydratase	NA	NA	NA	NA	NA
AXI19653.1|2365969_2366548_-	hypothetical protein	NA	NA	NA	NA	NA
AXI17638.1|2366313_2366751_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXI17639.1|2369756_2371124_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	48.6	3.3e-113
AXI19654.1|2372144_2372408_-|protease	serine protease	protease	NA	NA	NA	NA
>prophage 22
CP021788	Xanthomonas oryzae pv. oryzae strain PXO61 chromosome, complete genome	4980838	2683653	2747869	4980838	tRNA,transposase	Bacillus_phage(20.0%)	44	NA	NA
AXI17860.1|2683653_2684889_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
AXI17861.1|2686633_2688592_+	hypothetical protein	NA	NA	NA	NA	NA
AXI17862.1|2688616_2689348_-	copper homeostasis protein CutC	NA	NA	NA	NA	NA
AXI17863.1|2689344_2690409_-	N(4)-(beta-N-acetylglucosaminyl)-L-asparaginase	NA	NA	NA	NA	NA
AXI19678.1|2695030_2696113_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
AXI17864.1|2696124_2696748_-	alanine acetyltransferase	NA	NA	NA	NA	NA
AXI17865.1|2696998_2697475_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
AXI17866.1|2697508_2698711_-	chemotaxis protein	NA	NA	NA	NA	NA
AXI17867.1|2698718_2705645_-	hybrid sensor histidine kinase/response regulator	NA	W8CYM9	Bacillus_phage	31.1	2.9e-11
AXI17868.1|2705758_2707795_-	chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	42.1	2.1e-23
AXI17869.1|2707834_2708365_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
AXI17870.1|2708364_2708727_-	response regulator	NA	A0A220YL79	Alteromonas_virus	26.8	9.0e-10
AXI19679.1|2708744_2709146_-	response regulator	NA	NA	NA	NA	NA
AXI17871.1|2709395_2710346_+	glutathione synthase	NA	NA	NA	NA	NA
AXI17872.1|2710342_2711218_+	energy transducer TonB	NA	NA	NA	NA	NA
AXI17873.1|2711511_2712426_-	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	48.5	1.2e-63
AXI17874.1|2712422_2713142_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
AXI17875.1|2713155_2715183_-	helicase	NA	A0A127AW80	Bacillus_phage	33.2	4.6e-95
AXI17876.1|2715382_2715907_-	hypothetical protein	NA	NA	NA	NA	NA
AXI17877.1|2715920_2718365_-	penicillin-binding protein 1B	NA	NA	NA	NA	NA
AXI17878.1|2718606_2720709_+	glycosyl transferase	NA	NA	NA	NA	NA
AXI19680.1|2721041_2722484_-	hypothetical protein	NA	NA	NA	NA	NA
AXI17879.1|2722766_2724953_-	GTP pyrophosphokinase	NA	NA	NA	NA	NA
AXI17880.1|2725242_2725323_+	pyrroloquinoline quinone precursor peptide PqqA	NA	NA	NA	NA	NA
AXI17881.1|2725406_2726306_+	pyrroloquinoline quinone biosynthesis protein PqqB	NA	NA	NA	NA	NA
AXI17882.1|2726302_2727055_+	pyrroloquinoline-quinone synthase	NA	NA	NA	NA	NA
AXI17883.1|2727051_2727330_+	pyrroloquinoline quinone biosynthesis protein PqqD	NA	NA	NA	NA	NA
AXI17884.1|2727326_2728445_+	coenzyme PQQ synthesis protein E	NA	NA	NA	NA	NA
AXI17885.1|2728507_2729020_+	hypothetical protein	NA	NA	NA	NA	NA
AXI19681.1|2729330_2729909_-|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
AXI17886.1|2729674_2730121_-|transposase	transposase	transposase	NA	NA	NA	NA
AXI17887.1|2730264_2731779_+	PhoPQ-regulated protein	NA	NA	NA	NA	NA
AXI17888.1|2732578_2732851_+	hypothetical protein	NA	NA	NA	NA	NA
AXI19682.1|2732894_2733119_+	glucose kinase	NA	NA	NA	NA	NA
AXI17889.1|2733220_2735863_+	TonB-dependent receptor	NA	NA	NA	NA	NA
AXI17890.1|2736083_2740205_-	ATP-dependent RNA helicase HrpA	NA	A0A1V0SDF7	Indivirus	28.5	5.6e-47
AXI17891.1|2740306_2740852_+	DNA starvation/stationary phase protection protein	NA	A0A2H4N7L5	Lake_Baikal_phage	32.4	1.5e-16
AXI17892.1|2741066_2741303_-	hypothetical protein	NA	NA	NA	NA	NA
AXI17893.1|2741407_2743204_+	DNA helicase RecQ	NA	L7RCS0	Acanthamoeba_polyphaga_moumouvirus	35.3	2.6e-81
AXI17894.1|2743342_2743840_+	hypothetical protein	NA	NA	NA	NA	NA
AXI17895.1|2743918_2744323_+	response regulator	NA	NA	NA	NA	NA
AXI17896.1|2744953_2745628_-	7-cyano-7-deazaguanine synthase	NA	A0A088F6S9	Vibrio_phage	34.7	6.4e-25
AXI17897.1|2746006_2747383_+|transposase	IS5/IS1182 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.0	1.1e-58
AXI17898.1|2747422_2747869_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 23
CP021788	Xanthomonas oryzae pv. oryzae strain PXO61 chromosome, complete genome	4980838	2818685	2881874	4980838	tRNA,transposase	Ralstonia_phage(28.57%)	54	NA	NA
AXI17941.1|2818685_2821517_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A1V0SGW1	Hokovirus	22.2	4.1e-41
AXI17942.1|2821523_2822540_-	bifunctional riboflavin kinase/FMN adenylyltransferase	NA	NA	NA	NA	NA
AXI17943.1|2822738_2824343_-	murein biosynthesis integral membrane protein MurJ	NA	NA	NA	NA	NA
AXI17944.1|2824459_2824729_+	30S ribosomal protein S20	NA	NA	NA	NA	NA
AXI17945.1|2824820_2825873_-	GTPase ObgE	NA	NA	NA	NA	NA
AXI17946.1|2826105_2826366_-	50S ribosomal protein L27	NA	NA	NA	NA	NA
AXI17947.1|2826378_2826699_-	50S ribosomal protein L21	NA	NA	NA	NA	NA
AXI17948.1|2826991_2829958_+	excinuclease ABC subunit A	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	55.8	3.3e-307
AXI17949.1|2829954_2830362_+	thioesterase	NA	NA	NA	NA	NA
AXI17950.1|2830475_2830940_-	hypothetical protein	NA	NA	NA	NA	NA
AXI17951.1|2830963_2831734_+	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
AXI17952.1|2831804_2832710_+	acyl-CoA thioesterase II	NA	NA	NA	NA	NA
AXI17953.1|2832937_2833441_+	pathogenicity-like protein	NA	NA	NA	NA	NA
AXI19687.1|2834550_2835006_+	hypothetical protein	NA	NA	NA	NA	NA
AXI17954.1|2835150_2835949_-|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
AXI17955.1|2835991_2836573_-	calcium-binding protein	NA	NA	NA	NA	NA
AXI17956.1|2836633_2837548_+	arginyltransferase	NA	NA	NA	NA	NA
AXI17957.1|2837501_2838833_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
AXI17958.1|2838940_2839141_-	hypothetical protein	NA	NA	NA	NA	NA
AXI17959.1|2839137_2840739_-	hypothetical protein	NA	NA	NA	NA	NA
AXI17960.1|2841184_2842261_+	DUF4432 domain-containing protein	NA	NA	NA	NA	NA
AXI17961.1|2842356_2842830_-	hypothetical protein	NA	NA	NA	NA	NA
AXI17962.1|2843065_2845501_+	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	22.5	2.6e-12
AXI17963.1|2846856_2847579_+	trehalose-phosphatase	NA	NA	NA	NA	NA
AXI17964.1|2847623_2849402_+	glucoamylase	NA	NA	NA	NA	NA
AXI17965.1|2849398_2850766_+	trehalose-6-phosphate synthase	NA	NA	NA	NA	NA
AXI19688.1|2851370_2851877_-	DUF4166 domain-containing protein	NA	NA	NA	NA	NA
AXI17966.1|2851897_2852704_-	multi-copper polyphenol oxidoreductase	NA	NA	NA	NA	NA
AXI17967.1|2852711_2853707_-	23S rRNA pseudouridine(1911/1915/1917) synthase	NA	NA	NA	NA	NA
AXI17968.1|2853827_2854709_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
AXI17969.1|2854866_2856525_-	NAD+ synthase	NA	A0A2L0UZF5	Agrobacterium_phage	38.0	1.2e-93
AXI17970.1|2856953_2857250_-	hypothetical protein	NA	NA	NA	NA	NA
AXI17971.1|2857569_2858445_-	succinate--CoA ligase subunit alpha	NA	NA	NA	NA	NA
AXI17972.1|2858469_2859639_-	succinyl-CoA ligase subunit beta	NA	NA	NA	NA	NA
AXI17973.1|2859872_2861486_+	sensor histidine kinase	NA	NA	NA	NA	NA
AXI17974.1|2861816_2863208_+	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
AXI17975.1|2863280_2863487_+	DUF2559 domain-containing protein	NA	NA	NA	NA	NA
AXI17976.1|2863722_2864058_+	cell filamentation protein Fic	NA	NA	NA	NA	NA
AXI17977.1|2864066_2865800_-	type IV-A pilus assembly ATPase PilB	NA	NA	NA	NA	NA
AXI17978.1|2865834_2867361_-	hypothetical protein	NA	NA	NA	NA	NA
AXI17979.1|2867330_2867990_-	hypothetical protein	NA	NA	NA	NA	NA
AXI17980.1|2867970_2869560_-	hypothetical protein	NA	NA	NA	NA	NA
AXI17981.1|2869694_2870120_-	pilin	NA	NA	NA	NA	NA
AXI19689.1|2870473_2871733_+	type II secretory pathway protein	NA	NA	NA	NA	NA
AXI17982.1|2871739_2872603_+	prepilin peptidase	NA	NA	NA	NA	NA
AXI17983.1|2872616_2873225_+	dephospho-CoA kinase	NA	NA	NA	NA	NA
AXI17984.1|2873202_2874615_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AXI17985.1|2875175_2875583_-	hypothetical protein	NA	NA	NA	NA	NA
AXI17986.1|2875461_2876418_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	34.9	1.1e-41
AXI17987.1|2876492_2876678_-	hypothetical protein	NA	NA	NA	NA	NA
AXI17988.1|2876753_2877014_-|transposase	transposase	transposase	NA	NA	NA	NA
AXI17989.1|2877109_2878078_+|transposase	IS5 family transposase ISXo1	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
AXI17990.1|2878247_2878616_-	hypothetical protein	NA	NA	NA	NA	NA
AXI17991.1|2880905_2881874_-|transposase	IS5 family transposase ISXo1	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
>prophage 24
CP021788	Xanthomonas oryzae pv. oryzae strain PXO61 chromosome, complete genome	4980838	2888138	3026913	4980838	tRNA,transposase	Ralstonia_phage(16.0%)	113	NA	NA
AXI17993.1|2888138_2889521_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AXI17994.1|2889536_2889983_+|transposase	transposase	transposase	NA	NA	NA	NA
AXI19690.1|2889748_2890327_+|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
AXI17995.1|2890402_2892235_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.3	1.2e-30
AXI17996.1|2892366_2892957_-	plasmid pRiA4b ORF-3 family protein	NA	NA	NA	NA	NA
AXI17997.1|2893022_2896079_-	AcrB/AcrD/AcrF family protein	NA	NA	NA	NA	NA
AXI17998.1|2896075_2897179_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AXI17999.1|2897204_2898041_-	MipA/OmpV family protein	NA	NA	NA	NA	NA
AXI19691.1|2898060_2899530_-	outer membrane channel protein	NA	NA	NA	NA	NA
AXI19692.1|2899635_2900325_+	DNA-binding response regulator	NA	Q6XM27	Feldmannia_irregularis_virus	28.3	3.6e-07
AXI18000.1|2900321_2901515_+	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	25.3	4.0e-22
AXI18001.1|2901573_2902839_-	cation/H(+) antiporter	NA	NA	NA	NA	NA
AXI18002.1|2902985_2904662_-	serine hydrolase	NA	NA	NA	NA	NA
AXI18003.1|2904603_2905104_-	ribonuclease activity regulator protein RraA	NA	NA	NA	NA	NA
AXI18004.1|2908023_2908746_-	23S rRNA pseudouridine synthase F	NA	NA	NA	NA	NA
AXI18005.1|2908895_2911292_-	GGDEF domain-containing protein	NA	G3MA91	Bacillus_virus	30.2	3.8e-11
AXI18006.1|2911555_2913460_-	ATP-dependent RNA helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	35.7	2.5e-58
AXI18007.1|2913809_2914106_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
AXI18008.1|2914821_2915064_+	RNA-binding protein	NA	NA	NA	NA	NA
AXI18009.1|2915412_2915814_-	hypothetical protein	NA	NA	NA	NA	NA
AXI18010.1|2915839_2916373_-	hypothetical protein	NA	NA	NA	NA	NA
AXI18011.1|2916775_2917030_-	hypothetical protein	NA	NA	NA	NA	NA
AXI19693.1|2917106_2917412_-	hypothetical protein	NA	NA	NA	NA	NA
AXI18012.1|2917422_2918268_-	hypothetical protein	NA	NA	NA	NA	NA
AXI18013.1|2918490_2919954_+	DNA methylase	NA	NA	NA	NA	NA
AXI18014.1|2919950_2920496_+	cysteine methyltransferase	NA	A0A1S5V092	Saudi_moumouvirus	51.9	4.1e-14
AXI18015.1|2920674_2922111_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AXI18016.1|2922323_2923292_-|transposase	IS5/IS1182 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
AXI18017.1|2924822_2926268_+	chloride channel protein	NA	A0A1X9I5Z9	Streptococcus_phage	31.5	4.9e-14
AXI18018.1|2926340_2927381_+	alcohol dehydrogenase	NA	NA	NA	NA	NA
AXI18019.1|2927513_2927696_-	30S ribosomal protein THX	NA	NA	NA	NA	NA
AXI19694.1|2927995_2928406_-	MerC domain-containing protein	NA	NA	NA	NA	NA
AXI19695.1|2928667_2928853_+	outer membrane hemin receptor	NA	NA	NA	NA	NA
AXI18020.1|2928833_2930669_+	ligand-gated channel	NA	NA	NA	NA	NA
AXI18021.1|2931059_2933441_+	TonB-dependent receptor	NA	NA	NA	NA	NA
AXI18022.1|2933684_2934641_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	34.8	1.0e-39
AXI18023.1|2934692_2935025_-	short-chain dehydrogenase	NA	NA	NA	NA	NA
AXI18024.1|2935201_2935927_-	OmpA family lipoprotein	NA	G3M9Z0	Bacillus_virus	33.9	1.4e-09
AXI19696.1|2935936_2936116_-	hypothetical protein	NA	NA	NA	NA	NA
AXI18025.1|2936343_2937798_-	deoxyribodipyrimidine photo-lyase	NA	A0A1V0S949	Catovirus	31.7	5.7e-47
AXI18026.1|2937864_2939295_-	replicative DNA helicase	NA	O80281	Escherichia_phage	53.4	8.5e-120
AXI18027.1|2939516_2940071_-	NADPH-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	35.3	1.1e-19
AXI18028.1|2940287_2942228_-	asparagine synthetase B	NA	A0A1B1ISV2	uncultured_Mediterranean_phage	30.5	4.4e-26
AXI18029.1|2942403_2943042_-	glutathione S-transferase family protein	NA	NA	NA	NA	NA
AXI19697.1|2945275_2946439_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
AXI18030.1|2946596_2947388_-	hypothetical protein	NA	NA	NA	NA	NA
AXI18031.1|2947533_2947749_+	hypothetical protein	NA	NA	NA	NA	NA
AXI18032.1|2947748_2948516_+	TatD family deoxyribonuclease	NA	NA	NA	NA	NA
AXI18033.1|2948577_2949408_-|tRNA	tRNA threonylcarbamoyladenosine dehydratase	tRNA	NA	NA	NA	NA
AXI18034.1|2949480_2949909_+	hypothetical protein	NA	NA	NA	NA	NA
AXI18035.1|2950040_2950520_+	peptidoglycan-associated outer membrane lipoprotein precursor	NA	NA	NA	NA	NA
AXI18036.1|2950770_2950986_-	cold-shock protein	NA	A0A1X9IGI9	Lactococcus_phage	59.7	6.5e-16
AXI18037.1|2951213_2951699_+	hypothetical protein	NA	NA	NA	NA	NA
AXI18038.1|2953260_2953464_-	hypothetical protein	NA	NA	NA	NA	NA
AXI18039.1|2954241_2954700_-	cupin	NA	NA	NA	NA	NA
AXI18040.1|2955105_2955612_-	Fur family transcriptional regulator	NA	NA	NA	NA	NA
AXI18041.1|2955625_2957029_-|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
AXI18042.1|2957097_2958201_-	hypothetical protein	NA	NA	NA	NA	NA
AXI19698.1|2958222_2958960_-	nitrilase	NA	NA	NA	NA	NA
AXI18043.1|2959027_2959984_+|transposase	IS30 family transposase IS1112a	transposase	Q9MBM9	Staphylococcus_prophage	35.2	2.1e-42
AXI18044.1|2960282_2960870_-	GNAT family acetyltransferase	NA	NA	NA	NA	NA
AXI18045.1|2961100_2961913_+	peptidase C1	NA	NA	NA	NA	NA
AXI18046.1|2962045_2963014_-|transposase	IS5/IS1182 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	1.5e-99
AXI18047.1|2963103_2964267_-|transposase	IS5/IS1182 family transposase	transposase	A0A077K814	Ralstonia_phage	61.2	2.6e-98
AXI18048.1|2964452_2964836_-	hypothetical protein	NA	NA	NA	NA	NA
AXI19699.1|2965351_2966164_+	peptidase C1	NA	NA	NA	NA	NA
AXI18049.1|2966224_2967283_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	42.6	4.1e-71
AXI18050.1|2967277_2968447_-|transposase	IS5/IS1182 family transposase	transposase	A0A077K814	Ralstonia_phage	60.5	1.1e-96
AXI18051.1|2968605_2968989_-	hypothetical protein	NA	NA	NA	NA	NA
AXI18052.1|2969724_2970537_+	peptidase C1	NA	NA	NA	NA	NA
AXI18053.1|2971747_2972467_-	two-component sensor histidine kinase	NA	NA	NA	NA	NA
AXI18054.1|2972610_2973408_+|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
AXI19700.1|2973754_2974663_+	23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ	NA	NA	NA	NA	NA
AXI18055.1|2975074_2975617_+	N-acetyltransferase	NA	NA	NA	NA	NA
AXI18056.1|2976019_2979484_+	transcription-repair coupling factor	NA	NA	NA	NA	NA
AXI18057.1|2979973_2980303_+	anti-sigma factor antagonist	NA	NA	NA	NA	NA
AXI18058.1|2980321_2982319_+	chemotaxis protein CheA	NA	NA	NA	NA	NA
AXI18059.1|2982386_2984543_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	62.1	2.9e-10
AXI18060.1|2984553_2985069_+	chemotaxis protein CheW	NA	NA	NA	NA	NA
AXI18061.1|2985095_2986379_+	diguanylate phosphodiesterase	NA	NA	NA	NA	NA
AXI18062.1|2986362_2987190_+	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AXI19701.1|2987204_2988326_+	chemotaxis response regulator protein-glutamate methylesterase	NA	NA	NA	NA	NA
AXI18063.1|2988494_2989568_-	cardiolipin synthase	NA	NA	NA	NA	NA
AXI18064.1|2990273_2992331_-	peptidase	NA	A0A1V0SHG2	Klosneuvirus	28.6	1.2e-79
AXI18065.1|2992663_2992915_-	hypothetical protein	NA	NA	NA	NA	NA
AXI18066.1|2993275_2994025_-	2,3-bisphosphoglycerate-dependent phosphoglycerate mutase	NA	NA	NA	NA	NA
AXI19702.1|2994128_2994842_+	endonuclease V	NA	NA	NA	NA	NA
AXI18067.1|2995610_2996501_+	pirin family protein	NA	NA	NA	NA	NA
AXI18068.1|2996747_2997209_+	hypothetical protein	NA	NA	NA	NA	NA
AXI18069.1|2997553_2999962_-	hypothetical protein	NA	NA	NA	NA	NA
AXI19703.1|2999958_3000438_-	hypothetical protein	NA	NA	NA	NA	NA
AXI18070.1|3000745_3001333_-	hypothetical protein	NA	NA	NA	NA	NA
AXI19704.1|3001535_3002102_-	hypothetical protein	NA	NA	NA	NA	NA
AXI18071.1|3002322_3002556_-	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
AXI18072.1|3003019_3003706_-	hypothetical protein	NA	NA	NA	NA	NA
AXI18073.1|3003666_3004527_-	hypothetical protein	NA	NA	NA	NA	NA
AXI18074.1|3004581_3006483_-	type VI secretion protein	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	32.6	2.2e-30
AXI18075.1|3006504_3008613_-	hypothetical protein	NA	NA	NA	NA	NA
AXI18076.1|3008662_3009334_-	hypothetical protein	NA	NA	NA	NA	NA
AXI19705.1|3009614_3010163_-	hypothetical protein	NA	NA	NA	NA	NA
AXI18077.1|3010557_3011163_-	hypothetical protein	NA	NA	NA	NA	NA
AXI18078.1|3011155_3012103_-	hypothetical protein	NA	NA	NA	NA	NA
AXI18079.1|3012099_3014523_-	type IV secretion protein Rhs	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	29.0	3.1e-37
AXI19706.1|3014532_3015945_-	hypothetical protein	NA	NA	NA	NA	NA
AXI18080.1|3015934_3016621_-	hypothetical protein	NA	NA	NA	NA	NA
AXI18081.1|3016581_3017442_-	hypothetical protein	NA	NA	NA	NA	NA
AXI19707.1|3017496_3019899_-	type IV secretion protein Rhs	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	29.2	4.6e-41
AXI18082.1|3020934_3021792_-	pirin family protein	NA	NA	NA	NA	NA
AXI18083.1|3022023_3024096_+	carbon starvation protein A	NA	NA	NA	NA	NA
AXI18084.1|3024095_3024320_+	hypothetical protein	NA	NA	NA	NA	NA
AXI18085.1|3024350_3024539_-	hypothetical protein	NA	NA	NA	NA	NA
AXI18086.1|3024857_3025535_-	HAD family hydrolase	NA	NA	NA	NA	NA
AXI18087.1|3025914_3026913_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
>prophage 25
CP021788	Xanthomonas oryzae pv. oryzae strain PXO61 chromosome, complete genome	4980838	3053582	3081360	4980838	transposase,protease	Ralstonia_phage(33.33%)	31	NA	NA
AXI18108.1|3053582_3054980_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AXI18109.1|3055624_3056050_+	DNA-binding protein	NA	NA	NA	NA	NA
AXI18110.1|3056155_3056797_+	peptidase	NA	NA	NA	NA	NA
AXI18111.1|3056854_3057196_+	DUF3861 domain-containing protein	NA	NA	NA	NA	NA
AXI18112.1|3057253_3057796_+	hypothetical protein	NA	NA	NA	NA	NA
AXI18113.1|3057851_3058448_+	DUF1439 domain-containing protein	NA	NA	NA	NA	NA
AXI18114.1|3058565_3058919_-|protease	intracellular protease I	protease	NA	NA	NA	NA
AXI18115.1|3059052_3059271_-	peptidase	NA	NA	NA	NA	NA
AXI18116.1|3059375_3059843_-	SET domain-containing protein-lysine N-methyltransferase	NA	NA	NA	NA	NA
AXI18117.1|3060014_3060473_+	transcriptional regulator	NA	NA	NA	NA	NA
AXI18118.1|3060488_3061946_+	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
AXI18119.1|3062203_3062968_+	ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	28.9	1.6e-11
AXI18120.1|3062967_3064230_+	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
AXI18121.1|3064226_3065471_+	cysteine desulfurase CsdA	NA	Q2XUY6	environmental_halophage	41.9	2.3e-92
AXI19709.1|3065553_3065790_-	hypothetical protein	NA	NA	NA	NA	NA
AXI18122.1|3065784_3066324_+	N-acetyltransferase	NA	NA	NA	NA	NA
AXI18123.1|3066320_3066650_+	benzene 1,2-dioxygenase	NA	NA	NA	NA	NA
AXI18124.1|3066795_3067062_-	hypothetical protein	NA	A0A077K814	Ralstonia_phage	59.0	4.7e-16
AXI18125.1|3067073_3067499_+	hypothetical protein	NA	NA	NA	NA	NA
AXI18126.1|3068551_3069550_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
AXI18127.1|3069515_3069716_+	hypothetical protein	NA	NA	NA	NA	NA
AXI18128.1|3070814_3071969_+	2-aminoethylphosphonate--pyruvate transaminase	NA	NA	NA	NA	NA
AXI18129.1|3072232_3073201_-|transposase	IS5 family transposase ISXo1	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
AXI18130.1|3073203_3074451_+	O-acetylhomoserine aminocarboxypropyltransferase	NA	NA	NA	NA	NA
AXI19710.1|3074477_3075518_+	dihydrorhizobitoxine desaturase	NA	NA	NA	NA	NA
AXI19711.1|3075535_3076396_+	gamma-glutamyl-gamma-aminobutyrate hydrolase	NA	NA	NA	NA	NA
AXI18131.1|3076430_3077030_+	LysE family translocator	NA	NA	NA	NA	NA
AXI18132.1|3077096_3078032_+	homoserine O-succinyltransferase	NA	NA	NA	NA	NA
AXI19712.1|3078097_3079450_+	glutamine synthetase	NA	NA	NA	NA	NA
AXI19713.1|3079541_3080726_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	45.4	1.0e-41
AXI18133.1|3080880_3081360_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	67.2	1.2e-41
>prophage 26
CP021788	Xanthomonas oryzae pv. oryzae strain PXO61 chromosome, complete genome	4980838	3261134	3362264	4980838	transposase	Ralstonia_phage(60.0%)	77	NA	NA
AXI18247.1|3261134_3262232_+|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
AXI18248.1|3262648_3265729_+	histidine kinase	NA	NA	NA	NA	NA
AXI19727.1|3268764_3269472_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AXI18249.1|3269468_3270461_+	cytochrome-c peroxidase	NA	NA	NA	NA	NA
AXI18250.1|3270457_3272917_+	two-component sensor histidine kinase	NA	NA	NA	NA	NA
AXI18251.1|3273030_3274011_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AXI18252.1|3274019_3275048_+	type VI secretion system protein ImpA	NA	NA	NA	NA	NA
AXI18253.1|3275214_3276012_+|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
AXI18254.1|3276074_3276872_+|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
AXI18255.1|3276932_3277259_-	hypothetical protein	NA	NA	NA	NA	NA
AXI18256.1|3277255_3280159_-	serine/threonine protein kinase	NA	A0A2R8FF19	Brazilian_cedratvirus	25.0	2.5e-09
AXI18257.1|3280155_3280878_-	phosphoprotein phosphatase	NA	NA	NA	NA	NA
AXI18258.1|3280874_3281522_-	type VI secretion-associated protein	NA	NA	NA	NA	NA
AXI18259.1|3281518_3284977_-	type VI secretion protein	NA	NA	NA	NA	NA
AXI18260.1|3284980_3286297_-	hypothetical protein	NA	NA	NA	NA	NA
AXI18261.1|3286298_3287636_-	type VI secretion system-associated protein	NA	NA	NA	NA	NA
AXI18262.1|3287632_3289024_-	peptide-binding protein	NA	NA	NA	NA	NA
AXI18263.1|3289020_3289560_-	hypothetical protein	NA	NA	NA	NA	NA
AXI18264.1|3289568_3291506_-	type IV secretion protein Rhs	NA	A0A077K8Q4	Ralstonia_phage	28.6	3.4e-39
AXI18265.1|3291770_3292229_-	hypothetical protein	NA	NA	NA	NA	NA
AXI18266.1|3292615_3292942_-	hypothetical protein	NA	NA	NA	NA	NA
AXI18267.1|3293175_3293673_-	hypothetical protein	NA	NA	NA	NA	NA
AXI18268.1|3293861_3296567_-	ClpV1 family T6SS ATPase	NA	H6X3M6	Enterobacteria_phage	29.3	4.3e-80
AXI18269.1|3296599_3297610_-	type VI secretion protein	NA	NA	NA	NA	NA
AXI18270.1|3297573_3299451_-	type VI secretion system ImpG/VasA family protein	NA	NA	NA	NA	NA
AXI18271.1|3299454_3299958_-	type VI secretion system lysozyme	NA	NA	NA	NA	NA
AXI18272.1|3299945_3300779_-	ImpE protein	NA	NA	NA	NA	NA
AXI18273.1|3300814_3301318_-	Hcp1 family type VI secretion system effector	NA	NA	NA	NA	NA
AXI18274.1|3301417_3302932_-	EvpB family type VI secretion protein	NA	NA	NA	NA	NA
AXI19728.1|3302924_3303431_-	type VI secretion system-associated protein	NA	NA	NA	NA	NA
AXI18275.1|3303952_3304594_-	hypothetical protein	NA	NA	NA	NA	NA
AXI18276.1|3304644_3306054_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AXI18277.1|3306266_3307235_-|transposase	IS5/IS1182 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
AXI18278.1|3308857_3310093_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
AXI18279.1|3310278_3311247_-|transposase	IS5 family transposase ISXo1	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
AXI18280.1|3311298_3313215_-	hypothetical protein	NA	NA	NA	NA	NA
AXI18281.1|3313239_3313977_-	hypothetical protein	NA	NA	NA	NA	NA
AXI18282.1|3314007_3316350_-	hypothetical protein	NA	NA	NA	NA	NA
AXI19729.1|3316367_3317114_-	hypothetical protein	NA	NA	NA	NA	NA
AXI18283.1|3317142_3319977_-	hypothetical protein	NA	NA	NA	NA	NA
AXI19730.1|3319973_3320177_-	hypothetical protein	NA	NA	NA	NA	NA
AXI18284.1|3320214_3320463_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	49.2	5.4e-14
AXI18285.1|3322476_3323076_-	Fe-S biogenesis protein NfuA	NA	NA	NA	NA	NA
AXI18286.1|3323163_3323520_+	4a-hydroxytetrahydrobiopterin dehydratase	NA	NA	NA	NA	NA
AXI18287.1|3323516_3323939_+	energy transducer TonB	NA	NA	NA	NA	NA
AXI18288.1|3323954_3324188_+	zinc transporter ZupT	NA	NA	NA	NA	NA
AXI18289.1|3324214_3324475_+	zinc transporter ZupT	NA	NA	NA	NA	NA
AXI18290.1|3324823_3326608_+	hypothetical protein	NA	NA	NA	NA	NA
AXI18291.1|3326640_3327627_-	23S rRNA pseudouridine(955/2504/2580) synthase	NA	NA	NA	NA	NA
AXI18292.1|3328037_3331751_+	ribonuclease E/G	NA	NA	NA	NA	NA
AXI19731.1|3332276_3332855_-	hypothetical protein	NA	NA	NA	NA	NA
AXI18293.1|3332620_3333067_-	hypothetical protein	NA	NA	NA	NA	NA
AXI18294.1|3334013_3334775_-	sulfurtransferase	NA	NA	NA	NA	NA
AXI18295.1|3334932_3335901_-|transposase	IS5 family transposase ISXo1	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
AXI18296.1|3336034_3336400_-	hypothetical protein	NA	NA	NA	NA	NA
AXI18297.1|3336458_3336890_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
AXI18298.1|3336901_3338164_+	aminoacetone oxidase family FAD-binding enzyme	NA	NA	NA	NA	NA
AXI18299.1|3338147_3339440_-	nucleotide sugar dehydrogenase	NA	NA	NA	NA	NA
AXI18300.1|3339809_3340580_+	phosphopantetheinyl transferase	NA	NA	NA	NA	NA
AXI18301.1|3340664_3341333_+	hypothetical protein	NA	NA	NA	NA	NA
AXI19732.1|3343852_3344110_-	stress-induced protein	NA	NA	NA	NA	NA
AXI18302.1|3344549_3345533_+|transposase	IS5/IS1182 family transposase	transposase	A0A077K814	Ralstonia_phage	61.2	7.5e-99
AXI18303.1|3345848_3346817_-|transposase	IS5 family transposase ISXo1	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
AXI18304.1|3346819_3347908_+|transposase	DDE transposase	transposase	NA	NA	NA	NA
AXI18305.1|3348347_3348527_-	hypothetical protein	NA	NA	NA	NA	NA
AXI18306.1|3348891_3349890_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
AXI18307.1|3351064_3352042_+	siroheme synthase	NA	NA	NA	NA	NA
AXI18308.1|3352251_3352641_+	FAD-dependent monooxygenase	NA	NA	NA	NA	NA
AXI18309.1|3352850_3353045_+	short-chain dehydrogenase	NA	NA	NA	NA	NA
AXI18310.1|3354438_3354801_-	hypothetical protein	NA	NA	NA	NA	NA
AXI18311.1|3354784_3355354_-	molybdenum cofactor guanylyltransferase	NA	NA	NA	NA	NA
AXI18312.1|3355391_3356645_-	molybdopterin molybdenumtransferase MoeA	NA	NA	NA	NA	NA
AXI18313.1|3356850_3357228_+	hypothetical protein	NA	NA	NA	NA	NA
AXI19733.1|3358901_3359108_-|transposase	transposase	transposase	NA	NA	NA	NA
AXI18314.1|3359156_3360392_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
AXI18315.1|3360910_3361183_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXI19734.1|3361229_3362264_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	32.8	8.0e-43
>prophage 27
CP021788	Xanthomonas oryzae pv. oryzae strain PXO61 chromosome, complete genome	4980838	3503714	3633121	4980838	tRNA,integrase,transposase,protease	Ralstonia_phage(13.33%)	108	3607205:3607264	3623875:3624538
AXI18416.1|3503714_3504161_-|transposase	transposase	transposase	NA	NA	NA	NA
AXI18417.1|3505157_3507524_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
AXI19745.1|3507520_3508195_-	methylamine utilization protein	NA	NA	NA	NA	NA
AXI18418.1|3508404_3509343_-	flavonol synthase	NA	NA	NA	NA	NA
AXI18419.1|3509465_3510815_-	phosphoglucosamine mutase	NA	NA	NA	NA	NA
AXI18420.1|3510811_3511699_-	acetyl-CoA carboxylase carboxyl transferase subunit beta	NA	NA	NA	NA	NA
AXI18421.1|3512015_3512822_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
AXI18422.1|3513266_3514484_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
AXI18423.1|3514589_3515558_+	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	24.1	3.2e-09
AXI18424.1|3515942_3516611_-	N-(5'-phosphoribosyl)anthranilate isomerase	NA	NA	NA	NA	NA
AXI18425.1|3516607_3517381_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
AXI19746.1|3517954_3520021_-	ferrous iron transporter B	NA	NA	NA	NA	NA
AXI18426.1|3520587_3521613_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
AXI18427.1|3521697_3522771_-	D-glycerate dehydrogenase	NA	M1HTA3	Paramecium_bursaria_Chlorella_virus	23.2	2.1e-14
AXI18428.1|3522763_3523867_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	40.4	1.6e-73
AXI18429.1|3523877_3524804_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
AXI18430.1|3524884_3525535_+	SCO family protein	NA	NA	NA	NA	NA
AXI18431.1|3525531_3526380_+	phosphatidylserine decarboxylase proenzyme	NA	NA	NA	NA	NA
AXI18432.1|3526930_3528514_-	lytic transglycosylase	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	31.5	4.2e-11
AXI19747.1|3528433_3528619_+	hypothetical protein	NA	NA	NA	NA	NA
AXI18433.1|3528808_3529156_+	hypothetical protein	NA	A0A248XCZ8	Klebsiella_phage	44.7	1.1e-12
AXI18434.1|3529224_3529692_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
AXI18435.1|3529936_3531154_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
AXI19749.1|3531114_3531393_-	hypothetical protein	NA	NA	NA	NA	NA
AXI19748.1|3531512_3532019_+	transcription elongation factor GreB	NA	NA	NA	NA	NA
AXI18436.1|3532140_3533541_-	30S ribosomal protein S12 methylthiotransferase RimO	NA	NA	NA	NA	NA
AXI18437.1|3533803_3534379_+	dienelactone hydrolase family protein	NA	NA	NA	NA	NA
AXI18438.1|3534375_3534810_+	HIT family protein	NA	NA	NA	NA	NA
AXI18439.1|3534837_3535005_+	hypothetical protein	NA	NA	NA	NA	NA
AXI18440.1|3535775_3535961_+	hypothetical protein	NA	NA	NA	NA	NA
AXI18441.1|3535995_3536565_-	dCTP deaminase	NA	S5VM63	Pseudomonas_phage	70.1	2.6e-72
AXI18442.1|3536657_3537509_-	Fe-S-binding ATPase	NA	NA	NA	NA	NA
AXI18443.1|3538894_3540910_+	peptidase M13	NA	NA	NA	NA	NA
AXI18444.1|3541180_3541879_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
AXI18445.1|3541919_3542327_-	cysteine methyltransferase	NA	NA	NA	NA	NA
AXI18446.1|3542567_3542735_-	glutathione reductase	NA	NA	NA	NA	NA
AXI18447.1|3542764_3543727_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
AXI18448.1|3545010_3546261_-	amino acid dehydrogenase	NA	NA	NA	NA	NA
AXI18449.1|3546268_3547513_-	hypothetical protein	NA	NA	NA	NA	NA
AXI18450.1|3547740_3548220_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
AXI19750.1|3548330_3548867_+	glycoside hydrolase	NA	A0A1V0DZX6	Clostridioides_phage	40.5	3.2e-19
AXI18451.1|3548976_3549726_+	hypothetical protein	NA	A0A0K2SUC1	Clostridium_phage	38.5	1.2e-19
AXI18452.1|3549933_3550425_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
AXI18453.1|3553001_3554708_+	alkaline phosphatase	NA	NA	NA	NA	NA
AXI18454.1|3554741_3556046_+|tRNA	tRNA(Ile)-lysidine synthetase	tRNA	NA	NA	NA	NA
AXI18455.1|3556077_3556338_+	exodeoxyribonuclease 7 small subunit	NA	NA	NA	NA	NA
AXI18456.1|3556339_3557215_+	(2E,6E)-farnesyl diphosphate synthase	NA	NA	NA	NA	NA
AXI19751.1|3559049_3559514_-	DUF4870 domain-containing protein	NA	NA	NA	NA	NA
AXI19752.1|3560043_3561411_-|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
AXI18457.1|3561556_3562138_+	hypothetical protein	NA	NA	NA	NA	NA
AXI18458.1|3562394_3563840_-|protease	metalloprotease TldD	protease	NA	NA	NA	NA
AXI18459.1|3564686_3568607_-	DUF3971 domain-containing protein	NA	NA	NA	NA	NA
AXI18460.1|3568740_3570240_-	ribonuclease E/G	NA	NA	NA	NA	NA
AXI18461.1|3570239_3570812_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
AXI18462.1|3570950_3571685_+	SIMPL domain-containing protein	NA	NA	NA	NA	NA
AXI18463.1|3572156_3575270_+	Oar protein	NA	NA	NA	NA	NA
AXI18464.1|3576688_3577159_-	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
AXI18465.1|3578244_3579360_-	J domain-containing protein	NA	NA	NA	NA	NA
AXI18466.1|3579371_3579788_-	ribosome silencing factor RsfS	NA	NA	NA	NA	NA
AXI18467.1|3579844_3580744_-	nicotinate-nicotinamide nucleotide adenylyltransferase	NA	NA	NA	NA	NA
AXI18468.1|3580740_3581769_-	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
AXI18469.1|3581791_3582427_-	hypothetical protein	NA	NA	NA	NA	NA
AXI18470.1|3582940_3585583_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	39.7	2.7e-172
AXI18471.1|3585655_3586267_-	DUF998 domain-containing protein	NA	NA	NA	NA	NA
AXI18472.1|3586471_3587329_+	co-chaperone YbbN	NA	A0A1J0GW78	Streptomyces_phage	41.8	1.3e-11
AXI18473.1|3587584_3588034_+	DUF4442 domain-containing protein	NA	NA	NA	NA	NA
AXI18474.1|3588333_3589332_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
AXI18475.1|3589396_3589843_+|transposase	transposase	transposase	NA	NA	NA	NA
AXI19753.1|3589608_3590187_+|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
AXI18476.1|3590243_3590432_-	hypothetical protein	NA	NA	NA	NA	NA
AXI18477.1|3590796_3591090_+	hypothetical protein	NA	NA	NA	NA	NA
AXI19754.1|3591684_3593118_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AXI18478.1|3593073_3593274_+	DUF378 domain-containing protein	NA	NA	NA	NA	NA
AXI18479.1|3593307_3594321_+	peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
AXI18480.1|3594288_3594480_-	hypothetical protein	NA	NA	NA	NA	NA
AXI18481.1|3594570_3595968_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AXI18482.1|3595977_3597192_-|transposase	IS4/IS5 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	33.4	1.1e-54
AXI18483.1|3597337_3597865_+	hypothetical protein	NA	NA	NA	NA	NA
AXI18484.1|3597861_3598860_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
AXI18485.1|3599040_3599487_+|transposase	transposase	transposase	NA	NA	NA	NA
AXI19755.1|3599252_3599831_+|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
AXI18486.1|3600132_3602265_+	glycogen debranching enzyme	NA	NA	NA	NA	NA
AXI18487.1|3602815_3603784_-|transposase	IS5/IS1182 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	8.7e-100
AXI18488.1|3603944_3604913_-|transposase	IS5/IS1182 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	1.5e-99
AXI18489.1|3605988_3606402_+	hypothetical protein	NA	NA	NA	NA	NA
AXI19756.1|3606398_3606977_-|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
AXI18490.1|3606742_3607189_-|transposase	transposase	transposase	NA	NA	NA	NA
3607205:3607264	attL	CTAGCATCTACGCGCATCCGCGTGGGGGCTTGAAGAAGGAACTGGTCCAGGCCCTGCGTC	NA	NA	NA	NA
AXI18491.1|3608033_3608831_+|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
AXI18492.1|3608864_3609257_-	histone-like nucleoid-structuring protein	NA	NA	NA	NA	NA
AXI18493.1|3609347_3609740_-	hypothetical protein	NA	NA	NA	NA	NA
AXI18494.1|3610108_3610834_+|transposase	IS5/IS1182 family transposase	transposase	K4I1H9	Acidithiobacillus_phage	64.3	8.6e-36
AXI19757.1|3612078_3612498_+|integrase	integrase	integrase	C8CLF4	Xylella_phage	65.2	5.1e-41
AXI18495.1|3613725_3613950_+	hypothetical protein	NA	NA	NA	NA	NA
AXI18496.1|3614214_3615999_-	autotransporter domain-containing esterase	NA	NA	NA	NA	NA
AXI18497.1|3616189_3616390_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
AXI18498.1|3616925_3617720_+	thiazole synthase	NA	NA	NA	NA	NA
AXI18499.1|3618021_3618780_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
AXI18500.1|3618855_3620718_+	SLC13 family permease	NA	NA	NA	NA	NA
AXI19758.1|3620775_3621117_-	ferredoxin	NA	NA	NA	NA	NA
AXI18501.1|3621376_3621652_+	hypothetical protein	NA	NA	NA	NA	NA
AXI18502.1|3624698_3625412_+	fumarylacetoacetate hydrolase	NA	NA	NA	NA	NA
3623875:3624538	attR	CTAGCATCTACGCGCATCCGCGTGGGGGCTTGAAGAAGGAACTGGTCCAGGCCCTGCGTCAGCACAAGCCCAAACGCGGATGACGGCGTACAACGGCGGCCACACGCAGCTGGGTGCCGGAGGAGTTGCGGATTGTGCATCGCCCCGAAGAAGTGCAGACGCGCTTGGTCCCAGGTCATTGGGAAGGCGACTTGATCAAGGGCGCATTCAATCGTTCTTGCGTGGGCACGTTGGTGGAACGCAAGACGCGCTTTGTCGTGCTGTGCCGCATGGATGGCTGCACGGCCGCAGATGCGCTGGAAGGGTTTACCCGGCAAATGAAGAAACTGCCGGCCTCAATGCGGACAAGTCTGACCTACGATCGCGGTACCGAGCTCACGTGCTACGCCGAGCTGATGCAAGGATTGAACATCGACGTGTGGTTCGCTGATCCACATGCGCCGTGGCAGCGGGGAAGTAACGAGAACACCAACGGCCTGCTGCGCCAATTCCTGCCCAAGGGCGCCGACCTGTCCACTGTCAGCCAAGAGTATCTCAATCACATCGCACTGCTGATGAATACCCGCCCTCGTCAGACGCTCGGATGGAAGACACCAAGCGAGGCAATGGAGGAAGAAATCGCAGCACTCAAATCACGTGTTGCACTTGAATCTTGAGACTGCCC	NA	NA	NA	NA
AXI18503.1|3625472_3625895_+	large-conductance mechanosensitive channel	NA	NA	NA	NA	NA
AXI19759.1|3626026_3626605_-|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
AXI18504.1|3626370_3626817_-|transposase	transposase	transposase	NA	NA	NA	NA
AXI18505.1|3629863_3630775_-	RNA methyltransferase	NA	NA	NA	NA	NA
AXI18506.1|3631168_3631294_-	acetyltransferase	NA	NA	NA	NA	NA
AXI18507.1|3631290_3631467_-	acetyltransferase	NA	NA	NA	NA	NA
AXI18508.1|3632122_3633121_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
>prophage 28
CP021788	Xanthomonas oryzae pv. oryzae strain PXO61 chromosome, complete genome	4980838	4168978	4264099	4980838	tRNA,tail,transposase,protease	Ralstonia_phage(17.65%)	68	NA	NA
AXI19809.1|4168978_4170586_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AXI18904.1|4171861_4173226_-	glutamate--cysteine ligase	NA	NA	NA	NA	NA
AXI18905.1|4173441_4174137_+	VIT family protein	NA	NA	NA	NA	NA
AXI18906.1|4175083_4175707_-	GTP-binding protein	NA	NA	NA	NA	NA
AXI19810.1|4175908_4176649_+	cytochrome c4	NA	NA	NA	NA	NA
AXI18907.1|4176742_4177393_+	dihydroneopterin aldolase	NA	NA	NA	NA	NA
AXI18908.1|4177484_4178300_+	thiol:disulfide interchange protein	NA	NA	NA	NA	NA
AXI19811.1|4178349_4179087_+	endonuclease	NA	NA	NA	NA	NA
AXI18909.1|4181015_4182005_+|transposase	IS5/IS1182 family transposase	transposase	A0A077K814	Ralstonia_phage	61.2	7.5e-99
AXI18910.1|4182127_4184701_+	cystathionine gamma-synthase	NA	NA	NA	NA	NA
AXI18911.1|4184866_4185313_+|transposase	transposase	transposase	NA	NA	NA	NA
AXI19812.1|4185078_4185657_+	hypothetical protein	NA	NA	NA	NA	NA
AXI18912.1|4185729_4186698_+|transposase	IS5/IS1182 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
AXI18913.1|4187431_4187698_+	hypothetical protein	NA	NA	NA	NA	NA
AXI18914.1|4188629_4189428_-|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
AXI19813.1|4191074_4192307_+|tRNA	multifunctional CCA tRNA nucleotidyl transferase/2'3'-cyclic phosphodiesterase/2'nucleotidase/phosphatase	tRNA	K4IEX3	Salmonella_phage	41.7	2.0e-72
AXI18915.1|4192346_4193309_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
AXI18916.1|4193484_4194441_-|transposase	IS30 family transposase IS1112a	transposase	Q9MBM9	Staphylococcus_prophage	35.2	2.1e-42
AXI18917.1|4194652_4195621_-|transposase	IS5 family transposase ISXo1	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
AXI18918.1|4195929_4196376_+|transposase	transposase	transposase	NA	NA	NA	NA
AXI19814.1|4196141_4196720_+|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
AXI18919.1|4200096_4201095_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
AXI18920.1|4201556_4201787_-	hypothetical protein	NA	NA	NA	NA	NA
AXI18921.1|4202410_4204453_+	poly-beta-1,6 N-acetyl-D-glucosamine export porin PgaA	NA	NA	NA	NA	NA
AXI18922.1|4204454_4206353_+	poly-beta-1,6-N-acetyl-D-glucosamine N-deacetylase PgaB	NA	NA	NA	NA	NA
AXI18923.1|4206354_4207608_+	poly-beta-1,6 N-acetyl-D-glucosamine synthase	NA	NA	NA	NA	NA
AXI18924.1|4207604_4208210_+	poly-beta-1,6-N-acetyl-D-glucosamine biosynthesis protein PgaD	NA	NA	NA	NA	NA
AXI18925.1|4208629_4209784_-	N-acetylglucosamine-6-phosphate deacetylase	NA	NA	NA	NA	NA
AXI18926.1|4209786_4210815_-	iron dicitrate transport regulator FecR	NA	NA	NA	NA	NA
AXI18927.1|4210811_4211888_-	LacI family transcriptional regulator	NA	NA	NA	NA	NA
AXI18928.1|4211928_4213206_-	glucose/galactose MFS transporter	NA	NA	NA	NA	NA
AXI18929.1|4213250_4214018_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AXI18930.1|4214232_4215399_-	DUF5009 domain-containing protein	NA	NA	NA	NA	NA
AXI18931.1|4217942_4220840_-	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	25.2	8.8e-23
AXI18932.1|4220990_4223681_-	TonB-dependent receptor	NA	NA	NA	NA	NA
AXI18933.1|4223961_4224918_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.2	1.6e-42
AXI18934.1|4224951_4225164_-	hypothetical protein	NA	NA	NA	NA	NA
AXI18935.1|4225120_4225405_+	hypothetical protein	NA	NA	NA	NA	NA
AXI18936.1|4225408_4226644_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
AXI18937.1|4227573_4227990_+	hypothetical protein	NA	U5P429	Shigella_phage	54.0	7.7e-13
AXI19815.1|4228079_4229264_-	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AXI18938.1|4229331_4230069_+	pteridine reductase	NA	NA	NA	NA	NA
AXI18939.1|4230237_4230753_-	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
AXI18940.1|4230844_4232347_-	hybrid sensor histidine kinase/response regulator	NA	A0A2K9L5I4	Tupanvirus	26.2	1.1e-08
AXI18941.1|4232350_4232791_-	response regulator	NA	NA	NA	NA	NA
AXI18942.1|4232787_4234599_-	histidine kinase	NA	A0A2K9L0Z8	Tupanvirus	28.3	3.5e-09
AXI19816.1|4234884_4235247_-	BON domain-containing protein	NA	NA	NA	NA	NA
AXI18943.1|4235406_4236459_+	oxidoreductase	NA	NA	NA	NA	NA
AXI18944.1|4236798_4237740_-	6-phosphogluconate dehydrogenase (decarboxylating)	NA	M4SJX8	Cyanophage	44.9	5.9e-69
AXI18945.1|4237760_4239098_-	hypothetical protein	NA	NA	NA	NA	NA
AXI18946.1|4239269_4239650_-	hypothetical protein	NA	NA	NA	NA	NA
AXI18947.1|4239774_4240536_-	hypothetical protein	NA	NA	NA	NA	NA
AXI18948.1|4242784_4244188_-	nicotinate phosphoribosyltransferase	NA	A0A218M332	Acidovorax_phage	51.5	8.1e-131
AXI18949.1|4244310_4245366_-	ADP-ribose pyrophosphatase	NA	A0A1B0V161	Roseobacter_phage	47.1	1.3e-80
AXI19817.1|4245538_4246393_+	endonuclease	NA	NA	NA	NA	NA
AXI18950.1|4246684_4248868_-|tail,protease	tail-specific protease	tail,protease	A0A0R6PIZ1	Moraxella_phage	31.6	2.8e-82
AXI19818.1|4249366_4250362_-	restriction endonuclease	NA	NA	NA	NA	NA
AXI18951.1|4252512_4253526_-	lipoyl synthase	NA	NA	NA	NA	NA
AXI18952.1|4253540_4254239_-	octanoyltransferase	NA	NA	NA	NA	NA
AXI18953.1|4254226_4254505_-	hypothetical protein	NA	NA	NA	NA	NA
AXI18954.1|4255570_4256776_-	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	40.9	4.6e-66
AXI18955.1|4256884_4257166_+	hypothetical protein	NA	NA	NA	NA	NA
AXI18956.1|4257276_4258692_-	septal ring lytic transglycosylase RlpA family protein	NA	F5B3X9	Synechococcus_phage	50.6	4.3e-15
AXI18957.1|4258688_4259828_-	lytic murein transglycosylase B	NA	NA	NA	NA	NA
AXI18958.1|4260096_4260549_-	polygalacturonase	NA	NA	NA	NA	NA
AXI18959.1|4261567_4262842_-	peptigoglycan-binding protein LysM	NA	B3FJ91	Pseudomonas_phage	33.7	1.2e-21
AXI18960.1|4262841_4263060_-	hypothetical protein	NA	NA	NA	NA	NA
AXI18961.1|4263136_4264099_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
>prophage 29
CP021788	Xanthomonas oryzae pv. oryzae strain PXO61 chromosome, complete genome	4980838	4278162	4333044	4980838	tRNA,transposase	Erwinia_phage(22.22%)	41	NA	NA
AXI18971.1|4278162_4279131_-|transposase	IS5/IS1182 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
AXI18972.1|4279186_4279984_+|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
AXI18973.1|4280742_4281114_-	hypothetical protein	NA	K4I1H9	Acidithiobacillus_phage	64.0	2.3e-24
AXI18974.1|4281125_4281581_-|tRNA	tRNA-specific adenosine deaminase	tRNA	NA	NA	NA	NA
AXI18975.1|4281577_4282078_-	drug:proton antiporter	NA	NA	NA	NA	NA
AXI18976.1|4283328_4284405_-	HlyD family secretion protein	NA	NA	NA	NA	NA
AXI18977.1|4286131_4286893_+	ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE	NA	NA	NA	NA	NA
AXI18978.1|4287065_4287956_+	diguanylate cyclase	NA	NA	NA	NA	NA
AXI18979.1|4288077_4290090_+	aminopeptidase	NA	NA	NA	NA	NA
AXI18980.1|4290261_4290981_+	hypothetical protein	NA	NA	NA	NA	NA
AXI18981.1|4291289_4291904_+	HAD family hydrolase	NA	NA	NA	NA	NA
AXI18982.1|4292077_4293445_-	HslU--HslV peptidase ATPase subunit	NA	A0A2H5BJT2	Erwinia_phage	29.1	6.2e-43
AXI18983.1|4293555_4294107_-	HslU--HslV peptidase proteolytic subunit	NA	NA	NA	NA	NA
AXI19820.1|4294622_4295540_-	tyrosine recombinase XerC	NA	A0A142F2H8	Mycobacterium_phage	27.7	2.2e-12
AXI18984.1|4295739_4296420_-	hypothetical protein	NA	NA	NA	NA	NA
AXI19821.1|4297543_4297942_-	DUF454 domain-containing protein	NA	NA	NA	NA	NA
AXI18985.1|4298285_4300421_-	oligopeptidase B	NA	F2Y2Z7	Organic_Lake_phycodnavirus	26.1	2.1e-29
AXI18986.1|4300544_4301729_+	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
AXI19822.1|4302054_4302486_-	hypothetical protein	NA	NA	NA	NA	NA
AXI18987.1|4302568_4304662_-	S9 family peptidase	NA	NA	NA	NA	NA
AXI18988.1|4304729_4305041_-	hypothetical protein	NA	NA	NA	NA	NA
AXI18989.1|4305428_4305998_+	hypothetical protein	NA	NA	NA	NA	NA
AXI18990.1|4306106_4307072_-	transcriptional regulator	NA	NA	NA	NA	NA
AXI18991.1|4307630_4308431_+	hypothetical protein	NA	NA	NA	NA	NA
AXI18992.1|4308981_4309896_-	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
AXI18993.1|4309926_4310664_-	DNA-binding response regulator	NA	NA	NA	NA	NA
AXI18994.1|4310694_4311747_-	histidine kinase	NA	Q9EYF3	Enterobacteria_phage	33.6	1.8e-18
AXI18995.1|4311751_4312420_-	carboxylesterase	NA	NA	NA	NA	NA
AXI18996.1|4312571_4314509_-	glucan biosynthesis protein H	NA	NA	NA	NA	NA
AXI18997.1|4315208_4315655_+|transposase	transposase	transposase	NA	NA	NA	NA
AXI18998.1|4315612_4315999_+|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
AXI18999.1|4316124_4316385_+	hypothetical protein	NA	NA	NA	NA	NA
AXI19000.1|4316312_4317962_-	peptidase M20	NA	NA	NA	NA	NA
AXI19001.1|4319362_4320850_-	sodium-independent anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	56.7	1.0e-123
AXI19823.1|4321057_4322506_+	endoglucanase	NA	H2DE45	Erwinia_phage	32.3	7.5e-47
AXI19002.1|4323740_4326365_-	sensor domain-containing diguanylate cyclase	NA	G3MA91	Bacillus_virus	28.6	1.9e-08
AXI19003.1|4326620_4329491_+	peptidase M16	NA	NA	NA	NA	NA
AXI19004.1|4330038_4330968_+	GAF domain-containing protein	NA	NA	NA	NA	NA
AXI19005.1|4331006_4332011_-	hypothetical protein	NA	NA	NA	NA	NA
AXI19824.1|4332253_4332832_-|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
AXI19006.1|4332597_4333044_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 30
CP021788	Xanthomonas oryzae pv. oryzae strain PXO61 chromosome, complete genome	4980838	4373357	4419185	4980838	protease,transposase	Ralstonia_phage(66.67%)	45	NA	NA
AXI19029.1|4373357_4374017_+|protease	zinc metalloprotease	protease	NA	NA	NA	NA
AXI19030.1|4374013_4374679_+	peptidase M4	NA	NA	NA	NA	NA
AXI19031.1|4374685_4374910_+	hypothetical protein	NA	NA	NA	NA	NA
AXI19032.1|4375051_4375537_+	hypothetical protein	NA	NA	NA	NA	NA
AXI19033.1|4376075_4378904_+	monovalent cation/H+ antiporter subunit A	NA	NA	NA	NA	NA
AXI19034.1|4378903_4379278_+	Na+/H+ antiporter subunit C	NA	NA	NA	NA	NA
AXI19035.1|4379274_4380819_+	monovalent cation/H+ antiporter subunit D	NA	NA	NA	NA	NA
AXI19036.1|4380815_4381322_+	Na+/H+ antiporter subunit E	NA	NA	NA	NA	NA
AXI19037.1|4381318_4381603_+	K+/H+ antiporter subunit F	NA	NA	NA	NA	NA
AXI19038.1|4381599_4381953_+	Na+/H+ antiporter subunit G	NA	NA	NA	NA	NA
AXI19039.1|4382349_4382739_+	hypothetical protein	NA	NA	NA	NA	NA
AXI19040.1|4382922_4383891_+|transposase	IS5/IS1182 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
AXI19041.1|4384322_4385648_-	homogentisate 1,2-dioxygenase	NA	NA	NA	NA	NA
AXI19042.1|4386012_4387083_-	4-hydroxyphenylpyruvate dioxygenase	NA	NA	NA	NA	NA
AXI19043.1|4387246_4387741_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AXI19044.1|4388097_4388688_-	thioredoxin family protein	NA	NA	NA	NA	NA
AXI19045.1|4388699_4390208_-	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	33.4	1.1e-61
AXI19046.1|4390650_4391544_-	tryptophan 2,3-dioxygenase	NA	NA	NA	NA	NA
AXI19047.1|4392926_4393592_+	pyruvate dehydrogenase E1 subunit alpha	NA	NA	NA	NA	NA
AXI19048.1|4394191_4395190_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
AXI19049.1|4395722_4396103_+	peptide-binding protein	NA	NA	NA	NA	NA
AXI19050.1|4396305_4397211_-	hypothetical protein	NA	NA	NA	NA	NA
AXI19051.1|4397279_4398575_+	acetyl-CoA acetyltransferase	NA	NA	NA	NA	NA
AXI19832.1|4398665_4399229_+	hypothetical protein	NA	NA	NA	NA	NA
AXI19052.1|4399654_4400920_-	porphyrin biosynthesis protein	NA	NA	NA	NA	NA
AXI19053.1|4400916_4401894_-	hypothetical protein	NA	NA	NA	NA	NA
AXI19054.1|4401997_4402801_-	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
AXI19055.1|4402976_4403786_+	glycosyl transferase	NA	NA	NA	NA	NA
AXI19056.1|4403793_4404592_-|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
AXI19833.1|4404634_4405282_-	hypothetical protein	NA	NA	NA	NA	NA
AXI19057.1|4405376_4405952_-	hypothetical protein	NA	NA	NA	NA	NA
AXI19058.1|4406100_4407483_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AXI19059.1|4407632_4408601_+|transposase	IS5/IS1182 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
AXI19060.1|4408726_4409479_-	haloacid dehalogenase	NA	NA	NA	NA	NA
AXI19061.1|4409516_4409957_-	hypothetical protein	NA	NA	NA	NA	NA
AXI19834.1|4410163_4410505_-	hypothetical protein	NA	NA	NA	NA	NA
AXI19062.1|4410730_4411108_-	hypothetical protein	NA	NA	NA	NA	NA
AXI19835.1|4411318_4411516_-	CPXCG motif-containing cysteine-rich protein	NA	NA	NA	NA	NA
AXI19063.1|4411822_4412569_-	D-alanyl-D-alanine dipeptidase	NA	NA	NA	NA	NA
AXI19064.1|4412661_4413468_-	N-acetylmuramoyl-L-alanine amidase	NA	NA	NA	NA	NA
AXI19836.1|4413691_4415104_+	NlpC-P60 family protein	NA	NA	NA	NA	NA
AXI19065.1|4415100_4416198_+	dipeptide epimerase	NA	NA	NA	NA	NA
AXI19066.1|4416352_4417151_-|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
AXI19067.1|4417204_4418003_-|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
AXI19068.1|4418081_4419185_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
>prophage 31
CP021788	Xanthomonas oryzae pv. oryzae strain PXO61 chromosome, complete genome	4980838	4422825	4489130	4980838	tRNA,transposase	Acinetobacter_phage(27.27%)	54	NA	NA
AXI19073.1|4422825_4423212_-|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
AXI19074.1|4423283_4424519_+|transposase	ISL3 family transposase ISXoo13	transposase	NA	NA	NA	NA
AXI19075.1|4424522_4424936_-	hypothetical protein	NA	NA	NA	NA	NA
AXI19076.1|4425112_4425394_+	hypothetical protein	NA	NA	NA	NA	NA
AXI19077.1|4425954_4426392_-	hypothetical protein	NA	NA	NA	NA	NA
AXI19078.1|4426394_4427363_+|transposase	IS5 family transposase ISXo1	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
AXI19079.1|4427723_4428902_+	glucose dehydrogenase	NA	NA	NA	NA	NA
AXI19080.1|4429807_4430860_+|transposase	DDE transposase	transposase	NA	NA	NA	NA
AXI19081.1|4433193_4435365_-	beta-glucosidase	NA	NA	NA	NA	NA
AXI19082.1|4435592_4435949_-	dihydroneopterin aldolase	NA	NA	NA	NA	NA
AXI19083.1|4436027_4437092_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	56.6	4.3e-100
AXI19084.1|4437371_4437587_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
AXI19085.1|4437909_4438356_+|tRNA	glutamyl-tRNA amidotransferase	tRNA	A0A292GL36	Xanthomonas_phage	45.2	1.0e-23
AXI19086.1|4439833_4440796_+	YihY/virulence factor BrkB family protein	NA	NA	NA	NA	NA
AXI19087.1|4440885_4442634_+	DNA primase	NA	A0A1S5RF71	Helicobacter_phage	34.5	4.2e-44
AXI19088.1|4444206_4444440_-	hypothetical protein	NA	NA	NA	NA	NA
AXI19089.1|4444697_4445744_+	bile acid:sodium symporter	NA	NA	NA	NA	NA
AXI19090.1|4445927_4447508_+	thiol reductase thioredoxin	NA	NA	NA	NA	NA
AXI19091.1|4447896_4448793_-	protoheme IX farnesyltransferase	NA	NA	NA	NA	NA
AXI19092.1|4448795_4449959_-	heme A synthase	NA	NA	NA	NA	NA
AXI19093.1|4449969_4450545_-	hypothetical protein	NA	NA	NA	NA	NA
AXI19094.1|4450572_4451292_-	SURF1 family protein	NA	NA	NA	NA	NA
AXI19095.1|4451352_4451571_+	DUF2909 domain-containing protein	NA	NA	NA	NA	NA
AXI19096.1|4451670_4452546_-	cytochrome c oxidase subunit 3	NA	NA	NA	NA	NA
AXI19097.1|4452584_4453181_-	cytochrome c oxidase assembly protein	NA	NA	NA	NA	NA
AXI19098.1|4453177_4453351_-	hypothetical protein	NA	NA	NA	NA	NA
AXI19099.1|4453331_4454936_-	cytochrome c oxidase subunit I	NA	NA	NA	NA	NA
AXI19100.1|4454974_4455928_-	cytochrome c oxidase subunit II	NA	NA	NA	NA	NA
AXI19837.1|4455944_4456421_-	DUF2244 domain-containing protein	NA	NA	NA	NA	NA
AXI19101.1|4456697_4459898_+	bifunctional proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
AXI19102.1|4461080_4462079_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
AXI19103.1|4462091_4462562_-	bacterioferritin	NA	NA	NA	NA	NA
AXI19838.1|4462904_4463120_-	bacterioferritin	NA	NA	NA	NA	NA
AXI19104.1|4463200_4463818_-	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
AXI19105.1|4464366_4464759_-	30S ribosomal protein S9	NA	NA	NA	NA	NA
AXI19106.1|4464762_4465191_-	50S ribosomal protein L13	NA	NA	NA	NA	NA
AXI19839.1|4465376_4466030_+	demethoxyubiquinone hydroxylase family protein	NA	NA	NA	NA	NA
AXI19107.1|4466285_4466600_-	QacE family quaternary ammonium compound efflux SMR transporter	NA	NA	NA	NA	NA
AXI19108.1|4466759_4467554_-	S-adenosylmethionine decarboxylase proenzyme	NA	NA	NA	NA	NA
AXI19109.1|4467691_4468384_+	CRP-like protein Clp	NA	NA	NA	NA	NA
AXI19110.1|4468704_4469421_-	haloacid dehalogenase-like hydrolase	NA	NA	NA	NA	NA
AXI19111.1|4469413_4470211_-	indole-3-glycerol-phosphate synthase	NA	A0A0P0IR83	Acinetobacter_phage	52.9	7.5e-65
AXI19112.1|4470347_4471385_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	44.1	7.2e-76
AXI19113.1|4471502_4472132_-	Asp/Glu/hydantoin racemase	NA	NA	NA	NA	NA
AXI19114.1|4472128_4472287_-	molybdopterin biosynthesis protein	NA	NA	NA	NA	NA
AXI19115.1|4472283_4472865_-	glutamine amidotransferase	NA	A0A0P0IKJ1	Acinetobacter_phage	59.3	3.2e-65
AXI19116.1|4475441_4475681_-	biotin transporter BioY	NA	NA	NA	NA	NA
AXI19117.1|4475997_4478229_-	isocitrate dehydrogenase, NADP-dependent	NA	NA	NA	NA	NA
AXI19840.1|4478418_4480131_+	hypothetical protein	NA	NA	NA	NA	NA
AXI19118.1|4480279_4481656_+|transposase	IS5/IS1182 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	56.5	3.7e-80
AXI19119.1|4483863_4484662_-|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
AXI19120.1|4485646_4486615_-|transposase	IS5/IS1182 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	5.6e-99
AXI19121.1|4486781_4487753_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	34.9	7.2e-38
AXI19122.1|4487945_4489130_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	44.8	5.0e-41
>prophage 32
CP021788	Xanthomonas oryzae pv. oryzae strain PXO61 chromosome, complete genome	4980838	4503008	4571304	4980838	tRNA,transposase	Erysipelothrix_phage(12.5%)	47	NA	NA
AXI19129.1|4503008_4504007_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
AXI19130.1|4504392_4505391_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
AXI19841.1|4505820_4506291_+	thioesterase	NA	NA	NA	NA	NA
AXI19131.1|4506319_4506742_+	hypothetical protein	NA	NA	NA	NA	NA
AXI19132.1|4506817_4507252_+	hypothetical protein	NA	NA	NA	NA	NA
AXI19133.1|4507361_4507877_+	protein-export protein SecB	NA	NA	NA	NA	NA
AXI19134.1|4507892_4508918_+	glycerol-3-phosphate dehydrogenase (NAD(P)(+))	NA	NA	NA	NA	NA
AXI19135.1|4509240_4509837_-	Ax21 family protein	NA	NA	NA	NA	NA
AXI19136.1|4510194_4511922_+	pyruvate oxidase	NA	NA	NA	NA	NA
AXI19137.1|4511971_4513414_+	two-component sensor histidine kinase	NA	NA	NA	NA	NA
AXI19138.1|4513398_4514745_+	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
AXI19139.1|4514935_4515685_+	hypothetical protein	NA	NA	NA	NA	NA
AXI19140.1|4515786_4516398_+	hypothetical protein	NA	NA	NA	NA	NA
AXI19141.1|4516502_4517726_+	MFS transporter	NA	NA	NA	NA	NA
AXI19142.1|4518067_4518544_-|tRNA	tRNA (uridine(34)/cytosine(34)/5- carboxymethylaminomethyluridine(34)-2'-O)- methyltransferase TrmL	tRNA	NA	NA	NA	NA
AXI19143.1|4518570_4519032_-	hypothetical protein	NA	NA	NA	NA	NA
AXI19144.1|4519417_4519738_+	hypothetical protein	NA	NA	NA	NA	NA
AXI19145.1|4519839_4520856_+	3-oxoacyl-ACP synthase III	NA	NA	NA	NA	NA
AXI19146.1|4520927_4522091_+	addiction module protein	NA	NA	NA	NA	NA
AXI19147.1|4522087_4523719_+	site-specific DNA-methyltransferase	NA	A0A2K5B2C1	Erysipelothrix_phage	37.5	1.7e-63
AXI19148.1|4523720_4526222_+	helicase SNF2	NA	NA	NA	NA	NA
AXI19149.1|4526218_4527121_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
AXI19150.1|4527342_4527726_-	zinc/iron-chelating domain-containing protein	NA	NA	NA	NA	NA
AXI19151.1|4528044_4529715_+	peptide synthase	NA	NA	NA	NA	NA
AXI19152.1|4529943_4530954_+	3-beta hydroxysteroid dehydrogenase	NA	A0A0E3FNQ3	Synechococcus_phage	32.6	1.5e-14
AXI19153.1|4531018_4531177_+	DUF1328 domain-containing protein	NA	NA	NA	NA	NA
AXI19154.1|4531411_4532788_+|transposase	IS5/IS1182 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.1	5.0e-77
AXI19155.1|4532798_4533332_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AXI19156.1|4533760_4535020_-	phosphodiesterase	NA	NA	NA	NA	NA
AXI19157.1|4535158_4536466_-	MFS transporter	NA	NA	NA	NA	NA
AXI19158.1|4536637_4536859_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AXI19159.1|4537915_4538494_+|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
AXI19842.1|4538550_4539585_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	32.8	8.0e-43
AXI19160.1|4539935_4540481_+	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
AXI19843.1|4540506_4540773_-	zinc/iron-chelating domain-containing protein	NA	NA	NA	NA	NA
AXI19161.1|4540947_4542786_+	dihydroxy-acid dehydratase	NA	NA	NA	NA	NA
AXI19162.1|4543016_4543904_-	recombinase XerD	NA	A0A1P8DJJ6	Virus_Rctr41k	48.5	4.1e-56
AXI19163.1|4545376_4546612_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
AXI19164.1|4549588_4550488_+	coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
AXI19165.1|4551435_4554237_-	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	30.4	2.4e-65
AXI19166.1|4554313_4554604_+	hypothetical protein	NA	NA	NA	NA	NA
AXI19167.1|4556167_4556758_-	hypothetical protein	NA	NA	NA	NA	NA
AXI19168.1|4557240_4557495_+	hypothetical protein	NA	NA	NA	NA	NA
AXI19169.1|4557993_4560681_-	pyruvate dehydrogenase (acetyl-transferring), homodimeric type	NA	NA	NA	NA	NA
AXI19170.1|4563741_4564710_-|transposase	IS5/IS1182 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	1.8e-97
AXI19171.1|4569168_4569369_-	hypothetical protein	NA	NA	NA	NA	NA
AXI19172.1|4570791_4571304_-|transposase	transposase	transposase	Q8W6R2	Burkholderia_virus	68.8	1.6e-44
>prophage 33
CP021788	Xanthomonas oryzae pv. oryzae strain PXO61 chromosome, complete genome	4980838	4669334	4727634	4980838	tRNA,transposase	Leptospira_phage(50.0%)	34	NA	NA
AXI19237.1|4669334_4670333_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
AXI19238.1|4670400_4670826_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AXI19239.1|4670841_4671288_+|transposase	transposase	transposase	NA	NA	NA	NA
AXI19858.1|4671053_4671632_+|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
AXI19240.1|4671693_4672725_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	42.9	2.0e-70
AXI19241.1|4674085_4675342_+	alanine--glyoxylate aminotransferase family protein	NA	NA	NA	NA	NA
AXI19242.1|4675338_4676229_+	chitin deacetylase	NA	NA	NA	NA	NA
AXI19243.1|4676225_4676621_+	DUF4440 domain-containing protein	NA	NA	NA	NA	NA
AXI19859.1|4676640_4677219_+	OHCU decarboxylase	NA	NA	NA	NA	NA
AXI19244.1|4680104_4680284_+	hypothetical protein	NA	NA	NA	NA	NA
AXI19245.1|4681799_4681931_+	hypothetical protein	NA	NA	NA	NA	NA
AXI19246.1|4684067_4686152_-	S9 family peptidase	NA	NA	NA	NA	NA
AXI19247.1|4686251_4688279_-	3-methylcrotonyl-CoA carboxylase	NA	NA	NA	NA	NA
AXI19248.1|4688521_4690132_-	methylcrotonoyl-CoA carboxylase	NA	A0A1B2ITV7	Pike_perch_iridovirus	51.5	1.1e-19
AXI19249.1|4690142_4691306_-	isovaleryl-CoA dehydrogenase	NA	NA	NA	NA	NA
AXI19250.1|4691434_4692055_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AXI19251.1|4692385_4692574_-	hypothetical protein	NA	NA	NA	NA	NA
AXI19252.1|4692616_4692952_-	DUF3325 domain-containing protein	NA	NA	NA	NA	NA
AXI19253.1|4694576_4694888_-	hypothetical protein	NA	NA	NA	NA	NA
AXI19254.1|4696006_4696525_+	cytochrome c5 family protein	NA	NA	NA	NA	NA
AXI19255.1|4696796_4698515_+	nuclease	NA	NA	NA	NA	NA
AXI19256.1|4698605_4698992_-	hypothetical protein	NA	NA	NA	NA	NA
AXI19257.1|4699053_4700379_+	GTP-binding protein	NA	NA	NA	NA	NA
AXI19258.1|4700493_4701807_-	type III effector protein XopR	NA	NA	NA	NA	NA
AXI19860.1|4702846_4703509_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
AXI19259.1|4703587_4704682_+	cell division protein ZapE	NA	NA	NA	NA	NA
AXI19260.1|4705800_4705989_-	hypothetical protein	NA	NA	NA	NA	NA
AXI19261.1|4709197_4710787_-	sulfotransferase family protein	NA	NA	NA	NA	NA
AXI19262.1|4710786_4713024_-|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
AXI19263.1|4713312_4714221_-|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
AXI19264.1|4714310_4716125_+	type II/IV secretion system protein	NA	NA	NA	NA	NA
AXI19861.1|4716510_4724997_-	type III secretion system effector XopAD	NA	NA	NA	NA	NA
AXI19265.1|4725434_4726232_+|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
AXI19266.1|4726251_4727634_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
>prophage 34
CP021788	Xanthomonas oryzae pv. oryzae strain PXO61 chromosome, complete genome	4980838	4737885	4779682	4980838	tRNA,transposase	Escherichia_phage(25.0%)	29	NA	NA
AXI19279.1|4737885_4738803_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	62.5	3.1e-83
AXI19280.1|4738893_4739403_-	hypothetical protein	NA	NA	NA	NA	NA
AXI19281.1|4739406_4740744_+	xylose isomerase	NA	NA	NA	NA	NA
AXI19282.1|4740969_4742037_-	LacI family transcriptional regulator	NA	NA	NA	NA	NA
AXI19283.1|4742212_4744408_+	alpha-glucuronidase	NA	NA	NA	NA	NA
AXI19284.1|4744404_4746369_+	9-O-acetylesterase	NA	NA	NA	NA	NA
AXI19285.1|4746380_4747640_+	bifunctional D-altronate/D-mannonate dehydratase	NA	Q6A202	Oenococcus_phage	26.0	3.5e-40
AXI19286.1|4749341_4752056_+	glucan 1,4-alpha-glucosidase	NA	NA	NA	NA	NA
AXI19287.1|4752278_4753751_+	mannitol dehydrogenase	NA	G8DCZ3	Micromonas_pusilla_virus	32.1	4.5e-47
AXI19288.1|4754728_4755784_-	hypothetical protein	NA	NA	NA	NA	NA
AXI19289.1|4756011_4757430_-	uronate isomerase	NA	NA	NA	NA	NA
AXI19290.1|4757470_4758448_-	1,4-beta-xylanase	NA	NA	NA	NA	NA
AXI19291.1|4759864_4761346_-	MFS transporter	NA	NA	NA	NA	NA
AXI19863.1|4761687_4764561_+	TonB-dependent receptor	NA	NA	NA	NA	NA
AXI19292.1|4764659_4766147_+	MFS transporter	NA	NA	NA	NA	NA
AXI19293.1|4766178_4767213_+	alpha-N-arabinofuranosidase	NA	NA	NA	NA	NA
AXI19294.1|4767629_4768427_+|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
AXI19864.1|4769303_4769441_-	hypothetical protein	NA	NA	NA	NA	NA
AXI19295.1|4769700_4770690_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
AXI19296.1|4770919_4771375_+	histidine kinase	NA	NA	NA	NA	NA
AXI19297.1|4771390_4771837_+|transposase	transposase	transposase	NA	NA	NA	NA
AXI19865.1|4771602_4772181_+	hypothetical protein	NA	NA	NA	NA	NA
AXI19298.1|4772197_4773298_+	signal EAL domain protein	NA	NA	NA	NA	NA
AXI19299.1|4773363_4774485_-	acyl-CoA desaturase	NA	NA	NA	NA	NA
AXI19300.1|4774494_4775589_-	ferredoxin reductase	NA	NA	NA	NA	NA
AXI19301.1|4775663_4776344_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AXI19302.1|4776376_4777175_-|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
AXI19303.1|4777216_4778623_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AXI19866.1|4778725_4779682_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	36.0	1.4e-41
