The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	0	2712	5214712		Enterobacteria_phage(100.0%)	1	NA	NA
AXH16510.1|1977_2712_+	acyltransferase	NA	C7U0W4	Enterobacteria_phage	99.1	2.9e-79
>prophage 2
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	5865	6798	5214712		Enterobacteria_phage(100.0%)	1	NA	NA
AXH16511.1|5865_6798_-	hypothetical protein	NA	E7DYY8	Enterobacteria_phage	99.0	4.6e-167
>prophage 3
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	23255	24341	5214712		Pandoravirus(100.0%)	1	NA	NA
AXH16528.1|23255_24341_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	47.8	1.6e-89
>prophage 4
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	32877	34014	5214712		Brazilian_cedratvirus(100.0%)	1	NA	NA
AXH16537.1|32877_34014_+	erythronate-4-phosphate dehydrogenase	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.1	1.3e-22
>prophage 5
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	40672	42190	5214712		Mollivirus(100.0%)	1	NA	NA
AXH16545.1|40672_42190_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	44.0	4.5e-87
>prophage 6
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	46401	48261	5214712	transposase	Acanthocystis_turfacea_Chlorella_virus(50.0%)	2	NA	NA
AXH16551.1|46401_47175_+	histidine transport ATP-binding protein HisP	NA	M1I0T9	Acanthocystis_turfacea_Chlorella_virus	28.2	2.1e-08
AXH16552.1|47370_48261_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	53.1	4.0e-67
>prophage 7
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	58819	62047	5214712		Acanthocystis_turfacea_Chlorella_virus(50.0%)	3	NA	NA
AXH16563.1|58819_59470_+	sugar phosphatase	NA	M1IMD4	Acanthocystis_turfacea_Chlorella_virus	27.5	3.6e-09
AXH16564.1|59556_61389_+	SLC13 family permease	NA	NA	NA	NA	NA
AXH16565.1|61447_62047_-	5'-deoxynucleotidase	NA	A0A2L0V156	Salmonella_phage	38.6	7.0e-07
>prophage 8
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	97008	102012	5214712		Tupanvirus(50.0%)	4	NA	NA
AXH16599.1|97008_98991_-	bifunctional UDP-4-amino-4-deoxy-L-arabinose formyltransferase/UDP-glucuronic acid oxidase ArnA	NA	A0A2K9KZK0	Tupanvirus	25.8	2.4e-19
AXH16600.1|98990_99959_-	undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase	NA	F1C5B0	Cronobacter_phage	31.5	1.2e-35
AXH16601.1|99962_101102_-	UDP-4-amino-4-deoxy-L-arabinose-oxoglutarate aminotransferase	NA	A0A2K9L470	Tupanvirus	29.5	7.2e-29
AXH16602.1|101409_102012_+	histidine phosphatase family protein	NA	A0A2L1IV13	Escherichia_phage	41.7	7.5e-09
>prophage 9
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	105615	110174	5214712	transposase	Oenococcus_phage(50.0%)	5	NA	NA
AXH21143.1|105615_106821_+	L-rhamnonate dehydratase	NA	Q6A202	Oenococcus_phage	28.5	2.5e-27
AXH16607.1|106877_108167_+	MFS transporter	NA	NA	NA	NA	NA
AXH16608.1|108184_108988_+	2-keto-3-deoxy-L-rhamnonate aldolase	NA	NA	NA	NA	NA
AXH16609.1|109028_109250_-	hypothetical protein	NA	NA	NA	NA	NA
AXH16610.1|109262_110174_-|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	54.4	7.4e-69
>prophage 10
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	116066	129986	5214712		Pseudomonas_phage(33.33%)	8	NA	NA
AXH16615.1|116066_117143_+	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	46.0	5.1e-08
AXH16616.1|117345_117996_+	lipopolysaccharide kinase InaA	NA	NA	NA	NA	NA
AXH16617.1|118049_118304_-	ferredoxin	NA	G9IAA2	Pseudomonas_phage	73.1	2.6e-24
AXH16618.1|118303_119434_-	ribonucleotide-diphosphate reductase subunit beta	NA	G9IAA3	Pseudomonas_phage	78.9	2.5e-175
AXH16619.1|119623_121909_-	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2D1GNB1	Pseudoalteromonas_phage	63.6	1.9e-283
AXH21144.1|122591_126350_+	AIDA-I family autotransporter YfaL	NA	A0A2L1IV18	Escherichia_phage	28.2	4.4e-22
AXH16620.1|126489_127212_-	bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase	NA	NA	NA	NA	NA
AXH16621.1|127358_129986_+	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	31.4	1.4e-88
>prophage 11
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	144909	149752	5214712		Bacillus_phage(50.0%)	2	NA	NA
AXH16632.1|144909_146736_-	two-component system sensor histidine kinase AtoS	NA	W8CYF6	Bacillus_phage	26.5	2.9e-19
AXH16633.1|146902_149752_+	two-component system sensor histidine kinase RcsC	NA	A0A1V0SGX0	Hokovirus	27.2	1.1e-41
>prophage 12
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	154029	159831	5214712		Enterobacteria_phage(25.0%)	5	NA	NA
AXH16638.1|154029_155157_+	porin	NA	Q1MVN1	Enterobacteria_phage	57.9	3.2e-114
AXH16639.1|155268_156324_+	FAD:protein FMN transferase ApbE	NA	NA	NA	NA	NA
AXH16640.1|156397_157462_+	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	49.5	3.1e-18
AXH16641.1|157461_158112_+	DNA oxidative demethylase AlkB	NA	A0A2K9L3R7	Tupanvirus	31.4	1.1e-05
AXH16642.1|158187_159831_+	microcin J25 efflux ABC transporter YojI	NA	W8CYL7	Bacillus_phage	24.2	7.2e-14
>prophage 13
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	168592	169216	5214712		Bacillus_virus(100.0%)	1	NA	NA
AXH16652.1|168592_169216_+	cytochrome c biogenesis ATP-binding export protein CcmA	NA	G3M9Y6	Bacillus_virus	25.5	2.0e-12
>prophage 14
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	179119	186768	5214712		Vibrio_phage(50.0%)	7	NA	NA
AXH16666.1|179119_180127_+	nucleoid-associated protein	NA	A0A1V0E8C0	Vibrio_phage	48.3	1.5e-83
AXH16667.1|180265_180550_-	50S ribosomal protein L25	NA	NA	NA	NA	NA
AXH16668.1|180674_182435_-	DEAD/DEAH box helicase	NA	M4Q3N1	Vibrio_phage	42.0	2.2e-101
AXH16669.1|182584_183280_+	16S rRNA pseudouridine(516) synthase	NA	NA	NA	NA	NA
AXH16670.1|183307_184498_+	Bcr/CflA family drug resistance efflux transporter	NA	S4TR35	Salmonella_phage	23.7	3.8e-20
AXH16671.1|184830_185175_+	hypothetical protein	NA	NA	NA	NA	NA
AXH16672.1|185178_186768_-	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	33.6	1.9e-19
>prophage 15
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	192522	196826	5214712		Clostridioides_phage(50.0%)	4	NA	NA
AXH16677.1|192522_193089_-	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A1V0DZX6	Clostridioides_phage	40.7	4.2e-14
AXH16678.1|193500_194214_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
AXH16679.1|194252_195242_-	GTP-binding protein	NA	NA	NA	NA	NA
AXH16680.1|195359_196826_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	30.0	3.0e-43
>prophage 16
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	211352	212210	5214712		Catovirus(100.0%)	1	NA	NA
AXH16694.1|211352_212210_-	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	35.0	4.0e-24
>prophage 17
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	216276	220062	5214712	tRNA	Acinetobacter_phage(50.0%)	5	NA	NA
AXH16699.1|216276_218268_+	catecholate siderophore receptor CirA	NA	A0A0P0I887	Acinetobacter_phage	36.6	2.6e-13
AXH16700.1|218299_219136_-	S-formylglutathione hydrolase YeiG	NA	NA	NA	NA	NA
AXH16701.1|219063_219240_-	hypothetical protein	NA	NA	NA	NA	NA
AXH16702.1|219296_219410_+|tRNA	phenylalanyl-tRNA synthetase subunit beta	tRNA	NA	NA	NA	NA
AXH16703.1|219393_220062_+	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	56.3	9.0e-56
>prophage 18
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	223752	225273	5214712		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
AXH16707.1|223752_225273_+	galactose/methyl galactoside import ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	33.0	2.6e-10
>prophage 19
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	245623	255065	5214712		Enterobacteria_phage(85.71%)	10	NA	NA
AXH16725.1|245623_246550_+	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.3	1.5e-08
AXH16726.1|246554_247286_+	ABC transporter permease	NA	NA	NA	NA	NA
AXH16727.1|247266_247374_-	hypothetical protein	NA	NA	NA	NA	NA
AXH16728.1|247433_248165_-	transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	99.0	2.2e-111
AXH16729.1|248386_250072_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
AXH16730.1|250068_250788_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AXH16731.1|250834_251305_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	99.4	5.2e-82
AXH16732.1|251345_251807_-	DUF1307 domain-containing protein	NA	Q9EYF5	Enterobacteria_phage	99.3	3.2e-76
AXH16733.1|251931_253932_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	95.7	0.0e+00
AXH16734.1|253928_255065_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.1	1.2e-161
>prophage 20
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	267071	269105	5214712	tRNA	Indivirus(100.0%)	1	NA	NA
AXH16739.1|267071_269105_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.2	6.8e-54
>prophage 21
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	278210	293096	5214712	integrase	uncultured_Caudovirales_phage(33.33%)	17	277691:277707	297743:297759
277691:277707	attL	ATGCTCGACGAACCGCA	NA	NA	NA	NA
AXH16749.1|278210_279431_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	55.6	4.9e-132
AXH16750.1|279427_280282_+	hypothetical protein	NA	NA	NA	NA	NA
AXH16751.1|280385_280610_+	AlpA family phage regulatory protein	NA	A0A2H4JB58	uncultured_Caudovirales_phage	64.2	2.8e-17
AXH16752.1|280619_281534_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
AXH16753.1|281526_281847_+	hypothetical protein	NA	NA	NA	NA	NA
AXH16754.1|281853_282153_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
AXH16755.1|282149_283967_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	50.2	3.7e-128
AXH16756.1|284357_285071_-	HEPN domain-containing protein	NA	NA	NA	NA	NA
AXH16757.1|286325_286811_+	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	66.9	3.9e-48
AXH16758.1|286813_287095_+	hypothetical protein	NA	NA	NA	NA	NA
AXH16759.1|287589_287859_-	hypothetical protein	NA	NA	NA	NA	NA
AXH16760.1|287889_288678_+	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
AXH16761.1|288674_289475_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
AXH16762.1|289539_290358_+	glycoside hydrolase family 25 protein	NA	D0R7H8	Paenibacillus_phage	37.8	4.2e-23
AXH16763.1|290409_291156_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AXH16764.1|291129_292095_-	sugar kinase	NA	NA	NA	NA	NA
AXH16765.1|292091_293096_-	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.4	7.5e-14
297743:297759	attR	ATGCTCGACGAACCGCA	NA	NA	NA	NA
>prophage 22
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	302235	308509	5214712		Bacillus_phage(50.0%)	6	NA	NA
AXH16775.1|302235_303135_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.5	5.7e-13
AXH21146.1|303549_303867_+	hypothetical protein	NA	NA	NA	NA	NA
AXH16776.1|304366_305728_-	U32 family peptidase	NA	Q6DW11	Phage_TP	99.5	5.5e-217
AXH16777.1|305874_306207_-	DUF1508 domain-containing protein	NA	NA	NA	NA	NA
AXH16778.1|306386_307109_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	33.6	3.7e-31
AXH16779.1|307105_308509_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.8	7.0e-34
>prophage 23
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	321624	322977	5214712		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
AXH16787.1|321624_322977_-	molecular chaperone	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	20.9	1.2e-06
>prophage 24
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	327703	337924	5214712		Catovirus(20.0%)	8	NA	NA
AXH16790.1|327703_328345_+	uridine kinase	NA	A0A1V0SAA3	Catovirus	36.9	3.2e-34
AXH16791.1|328436_329018_+	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	42.1	1.3e-31
AXH16792.1|329039_330893_+	outer membrane assembly protein AsmA	NA	NA	NA	NA	NA
AXH16793.1|330960_332544_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	42.1	6.1e-34
AXH16794.1|333202_334342_+	lipoprotein	NA	NA	NA	NA	NA
AXH16795.1|334347_334791_+	protein-tyrosine-phosphatase	NA	NA	NA	NA	NA
AXH16796.1|334793_336956_+	tyrosine-protein kinase Wzc	NA	A0A1X9I5D6	Streptococcus_phage	30.3	2.4e-17
AXH16797.1|337084_337924_+	colanic acid biosynthesis glycosyltransferase WcaA	NA	A0A0F7L2F7	uncultured_marine_virus	34.8	9.7e-07
>prophage 25
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	342177	348971	5214712		Synechococcus_phage(25.0%)	6	NA	NA
AXH16803.1|342177_343299_+	GDP-mannose 4,6-dehydratase	NA	M4QRT5	Synechococcus_phage	64.9	1.5e-132
AXH16804.1|343301_344267_+	GDP-L-fucose synthase	NA	D1LW79	Prochlorococcus_phage	51.0	4.9e-87
AXH16805.1|344269_344749_+	GDP-mannose mannosyl hydrolase	NA	NA	NA	NA	NA
AXH16806.1|344745_345969_+	colanic acid biosynthesis glycosyltransferase WcaI	NA	NA	NA	NA	NA
AXH16807.1|345971_347408_+	mannose-1-phosphate guanyltransferase	NA	A0A1V0SH58	Hokovirus	29.2	9.7e-47
AXH16808.1|347600_348971_+	phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	27.7	4.9e-32
>prophage 26
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	354560	365201	5214712		Enterobacteria_phage(42.86%)	11	NA	NA
AXH16813.1|354560_355955_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	31.9	2.4e-18
AXH16814.1|356129_357023_+	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.4	1.3e-46
AXH16815.1|357395_358481_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.6	2.6e-100
AXH16816.1|358480_359380_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.6	8.2e-28
AXH16817.1|359438_360314_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.1	8.6e-107
AXH21149.1|360331_360742_+	WxcM-like domain-containing protein	NA	NA	NA	NA	NA
AXH16818.1|360728_361196_+	N-acetyltransferase	NA	NA	NA	NA	NA
AXH16819.1|361188_362295_+	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	E5ES42	Bathycoccus_sp._RCC1105_virus	32.6	5.9e-44
AXH16820.1|362294_363557_+	O50 family O-antigen flippase	NA	NA	NA	NA	NA
AXH16821.1|363573_364623_+	hypothetical protein	NA	NA	NA	NA	NA
AXH16822.1|364643_365201_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	54.3	8.1e-50
>prophage 27
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	372661	375481	5214712		Ostreococcus_lucimarinus_virus(50.0%)	2	NA	NA
AXH16826.1|372661_374068_+	phosphogluconate dehydrogenase (NADP(+)-dependent, decarboxylating)	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.3	1.1e-37
AXH16827.1|374314_375481_+	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	52.9	6.5e-110
>prophage 28
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	382922	383822	5214712		Cellulophaga_phage(100.0%)	1	NA	NA
AXH16835.1|382922_383822_-	ATP phosphoribosyltransferase	NA	A0A0F7Q4B0	Cellulophaga_phage	94.7	1.8e-11
>prophage 29
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	390019	391186	5214712		Stx2-converting_phage(100.0%)	1	NA	NA
AXH16842.1|390019_391186_+	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	99.5	2.2e-227
>prophage 30
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	396314	397712	5214712		Bordetella_phage(50.0%)	2	NA	NA
AXH16848.1|396314_396800_-	antirestriction protein	NA	A0A2D0W9W4	Bordetella_phage	33.6	1.5e-12
AXH16849.1|396890_397712_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	37.5	4.7e-46
>prophage 31
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	413131	414933	5214712	transposase	Escherichia_phage(100.0%)	2	NA	NA
AXH16858.1|413131_414154_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.1	1.3e-199
AXH16859.1|414150_414933_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.2	1.7e-138
>prophage 32
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	434416	436269	5214712		Mycobacterium_phage(50.0%)	2	NA	NA
AXH21160.1|434416_435640_+	phosphoadenosine phosphosulfate reductase	NA	A0A068F1U8	Mycobacterium_phage	33.5	1.5e-61
AXH16878.1|435624_436269_+	transcriptional regulator	NA	A0A0F7L444	uncultured_marine_virus	50.5	8.2e-54
>prophage 33
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	447225	456846	5214712		Tupanvirus(100.0%)	1	NA	NA
AXH16890.1|447225_456846_+	colibactin hybrid non-ribosomal peptide synthetase/type I polyketide synthase ClbB	NA	A0A2K9KZV5	Tupanvirus	23.8	5.0e-46
>prophage 34
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	463090	477513	5214712		Tupanvirus(66.67%)	3	NA	NA
AXH16894.1|463090_467887_+	colibactin non-ribosomal peptide synthetase ClbH	NA	A0A2K9L3I8	Tupanvirus	28.7	3.0e-44
AXH16895.1|467936_470969_+	colibactin polyketide synthase ClbI	NA	D0R7J2	Paenibacillus_phage	37.9	4.0e-50
AXH16896.1|471012_477513_+	colibactin non-ribosomal peptide synthetase ClbJ	NA	A0A2K9KZV5	Tupanvirus	23.4	1.5e-102
>prophage 35
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	486940	491308	5214712		Tupanvirus(100.0%)	1	NA	NA
AXH16899.1|486940_491308_+	colibactin non-ribosomal peptide synthetase ClbN	NA	A0A2K9KZV5	Tupanvirus	22.8	4.3e-37
>prophage 36
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	496866	498138	5214712		Stenotrophomonas_phage(100.0%)	1	NA	NA
AXH16905.1|496866_498138_-	DUF4102 domain-containing protein	NA	B7SYF8	Stenotrophomonas_phage	40.7	1.8e-73
>prophage 37
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	517606	555176	5214712		Bacillus_phage(22.22%)	24	NA	NA
AXH16921.1|517606_527098_-	yersiniabactin polyketide synthase HMWP1	NA	D0R7J2	Paenibacillus_phage	36.8	1.2e-49
AXH16922.1|527185_533293_-	yersiniabactin non-ribosomal peptide synthetase HMWP2	NA	A0A2K9L3I8	Tupanvirus	27.3	3.1e-33
AXH16923.1|533483_534443_-	yersiniabactin transcriptional regulator YbtA	NA	NA	NA	NA	NA
AXH16924.1|534609_536412_+	yersiniabactin ABC transporter ATP-binding/permease protein YbtP	NA	W8CYL7	Bacillus_phage	27.6	1.1e-31
AXH16925.1|536398_538201_+	yersiniabactin ABC transporter ATP-binding/permease protein YbtQ	NA	W8CYL7	Bacillus_phage	26.5	6.1e-22
AXH16926.1|538193_539474_+	yersiniabactin-associated zinc MFS transporter YbtX	NA	NA	NA	NA	NA
AXH16927.1|539501_540806_+	yersiniabactin biosynthesis salicylate synthase YbtS	NA	NA	NA	NA	NA
AXH16928.1|540999_542262_-	DUF4102 domain-containing protein	NA	A0A1B0VMI6	Pseudomonas_phage	38.5	2.0e-72
AXH21164.1|542599_543397_-	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
AXH16929.1|543858_544695_+	hypothetical protein	NA	NA	NA	NA	NA
AXH16930.1|544911_545130_+	AlpA family transcriptional regulator	NA	A0A2H4J8C8	uncultured_Caudovirales_phage	51.9	1.2e-09
AXH16931.1|545211_545502_+	hypothetical protein	NA	NA	NA	NA	NA
AXH16932.1|545554_545851_+	hypothetical protein	NA	NA	NA	NA	NA
AXH16933.1|545923_546166_+	DNA-binding protein	NA	NA	NA	NA	NA
AXH16934.1|546214_546604_+	hypothetical protein	NA	NA	NA	NA	NA
AXH16935.1|546910_547828_+	hypothetical protein	NA	NA	NA	NA	NA
AXH16936.1|548097_548601_-	hypothetical protein	NA	A0A291AWW1	Escherichia_phage	67.9	6.1e-57
AXH16937.1|549054_549459_-	DNA-binding protein	NA	NA	NA	NA	NA
AXH16938.1|549615_550095_-	DUF4756 family protein	NA	NA	NA	NA	NA
AXH16939.1|550371_551172_-	hypothetical protein	NA	NA	NA	NA	NA
AXH16940.1|551199_551934_-	DNA-binding protein	NA	M1Q742	Cellulophaga_phage	39.3	2.2e-26
AXH16941.1|553291_553561_+	hypothetical protein	NA	NA	NA	NA	NA
AXH16942.1|553644_554031_+	hypothetical protein	NA	NA	NA	NA	NA
AXH16943.1|554306_555176_-	hypothetical protein	NA	A0A2H4J8H9	uncultured_Caudovirales_phage	28.7	7.0e-16
>prophage 38
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	574676	580268	5214712	integrase	Leptospira_phage(33.33%)	5	571465:571478	584172:584185
571465:571478	attL	TGTTAAAGCGTTAT	NA	NA	NA	NA
AXH16964.1|574676_575597_-	hypothetical protein	NA	S5VKI3	Leptospira_phage	31.1	4.0e-30
AXH16965.1|575948_576200_+	hypothetical protein	NA	NA	NA	NA	NA
AXH16966.1|576981_578163_+	recombinase RecF	NA	C7BGE8	Burkholderia_phage	27.5	1.4e-35
AXH16967.1|578163_578910_+	HNH endonuclease	NA	NA	NA	NA	NA
AXH16968.1|579011_580268_-|integrase	site-specific integrase	integrase	A0A077KET4	Ralstonia_phage	41.1	7.6e-80
584172:584185	attR	ATAACGCTTTAACA	NA	NA	NA	NA
>prophage 39
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	584318	596807	5214712		Bacillus_phage(33.33%)	14	NA	NA
AXH21166.1|584318_584990_+	DNA-binding response regulator HprR	NA	W8CYM9	Bacillus_phage	35.2	5.4e-32
AXH16973.1|584989_586348_+	HAMP domain-containing protein	NA	NA	NA	NA	NA
AXH16974.1|586455_587307_-	protein deglycase HchA	NA	NA	NA	NA	NA
AXH16975.1|587901_589080_-	porin	NA	Q1MVN1	Enterobacteria_phage	55.7	1.4e-104
AXH16976.1|589349_589553_-	hypothetical protein	NA	NA	NA	NA	NA
AXH16977.1|589645_590011_+	permease	NA	NA	NA	NA	NA
AXH16978.1|590050_590746_+	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	28.2	2.1e-07
AXH16979.1|590812_592231_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	55.1	1.0e-101
AXH16980.1|592211_592682_+	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	48.3	5.2e-34
AXH16981.1|592670_593591_-	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
AXH16982.1|593763_594681_+	DUF808 domain-containing protein	NA	NA	NA	NA	NA
AXH16983.1|594759_594942_+	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
AXH21167.1|595003_595192_+	hypothetical protein	NA	NA	NA	NA	NA
AXH16984.1|595112_596807_+	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	35.6	2.2e-18
>prophage 40
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	613137	614220	5214712		Enterobacteria_phage(100.0%)	1	NA	NA
AXH17007.1|613137_614220_-	porin OmpD	NA	Q1MVN1	Enterobacteria_phage	80.1	6.0e-166
>prophage 41
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	627660	628413	5214712		Bacillus_virus(100.0%)	1	NA	NA
AXH17022.1|627660_628413_+	L-cystine ABC transporter ATP-binding protein YecC	NA	G3M9Y6	Bacillus_virus	34.9	2.9e-26
>prophage 42
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	640406	641921	5214712		Cedratvirus(100.0%)	1	NA	NA
AXH17039.1|640406_641921_+	L-arabinose ABC transporter ATP-binding protein AraG	NA	A0A285PWH2	Cedratvirus	29.7	7.4e-13
>prophage 43
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	652008	656277	5214712		uncultured_Caudovirales_phage(33.33%)	4	NA	NA
AXH17049.1|652008_653670_+	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.3	1.7e-10
AXH17050.1|653960_654821_+	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
AXH17051.1|654823_655873_+	chemotaxis response regulator protein-glutamate methylesterase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	1.0e-05
AXH17052.1|655887_656277_+	two-component system response regulator	NA	A0A2K9L4R0	Tupanvirus	32.0	1.7e-06
>prophage 44
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	660804	662538	5214712	tRNA	Tupanvirus(100.0%)	1	NA	NA
AXH17057.1|660804_662538_-|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.7	8.8e-87
>prophage 45
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	669154	671205	5214712		Synechococcus_phage(50.0%)	3	NA	NA
AXH17064.1|669154_669898_-	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.6e-24
AXH17065.1|669938_670334_-	hypothetical protein	NA	NA	NA	NA	NA
AXH17066.1|670386_671205_-	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	98.4	4.2e-71
>prophage 46
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	675098	682163	5214712		Bacillus_virus(50.0%)	9	NA	NA
AXH17071.1|675098_675620_+	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.0e-10
AXH17072.1|675621_676224_-	YebB family permuted papain-like enzyme	NA	NA	NA	NA	NA
AXH21169.1|676295_676361_+	hypothetical protein	NA	NA	NA	NA	NA
AXH17073.1|676499_677111_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
AXH17074.1|677119_678130_+	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.5	5.6e-09
AXH17075.1|678276_679062_-	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
AXH17076.1|679058_679814_-	Mn2+/Zn2+ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.3	1.3e-18
AXH21170.1|679892_680825_+	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
AXH17077.1|680840_682163_+	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	40.9	1.2e-14
>prophage 47
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	686161	687637	5214712		Cyanophage(100.0%)	1	NA	NA
AXH17081.1|686161_687637_+	glucose-6-phosphate 1-dehydrogenase	NA	H6WFS4	Cyanophage	37.5	4.4e-79
>prophage 48
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	695693	700162	5214712		Klebsiella_phage(33.33%)	7	NA	NA
AXH17089.1|695693_696356_-	DNA polymerase III subunit epsilon	NA	Q6UAU3	Klebsiella_phage	41.6	2.0e-07
AXH17090.1|696379_697036_-	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
AXH17091.1|697137_697368_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	1.3e-14
AXH17092.1|697506_697881_+	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
AXH17093.1|697884_698757_+	hypothetical protein	NA	NA	NA	NA	NA
AXH17094.1|698769_699111_+	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
AXH17095.1|699505_700162_+	protein-serine/threonine phosphatase	NA	A0A2D1GLI5	Escherichia_phage	49.5	6.8e-56
>prophage 49
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	707659	709708	5214712	tail,protease	Moraxella_phage(100.0%)	1	NA	NA
AXH17101.1|707659_709708_+|tail,protease	tail-specific protease	tail,protease	A0A0R6PIZ1	Moraxella_phage	33.5	6.8e-86
>prophage 50
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	715040	715250	5214712		Morganella_phage(100.0%)	1	NA	NA
AXH17109.1|715040_715250_+	cold-shock protein CspC	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
>prophage 51
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	720891	722442	5214712		Moraxella_phage(100.0%)	1	NA	NA
AXH17117.1|720891_722442_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	45.4	1.7e-41
>prophage 52
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	726304	734409	5214712	tRNA	Pandoravirus(33.33%)	7	NA	NA
AXH17121.1|726304_727666_-	aminodeoxychorismate synthase component 1	NA	S4VT78	Pandoravirus	34.2	3.6e-43
AXH17122.1|728037_728397_-	DUF1889 family protein	NA	NA	NA	NA	NA
AXH17123.1|728758_729103_-	RidA family protein	NA	NA	NA	NA	NA
AXH17124.1|729234_731145_+	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	31.6	1.7e-91
AXH17125.1|731202_731898_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
AXH17126.1|731937_732519_+	hypothetical protein	NA	NA	NA	NA	NA
AXH21174.1|732723_734409_+	long-chain-fatty-acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	26.0	1.5e-35
>prophage 53
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	743376	747953	5214712		Bacillus_phage(100.0%)	3	NA	NA
AXH17141.1|743376_744867_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	30.6	6.4e-09
AXH17142.1|745047_746523_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
AXH17143.1|746669_747953_-	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	36.3	7.6e-11
>prophage 54
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	751273	752128	5214712		Indivirus(100.0%)	1	NA	NA
AXH17146.1|751273_752128_+	aldo/keto reductase	NA	A0A1V0SDE7	Indivirus	24.6	1.5e-10
>prophage 55
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	760941	765027	5214712		Staphylococcus_phage(50.0%)	4	NA	NA
AXH17156.1|760941_761922_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	22.0	3.0e-07
AXH17157.1|762058_762817_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
AXH17158.1|762934_764293_+	MFS transporter	NA	NA	NA	NA	NA
AXH17159.1|764385_765027_-	bifunctional nicotinamidase/pyrazinamidase	NA	A0A2K9L6K4	Tupanvirus	36.0	2.9e-19
>prophage 56
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	769953	771909	5214712		Streptococcus_phage(100.0%)	1	NA	NA
AXH17166.1|769953_771909_+	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	29.2	3.1e-40
>prophage 57
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	776301	776955	5214712		Bacillus_phage(100.0%)	1	NA	NA
AXH17172.1|776301_776955_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	31.0	8.7e-11
>prophage 58
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	783718	784939	5214712		Klosneuvirus(100.0%)	1	NA	NA
AXH17180.1|783718_784939_+	succinylornithine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	27.1	2.7e-26
>prophage 59
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	792415	793243	5214712		Bacillus_virus(100.0%)	1	NA	NA
AXH17188.1|792415_793243_-	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	54.6	2.0e-73
>prophage 60
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	799370	801632	5214712		Tupanvirus(100.0%)	1	NA	NA
AXH17196.1|799370_801632_-	catalase HPII	NA	A0A2K9L572	Tupanvirus	49.4	6.7e-143
>prophage 61
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	811008	821311	5214712	tRNA	Tupanvirus(33.33%)	12	NA	NA
AXH17207.1|811008_812937_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.3	9.4e-130
AXH17208.1|812940_813483_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.9	6.3e-15
AXH17209.1|813579_813777_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
AXH17210.1|813829_814186_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
AXH21178.1|814308_814353_+|tRNA	phenylalanyl--tRNA ligase operon leader peptide	tRNA	NA	NA	NA	NA
AXH17211.1|814636_815620_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.1e-33
AXH17212.1|815634_818022_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
AXH17213.1|818026_818326_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
AXH17214.1|818426_819407_+	vitamin B12 import system permease BtuC	NA	NA	NA	NA	NA
AXH17215.1|819468_820020_+	glutathione peroxidase	NA	NA	NA	NA	NA
AXH17216.1|820019_820769_+	vitamin B12 import ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	28.2	9.3e-09
AXH17217.1|820846_821311_+	endopeptidase	NA	S5MM68	Bacillus_phage	36.9	2.1e-11
>prophage 62
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	826463	830545	5214712		Hokovirus(50.0%)	2	NA	NA
AXH17223.1|826463_828842_+	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	36.7	1.4e-172
AXH21179.1|828898_830545_-	cyclohexanecarboxylate-CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	25.6	2.9e-31
>prophage 63
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	849017	854101	5214712		Lake_Baikal_phage(33.33%)	5	NA	NA
AXH17241.1|849017_849386_+	iron-sulfur cluster assembly accessory protein	NA	A0A2H4N7N5	Lake_Baikal_phage	38.5	5.6e-15
AXH17242.1|849394_850882_+	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
AXH17243.1|850891_851638_+	Fe-S cluster assembly ATPase SufC	NA	A0A1V0SE00	Indivirus	24.0	5.1e-07
AXH17244.1|851612_852884_+	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
AXH17245.1|852880_854101_+	cysteine desulfurase SufS	NA	Q2XUY6	environmental_halophage	41.2	5.8e-93
>prophage 64
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	862389	864656	5214712		Escherichia_phage(50.0%)	3	NA	NA
AXH17252.1|862389_863058_+	thiosulfate reductase electron transport protein PhsB	NA	A0A077SL61	Escherichia_phage	36.5	6.5e-22
AXH17253.1|863054_863840_+	thiosulfate reductase cytochrome B subunit	NA	NA	NA	NA	NA
AXH17254.1|863843_864656_+	hypothetical protein	NA	A0A077K9W7	Edwardsiella_phage	35.9	5.0e-08
>prophage 65
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	870160	878954	5214712		Orpheovirus(20.0%)	10	NA	NA
AXH17259.1|870160_870802_+	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	35.2	7.4e-23
AXH17260.1|870841_871990_-	cyclopropane-fatty-acyl-phospholipid synthase	NA	A0A2K9L4K8	Tupanvirus	45.4	9.3e-85
AXH17261.1|872281_873493_-	Bcr/CflA family multidrug efflux MFS transporter	NA	NA	NA	NA	NA
AXH17262.1|873605_874538_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AXH17263.1|874534_875560_-	HTH-type transcriptional repressor PurR	NA	C6ZCU4	Enterobacteria_phage	31.6	8.2e-32
AXH17264.1|875547_875772_-	hypothetical protein	NA	NA	NA	NA	NA
AXH17265.1|875859_875949_+	YnhF family membrane protein	NA	NA	NA	NA	NA
AXH17266.1|876114_877284_+	MFS transporter	NA	NA	NA	NA	NA
AXH17267.1|877429_878011_-	superoxide dismutase [Fe]	NA	Q56AR7	Bacillus_thuringiensis_phage	46.0	2.6e-43
AXH17268.1|878138_878954_-	peptidoglycan endopeptidase	NA	A0A2H5BM69	Streptomyces_phage	42.7	1.7e-19
>prophage 66
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	883367	884866	5214712		Indivirus(50.0%)	2	NA	NA
AXH17273.1|883367_884264_+	aldo/keto reductase family oxidoreductase	NA	A0A1V0SDE7	Indivirus	30.2	8.0e-07
AXH21181.1|884344_884866_+	superoxide dismutase [Cu-Zn] SodC2	NA	Q9MC02	Salmonella_phage	56.3	6.0e-47
>prophage 67
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	891776	893051	5214712	tRNA	Cronobacter_phage(100.0%)	1	NA	NA
AXH17280.1|891776_893051_+|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	41.4	8.8e-84
>prophage 68
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	913554	915366	5214712		Vaccinia_virus(100.0%)	1	NA	NA
AXH17303.1|913554_915366_+	beta-glucuronidase	NA	B9U1V4	Vaccinia_virus	99.7	0.0e+00
>prophage 69
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	925261	926563	5214712		Bacillus_phage(100.0%)	1	NA	NA
AXH17311.1|925261_926563_-	two-component system sensor histidine kinase RstB	NA	W8CYF6	Bacillus_phage	24.6	1.1e-17
>prophage 70
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	936663	1012229	5214712	terminase,protease,lysis,tail,transposase	Enterobacteria_phage(43.64%)	86	NA	NA
AXH17324.1|936663_937485_-|protease	serine protease	protease	NA	NA	NA	NA
AXH17325.1|937584_937668_-	hypothetical protein	NA	NA	NA	NA	NA
AXH17326.1|937760_938096_-	acid shock protein	NA	NA	NA	NA	NA
AXH17327.1|938493_939747_-	MFS transporter	NA	NA	NA	NA	NA
AXH17328.1|939853_940747_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AXH17329.1|940881_942102_+	ROK family transcriptional regulator	NA	NA	NA	NA	NA
AXH17330.1|942226_942922_+	dethiobiotin synthase	NA	NA	NA	NA	NA
AXH21184.1|942874_944092_-	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
AXH17331.1|944252_944867_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	5.1e-29
AXH17332.1|944909_945764_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
AXH17333.1|945765_946383_-	dimethylsulfoxide reductase	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
AXH21185.1|946393_948817_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.5	8.3e-208
AXH17334.1|948877_951304_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.2	2.7e-214
AXH17335.1|951502_951808_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
AXH17336.1|951915_952626_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
AXH17337.1|952628_953189_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
AXH17338.1|953223_953565_-	DUF1283 family protein	NA	NA	NA	NA	NA
AXH17339.1|953699_954026_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	54.5	2.9e-23
AXH17340.1|954062_954251_+	hypothetical protein	NA	NA	NA	NA	NA
AXH17341.1|954231_955446_+	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.5	2.8e-47
AXH17342.1|955457_956477_+	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	25.9	5.7e-17
AXH17343.1|956534_956663_+	transporter	NA	NA	NA	NA	NA
AXH17344.1|957597_957963_-	DUF3596 domain-containing protein	NA	Q9EY96	Enterobacteria_phage	65.4	1.3e-35
AXH17345.1|957982_958234_-	DNA-binding protein	NA	S4TND0	Salmonella_phage	50.0	2.2e-15
AXH17346.1|958306_960778_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	55.6	9.4e-58
AXH17347.1|960871_961063_-	DUF1482 family protein	NA	NA	NA	NA	NA
AXH17348.1|961059_961248_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
AXH17349.1|961734_962352_-	hypothetical protein	NA	NA	NA	NA	NA
AXH21186.1|962311_962467_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	51.1	1.2e-06
AXH21187.1|962759_963284_-	LexA family transcriptional repressor	NA	A0A1W6JP50	Morganella_phage	32.9	1.3e-12
AXH17350.1|963714_964140_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
AXH17351.1|964211_965282_+	phage replisome organizer	NA	A0A088CD36	Shigella_phage	64.1	2.3e-61
AXH17352.1|965322_965748_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	89.6	6.6e-60
AXH17353.1|965988_966216_+	hypothetical protein	NA	NA	NA	NA	NA
AXH17354.1|966369_966618_-	hypothetical protein	NA	E5E3R2	Burkholderia_phage	52.6	1.2e-16
AXH17355.1|967184_967397_+	Hok/Gef family protein	NA	A0A0U2QV81	Escherichia_phage	95.7	3.9e-29
AXH17356.1|967563_968178_+	hypothetical protein	NA	NA	NA	NA	NA
AXH17357.1|968174_969320_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A0A7RTT7	Clostridium_phage	30.1	2.8e-41
AXH17358.1|969705_970755_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.6	1.3e-112
AXH17359.1|970768_971521_+	antitermination protein	NA	Q8SBE4	Shigella_phage	95.2	9.6e-131
AXH17360.1|972196_972412_+	RNA chaperone/antiterminator CspA	NA	A0A1W6JNX5	Morganella_phage	76.5	7.7e-25
AXH17361.1|973167_973383_+|lysis	lysis protein S	lysis	A5LH82	Enterobacteria_phage	94.4	1.1e-31
AXH17362.1|973387_973699_+	DUF1327 domain-containing protein	NA	K7PGU6	Enterobacteria_phage	63.6	1.0e-25
AXH17363.1|973695_974229_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	92.1	7.1e-96
AXH17364.1|974225_974717_+	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	29.5	2.8e-06
AXH17365.1|975085_975298_+	cold-shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
AXH17366.1|975308_975497_+	cold-shock protein	NA	NA	NA	NA	NA
AXH17367.1|975527_975800_+	hypothetical protein	NA	NA	NA	NA	NA
AXH17368.1|975972_976146_+	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
AXH17369.1|976297_976708_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	91.2	5.0e-65
AXH17370.1|976653_976854_-	hypothetical protein	NA	C6ZCX4	Enterobacteria_phage	70.0	4.5e-11
AXH17371.1|977008_977215_+	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	91.2	6.7e-26
AXH17372.1|977759_978299_+	DUF1441 family protein	NA	A5LH26	Enterobacteria_phage	100.0	1.8e-94
AXH17373.1|978307_980407_+|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	99.4	0.0e+00
AXH17374.1|980403_980616_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
AXH17375.1|981972_984096_+|protease	Clp protease ClpP	protease	A5LH30	Enterobacteria_phage	99.7	0.0e+00
AXH17376.1|984137_984506_+	DUF2190 family protein	NA	K7PLV6	Enterobacteria_phage	100.0	9.7e-52
AXH17377.1|984498_984774_+	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
AXH17378.1|984785_985376_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	80.1	7.2e-81
AXH21189.1|985372_985774_+|tail	phage tail protein	tail	A0A291AWY2	Escherichia_phage	99.2	2.4e-72
AXH17379.1|985784_986528_+|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	98.0	1.6e-130
AXH21188.1|986588_986975_+|tail	phage minor tail protein G	tail	K7PLV8	Enterobacteria_phage	100.0	3.3e-66
AXH17380.1|986983_987313_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
AXH17381.1|987284_990341_+|tail	phage tail tape measure protein	tail	A5LH38	Enterobacteria_phage	98.0	0.0e+00
AXH17382.1|990340_990670_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	99.1	3.9e-60
AXH17383.1|990679_991378_+|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	99.1	1.5e-133
AXH17384.1|991382_992126_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	98.4	7.0e-150
AXH17385.1|992023_992671_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	97.7	7.8e-113
AXH17386.1|992731_996211_+	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	89.6	0.0e+00
AXH17387.1|996278_996878_+	Ail/Lom family protein	NA	Q9EV15	Enterobacteria_phage	93.0	1.2e-102
AXH17388.1|996942_999318_+|tail	phage tail protein	tail	A0A1X7QGG5	Escherichia_phage	69.3	1.4e-167
AXH17389.1|999317_999599_+	hypothetical protein	NA	A0A1X7QHA1	Escherichia_phage	47.8	1.6e-17
AXH17390.1|999608_1000649_+|tail	tail fiber domain-containing protein	tail	A0A0E3M4A9	Enterobacteria_phage	67.3	1.4e-124
AXH21190.1|1000691_1000985_+	hypothetical protein	NA	NA	NA	NA	NA
AXH17391.1|1001212_1001803_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
AXH17392.1|1002119_1002353_-	hypothetical protein	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
AXH17393.1|1003138_1004422_+	MFS transporter	NA	NA	NA	NA	NA
AXH17394.1|1004510_1005971_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	3.9e-43
AXH17395.1|1006006_1006210_-	protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
AXH17396.1|1006386_1007073_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AXH17397.1|1007161_1007908_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
AXH17398.1|1007919_1008138_-	hypothetical protein	NA	NA	NA	NA	NA
AXH21191.1|1008044_1010090_+	peptidyl-dipeptidase Dcp	NA	NA	NA	NA	NA
AXH17399.1|1010181_1010343_+	hypothetical protein	NA	NA	NA	NA	NA
AXH17400.1|1010596_1011487_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	39.0	9.6e-21
AXH17401.1|1011770_1012229_+|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	5.5e-12
>prophage 71
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	1019702	1021832	5214712		Pandoravirus(50.0%)	3	NA	NA
AXH17410.1|1019702_1021142_+	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	26.1	2.8e-30
AXH17411.1|1021198_1021417_-	multiple antibiotic resistance protein MarB	NA	NA	NA	NA	NA
AXH17412.1|1021448_1021832_-	MDR efflux pump AcrAB transcriptional activator MarA	NA	D0R0F8	Streptococcus_phage	32.3	4.7e-09
>prophage 72
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	1029046	1029994	5214712		Bacillus_phage(100.0%)	1	NA	NA
AXH21192.1|1029046_1029994_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	36.1	9.6e-19
>prophage 73
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	1058289	1060713	5214712		Klosneuvirus(100.0%)	1	NA	NA
AXH17443.1|1058289_1060713_+	oxygen-sensing cyclic-di-GMP phosphodiesterase	NA	A0A1V0SL97	Klosneuvirus	20.9	4.6e-09
>prophage 74
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	1064120	1065879	5214712		Escherichia_phage(66.67%)	3	NA	NA
AXH17448.1|1064120_1065131_+	alcohol dehydrogenase AdhP	NA	A0A2K9L339	Tupanvirus	25.0	2.8e-24
AXH17449.1|1065316_1065595_+	Killer protein	NA	A0A2L1IV28	Escherichia_phage	60.9	1.1e-26
AXH17450.1|1065594_1065879_+	transcriptional regulator	NA	A0A2L1IV52	Escherichia_phage	51.1	1.2e-20
>prophage 75
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	1077303	1078848	5214712		Escherichia_phage(100.0%)	1	NA	NA
AXH17457.1|1077303_1078848_+	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	39.2	6.4e-20
>prophage 76
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	1092905	1094870	5214712		Ralstonia_phage(100.0%)	1	NA	NA
AXH17469.1|1092905_1094870_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	26.2	1.9e-24
>prophage 77
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	1099496	1101599	5214712		Salmonella_phage(100.0%)	1	NA	NA
AXH17474.1|1099496_1101599_+	TonB-dependent receptor	NA	A0A1B0VCF0	Salmonella_phage	66.2	2.5e-136
>prophage 78
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	1107095	1108109	5214712		Mycoplasma_phage(100.0%)	1	NA	NA
AXH17483.1|1107095_1108109_-	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	37.9	6.0e-27
>prophage 79
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	1111738	1113700	5214712		Phage_TP(100.0%)	1	NA	NA
AXH17487.1|1111738_1113700_-	U32 family peptidase	NA	Q6DW11	Phage_TP	28.3	3.5e-23
>prophage 80
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	1125250	1126199	5214712		Moraxella_phage(50.0%)	2	NA	NA
AXH17501.1|1125250_1125424_-	hypothetical protein	NA	A0A0R6PKG1	Moraxella_phage	65.2	9.9e-07
AXH17502.1|1125668_1126199_-	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	44.9	5.4e-19
>prophage 81
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	1130139	1134042	5214712		Klosneuvirus(100.0%)	1	NA	NA
AXH17506.1|1130139_1134042_-	ATP-dependent RNA helicase HrpA	NA	A0A1V0SIV3	Klosneuvirus	29.5	2.2e-53
>prophage 82
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	1152404	1153394	5214712		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
AXH17516.1|1152404_1153394_+	2-hydroxyacid dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	44.0	2.5e-70
>prophage 83
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	1158352	1160061	5214712		Enterobacteria_phage(50.0%)	2	NA	NA
AXH17520.1|1158352_1159486_+	porin OmpS2	NA	Q1MVN1	Enterobacteria_phage	54.1	2.0e-103
AXH17521.1|1159626_1160061_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.4e-28
>prophage 84
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	1163181	1168870	5214712	tRNA,integrase	Escherichia_phage(50.0%)	6	1156066:1156080	1168031:1168045
1156066:1156080	attL	CAGAAAAAAGCGCGC	NA	NA	NA	NA
AXH21201.1|1163181_1163433_+|integrase	integrase	integrase	A0A0U2JGI6	Escherichia_phage	100.0	1.9e-38
AXH17525.1|1163484_1164420_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.4	2.2e-145
AXH17526.1|1164548_1165922_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.9	5.6e-52
AXH17527.1|1165951_1166125_-	hypothetical protein	NA	NA	NA	NA	NA
AXH17528.1|1166399_1167383_-	zinc transporter ZntB	NA	NA	NA	NA	NA
AXH17529.1|1167637_1168870_+	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
1168031:1168045	attR	GCGCGCTTTTTTCTG	NA	NA	NA	NA
>prophage 85
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	1173612	1174128	5214712		Streptococcus_phage(100.0%)	1	NA	NA
AXH17534.1|1173612_1174128_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	42.1	1.8e-24
>prophage 86
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	1191351	1192434	5214712		Bacillus_phage(100.0%)	1	NA	NA
AXH17549.1|1191351_1192434_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.6	1.2e-09
>prophage 87
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	1211776	1213794	5214712		Bacillus_virus(50.0%)	2	NA	NA
AXH17569.1|1211776_1212583_+	peptide ABC transporter ATP-binding protein SapF	NA	G3M9Y6	Bacillus_virus	28.6	7.2e-15
AXH17570.1|1212630_1213794_-	MFS transporter	NA	S4TR35	Salmonella_phage	26.9	2.1e-28
>prophage 88
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	1222727	1224662	5214712		Lactococcus_phage(100.0%)	1	NA	NA
AXH17576.1|1222727_1224662_+	exoribonuclease 2	NA	Q0GXV6	Lactococcus_phage	28.1	2.8e-33
>prophage 89
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	1232475	1233066	5214712		Staphylococcus_phage(100.0%)	1	NA	NA
AXH17586.1|1232475_1233066_+	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.9	7.7e-43
>prophage 90
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	1237976	1243268	5214712	protease	Tupanvirus(33.33%)	5	NA	NA
AXH17591.1|1237976_1240574_-	DNA topoisomerase I	NA	A0A2K9L1Q2	Tupanvirus	34.5	7.0e-88
AXH17592.1|1240696_1240909_-	hypothetical protein	NA	NA	NA	NA	NA
AXH17593.1|1240953_1241205_+	DUF2498 family protein	NA	NA	NA	NA	NA
AXH17594.1|1241240_1242290_-|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
AXH17595.1|1242509_1243268_+	NAD(P)-dependent oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.4	4.4e-06
>prophage 91
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	1250232	1253190	5214712		Acinetobacter_phage(100.0%)	2	NA	NA
AXH17601.1|1250232_1251828_+	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	1.7e-52
AXH17602.1|1251831_1253190_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	41.2	3.0e-37
>prophage 92
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	1263153	1265168	5214712		Bacillus_virus(50.0%)	2	NA	NA
AXH17614.1|1263153_1264158_-	oligopeptide transport ATP-binding protein OppF	NA	G3M9Y6	Bacillus_virus	30.7	2.3e-15
AXH17615.1|1264154_1265168_-	oligopeptide ABC transporter ATP-binding protein OppD	NA	G9BWD6	Planktothrix_phage	31.7	2.0e-14
>prophage 93
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	1276513	1286065	5214712	transposase	Bacillus_phage(25.0%)	9	NA	NA
AXH17621.1|1276513_1277422_-	UTP--glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	46.8	1.1e-59
AXH17622.1|1277623_1278637_-	two-component system response regulator RssB	NA	NA	NA	NA	NA
AXH17623.1|1278728_1279634_-	patatin family protein	NA	NA	NA	NA	NA
AXH17624.1|1279746_1280205_+	YchJ family protein	NA	NA	NA	NA	NA
AXH17625.1|1280254_1281097_+	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	47.6	1.1e-13
AXH17626.1|1281890_1283090_+|transposase	IS4 family transposase	transposase	S5FM71	Shigella_phage	63.2	9.6e-141
AXH17627.1|1283142_1283820_-	respiratory nitrate reductase subunit gamma	NA	NA	NA	NA	NA
AXH17628.1|1283819_1284530_-	nitrate reductase molybdenum cofactor assembly chaperone	NA	NA	NA	NA	NA
AXH17629.1|1284526_1286065_-	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	41.7	4.8e-20
>prophage 94
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	1297184	1303452	5214712		Spodoptera_litura_granulovirus(33.33%)	8	NA	NA
AXH17638.1|1297184_1297415_-	cation transport regulator ChaB	NA	A5IZT6	Spodoptera_litura_granulovirus	40.0	8.5e-06
AXH17639.1|1297684_1298785_+	sodium-potassium/proton antiporter ChaA	NA	NA	NA	NA	NA
AXH21207.1|1299190_1299298_+	small toxic polypeptide LdrA/LdrC	NA	NA	NA	NA	NA
AXH17640.1|1299444_1300299_-	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	39.0	8.3e-46
AXH17641.1|1300334_1301144_-	tetratricopeptide repeat-containing protein	NA	NA	NA	NA	NA
AXH17642.1|1301147_1301540_-	SirB family protein	NA	NA	NA	NA	NA
AXH17643.1|1301536_1302370_-	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
AXH17644.1|1302369_1303452_-	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	41.6	1.5e-07
>prophage 95
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	1306588	1309340	5214712		Tupanvirus(50.0%)	2	NA	NA
AXH17647.1|1306588_1307536_+	ribose-phosphate pyrophosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.8	3.9e-44
AXH17648.1|1307660_1309340_+	sodium-independent anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.8	6.0e-24
>prophage 96
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	1321789	1322548	5214712		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
AXH17660.1|1321789_1322548_+	ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.3	1.5e-14
>prophage 97
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	1338576	1340264	5214712		Salmonella_phage(50.0%)	2	NA	NA
AXH17675.1|1338576_1339845_-	translesion error-prone DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	82.5	9.6e-208
AXH17676.1|1339844_1340264_-	protein UmuD	NA	A0A1W6JNS2	Morganella_phage	61.3	6.9e-38
>prophage 98
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	1347121	1347778	5214712		Escherichia_phage(100.0%)	1	NA	NA
AXH17690.1|1347121_1347778_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	29.4	4.6e-36
>prophage 99
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	1353296	1405136	5214712	terminase,integrase,tRNA,capsid,portal,lysis,tail,head	Enterobacteria_phage(52.83%)	66	1354864:1354923	1399328:1399542
AXH17699.1|1353296_1354028_+	helix-turn-helix-type transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	51.0	1.6e-53
AXH17700.1|1354248_1354653_+	DUF1398 domain-containing protein	NA	NA	NA	NA	NA
1354864:1354923	attL	AAAACAACGGGCGTGTTATACGCCCGTTATAATATTTAACACATGTGGTAATTACATATT	NA	NA	NA	NA
AXH17701.1|1354914_1355067_-	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	1.6e-21
AXH17702.1|1355994_1356909_+	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AXH17703.1|1356908_1357736_+	manganese/iron ABC transporter ATP-binding protein	NA	M1HV27	Acanthocystis_turfacea_Chlorella_virus	28.0	1.5e-07
AXH17704.1|1357732_1358590_+	metal ABC transporter permease	NA	NA	NA	NA	NA
AXH17705.1|1358586_1359444_+	metal ABC transporter permease	NA	NA	NA	NA	NA
AXH17706.1|1359841_1360120_-	hypothetical protein	NA	A0A0E3JSQ1	Enterobacteria_phage	57.6	7.6e-25
AXH17707.1|1360116_1362177_-|tail	phage tail protein	tail	A0A0E3M194	Enterobacteria_phage	53.5	3.3e-125
AXH17708.1|1362235_1365718_-	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	90.2	0.0e+00
AXH17709.1|1365778_1366450_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	100.0	8.1e-105
AXH17710.1|1366347_1367091_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
AXH17711.1|1367795_1368125_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	100.0	1.6e-58
AXH17712.1|1368121_1370689_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	93.5	0.0e+00
AXH17713.1|1370681_1371116_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	97.5	5.0e-63
AXH17714.1|1371097_1371520_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	95.0	1.2e-69
AXH21211.1|1371535_1372276_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	96.7	2.6e-128
AXH17715.1|1372283_1372679_-|tail	phage tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	97.7	2.5e-69
AXH17716.1|1372675_1373254_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	98.4	7.8e-80
AXH17717.1|1373629_1374025_-	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	95.5	5.7e-58
AXH17718.1|1374066_1375092_-|capsid	minor capsid protein E	capsid	C6ZCY2	Enterobacteria_phage	97.1	6.9e-188
AXH17719.1|1375147_1375480_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	98.2	1.4e-54
AXH17720.1|1375489_1376809_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	97.9	1.0e-231
AXH17721.1|1376789_1378391_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.6	3.5e-311
AXH17722.1|1378387_1378594_-|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
AXH17723.1|1378590_1380516_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.5	0.0e+00
AXH17724.1|1380490_1381036_-|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	82.9	1.2e-79
AXH21212.1|1381103_1381286_-	DNA-packaging protein	NA	NA	NA	NA	NA
AXH17725.1|1381301_1381622_+	hypothetical protein	NA	NA	NA	NA	NA
AXH17726.1|1381509_1381863_+	hypothetical protein	NA	NA	NA	NA	NA
AXH17727.1|1382797_1383091_+	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	92.8	7.0e-45
AXH17728.1|1383122_1383584_-|lysis	lysis protein	lysis	A0A0K2FJD0	Enterobacteria_phage	98.7	1.2e-75
AXH17729.1|1383580_1384078_-	lysozyme	NA	M1FJA0	Enterobacteria_phage	96.4	2.1e-89
AXH17730.1|1384077_1384293_-|lysis	lysis protein S	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
AXH17731.1|1384881_1385964_+	porin	NA	Q1MVN1	Enterobacteria_phage	80.1	1.6e-166
AXH17732.1|1386152_1386536_-	antitermination protein	NA	A0A088CD47	Shigella_phage	83.3	1.5e-55
AXH17733.1|1386621_1386762_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	1.1e-08
AXH17734.1|1386758_1387121_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
AXH17735.1|1387117_1387408_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	92.7	9.6e-47
AXH17736.1|1387400_1387571_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	2.0e-12
AXH17737.1|1387570_1388026_-	hypothetical protein	NA	I6PD71	Cronobacter_phage	66.2	7.0e-60
AXH17738.1|1388666_1389095_+	hypothetical protein	NA	NA	NA	NA	NA
AXH17739.1|1389173_1389887_-	phage replication protein	NA	G8C7U6	Escherichia_phage	83.4	9.8e-109
AXH17740.1|1389883_1390903_-	Replication protein O	NA	A0A0M5M7Y1	Salmonella_phage	64.7	6.1e-112
AXH17741.1|1390899_1391439_-	regulator	NA	M9NZI6	Enterobacteria_phage	66.7	8.9e-62
AXH17742.1|1391469_1391697_-	transcriptional regulator	NA	Q76H55	Enterobacteria_phage	69.0	3.8e-22
AXH21213.1|1391807_1392500_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	86.1	1.5e-109
AXH17743.1|1392580_1393642_+	N-acetyltransferase	NA	Q6SE88	Lactobacillus_prophage	42.0	2.9e-64
AXH17744.1|1393619_1393997_+	ASCH domain-containing protein	NA	Q6SE87	Lactobacillus_prophage	49.2	1.3e-30
AXH17745.1|1394472_1394679_+	cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	83.8	9.3e-28
AXH17746.1|1394753_1395050_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	99.0	3.6e-49
AXH17747.1|1395055_1395841_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
AXH17748.1|1395837_1396518_+	exonuclease	NA	B6DZ61	Enterobacteria_phage	98.2	5.1e-131
AXH17749.1|1396514_1396697_+	DUF1317 family protein	NA	A0A0N7CHV0	Escherichia_phage	98.3	1.3e-28
AXH17750.1|1396669_1396861_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	98.4	2.1e-26
AXH17751.1|1396871_1397153_+	hypothetical protein	NA	A0A0P0ZE02	Stx2-converting_phage	97.8	1.2e-46
AXH17752.1|1397251_1397470_+	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	95.8	1.8e-34
AXH17753.1|1397517_1397757_+	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	94.9	3.9e-38
AXH17754.1|1397896_1398133_+	excisionase	NA	NA	NA	NA	NA
AXH17755.1|1398122_1399265_+|integrase	integrase	integrase	Q77Z02	Phage_21	99.4	3.1e-205
AXH17756.1|1399378_1400629_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
1399328:1399542	attR	AAAACAACGGGCGTGTTATACGCCCGTTATAATATTTAACACATGTGGTAATTACATATTTTTGATGATCGCGTCACCAAACTCGCTGCATTTCAGCAGTTTAGCGCCTTCCATCAGACGTTCGAAGTCATAGGTTACGGTCTTGGCGTTGATTGCGCCTTCCATACCTTTAACAATCAGGTCTGCGGCTTCAGTCCAGCCCATATGGCGCAGCA	NA	NA	NA	NA
AXH17757.1|1400800_1401454_+	23S rRNA pseudouridine synthase E	NA	NA	NA	NA	NA
AXH17758.1|1401463_1401925_+	NUDIX hydrolase	NA	NA	NA	NA	NA
AXH17759.1|1401978_1403085_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
AXH21214.1|1403120_1403762_+	lysogenization protein HflD	NA	NA	NA	NA	NA
AXH17760.1|1403765_1405136_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	1.2e-107
>prophage 100
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	1410158	1412136	5214712		Mycoplasma_phage(100.0%)	2	NA	NA
AXH17765.1|1410158_1411295_+	Fe3+/spermidine/putrescine ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
AXH17766.1|1411278_1412136_+	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	27.8	5.1e-11
>prophage 101
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	1415411	1416233	5214712		Vibrio_phage(100.0%)	1	NA	NA
AXH17771.1|1415411_1416233_-	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	35.6	3.3e-23
>prophage 102
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	1426421	1426679	5214712		Erwinia_phage(100.0%)	1	NA	NA
AXH17778.1|1426421_1426679_-	multiple stress resistance protein BhsA	NA	A0A1B2IFR9	Erwinia_phage	37.1	9.6e-06
>prophage 103
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	1439000	1440643	5214712		Streptococcus_virus(50.0%)	2	NA	NA
AXH17790.1|1439000_1440005_-	DNA polymerase III subunit delta'	NA	A0A1U9WR94	Streptococcus_virus	40.0	6.4e-05
AXH17791.1|1440001_1440643_-	thymidylate kinase	NA	Q2Z0N0	Pseudomonas_phage	36.9	4.5e-28
>prophage 104
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	1443915	1445097	5214712		Ralstonia_phage(50.0%)	2	NA	NA
AXH17795.1|1443915_1444152_-	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	45.2	1.5e-10
AXH17796.1|1444362_1445097_-	beta-ketoacyl-ACP reductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	34.1	1.3e-15
>prophage 105
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	1457453	1458395	5214712		Brevibacillus_phage(100.0%)	1	NA	NA
AXH17808.1|1457453_1458395_-	flagellar assembly peptidoglycan hydrolase FlgJ	NA	S5M633	Brevibacillus_phage	31.3	3.6e-10
>prophage 106
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	1474275	1474521	5214712		Salmonella_phage(100.0%)	1	NA	NA
AXH17828.1|1474275_1474521_+	DNA-damage-inducible protein I	NA	H6WRY5	Salmonella_phage	48.7	7.7e-13
>prophage 107
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	1479184	1480105	5214712		Morganella_phage(100.0%)	1	NA	NA
AXH17835.1|1479184_1480105_+	LpxL/LpxP family Kdo(2)-lipid IV(A) lauroyl/palmitoleoyl acyltransferase	NA	A0A1W6JP29	Morganella_phage	41.9	3.9e-57
>prophage 108
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	1489411	1489945	5214712		Red_sea_bream_iridovirus(100.0%)	1	NA	NA
AXH17842.1|1489411_1489945_-	O-acetyl-ADP-ribose deacetylase	NA	Q71G61	Red_sea_bream_iridovirus	40.2	5.9e-26
>prophage 109
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	1494082	1494916	5214712		Pelagibacter_phage(100.0%)	1	NA	NA
AXH17851.1|1494082_1494916_+	curli production assembly/transport component CsgG	NA	M1ICK2	Pelagibacter_phage	40.1	5.1e-40
>prophage 110
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	1500832	1503911	5214712		Pseudomonas_phage(25.0%)	6	NA	NA
AXH17858.1|1500832_1501477_-	antitoxin of toxin-antitoxin stability system	NA	A0A2I6PI07	Pseudomonas_phage	33.6	2.9e-27
AXH17859.1|1501495_1501717_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.4e-10
AXH21220.1|1501785_1502232_-	DNA repair protein RadC	NA	NA	NA	NA	NA
AXH17860.1|1502277_1502751_-	antirestriction protein	NA	A0A2D0W9W4	Bordetella_phage	34.1	5.1e-13
AXH17861.1|1502844_1503090_-	antirestriction protein	NA	NA	NA	NA	NA
AXH17862.1|1503089_1503911_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	37.9	2.7e-46
>prophage 111
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	1528129	1531915	5214712		Bacillus_phage(100.0%)	1	NA	NA
AXH17876.1|1528129_1531915_+	salmochelin/enterobactin export ABC transporter IroC	NA	W8CYL7	Bacillus_phage	29.8	3.7e-45
>prophage 112
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	1560995	1564057	5214712	transposase	Acinetobacter_phage(50.0%)	4	NA	NA
AXH17899.1|1560995_1562145_+|transposase	IS3-like element ISEc16 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	9.8e-50
AXH17900.1|1562713_1562893_-	hypothetical protein	NA	NA	NA	NA	NA
AXH17901.1|1562901_1563135_-	hypothetical protein	NA	NA	NA	NA	NA
AXH17902.1|1563022_1564057_-	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	43.4	2.4e-71
>prophage 113
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	1573952	1576801	5214712		Pseudomonas_phage(50.0%)	2	NA	NA
AXH17911.1|1573952_1575155_-	DUF4102 domain-containing protein	NA	A0A1B0VMI6	Pseudomonas_phage	34.4	7.6e-45
AXH17912.1|1575433_1576801_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	33.0	2.5e-20
>prophage 114
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	1583620	1584685	5214712		Cronobacter_phage(100.0%)	1	NA	NA
AXH17917.1|1583620_1584685_-	phosphate starvation-inducible protein PhoH	NA	R4II13	Cronobacter_phage	76.7	3.6e-91
>prophage 115
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	1599006	1601106	5214712		Enterobacteria_phage(100.0%)	3	NA	NA
AXH17929.1|1599006_1599501_+	FMN reductase	NA	Q9KX93	Enterobacteria_phage	97.9	5.0e-51
AXH17930.1|1599521_1600850_+	pyrimidine utilization transport protein G	NA	Q9KX94	Enterobacteria_phage	98.4	1.5e-232
AXH17931.1|1600932_1601106_-	stress-induced protein	NA	Q9KX95	Enterobacteria_phage	96.3	4.9e-06
>prophage 116
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	1604135	1616451	5214712		Klosneuvirus(20.0%)	13	NA	NA
AXH17936.1|1604135_1605056_+	curved DNA-binding protein	NA	A0A1V0SIM1	Klosneuvirus	43.0	4.2e-11
AXH17937.1|1605055_1605361_+	chaperone modulatory protein CbpM	NA	NA	NA	NA	NA
AXH17938.1|1605514_1606114_-	molecular chaperone TorD	NA	NA	NA	NA	NA
AXH17939.1|1606110_1608657_-	trimethylamine-N-oxide reductase TorA	NA	A0A077SK27	Escherichia_phage	29.1	2.2e-70
AXH17940.1|1608656_1609829_-	pentaheme c-type cytochrome TorC	NA	NA	NA	NA	NA
AXH17941.1|1609958_1610651_+	two-component system response regulator TorR	NA	W8CYM9	Bacillus_phage	28.0	3.5e-18
AXH17942.1|1610623_1611652_-	TMAO reductase system periplasmic protein TorT	NA	NA	NA	NA	NA
AXH17943.1|1611734_1614467_+	TMAO reductase system sensor histidine kinase/response regulator TorS	NA	A0A1V0SGX0	Hokovirus	32.8	7.0e-38
AXH17944.1|1614549_1615623_+	4Fe-4S binding protein	NA	NA	NA	NA	NA
AXH17945.1|1615671_1615845_-	protein GnsA	NA	NA	NA	NA	NA
AXH17946.1|1615834_1616065_-	cold-shock protein	NA	NA	NA	NA	NA
AXH21227.1|1616039_1616228_-	cold-shock protein	NA	NA	NA	NA	NA
AXH17947.1|1616238_1616451_-	cold-shock protein CspG	NA	A0A1W6JNX5	Morganella_phage	71.4	7.8e-22
>prophage 117
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	1627447	1628107	5214712		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
AXH17958.1|1627447_1628107_+	BAX inhibitor protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	4.0e-48
>prophage 118
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	1632341	1634396	5214712		Bacillus_phage(100.0%)	1	NA	NA
AXH17966.1|1632341_1634396_-	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.9	1.0e-20
>prophage 119
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	1646996	1648904	5214712		Tupanvirus(100.0%)	1	NA	NA
AXH17978.1|1646996_1648904_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.3	1.6e-52
>prophage 120
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	1657658	1668608	5214712	tRNA	Bacillus_virus(20.0%)	9	NA	NA
AXH17986.1|1657658_1658426_+	aliphatic sulfonate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.0	7.5e-30
AXH17987.1|1658620_1661233_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.8	9.1e-19
AXH17988.1|1661498_1662719_+	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
AXH17989.1|1662870_1664271_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	36.1	5.3e-82
AXH17990.1|1664872_1665961_+	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	53.7	9.1e-98
AXH17991.1|1665976_1666159_-	hypothetical protein	NA	NA	NA	NA	NA
AXH17992.1|1666145_1667336_+	aspartate aminotransferase	NA	NA	NA	NA	NA
AXH17993.1|1667385_1668033_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
AXH21232.1|1668059_1668608_-	DUF882 domain-containing protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	7.0e-06
>prophage 121
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	1683313	1687853	5214712		Bacillus_phage(100.0%)	3	NA	NA
AXH18004.1|1683313_1685062_-	lipid A export ATP-binding/permease MsbA	NA	W8CYL7	Bacillus_phage	29.8	3.3e-57
AXH18005.1|1685098_1687363_-	ComEC family protein	NA	NA	NA	NA	NA
AXH18006.1|1687568_1687853_-	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	3.2e-10
>prophage 122
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	1692939	1694028	5214712		Streptococcus_phage(100.0%)	1	NA	NA
AXH18010.1|1692939_1694028_-	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	47.1	9.2e-82
>prophage 123
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	1698126	1701341	5214712		Tetraselmis_virus(100.0%)	2	NA	NA
AXH18014.1|1698126_1700409_+	formate acetyltransferase 1	NA	A0A2P0VNR5	Tetraselmis_virus	41.5	1.0e-162
AXH18015.1|1700600_1701341_+	pyruvate formate lyase-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.5	8.0e-21
>prophage 124
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	1704427	1737294	5214712	tRNA,protease	Vibrio_phage(20.0%)	22	NA	NA
AXH18019.1|1704427_1705045_-	dimethyl sulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.6	5.0e-77
AXH18020.1|1705055_1707500_-	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	50.1	1.7e-221
AXH18021.1|1707738_1709031_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
AXH18022.1|1709121_1710465_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.8	2.1e-80
AXH18023.1|1710475_1711087_-	outer membrane lipoprotein carrier protein LolA	NA	NA	NA	NA	NA
AXH18024.1|1711256_1715363_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
AXH18025.1|1715497_1715992_-	leucine-responsive regulatory protein	NA	NA	NA	NA	NA
AXH18026.1|1716534_1717500_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	1.9e-62
AXH18027.1|1717622_1719389_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	4.1e-23
AXH18028.1|1719389_1721111_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	30.8	1.2e-14
AXH18029.1|1721152_1721857_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
AXH18030.1|1722141_1722360_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
AXH18031.1|1723160_1723715_-	type I-F CRISPR-associated endoribonuclease Cas6/Csy4	NA	NA	NA	NA	NA
AXH18032.1|1723725_1724727_-	type I-F CRISPR-associated protein Csy3	NA	A0A2D0YRR8	Vibrio_phage	40.2	5.5e-49
AXH18033.1|1724737_1725661_-	type I-F CRISPR-associated protein Csy2	NA	NA	NA	NA	NA
AXH18034.1|1725657_1726965_-	type I-F CRISPR-associated protein Csy1	NA	NA	NA	NA	NA
AXH18035.1|1727294_1730528_-	type I-F CRISPR-associated helicase Cas3	NA	A0A2I7RCU8	Vibrio_phage	29.1	8.0e-65
AXH18036.1|1730524_1731508_-	type I-F CRISPR-associated endonuclease Cas1	NA	A0A2D0YFC9	Vibrio_phage	34.9	4.9e-42
AXH18037.1|1732100_1734377_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
AXH18038.1|1734407_1734728_-|protease	ATP-dependent Clp protease adaptor ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
AXH18039.1|1735050_1735275_+	cold-shock protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
AXH18040.1|1735347_1737294_-	MacB family efflux pump subunit	NA	G9BWD6	Planktothrix_phage	40.1	1.1e-37
>prophage 125
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	1746417	1748136	5214712		Yellowstone_lake_phycodnavirus(100.0%)	1	NA	NA
AXH18048.1|1746417_1748136_+	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.1	4.0e-31
>prophage 126
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	1751723	1754461	5214712		Roseobacter_phage(50.0%)	4	NA	NA
AXH18051.1|1751723_1752554_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	30.0	7.4e-07
AXH18052.1|1752550_1752874_-	hypothetical protein	NA	NA	NA	NA	NA
AXH18053.1|1752999_1753515_+	lipoprotein	NA	NA	NA	NA	NA
AXH18054.1|1753732_1754461_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.7	6.0e-29
>prophage 127
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	1757586	1758714	5214712		Streptococcus_phage(100.0%)	1	NA	NA
AXH18059.1|1757586_1758714_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	27.3	2.3e-27
>prophage 128
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	1764351	1766725	5214712		Synechococcus_phage(50.0%)	4	NA	NA
AXH18065.1|1764351_1765254_-	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	34.4	2.6e-37
AXH18066.1|1765314_1766037_-	oxygen-insensitive NADPH nitroreductase	NA	NA	NA	NA	NA
AXH18067.1|1766020_1766308_-	DUF1418 family protein	NA	NA	NA	NA	NA
AXH18068.1|1766467_1766725_+	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	63.1	7.8e-24
>prophage 129
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	1775291	1776494	5214712		Stx2-converting_phage(100.0%)	1	NA	NA
AXH21235.1|1775291_1776494_-	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	48.0	8.2e-100
>prophage 130
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	1787828	1789700	5214712		Planktothrix_phage(100.0%)	1	NA	NA
AXH18087.1|1787828_1789700_-	glutathione ABC transporter ATP-binding protein GsiA	NA	G9BWD6	Planktothrix_phage	29.7	8.8e-16
>prophage 131
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	1792915	1799799	5214712		Synechococcus_phage(33.33%)	5	NA	NA
AXH18091.1|1792915_1793578_-	fructose-6-phosphate aldolase	NA	C7BV14	Synechococcus_phage	32.7	4.3e-26
AXH18092.1|1793708_1794608_+	glycyl-radical enzyme activating protein	NA	NA	NA	NA	NA
AXH18093.1|1794613_1797046_+	formate C-acetyltransferase/glycerol dehydratase family glycyl radical enzyme	NA	A0A076YHZ7	Citrobacter_phage	43.5	6.1e-09
AXH18094.1|1797191_1798007_+	HAD family hydrolase	NA	NA	NA	NA	NA
AXH18095.1|1798206_1799799_-	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.7	6.9e-62
>prophage 132
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	1804796	1810022	5214712		Escherichia_phage(33.33%)	7	NA	NA
AXH18102.1|1804796_1805312_-	outer membrane protein X	NA	H6WZM8	Escherichia_phage	33.8	1.1e-16
AXH18103.1|1805664_1806552_+	threonine/homoserine exporter RhtA	NA	NA	NA	NA	NA
AXH18104.1|1806851_1807355_+	DNA starvation/stationary phase protection protein	NA	A0A222YYG6	Streptomyces_phage	29.0	4.9e-06
AXH18105.1|1807419_1807713_+	hypothetical protein	NA	NA	NA	NA	NA
AXH18106.1|1807758_1808505_+	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AXH18107.1|1808643_1809303_+	glutamine ABC transporter permease	NA	NA	NA	NA	NA
AXH18108.1|1809299_1810022_+	glutamine ABC transporter ATP-binding protein GlnQ	NA	G9BWD6	Planktothrix_phage	41.8	2.5e-35
>prophage 133
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	1816584	1828246	5214712		Synechococcus_phage(16.67%)	11	NA	NA
AXH18113.1|1816584_1817262_+	PKHD-type hydroxylase	NA	Q5GQB0	Synechococcus_phage	29.7	5.2e-19
AXH18114.1|1817335_1817602_+	DksA/TraR family C4-type zinc finger protein	NA	K4F9U1	Cronobacter_phage	50.0	2.1e-16
AXH18115.1|1817866_1818127_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
AXH18116.1|1818354_1819440_-	malate/lactate/ureidoglycolate dehydrogenase	NA	NA	NA	NA	NA
AXH18117.1|1819580_1820543_-	DNA-binding protein YbiB	NA	NA	NA	NA	NA
AXH18118.1|1820570_1822721_-	ATP-dependent helicase DinG	NA	A0A127AW80	Bacillus_phage	26.1	6.3e-42
AXH18119.1|1822719_1823025_+	DUF1768 domain-containing protein	NA	A0A0H3TLU0	Faustovirus	52.9	6.2e-12
AXH18120.1|1823257_1824619_-	ATP-dependent RNA helicase RhlE	NA	A0A1V0SBR7	Catovirus	31.8	1.5e-52
AXH21236.1|1824847_1825519_+	transcriptional regulator	NA	NA	NA	NA	NA
AXH18121.1|1825518_1826517_+	secretion protein HlyD	NA	NA	NA	NA	NA
AXH18122.1|1826509_1828246_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.8	2.3e-18
>prophage 134
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	1838847	1839756	5214712		Streptococcus_phage(100.0%)	1	NA	NA
AXH18136.1|1838847_1839756_+	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	31.1	6.4e-28
>prophage 135
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	1846083	1848614	5214712	transposase	Klosneuvirus(50.0%)	2	NA	NA
AXH18142.1|1846083_1847373_+	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	29.0	1.0e-18
AXH18143.1|1847483_1848614_-|transposase	transposase	transposase	Q9G0F2	Phage_Gifsy-1	86.2	4.7e-190
>prophage 136
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	1858926	1859985	5214712		Planktothrix_phage(100.0%)	1	NA	NA
AXH18152.1|1858926_1859985_-	molybdenum import ATP-binding protein ModC	NA	G9BWD6	Planktothrix_phage	35.4	7.4e-20
>prophage 137
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	1864482	1865499	5214712		Tupanvirus(100.0%)	1	NA	NA
AXH18159.1|1864482_1865499_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	46.0	1.0e-79
>prophage 138
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	1869861	1873381	5214712		Pandoravirus(33.33%)	4	NA	NA
AXH18164.1|1869861_1870914_-	3-deoxy-7-phosphoheptulonate synthase AroG	NA	S4W5F1	Pandoravirus	47.9	2.9e-80
AXH18165.1|1871229_1871610_+	hypothetical protein	NA	NA	NA	NA	NA
AXH18166.1|1871723_1872665_+	zinc transporter ZitB	NA	A0A1V0SED0	Indivirus	27.9	2.9e-23
AXH18167.1|1872661_1873381_-	nicotinamide riboside transporter PnuC	NA	A0A126HGA3	Vibrio_phage	32.7	4.1e-22
>prophage 139
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	1900917	1901709	5214712		Kaumoebavirus(100.0%)	1	NA	NA
AXH18192.1|1900917_1901709_-	endonuclease VIII	NA	A0A1V0CNR6	Kaumoebavirus	25.8	7.5e-09
>prophage 140
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	1905087	1916920	5214712		Hokovirus(40.0%)	10	NA	NA
AXH18197.1|1905087_1906569_+	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	28.2	3.2e-45
AXH18198.1|1906610_1908029_-	deoxyribodipyrimidine photo-lyase	NA	A0A1V0SGL1	Hokovirus	32.6	6.2e-62
AXH18199.1|1908025_1908535_-	DUF1722 domain-containing protein	NA	NA	NA	NA	NA
AXH18200.1|1908635_1908842_-	DUF2517 family protein	NA	NA	NA	NA	NA
AXH18201.1|1909154_1909244_+	potassium-transporting ATPase subunit F	NA	NA	NA	NA	NA
AXH18202.1|1909243_1910917_+	potassium-transporting ATPase subunit KdpA	NA	NA	NA	NA	NA
AXH18203.1|1910939_1912988_+	potassium-transporting ATPase subunit B	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	22.5	3.5e-26
AXH18204.1|1912996_1913569_+	potassium-transporting ATPase subunit C	NA	NA	NA	NA	NA
AXH18205.1|1913561_1916246_+	two-component system sensor histidine kinase KdbD	NA	A0A1V0SGX0	Hokovirus	26.8	1.1e-11
AXH18206.1|1916242_1916920_+	two-component system response regulator KdpE	NA	W8CYM9	Bacillus_phage	30.6	2.0e-26
>prophage 141
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	1923700	1924465	5214712		Mycobacterium_phage(100.0%)	1	NA	NA
AXH18213.1|1923700_1924465_+	esterase	NA	A0A1J0GNR5	Mycobacterium_phage	31.5	2.9e-05
>prophage 142
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	1928610	1931256	5214712	tRNA	Escherichia_phage(100.0%)	2	NA	NA
AXH18219.1|1928610_1930275_-|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	98.7	0.0e+00
AXH18220.1|1930494_1931256_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	35.7	7.4e-30
>prophage 143
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	1935749	1936508	5214712		Moraxella_phage(100.0%)	1	NA	NA
AXH18225.1|1935749_1936508_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	47.8	1.1e-44
>prophage 144
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	1939559	1941506	5214712		Vibrio_phage(100.0%)	1	NA	NA
AXH18229.1|1939559_1941506_-	PTS N-acetyl glucosamine transporter subunit IIABC	NA	A0A2I7SAJ6	Vibrio_phage	47.3	1.2e-07
>prophage 145
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	1946131	1947796	5214712		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
AXH21239.1|1946131_1947796_+	asparagine synthetase B	NA	A9YVS6	Ostreococcus_tauri_virus	39.5	1.4e-84
>prophage 146
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	1951893	1952973	5214712		Pseudomonas_phage(100.0%)	1	NA	NA
AXH18237.1|1951893_1952973_+	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	46.6	4.3e-47
>prophage 147
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	1960925	1961651	5214712		Planktothrix_phage(100.0%)	1	NA	NA
AXH18245.1|1960925_1961651_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.1	7.6e-32
>prophage 148
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	1973057	1975497	5214712		Synechococcus_phage(50.0%)	2	NA	NA
AXH18256.1|1973057_1974146_+	endolytic peptidoglycan transglycosylase RlpA	NA	F5B3X9	Synechococcus_phage	53.2	3.6e-09
AXH18257.1|1974285_1975497_+	serine-type D-Ala-D-Ala carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	47.4	2.6e-101
>prophage 149
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	1979708	1980355	5214712		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
AXH18264.1|1979708_1980092_+	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	53.6	6.8e-24
AXH18265.1|1980145_1980355_-	cold-shock protein CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	2.7e-22
>prophage 150
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	1994444	1996559	5214712		Morganella_phage(50.0%)	2	NA	NA
AXH18280.1|1994444_1994873_+	universal stress protein UspG	NA	A0A1W6JNV4	Morganella_phage	38.5	3.3e-19
AXH18281.1|1994993_1996559_-	alkyl hydroperoxide reductase subunit F	NA	G3MA85	Bacillus_virus	34.3	2.2e-44
>prophage 151
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	1999664	2001487	5214712		Streptococcus_phage(50.0%)	2	NA	NA
AXH18285.1|1999664_2000885_+	phosphoadenosine phosphosulfate reductase	NA	A0A220GKF8	Streptococcus_phage	32.8	2.1e-58
AXH18286.1|2000857_2001487_+	hypothetical protein	NA	A0A0F7L444	uncultured_marine_virus	53.3	1.3e-56
>prophage 152
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	2015778	2021821	5214712		Klosneuvirus(50.0%)	3	NA	NA
AXH18300.1|2015778_2016594_+	iron-enterobactin ABC transporter ATP-binding protein	NA	A0A1V0SJ29	Klosneuvirus	22.0	7.3e-07
AXH18301.1|2016590_2017724_-	LPS O-antigen length regulator	NA	NA	NA	NA	NA
AXH18302.1|2017939_2021821_-	enterobactin non-ribosomal peptide synthetase EntF	NA	A0A2K9KZV5	Tupanvirus	29.6	5.8e-62
>prophage 153
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	2033354	2036498	5214712		Leptospira_phage(100.0%)	1	NA	NA
AXH18313.1|2033354_2036498_-	Cu(+)/Ag(+) efflux RND transporter permease subunit CusA	NA	S5VTK5	Leptospira_phage	22.4	1.3e-59
>prophage 154
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	2039643	2040327	5214712		Bacillus_phage(100.0%)	1	NA	NA
AXH18317.1|2039643_2040327_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	35.1	1.0e-30
>prophage 155
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	2051907	2055038	5214712	tRNA	Enterococcus_phage(50.0%)	4	NA	NA
AXH18325.1|2051907_2052774_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
AXH18326.1|2052775_2052988_+	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
AXH18327.1|2053095_2053617_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
AXH18328.1|2053652_2055038_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.9e-45
>prophage 156
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	2067273	2068419	5214712		Streptococcus_phage(100.0%)	1	NA	NA
AXH18341.1|2067273_2068419_-	glycerate 3-kinase	NA	W6LM47	Streptococcus_phage	43.0	4.8e-49
>prophage 157
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	2074610	2076392	5214712		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
AXH18347.1|2074610_2076392_-	glyoxylate carboligase	NA	E4WLQ6	Ostreococcus_tauri_virus	27.2	4.6e-38
>prophage 158
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	2082827	2083514	5214712		Planktothrix_phage(100.0%)	1	NA	NA
AXH18353.1|2082827_2083514_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.6	2.9e-33
>prophage 159
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	2086650	2087328	5214712		Bacillus_virus(100.0%)	1	NA	NA
AXH18357.1|2086650_2087328_-	iron ABC transporter ATP-binding protein FetA	NA	G3M9Y6	Bacillus_virus	33.8	6.8e-27
>prophage 160
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	2093209	2096113	5214712		uncultured_virus(50.0%)	2	NA	NA
AXH18364.1|2093209_2095714_+	copper-exporting P-type ATPase CopA	NA	A0A218MNH6	uncultured_virus	38.4	1.3e-115
AXH18365.1|2095771_2096113_-	transcriptional regulator	NA	A0A222YWD7	Escherichia_phage	75.5	3.2e-41
>prophage 161
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	2104687	2113132	5214712		Acanthamoeba_polyphaga_moumouvirus(25.0%)	8	NA	NA
AXH18374.1|2104687_2105656_+	acetyl esterase	NA	L7RDF8	Acanthamoeba_polyphaga_moumouvirus	25.0	6.0e-16
AXH18375.1|2105630_2106593_-	ferrochelatase	NA	NA	NA	NA	NA
AXH18376.1|2106724_2107369_-	adenylate kinase	NA	NA	NA	NA	NA
AXH18377.1|2107549_2109424_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	37.8	1.0e-117
AXH18378.1|2109533_2110139_-	recombination protein RecR	NA	NA	NA	NA	NA
AXH18379.1|2110138_2110468_-	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
AXH18380.1|2110520_2112452_-	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	41.5	5.1e-43
AXH18381.1|2112580_2113132_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	47.3	3.7e-31
>prophage 162
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	2120140	2123290	5214712		Leptospira_phage(100.0%)	1	NA	NA
AXH18390.1|2120140_2123290_+	multidrug efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	23.9	4.7e-54
>prophage 163
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	2132127	2135674	5214712		Bacillus_phage(100.0%)	2	NA	NA
AXH18401.1|2132127_2133909_-	multidrug resistance-like ATP-binding protein MdlB	NA	W8CYL7	Bacillus_phage	26.9	5.2e-42
AXH18402.1|2133901_2135674_-	multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.5	1.8e-50
>prophage 164
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	2138997	2139693	5214712		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
AXH18406.1|2138997_2139693_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	68.0	1.9e-88
>prophage 165
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	2142833	2147880	5214712	protease	Bacillus_phage(25.0%)	4	NA	NA
AXH18410.1|2142833_2143106_-	DNA-binding protein HU-beta	NA	A7KV42	Bacillus_phage	58.4	1.1e-20
AXH18411.1|2143314_2145669_-|protease	Lon protease	protease	A0A0R6PGP8	Moraxella_phage	52.4	1.6e-224
AXH18412.1|2145856_2147131_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	56.4	8.7e-132
AXH18413.1|2147256_2147880_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	63.9	2.9e-64
>prophage 166
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	2173339	2182181	5214712	tRNA	uncultured_Mediterranean_phage(60.0%)	10	NA	NA
AXH18438.1|2173339_2173810_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	47.4	1.3e-29
AXH18439.1|2173898_2175002_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	36.1	1.3e-54
AXH18440.1|2175005_2175455_-	transcriptional regulator NrdR	NA	NA	NA	NA	NA
AXH18441.1|2175605_2176145_+	DUF3251 domain-containing protein	NA	NA	NA	NA	NA
AXH18442.1|2176442_2177327_+	nucleoside-specific channel-forming protein Tsx	NA	NA	NA	NA	NA
AXH18443.1|2177364_2177712_-	HNH endonuclease	NA	NA	NA	NA	NA
AXH18444.1|2177841_2178813_-	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	37.9	1.0e-44
AXH18445.1|2178823_2180671_-	protein translocase subunit SecD	NA	NA	NA	NA	NA
AXH18446.1|2180698_2181031_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	33.0	2.8e-10
AXH18447.1|2181053_2182181_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	46.1	2.1e-89
>prophage 167
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	2189132	2199229	5214712		Bacillus_phage(60.0%)	7	NA	NA
AXH18453.1|2189132_2190428_-	PAS domain-containing sensor histidine kinase	NA	W8CYF6	Bacillus_phage	30.8	1.3e-26
AXH18454.1|2190485_2191175_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	38.0	4.4e-37
AXH18455.1|2191364_2192567_+	exonuclease sbcCD subunit D	NA	R4JGS2	Bacillus_phage	32.4	2.4e-06
AXH18456.1|2192563_2195707_+	exonuclease subunit SbcC	NA	G3MAB6	Bacillus_virus	26.9	5.8e-12
AXH21245.1|2195832_2197017_+	MFS transporter AraJ	NA	NA	NA	NA	NA
AXH18457.1|2197284_2198193_-	fructokinase	NA	NA	NA	NA	NA
AXH21246.1|2198317_2199229_+	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	63.6	2.7e-103
>prophage 168
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	2203515	2204631	5214712		Bacillus_phage(100.0%)	1	NA	NA
AXH18467.1|2203515_2204631_-	diguanylate cyclase AdrA	NA	A0A127AWB9	Bacillus_phage	34.5	1.1e-18
>prophage 169
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	2212045	2213203	5214712		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
AXH18478.1|2212045_2213203_+	D-alanyl-D-alanine- carboxypeptidase/endopeptidase AmpH	NA	A0A2H4JAN9	uncultured_Caudovirales_phage	22.1	3.9e-06
>prophage 170
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	2220072	2220840	5214712		Planktothrix_phage(100.0%)	1	NA	NA
AXH18484.1|2220072_2220840_-	taurine import ATP-binding protein TauB	NA	G9BWD6	Planktothrix_phage	39.8	1.9e-25
>prophage 171
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	2226128	2233411	5214712		Prochlorococcus_phage(33.33%)	6	NA	NA
AXH18488.1|2226128_2227238_+	S-(hydroxymethyl)glutathione dehydrogenase	NA	A0A0K0KVL7	Prochlorococcus_phage	28.9	4.0e-32
AXH18489.1|2227330_2228164_+	S-formylglutathione hydrolase FrmB	NA	NA	NA	NA	NA
AXH18490.1|2228114_2228369_-	hypothetical protein	NA	NA	NA	NA	NA
AXH18491.1|2228390_2228930_-	DUF2058 domain-containing protein	NA	NA	NA	NA	NA
AXH18492.1|2229131_2230214_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	98.9	1.6e-190
AXH18493.1|2230336_2233411_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	97.1	0.0e+00
>prophage 172
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	2238370	2240257	5214712		Staphylococcus_phage(100.0%)	1	NA	NA
AXH18497.1|2238370_2240257_-	propionate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	29.4	2.4e-53
>prophage 173
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	2247903	2248953	5214712		Tupanvirus(100.0%)	1	NA	NA
AXH18504.1|2247903_2248953_-	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L339	Tupanvirus	45.0	1.8e-71
>prophage 174
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	2260065	2353558	5214712	terminase,integrase,protease,holin,capsid,portal,lysis,head,tail,plate	Shigella_phage(45.0%)	105	2335952:2335970	2360960:2360978
AXH18516.1|2260065_2262099_-|holin	high-affinity choline transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.4	3.4e-21
AXH21249.1|2262095_2262311_-	hypothetical protein	NA	NA	NA	NA	NA
AXH18517.1|2262227_2262815_+	transcriptional regulator	NA	NA	NA	NA	NA
AXH18518.1|2262828_2264301_+	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
AXH18519.1|2264314_2266003_+|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	30.9	5.3e-60
AXH18520.1|2266027_2266255_-	hypothetical protein	NA	NA	NA	NA	NA
AXH18521.1|2266782_2266968_-	hypothetical protein	NA	NA	NA	NA	NA
AXH18522.1|2267073_2267637_+	DNA recombinase	NA	A0A2L1IV36	Escherichia_phage	53.3	6.0e-53
AXH18523.1|2267966_2268761_+	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
AXH18524.1|2268914_2269676_+	hypothetical protein	NA	NA	NA	NA	NA
AXH21250.1|2270821_2272015_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
AXH18525.1|2272198_2272867_+	hypothetical protein	NA	NA	NA	NA	NA
AXH18526.1|2272838_2273036_+	universal stress protein	NA	NA	NA	NA	NA
AXH18527.1|2272942_2273155_+	hypothetical protein	NA	NA	NA	NA	NA
AXH18528.1|2273109_2273805_-	lactate utilization protein C	NA	NA	NA	NA	NA
AXH18529.1|2273797_2275225_-	iron-sulfur cluster-binding protein	NA	NA	NA	NA	NA
AXH18530.1|2275235_2275955_-	(Fe-S)-binding protein	NA	NA	NA	NA	NA
AXH18531.1|2276481_2277336_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AXH18532.1|2277562_2278888_+	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.8	3.8e-114
AXH18533.1|2278996_2279233_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
AXH18534.1|2279244_2279838_+	DUF417 domain-containing protein	NA	NA	NA	NA	NA
AXH18535.1|2279997_2280882_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	42.1	2.5e-53
AXH18536.1|2281081_2281972_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AXH18537.1|2282096_2286347_-	intimin-like adhesin FdeC	NA	NA	NA	NA	NA
AXH18538.1|2286912_2287764_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	40.7	1.2e-47
AXH18539.1|2287851_2288781_+	aldo/keto reductase	NA	NA	NA	NA	NA
AXH21251.1|2288811_2289747_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AXH18540.1|2289904_2290831_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AXH18541.1|2290987_2291908_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
AXH18542.1|2292079_2293222_+	NADH:flavin oxidoreductase	NA	NA	NA	NA	NA
AXH18543.1|2293694_2293796_+	hypothetical protein	NA	NA	NA	NA	NA
AXH18544.1|2294160_2294424_+	50S ribosomal protein L31 type B	NA	NA	NA	NA	NA
AXH18545.1|2294423_2294564_+	50S ribosomal protein L36	NA	NA	NA	NA	NA
AXH21252.1|2294885_2295068_-	hypothetical protein	NA	NA	NA	NA	NA
AXH18546.1|2294970_2295195_+	hypothetical protein	NA	NA	NA	NA	NA
AXH18547.1|2295599_2296190_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
AXH18548.1|2296264_2296852_+	common pilus major fimbrillin subunit EcpA	NA	NA	NA	NA	NA
AXH18549.1|2296908_2297577_+	fimbrial chaperone EcpB	NA	NA	NA	NA	NA
AXH18550.1|2297602_2300128_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
AXH18551.1|2300117_2301761_+	hypothetical protein	NA	NA	NA	NA	NA
AXH18552.1|2301729_2302440_+	fimbrial chaperone EcpE	NA	NA	NA	NA	NA
AXH18553.1|2302752_2303082_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
AXH18554.1|2303330_2303945_-	DUF1440 domain-containing protein	NA	NA	NA	NA	NA
AXH18555.1|2306054_2310185_+	vacuolating autotransporter toxin Vat	NA	Q9LA54	Enterobacteria_phage	40.6	2.5e-281
AXH18556.1|2310310_2310835_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AXH18557.1|2311269_2311608_-	DUF4102 domain-containing protein	NA	E5AGD0	Erwinia_phage	48.6	5.6e-22
AXH18558.1|2311897_2312026_-	hypothetical protein	NA	NA	NA	NA	NA
AXH18559.1|2312258_2313191_-	hypothetical protein	NA	NA	NA	NA	NA
AXH18560.1|2313976_2314960_-	hypothetical protein	NA	NA	NA	NA	NA
AXH18561.1|2315095_2315278_-	hypothetical protein	NA	NA	NA	NA	NA
AXH21253.1|2316291_2317284_+	acyltransferase	NA	G9L6E5	Escherichia_phage	28.9	1.0e-15
AXH18562.1|2317325_2317721_-|tail	tail fiber assembly protein	tail	A0A0M4S6V4	Salmonella_phage	36.6	1.6e-12
AXH18563.1|2317720_2318671_-	carbohydrate kinase	NA	O22004	Shigella_phage	95.2	3.6e-50
AXH18564.1|2318674_2319259_-	DUF2313 domain-containing protein	NA	O22003	Shigella_phage	98.5	3.0e-111
AXH18565.1|2319249_2320308_-|plate	baseplate J/gp47 family protein	plate	U5P424	Shigella_phage	98.6	1.1e-199
AXH18566.1|2320294_2320723_-|tail	phage tail protein	tail	U5P0R9	Shigella_phage	98.6	2.0e-80
AXH18567.1|2320719_2321268_-|plate	phage baseplate assembly protein V	plate	U5P081	Shigella_phage	99.5	3.0e-97
AXH18568.1|2321267_2322347_-|plate	baseplate protein	plate	Q8SBG7	Shigella_phage	98.3	5.5e-204
AXH18569.1|2322343_2323714_-	DNA circularization protein	NA	S5FUX4	Shigella_phage	97.4	1.2e-251
AXH18570.1|2323732_2325568_-|tail	phage tail tape measure protein	tail	Q8SBG9	Shigella_phage	99.5	4.5e-307
AXH18571.1|2325560_2325743_-	hypothetical protein	NA	NA	NA	NA	NA
AXH18572.1|2325709_2325979_-|tail	phage tail assembly protein	tail	M1FPE4	Enterobacteria_phage	100.0	3.5e-43
AXH18573.1|2325978_2326335_-|tail	phage tail protein	tail	U5P076	Shigella_phage	100.0	5.3e-63
AXH18574.1|2326334_2327831_-|tail	phage tail protein	tail	M1FN90	Enterobacteria_phage	99.2	2.0e-273
AXH18575.1|2327814_2327985_-	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	100.0	9.3e-26
AXH18576.1|2327993_2328554_-	hypothetical protein	NA	M1FQV7	Enterobacteria_phage	99.5	2.3e-105
AXH18577.1|2328550_2329057_-	hypothetical protein	NA	M1FPE2	Enterobacteria_phage	100.0	1.7e-91
AXH18578.1|2329031_2329442_-|head,tail	head-tail adaptor protein	head,tail	M1FJ87	Enterobacteria_phage	100.0	3.1e-75
AXH18579.1|2329438_2329762_-|head,tail	phage gp6-like head-tail connector protein	head,tail	S5FKK6	Shigella_phage	100.0	5.1e-57
AXH18580.1|2329764_2329965_-	hypothetical protein	NA	S5FNU1	Shigella_phage	100.0	3.4e-27
AXH18581.1|2330014_2331220_-|capsid	phage major capsid protein	capsid	M1FPN2	Enterobacteria_phage	100.0	1.8e-224
AXH18582.1|2331234_2331921_-|head,protease	HK97 family phage prohead protease	head,protease	U5P4H2	Shigella_phage	98.7	1.0e-123
AXH18583.1|2331862_2333104_-|portal	phage portal protein	portal	U5P411	Shigella_phage	99.8	2.0e-242
AXH18584.1|2333103_2333286_-	hypothetical protein	NA	M1FJ83	Enterobacteria_phage	100.0	1.7e-25
AXH18585.1|2333297_2335031_-|terminase	terminase large subunit	terminase	U5P0Q5	Shigella_phage	98.8	0.0e+00
AXH18586.1|2335027_2335531_-|terminase	phage terminase small subunit P27 family	terminase	U5P067	Shigella_phage	99.4	2.3e-88
AXH21254.1|2335648_2335999_-	HNH endonuclease	NA	M1FQV2	Enterobacteria_phage	95.7	2.6e-62
2335952:2335970	attL	TTGGCGGCAGCCGCGAACG	NA	NA	NA	NA
AXH18587.1|2336064_2336268_-	hypothetical protein	NA	A0A1W6JPG4	Morganella_phage	52.9	4.9e-13
AXH18588.1|2336385_2336760_-	hypothetical protein	NA	M1FPD9	Enterobacteria_phage	96.0	1.8e-61
AXH18589.1|2336798_2337242_-|lysis	lysis protein	lysis	M1FJ79	Enterobacteria_phage	94.6	5.0e-71
AXH18590.1|2337238_2337715_-	lysozyme	NA	K7PKV2	Enterobacteria_phage	94.3	6.2e-83
AXH18591.1|2337718_2338054_-|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	100.0	5.2e-60
AXH18592.1|2338320_2339067_+	hypothetical protein	NA	NA	NA	NA	NA
AXH18593.1|2339117_2339480_-	antitermination protein Q	NA	A5LH77	Enterobacteria_phage	95.0	2.5e-60
AXH18594.1|2339497_2340487_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	98.5	1.2e-192
AXH18595.1|2340494_2341304_-	KilA-N domain-containing protein	NA	A5LH75	Enterobacteria_phage	100.0	8.2e-152
AXH18596.1|2341323_2341713_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	98.4	2.1e-68
AXH18597.1|2341709_2342069_-	LexA family transcriptional regulator	NA	S5FXP5	Shigella_phage	100.0	1.0e-53
AXH18598.1|2342035_2342530_-	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	96.9	4.0e-85
AXH18599.1|2342526_2343453_-	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	90.7	2.9e-137
AXH18600.1|2343442_2343622_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
AXH18601.1|2343797_2344349_-	protein YmfL	NA	S5FXP0	Shigella_phage	98.4	2.2e-100
AXH18602.1|2344392_2344593_-	transcriptional regulator	NA	U5P445	Shigella_phage	100.0	7.9e-32
AXH18603.1|2344683_2345358_+	LexA family transcriptional repressor	NA	U5P0T5	Shigella_phage	100.0	1.2e-132
AXH18604.1|2345530_2345827_+	hypothetical protein	NA	Q8SBF7	Shigella_phage	100.0	1.2e-52
AXH18605.1|2345744_2345990_-	hypothetical protein	NA	NA	NA	NA	NA
AXH18606.1|2346130_2346355_-	hypothetical protein	NA	A0A291AWX8	Escherichia_phage	64.6	6.4e-14
AXH18607.1|2346504_2347041_+	HD family hydrolase	NA	S5MW55	Escherichia_phage	98.3	2.0e-98
AXH18608.1|2347031_2347910_+	hypothetical protein	NA	A0A2R2Z314	Escherichia_phage	92.4	5.3e-165
AXH18609.1|2347906_2348251_+	DNA-binding protein	NA	U5P0J0	Shigella_phage	80.7	2.0e-30
AXH18610.1|2348250_2348601_+	DNA-binding protein	NA	U5P4J3	Shigella_phage	100.0	4.9e-61
AXH21255.1|2348702_2349641_+|integrase	site-specific integrase	integrase	U5P434	Shigella_phage	99.7	4.7e-183
AXH18611.1|2349845_2351099_-	gamma-glutamyl-phosphate reductase	NA	A0A1X9I5D4	Streptococcus_phage	47.5	4.4e-96
AXH18612.1|2351110_2352214_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
AXH18613.1|2352502_2353558_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.6	3.5e-118
2360960:2360978	attR	CGTTCGCGGCTGCCGCCAA	NA	NA	NA	NA
>prophage 175
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	2358235	2359387	5214712		Mycobacterium_phage(100.0%)	1	NA	NA
AXH18619.1|2358235_2359387_-	RNA ligase RtcB family protein	NA	A0A222ZMP7	Mycobacterium_phage	31.8	2.7e-31
>prophage 176
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	2363859	2367182	5214712		Clostridioides_phage(50.0%)	4	NA	NA
AXH18623.1|2363859_2364618_-	peptidoglycan endopeptidase	NA	A0A1V0DZX6	Clostridioides_phage	37.7	1.5e-19
AXH18624.1|2364920_2365661_+	transpeptidase	NA	NA	NA	NA	NA
AXH18625.1|2365631_2366399_-	class II glutamine amidotransferase	NA	NA	NA	NA	NA
AXH18626.1|2366603_2367182_-	phosphoheptose isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
>prophage 177
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	2379461	2381609	5214712		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
AXH18634.1|2379461_2381609_-	type I secretion system permease/ATPase	NA	F2Y2R6	Organic_Lake_phycodnavirus	26.9	4.2e-22
>prophage 178
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	2387289	2391405	5214712	protease	Enterobacteria_phage(100.0%)	1	NA	NA
AXH18638.1|2387289_2391405_+|protease	serine protease autotransporter toxin Pic	protease	Q9LA54	Enterobacteria_phage	45.8	0.0e+00
>prophage 179
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	2404987	2412114	5214712		Enterobacteria_phage(66.67%)	8	NA	NA
AXH18645.1|2404987_2406760_-	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	A0A0R6PI85	Moraxella_phage	25.3	1.7e-21
AXH18646.1|2406802_2406991_+	hypothetical protein	NA	NA	NA	NA	NA
AXH18647.1|2406981_2407605_-	DNA-binding protein	NA	NA	NA	NA	NA
AXH18648.1|2408359_2409391_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	27.0	1.4e-18
AXH18649.1|2409661_2410105_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
AXH18650.1|2410120_2410408_+	PTS ascorbate transporter subunit IIB	NA	NA	NA	NA	NA
AXH18651.1|2410420_2411677_+	PTS ascorbate transporter subunit IIC	NA	NA	NA	NA	NA
AXH21259.1|2411892_2412114_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	66.7	6.5e-19
>prophage 180
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	2438596	2439364	5214712		Bacillus_virus(100.0%)	1	NA	NA
AXH18683.1|2438596_2439364_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	27.9	1.7e-13
>prophage 181
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	2452725	2455798	5214712		Pseudomonas_phage(50.0%)	6	NA	NA
AXH18693.1|2452725_2453547_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	37.5	6.1e-46
AXH18694.1|2453546_2453792_+	antirestriction protein	NA	NA	NA	NA	NA
AXH18695.1|2453885_2454359_+	antirestriction protein	NA	A9J566	Pseudomonas_phage	31.2	4.3e-12
AXH21263.1|2454404_2454851_+	DNA repair protein RadC	NA	NA	NA	NA	NA
AXH18696.1|2454913_2455135_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	8.5e-11
AXH18697.1|2455153_2455798_+	antitoxin of toxin-antitoxin stability system	NA	A0A2I6PI07	Pseudomonas_phage	33.6	1.4e-26
>prophage 182
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	2461411	2471408	5214712		Stx2-converting_phage(20.0%)	12	NA	NA
AXH18701.1|2461411_2461762_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	2.8e-40
AXH21264.1|2462091_2462286_+	DUF957 domain-containing protein	NA	NA	NA	NA	NA
AXH18702.1|2463435_2463666_+	hypothetical protein	NA	NA	NA	NA	NA
AXH21265.1|2463554_2464286_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	38.6	7.6e-40
AXH18703.1|2464350_2464818_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.4e-50
AXH18704.1|2464814_2465537_-	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AXH18705.1|2465570_2466326_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
AXH18706.1|2466397_2467756_+	lytic transglycosylase	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
AXH18707.1|2467804_2468575_-	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AXH18708.1|2468652_2469453_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
AXH18709.1|2469693_2470608_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AXH18710.1|2470604_2471408_-	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.2	9.2e-39
>prophage 183
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	2477939	2478971	5214712		Planktothrix_phage(100.0%)	1	NA	NA
AXH18712.1|2477939_2478971_+	methionine import ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
>prophage 184
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	2491929	2496045	5214712		Saccharomonospora_phage(50.0%)	2	NA	NA
AXH18727.1|2491929_2495412_-	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.8	3.7e-209
AXH18728.1|2495448_2496045_-	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	8.7e-26
>prophage 185
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	2504873	2505632	5214712		Flavobacterium_phage(100.0%)	1	NA	NA
AXH18737.1|2504873_2505632_-	(2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase	NA	R9W0U9	Flavobacterium_phage	44.4	7.7e-27
>prophage 186
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	2517213	2579693	5214712	tRNA,bacteriocin,protease,transposase	uncultured_Mediterranean_phage(10.0%)	58	NA	NA
AXH18748.1|2517213_2518638_-|protease	serine endoprotease DegP	protease	A0A1B1IT49	uncultured_Mediterranean_phage	28.8	2.5e-26
AXH18749.1|2518767_2520285_-	deoxyguanosinetriphosphate triphosphohydrolase	NA	NA	NA	NA	NA
AXH18750.1|2520368_2521067_+	5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase	NA	NA	NA	NA	NA
AXH18751.1|2521059_2521860_+	cobalamin-binding protein	NA	NA	NA	NA	NA
AXH18752.1|2521897_2522521_+	hypothetical protein	NA	NA	NA	NA	NA
AXH18753.1|2522567_2522912_-	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	51.4	4.5e-27
AXH18754.1|2522993_2524415_-	ClC family H(+)/Cl(-) exchange transporter	NA	NA	NA	NA	NA
AXH18755.1|2524639_2525920_+	glutamate-1-semialdehyde-2,1-aminomutase	NA	NA	NA	NA	NA
AXH18756.1|2525954_2527937_-	Fe(3+)-hydroxamate ABC transporter permease FhuB	NA	NA	NA	NA	NA
AXH18757.1|2527933_2528824_-	Fe(3+)-hydroxamate ABC transporter substrate-binding protein FhuD	NA	NA	NA	NA	NA
AXH18758.1|2528823_2529621_-	Fe3+-hydroxamate ABC transporter ATP-binding protein FhuC	NA	G9BWD6	Planktothrix_phage	26.9	1.3e-13
AXH18759.1|2529671_2531930_-	ferrichrome porin FhuA	NA	NA	NA	NA	NA
AXH18760.1|2532149_2534684_-	bifunctional glycosyl transferase/transpeptidase	NA	NA	NA	NA	NA
AXH18761.1|2534777_2537207_-	ATP-dependent helicase HrpB	NA	A0A0G2Y9F4	Acanthamoeba_polyphaga_mimivirus	28.9	7.9e-41
AXH18762.1|2537280_2537811_+	RNA 2',3'-cyclic phosphodiesterase	NA	NA	NA	NA	NA
AXH18763.1|2537825_2538530_+	DNA/RNA nuclease SfsA	NA	NA	NA	NA	NA
AXH18764.1|2538707_2539163_+	RNA polymerase-binding transcription factor DksA	NA	NA	NA	NA	NA
AXH18765.1|2539199_2540126_+|tRNA	glutamyl-Q tRNA(Asp) synthetase	tRNA	NA	NA	NA	NA
AXH18766.1|2540164_2541583_+	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	37.9	3.2e-26
AXH18767.1|2541579_2542059_+	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
AXH18768.1|2542422_2543013_+	fimbrial protein	NA	NA	NA	NA	NA
AXH18769.1|2543121_2543862_+	fimbrial chaperone	NA	NA	NA	NA	NA
AXH18770.1|2543896_2546485_+	outer membrane usher protein	NA	NA	NA	NA	NA
AXH18771.1|2546501_2547068_+	fimbrial protein	NA	NA	NA	NA	NA
AXH18772.1|2547079_2547688_+	fimbrial-like protein YadL	NA	NA	NA	NA	NA
AXH18773.1|2547714_2548311_+	fimbrial protein StaF	NA	NA	NA	NA	NA
AXH18774.1|2548336_2549623_+	fimbrial-like adhesin	NA	NA	NA	NA	NA
AXH18775.1|2549734_2550529_+	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	NA	NA	NA	NA
AXH18776.1|2550540_2551392_+	pantoate--beta-alanine ligase	NA	NA	NA	NA	NA
AXH18777.1|2551469_2551685_-|transposase	transposase	transposase	NA	NA	NA	NA
AXH18778.1|2551753_2552674_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	48.4	8.3e-60
AXH18779.1|2552794_2552998_-	hypothetical protein	NA	NA	NA	NA	NA
AXH18780.1|2552947_2553328_+	aspartate 1-decarboxylase	NA	NA	NA	NA	NA
AXH18781.1|2553331_2554561_-	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
AXH18782.1|2554624_2555065_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
AXH18783.1|2555169_2555940_-	inner membrane transport permease YadH	NA	NA	NA	NA	NA
AXH18784.1|2555936_2556863_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	34.0	1.2e-21
AXH18785.1|2556971_2557634_+	carbonate dehydratase	NA	NA	NA	NA	NA
AXH18786.1|2557674_2558211_-	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	33.1	5.1e-17
AXH18787.1|2558416_2560807_+	glucose/quinate/shikimate family membrane-bound PQQ-dependent dehydrogenase	NA	NA	NA	NA	NA
AXH18788.1|2561063_2562614_-	multicopper oxidase CueO	NA	A0A0C6DWA2	Mamastrovirus	55.4	2.1e-18
AXH18789.1|2562779_2563127_+	hypothetical protein	NA	NA	NA	NA	NA
AXH18790.1|2563232_2564099_+	polyamine aminopropyltransferase	NA	NA	NA	NA	NA
AXH18791.1|2564114_2564909_+	S-adenosylmethionine decarboxylase proenzyme	NA	NA	NA	NA	NA
AXH18792.1|2564946_2565309_-	UPF0231 family protein	NA	NA	NA	NA	NA
AXH18793.1|2565483_2568081_-	aconitate hydratase B	NA	NA	NA	NA	NA
AXH18794.1|2568061_2568178_-	aconitate hydratase	NA	NA	NA	NA	NA
AXH18795.1|2568435_2570193_+	DUF3300 domain-containing protein	NA	NA	NA	NA	NA
AXH18796.1|2570434_2571859_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.8	4.2e-42
AXH18797.1|2572066_2573947_-	pyruvate dehydrogenase complex dihydrolipoyllysine-residue acetyltransferase	NA	NA	NA	NA	NA
AXH18798.1|2573961_2576625_-	pyruvate dehydrogenase E1 component	NA	NA	NA	NA	NA
AXH21267.1|2576606_2576789_+	hypothetical protein	NA	NA	NA	NA	NA
AXH18799.1|2576785_2577550_-	pyruvate dehydrogenase complex repressor	NA	NA	NA	NA	NA
AXH18800.1|2578005_2578296_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
AXH18801.1|2578349_2578538_-	HNH endonuclease	NA	NA	NA	NA	NA
AXH18802.1|2578704_2578995_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
AXH18803.1|2578995_2579235_-	hypothetical protein	NA	NA	NA	NA	NA
AXH21268.1|2579402_2579693_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
>prophage 187
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	2584271	2584823	5214712		Sphingobium_phage(100.0%)	1	NA	NA
AXH18807.1|2584271_2584823_-	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A1W6DX33	Sphingobium_phage	31.6	1.5e-11
>prophage 188
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	2589069	2590113	5214712		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
AXH18812.1|2589069_2590113_-	guanosine monophosphate reductase	NA	A0A0N9Q9A5	Chrysochromulina_ericina_virus	56.3	6.3e-104
>prophage 189
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	2616081	2617806	5214712		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
AXH18838.1|2616081_2617806_-	acetolactate synthase 3 large subunit	NA	E5ERI2	Ostreococcus_lucimarinus_virus	26.9	4.1e-36
>prophage 190
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	2629284	2629983	5214712		Planktothrix_phage(100.0%)	1	NA	NA
AXH18849.1|2629284_2629983_+	thiamine ABC transporter ATP-binding protein ThiQ	NA	G9BWD6	Planktothrix_phage	36.7	1.1e-22
>prophage 191
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	2638254	2643677	5214712		Yellowstone_lake_phycodnavirus(50.0%)	2	NA	NA
AXH18855.1|2638254_2640606_+	DNA polymerase II	NA	A0A0P0YM26	Yellowstone_lake_phycodnavirus	25.2	6.7e-37
AXH18856.1|2640770_2643677_+	RNA polymerase-associated protein RapA	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	37.9	5.7e-22
>prophage 192
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	2651422	2653383	5214712		Microcystis_phage(50.0%)	4	NA	NA
AXH18864.1|2651422_2652271_+	bis(5'-nucleosyl)-tetraphosphatase (symmetrical)	NA	A0A075BTY6	Microcystis_phage	42.0	1.1e-08
AXH18865.1|2652267_2652582_-	plasmid maintenance protein CcdB	NA	NA	NA	NA	NA
AXH18866.1|2652584_2652818_-	antitoxin	NA	NA	NA	NA	NA
AXH18867.1|2652903_2653383_-	type 3 dihydrofolate reductase	NA	A0A219UQN5	Bacillus_phage	46.4	1.0e-29
>prophage 193
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	2661277	2666936	5214712		Vibrio_phage(50.0%)	4	NA	NA
AXH18875.1|2661277_2662792_+	L-carnitine/gamma-butyrobetaine antiporter	NA	A0A2I7QNT1	Vibrio_phage	21.1	3.5e-07
AXH18876.1|2662822_2663965_+	crotonobetainyl-CoA dehydrogenase	NA	NA	NA	NA	NA
AXH18877.1|2664092_2665310_+	L-carnitine CoA-transferase	NA	NA	NA	NA	NA
AXH18878.1|2665382_2666936_+	crotonobetaine/carnitine-CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	26.7	1.3e-33
>prophage 194
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	2672439	2673588	5214712		Halovirus(100.0%)	1	NA	NA
AXH18884.1|2672439_2673588_-	carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	32.6	9.8e-50
>prophage 195
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	2678396	2692921	5214712	tRNA	Tupanvirus(16.67%)	13	NA	NA
AXH18891.1|2678396_2681213_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A2K9L260	Tupanvirus	26.3	2.1e-77
AXH18892.1|2681255_2682197_-	bifunctional riboflavin kinase/FAD synthetase	NA	NA	NA	NA	NA
AXH18893.1|2682204_2682423_-	DUF2575 domain-containing protein	NA	NA	NA	NA	NA
AXH18894.1|2682525_2682789_+	30S ribosomal protein S20	NA	NA	NA	NA	NA
AXH18895.1|2682884_2683790_-	transcriptional activator NhaR	NA	NA	NA	NA	NA
AXH18896.1|2683849_2685016_-	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	50.3	9.8e-90
AXH18897.1|2685250_2686510_-	cytoplasmic protein	NA	NA	NA	NA	NA
AXH18898.1|2686638_2688132_-	arylsulfatase	NA	A0A2P0VMN7	Tetraselmis_virus	28.3	3.6e-28
AXH18899.1|2688152_2688914_-	hypothetical protein	NA	NA	NA	NA	NA
AXH18900.1|2689193_2689484_-	hypothetical protein	NA	NA	NA	NA	NA
AXH18901.1|2689471_2689681_+	type I toxin-antitoxin system hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	72.5	5.2e-18
AXH18902.1|2689785_2690916_-	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	34.6	4.6e-28
AXH18903.1|2691004_2692921_-	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	51.1	6.9e-149
>prophage 196
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	2696057	2697011	5214712		Cyanophage(100.0%)	1	NA	NA
AXH18908.1|2696057_2697011_-	transaldolase B	NA	A0A127KNC6	Cyanophage	31.5	1.7e-10
>prophage 197
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	2707438	2711606	5214712	transposase	Saccharomonospora_phage(33.33%)	4	NA	NA
AXH18916.1|2707438_2707948_-|transposase	IS200/IS605 family transposase IS200C	transposase	I4AZI8	Saccharomonospora_phage	31.5	6.1e-12
AXH18917.1|2708082_2709435_-	cell envelope integrity protein CreD	NA	NA	NA	NA	NA
AXH18918.1|2709492_2710917_-	two-component system sensor histidine kinase CreC	NA	Q8QKV7	Ectocarpus_siliculosus_virus	20.9	3.2e-10
AXH18919.1|2710916_2711606_-	two-component system response regulator CreB	NA	W8CYM9	Bacillus_phage	35.3	8.8e-30
>prophage 198
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	2714883	2720693	5214712		Bacillus_phage(33.33%)	5	NA	NA
AXH18924.1|2714883_2716821_-	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	34.8	4.0e-11
AXH18925.1|2717027_2718695_+	energy-dependent translational throttle protein EttA	NA	A0A2K9L3Z8	Tupanvirus	27.7	1.0e-39
AXH18926.1|2718750_2719035_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AXH18927.1|2719036_2719369_-	addiction module toxin RelE	NA	NA	NA	NA	NA
AXH18928.1|2719460_2720693_-	trifunctional NAD biosynthesis/regulator protein NadR	NA	A0A0C5K935	Enterococcus_phage	42.9	7.2e-83
>prophage 199
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	2727413	2728736	5214712		Geobacillus_virus(100.0%)	1	NA	NA
AXH18936.1|2727413_2728736_-	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	39.8	4.0e-79
>prophage 200
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	2734421	2737297	5214712		Salmonella_phage(50.0%)	3	NA	NA
AXH18941.1|2734421_2734601_-	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	64.2	2.0e-10
AXH18942.1|2734709_2735315_-	molecular chaperone OsmY	NA	NA	NA	NA	NA
AXH18943.1|2735707_2737297_-	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	25.2	2.4e-30
>prophage 201
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	2745127	2746407	5214712		Salmonella_phage(50.0%)	2	NA	NA
AXH18954.1|2745127_2745667_+	primosomal protein 1	NA	T1SA92	Salmonella_phage	62.8	3.8e-28
AXH18955.1|2745669_2746407_+	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	50.8	7.6e-64
>prophage 202
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	2757033	2758707	5214712		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
AXH18963.1|2757033_2758707_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	39.6	6.2e-13
>prophage 203
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	2766448	2767369	5214712	transposase	Sodalis_phage(100.0%)	1	NA	NA
AXH18973.1|2766448_2767369_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	51.7	2.2e-60
>prophage 204
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	2782910	2789164	5214712		Ostreococcus_tauri_virus(33.33%)	5	NA	NA
AXH18986.1|2782910_2784650_+	glyoxylate carboligase	NA	E4WLQ6	Ostreococcus_tauri_virus	26.8	5.3e-39
AXH18987.1|2784662_2785445_+	hydroxypyruvate isomerase	NA	NA	NA	NA	NA
AXH18988.1|2785462_2786350_+	2-hydroxy-3-oxopropionate reductase	NA	NA	NA	NA	NA
AXH18989.1|2786424_2787567_+	glycerate kinase	NA	W6LM47	Streptococcus_phage	39.6	1.2e-44
AXH18990.1|2787622_2789164_-	carnitine transporter CniT	NA	A0A2I7QNT1	Vibrio_phage	23.9	3.2e-11
>prophage 205
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	2799515	2800976	5214712		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
AXH19000.1|2799515_2800976_-	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	32.2	1.6e-49
>prophage 206
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	2810065	2811742	5214712	integrase	Escherichia_phage(100.0%)	2	2810508:2810521	2815434:2815447
AXH19010.1|2810065_2810662_-	tyrosine recombinase	NA	A0A2L1IV36	Escherichia_phage	53.4	3.9e-50
2810508:2810521	attL	TCCTGATAATGCAG	NA	NA	NA	NA
AXH19011.1|2811139_2811742_-|integrase	integrase	integrase	A0A2L1IV36	Escherichia_phage	51.8	4.0e-55
AXH19011.1|2811139_2811742_-|integrase	integrase	integrase	A0A2L1IV36	Escherichia_phage	51.8	4.0e-55
2815434:2815447	attR	TCCTGATAATGCAG	NA	NA	NA	NA
>prophage 207
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	2815113	2816094	5214712		Escherichia_phage(100.0%)	1	NA	NA
AXH19016.1|2815113_2816094_+	sialate O-acetylesterase	NA	H6WZJ9	Escherichia_phage	56.0	7.9e-101
>prophage 208
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	2823235	2823676	5214712		Pseudomonas_phage(100.0%)	1	NA	NA
AXH19027.1|2823235_2823676_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	31.7	2.7e-16
>prophage 209
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	2831734	2839613	5214712		uncultured_Caudovirales_phage(33.33%)	4	NA	NA
AXH19037.1|2831734_2834584_+	helicase SNF2	NA	A0A2H4J643	uncultured_Caudovirales_phage	40.5	1.0e-188
AXH19038.1|2834609_2835590_+	ATP-binding protein	NA	Q677Q6	Lymphocystis_disease_virus	31.1	2.7e-16
AXH19039.1|2835599_2837987_+	peptidase S8	NA	NA	NA	NA	NA
AXH19040.1|2837996_2839613_+	site-specific DNA-methyltransferase	NA	A0A220NUF4	Escherichia_phage	42.9	2.0e-88
>prophage 210
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	2843253	2846008	5214712		Stenotrophomonas_phage(50.0%)	2	NA	NA
AXH19041.1|2843253_2844510_-	DUF4102 domain-containing protein	NA	B7SYF8	Stenotrophomonas_phage	43.4	5.1e-84
AXH19042.1|2844988_2846008_+	NAD(P)-dependent alcohol dehydrogenase	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	31.3	2.2e-45
>prophage 211
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	2851137	2860193	5214712	tRNA	Klebsiella_phage(33.33%)	6	NA	NA
AXH19048.1|2851137_2852640_+	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	44.3	1.1e-82
AXH19049.1|2852800_2853883_-	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
AXH19050.1|2853882_2854983_-	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
AXH19051.1|2855249_2856761_+	cytosol aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.0	6.0e-47
AXH21277.1|2856894_2857338_+	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
AXH19052.1|2857337_2860193_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.7	1.8e-140
>prophage 212
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	2870407	2876504	5214712		Paramecium_bursaria_Chlorella_virus(66.67%)	6	NA	NA
AXH19063.1|2870407_2871343_+	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	39.9	1.1e-51
AXH19064.1|2871355_2871817_+	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
AXH19065.1|2871889_2872276_+	reactive intermediate/imine deaminase	NA	NA	NA	NA	NA
AXH19066.1|2872481_2875178_-	magnesium-translocating P-type ATPase	NA	M1HLC0	Paramecium_bursaria_Chlorella_virus	27.3	1.5e-45
AXH21278.1|2875318_2875372_-	mgtA regulatory leader peptide MgtL	NA	NA	NA	NA	NA
AXH19067.1|2875556_2876504_+	HTH-type transcriptional regulator TreR	NA	C6ZCU4	Enterobacteria_phage	21.8	6.0e-13
>prophage 213
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	2880141	2882902	5214712		Vibrio_phage(50.0%)	2	NA	NA
AXH19070.1|2880141_2882280_+	anaerobic ribonucleoside triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.5	1.5e-266
AXH19071.1|2882437_2882902_+	anaerobic ribonucleoside-triphosphate reductase activating protein	NA	K4F9T1	Cronobacter_phage	57.7	3.8e-53
>prophage 214
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	2887219	2893707	5214712		Klosneuvirus(33.33%)	6	NA	NA
AXH19076.1|2887219_2888218_+	fructose 1,6-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.7	5.7e-70
AXH19077.1|2888250_2889246_-	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
AXH19078.1|2889232_2890258_-	ABC transporter permease	NA	NA	NA	NA	NA
AXH19079.1|2890268_2891771_-	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	29.8	5.2e-11
AXH19080.1|2891910_2892867_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AXH19081.1|2893176_2893707_+	inorganic pyrophosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.9	9.4e-56
>prophage 215
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	2939535	2940699	5214712		Ralstonia_phage(100.0%)	1	NA	NA
AXH19127.1|2939535_2940699_-	glutathionylspermidine synthase preATP-grasp family protein	NA	B2ZXR7	Ralstonia_phage	43.2	1.4e-80
>prophage 216
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	2944542	2957567	5214712	tRNA,protease	Lactococcus_phage(20.0%)	11	NA	NA
AXH19133.1|2944542_2946984_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.1	4.9e-67
AXH19134.1|2947022_2947448_-	transcriptional regulator	NA	NA	NA	NA	NA
AXH19135.1|2947652_2948951_-	adenylosuccinate synthetase	NA	W5S5V7	Pithovirus	35.9	2.2e-66
AXH19136.1|2949054_2949252_-	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
AXH19137.1|2949333_2950338_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
AXH19138.1|2950340_2951600_-|protease	protease modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
AXH19139.1|2951685_2952966_-	GTPase HflX	NA	NA	NA	NA	NA
AXH19140.1|2953041_2953350_-	RNA-binding protein Hfq	NA	NA	NA	NA	NA
AXH19141.1|2953435_2954386_-|tRNA	tRNA dimethylallyltransferase	tRNA	NA	NA	NA	NA
AXH19142.1|2954378_2956226_-	DNA mismatch repair protein MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.3	4.4e-60
AXH19143.1|2956235_2957567_-	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	30.5	1.9e-17
>prophage 217
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	2961482	2962028	5214712		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
AXH19147.1|2961482_2962028_-	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	39.9	8.5e-28
>prophage 218
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	2969747	2970725	5214712		Tupanvirus(100.0%)	1	NA	NA
AXH19152.1|2969747_2970725_-	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	28.1	5.2e-28
>prophage 219
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	2975646	2976180	5214712		Morganella_phage(100.0%)	1	NA	NA
AXH19157.1|2975646_2976180_+	hypothetical protein	NA	A0A1W6JNX6	Morganella_phage	55.0	2.7e-47
>prophage 220
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	2980384	2982368	5214712		Vibrio_phage(50.0%)	2	NA	NA
AXH19165.1|2980384_2982031_-	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	68.9	5.3e-190
AXH19166.1|2982074_2982368_-	co-chaperone GroES	NA	K4F9I2	Cronobacter_phage	45.4	9.2e-13
>prophage 221
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	3012565	3013339	5214712		Bacillus_virus(100.0%)	1	NA	NA
AXH19184.1|3012565_3013339_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	29.2	6.6e-18
>prophage 222
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	3038478	3040251	5214712		Moraxella_phage(100.0%)	1	NA	NA
AXH19198.1|3038478_3040251_-	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	A0A0R6PI85	Moraxella_phage	25.8	7.1e-23
>prophage 223
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	3044284	3049719	5214712	bacteriocin,protease	Sodalis_phage(50.0%)	8	NA	NA
AXH19204.1|3044284_3044629_+	prop effector	NA	Q2A0A1	Sodalis_phage	39.7	1.0e-07
AXH19205.1|3044647_3045196_-	hypothetical protein	NA	NA	NA	NA	NA
AXH19206.1|3045397_3045589_-	hypothetical protein	NA	NA	NA	NA	NA
AXH19207.1|3045653_3046112_+	hypothetical protein	NA	NA	NA	NA	NA
AXH19208.1|3046211_3046898_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
AXH19209.1|3047072_3047351_-|bacteriocin	colicin-V (microcin-V bacteriocin)	bacteriocin	NA	NA	NA	NA
AXH19210.1|3047347_3047569_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AXH19211.1|3047604_3049719_-	microcin export transporter peptidase/ATP-binding subunit MchF	NA	F2Y165	Organic_Lake_phycodnavirus	24.4	4.2e-14
>prophage 224
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	3069748	3071926	5214712		Yersinia_phage(33.33%)	4	NA	NA
AXH19230.1|3069748_3070567_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	37.9	3.3e-44
AXH19231.1|3070658_3071144_+	antirestriction protein	NA	A9J566	Pseudomonas_phage	31.5	2.6e-12
AXH21286.1|3071189_3071636_+	DNA repair protein RadC	NA	NA	NA	NA	NA
AXH19232.1|3071704_3071926_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.1e-10
>prophage 225
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	3080785	3083997	5214712	tRNA	Acinetobacter_phage(50.0%)	2	NA	NA
AXH19242.1|3080785_3082243_+	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	29.6	3.1e-48
AXH19243.1|3082479_3083997_+|tRNA	lysine--tRNA ligase heat inducible	tRNA	A0A1V0SAC0	Catovirus	38.0	2.7e-87
>prophage 226
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	3103561	3105064	5214712		Burkholderia_virus(100.0%)	1	NA	NA
AXH19261.1|3103561_3105064_-	proline/glycine betaine transporter ProP	NA	Q6JIH2	Burkholderia_virus	31.2	1.4e-56
>prophage 227
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	3109903	3110692	5214712		Pithovirus(100.0%)	1	NA	NA
AXH19265.1|3109903_3110692_+	phosphonates import ATP-binding protein PhnC	NA	W5SAS9	Pithovirus	28.2	1.9e-12
>prophage 228
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	3116296	3117846	5214712		Bacillus_virus(50.0%)	2	NA	NA
AXH19273.1|3116296_3117055_+	phosphonate C-P lyase system protein PhnK	NA	G3M9Y6	Bacillus_virus	28.3	1.6e-16
AXH19274.1|3117165_3117846_+	phosphonate C-P lyase system protein PhnL	NA	F2Y1V6	Organic_Lake_phycodnavirus	25.0	1.1e-05
>prophage 229
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	3123968	3125501	5214712		Bacillus_virus(100.0%)	1	NA	NA
AXH19282.1|3123968_3125501_+	D-allose ABC transporter ATP-binding protein AlsA	NA	G3M9Y6	Bacillus_virus	27.4	7.5e-13
>prophage 230
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	3135580	3137728	5214712		Escherichia_phage(100.0%)	1	NA	NA
AXH19289.1|3135580_3137728_+	formate dehydrogenase H subunit alpha, selenocysteine-containing	NA	A0A077SK27	Escherichia_phage	23.9	5.3e-33
>prophage 231
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	3141645	3143173	5214712		Planktothrix_phage(50.0%)	2	NA	NA
AXH19293.1|3141645_3142482_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.5	8.8e-16
AXH19294.1|3142468_3143173_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	7.1e-19
>prophage 232
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	3153109	3155068	5214712		Staphylococcus_phage(100.0%)	1	NA	NA
AXH19306.1|3153109_3155068_+	acetyl-coenzyme A synthetase	NA	A0A2H4PQU7	Staphylococcus_phage	40.2	1.6e-89
>prophage 233
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	3161376	3162726	5214712		Moraxella_phage(100.0%)	1	NA	NA
AXH19313.1|3161376_3162726_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	71.4	3.0e-159
>prophage 234
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	3166543	3170157	5214712		Enterobacteria_phage(50.0%)	2	NA	NA
AXH19320.1|3166543_3167080_-	ssDNA-binding protein	NA	A0A0A0P1Q9	Enterobacteria_phage	78.7	1.1e-56
AXH19321.1|3167334_3170157_+	excinuclease ABC subunit A	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	56.2	0.0e+00
>prophage 235
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	3180274	3181693	5214712		Erysipelothrix_phage(100.0%)	1	NA	NA
AXH19331.1|3180274_3181693_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.5	9.6e-39
>prophage 236
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	3187263	3189811	5214712		Yellowstone_lake_mimivirus(50.0%)	2	NA	NA
AXH19335.1|3187263_3188343_-	alanine racemase biosynthetic	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	27.9	5.2e-29
AXH19336.1|3188395_3189811_-	replicative DNA helicase	NA	O80281	Escherichia_phage	78.3	4.8e-200
>prophage 237
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	3194848	3195457	5214712		Lactococcus_phage(100.0%)	1	NA	NA
AXH19343.1|3194848_3195457_-	LexA repressor	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
>prophage 238
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	3202899	3204015	5214712		Mycoplasma_phage(100.0%)	1	NA	NA
AXH19349.1|3202899_3204015_-	maltose/maltodextrin import ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	31.7	4.3e-18
>prophage 239
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	3228356	3232040	5214712		Dickeya_phage(100.0%)	1	NA	NA
AXH19375.1|3228356_3232040_-	methionine synthase	NA	A0A140XBC7	Dickeya_phage	88.5	2.9e-26
>prophage 240
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	3245771	3247361	5214712		Prochlorococcus_phage(100.0%)	1	NA	NA
AXH19382.1|3245771_3247361_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/inosine monophosphate cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	47.1	3.2e-67
>prophage 241
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	3252723	3254487	5214712		Bacillus_phage(50.0%)	3	NA	NA
AXH19388.1|3252723_3252996_-	DNA-binding protein HU-alpha	NA	A7KV42	Bacillus_phage	58.9	3.2e-20
AXH19389.1|3253182_3253773_-	DUF416 family protein	NA	NA	NA	NA	NA
AXH19390.1|3253815_3254487_-	endonuclease V	NA	A0A1V0SJW5	Klosneuvirus	28.7	6.1e-20
>prophage 242
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	3262782	3271111	5214712		Vibrio_phage(50.0%)	2	NA	NA
AXH19400.1|3262782_3267006_-	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	26.3	5.5e-66
AXH19401.1|3267082_3271111_-	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	29.0	9.4e-23
>prophage 243
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	3275106	3278159	5214712		Tupanvirus(50.0%)	4	NA	NA
AXH19408.1|3275106_3276291_-	translation elongation factor EF-Tu 2	NA	A0A2K9L516	Tupanvirus	26.1	4.4e-13
AXH19409.1|3276866_3277022_+	hypothetical protein	NA	NA	NA	NA	NA
AXH19410.1|3277031_3277226_-	hypothetical protein	NA	NA	NA	NA	NA
AXH19411.1|3277208_3278159_+	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	32.0	8.7e-28
>prophage 244
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	3286501	3292284	5214712	tRNA	Acinetobacter_phage(50.0%)	5	NA	NA
AXH19415.1|3286501_3288346_-	vitamin B12 transporter BtuB	NA	A0A0P0I887	Acinetobacter_phage	32.0	9.3e-10
AXH19416.1|3288714_3289815_+|tRNA	tRNA (uridine(54)-C5)-methyltransferase TrmA	tRNA	NA	NA	NA	NA
AXH19417.1|3289854_3290214_-	YijD family membrane protein	NA	NA	NA	NA	NA
AXH21299.1|3290213_3290861_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AXH19418.1|3290967_3292284_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	35.2	2.0e-59
>prophage 245
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	3297724	3298939	5214712		Oenococcus_phage(100.0%)	1	NA	NA
AXH19423.1|3297724_3298939_-	D-galactonate dehydratase family protein	NA	Q6A202	Oenococcus_phage	28.1	7.7e-45
>prophage 246
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	3311083	3318330	5214712		Serratia_phage(33.33%)	5	NA	NA
AXH19434.1|3311083_3313381_-	formate C-acetyltransferase	NA	A0A1S6UAD4	Serratia_phage	48.1	4.6e-06
AXH19435.1|3313431_3313752_-	fructose-like phosphotransferase enzyme IIB component 2	NA	NA	NA	NA	NA
AXH19436.1|3313766_3314846_-	PTS fructose transporter subunit EIIC	NA	NA	NA	NA	NA
AXH19437.1|3315154_3317656_+	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	26.9	1.0e-11
AXH19438.1|3317667_3318330_+	fructose-6-phosphate aldolase	NA	A0A0E3F0E2	Synechococcus_phage	34.1	1.6e-28
>prophage 247
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	3325143	3329737	5214712		Pandoravirus(100.0%)	3	NA	NA
AXH19444.1|3325143_3326697_-	bifunctional metallophosphatase/5'-nucleotidase	NA	A0A0B5J7T1	Pandoravirus	24.2	1.3e-09
AXH19445.1|3326829_3327954_+	cytoplasmic protein	NA	NA	NA	NA	NA
AXH19446.1|3328186_3329737_+	bifunctional metallophosphatase/5'-nucleotidase	NA	A0A0B5J7T1	Pandoravirus	35.4	3.4e-05
>prophage 248
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	3342947	3347450	5214712		Erwinia_phage(50.0%)	5	NA	NA
AXH19458.1|3342947_3344279_+	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	29.9	1.7e-45
AXH19459.1|3344345_3345272_+	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
AXH19460.1|3345364_3345850_+	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
AXH19461.1|3345934_3346180_-	cell division protein ZapB	NA	NA	NA	NA	NA
AXH19462.1|3346604_3347450_+	aquaporin	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.0	4.4e-15
>prophage 249
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	3359060	3363921	5214712		Feldmannia_irregularis_virus(33.33%)	6	NA	NA
AXH19475.1|3359060_3359759_+	DNA-binding transcriptional regulator CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
AXH19476.1|3359755_3361129_+	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	25.9	3.8e-16
AXH19477.1|3361233_3361908_-	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
AXH19478.1|3362056_3363022_-	2-keto-3-deoxygluconate transporter	NA	NA	NA	NA	NA
AXH19479.1|3363018_3363126_-	2-keto-3-deoxygluconate permease	NA	NA	NA	NA	NA
AXH19480.1|3363300_3363921_-	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	59.8	8.4e-64
>prophage 250
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	3390722	3395454	5214712		Prochlorococcus_phage(33.33%)	5	NA	NA
AXH19508.1|3390722_3391733_-	Zn-dependent alcohol dehydrogenase	NA	A0A0K0KVL7	Prochlorococcus_phage	22.2	1.3e-05
AXH19509.1|3391765_3392653_-	aldolase	NA	NA	NA	NA	NA
AXH19510.1|3392677_3393556_-	sulfolactaldehyde 3-reductase	NA	D2K0C8	Staphylococcus_phage	73.6	2.0e-47
AXH19511.1|3393729_3394626_+	sugar kinase	NA	NA	NA	NA	NA
AXH19512.1|3394665_3395454_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.8	1.3e-21
>prophage 251
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	3402574	3405045	5214712		Ectocarpus_siliculosus_virus(50.0%)	2	NA	NA
AXH19518.1|3402574_3403624_+	two-component system sensor histidine kinase NtrB	NA	Q8QKV7	Ectocarpus_siliculosus_virus	26.6	5.0e-08
AXH21304.1|3403635_3405045_+	nitrogen regulation protein NR(I)	NA	Q56AR1	Bacillus_thuringiensis_phage	28.7	2.4e-05
>prophage 252
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	3409166	3411953	5214712		uncultured_virus(100.0%)	1	NA	NA
AXH19522.1|3409166_3411953_-	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	31.9	6.4e-71
>prophage 253
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	3425646	3426261	5214712		Streptococcus_phage(100.0%)	1	NA	NA
AXH19531.1|3425646_3426261_-	IMPACT family protein	NA	A0A1X9I5T8	Streptococcus_phage	32.8	1.3e-19
>prophage 254
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	3435142	3438429	5214712		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
AXH19539.1|3435142_3435919_-	twin-arginine translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	32.6	5.1e-26
AXH19540.1|3435921_3436437_-	twin-arginine translocase subunit TatB	NA	NA	NA	NA	NA
AXH19541.1|3436440_3436710_-	twin-arginine translocase subunit TatA	NA	NA	NA	NA	NA
AXH19542.1|3436788_3438429_-	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	M4R0M8	Ostreococcus_lucimarinus_virus	29.0	4.8e-42
>prophage 255
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	3454871	3456380	5214712		Vibrio_phage(100.0%)	1	NA	NA
AXH19558.1|3454871_3456380_-	PTS N-acetylglucosamine transporter subunit IICB	NA	A0A2I7SAJ6	Vibrio_phage	50.7	6.2e-12
>prophage 256
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	3466839	3468669	5214712		Catovirus(100.0%)	1	NA	NA
AXH21307.1|3466839_3468669_-	ATP-dependent DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	37.8	1.3e-83
>prophage 257
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	3476038	3484645	5214712		Bacillus_phage(50.0%)	8	NA	NA
AXH19577.1|3476038_3478201_-	DNA helicase II	NA	A7KV33	Bacillus_phage	37.2	4.6e-117
AXH19578.1|3478284_3479001_-	5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase YigB	NA	NA	NA	NA	NA
AXH19579.1|3479000_3479897_-	tyrosine recombinase XerC	NA	A0A142F1N9	Bacillus_phage	29.6	3.8e-25
AXH19580.1|3479893_3480601_-	DUF484 domain-containing protein	NA	NA	NA	NA	NA
AXH19581.1|3480597_3481422_-	diaminopimelate epimerase	NA	NA	NA	NA	NA
AXH19582.1|3481458_3481662_-	hypothetical protein	NA	NA	NA	NA	NA
AXH19583.1|3481850_3483329_+	DKNYY family protein	NA	A0A0U2C3T4	Salmonella_phage	54.1	3.3e-42
AXH19584.1|3483325_3484645_+	DKNYY family protein	NA	A0A0U2C3T4	Salmonella_phage	47.4	8.7e-10
>prophage 258
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	3492780	3494436	5214712		Tetraselmis_virus(100.0%)	1	NA	NA
AXH19592.1|3492780_3494436_+	arylsulfatase	NA	A0A2P0VMN7	Tetraselmis_virus	29.7	1.8e-44
>prophage 259
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	3502443	3508587	5214712		Enterobacteria_phage(40.0%)	6	NA	NA
AXH19599.1|3502443_3503574_-	dTDP-4-amino-4,6-dideoxygalactose transaminase	NA	A0A0F7LAY0	uncultured_marine_virus	41.7	2.0e-18
AXH19600.1|3503578_3504253_-	dTDP-fucosamine acetyltransferase	NA	NA	NA	NA	NA
AXH19601.1|3504230_3505112_-	glucose-1-phosphate thymidylyltransferase 2	NA	I7I009	Enterobacteria_phage	66.3	8.7e-107
AXH19602.1|3505130_3506198_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.4	7.8e-102
AXH19603.1|3506197_3507460_-	UDP-N-acetyl-D-mannosamine dehydrogenase	NA	M1HNJ7	Paramecium_bursaria_Chlorella_virus	27.2	7.7e-24
AXH19604.1|3507456_3508587_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	32.8	2.3e-27
>prophage 260
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	3512629	3521230	5214712		Indivirus(25.0%)	8	NA	NA
AXH19610.1|3512629_3512959_-	thiol reductase thioredoxin	NA	A0A1V0SD63	Indivirus	38.5	4.2e-14
AXH19611.1|3513159_3514356_+	ATP-dependent RNA helicase RhlB	NA	E3T5E1	Cafeteria_roenbergensis_virus	32.1	4.3e-40
AXH19612.1|3514363_3514486_+	addiction module toxin RelE	NA	NA	NA	NA	NA
AXH19613.1|3514491_3515976_+	guanosine-5'-triphosphate,3'-diphosphate pyrophosphatase	NA	NA	NA	NA	NA
AXH19614.1|3516022_3518044_-	ATP-dependent DNA helicase Rep	NA	A7KV33	Bacillus_phage	37.6	2.9e-113
AXH19615.1|3518130_3518412_+	peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
AXH19616.1|3518817_3520155_+	MFS transporter	NA	NA	NA	NA	NA
AXH19617.1|3520270_3521230_+	C-terminal binding protein	NA	A0A1J0F959	Only_Syngen_Nebraska_virus	31.9	2.3e-28
>prophage 261
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	3530991	3532638	5214712		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
AXH19626.1|3530991_3532638_-	acetolactate synthase 2 catalytic subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	31.6	3.7e-66
>prophage 262
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	3546032	3551885	5214712		Enterobacteria_phage(33.33%)	5	NA	NA
AXH19634.1|3546032_3546923_-	ribose ABC transporter substrate-binding protein RbsB	NA	C6ZCU4	Enterobacteria_phage	23.4	4.3e-05
AXH19635.1|3546947_3547913_-	ribose ABC transporter permease	NA	NA	NA	NA	NA
AXH19636.1|3547917_3549423_-	ribose import ATP-binding protein RbsA	NA	G3M9Y6	Bacillus_virus	27.7	5.1e-14
AXH21311.1|3549430_3549850_-	D-ribose pyranase	NA	NA	NA	NA	NA
AXH19637.1|3550016_3551885_-	low affinity potassium transport system protein kup	NA	M1I6H8	Paramecium_bursaria_Chlorella_virus	30.6	6.0e-65
>prophage 263
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	3555053	3556046	5214712		Heterosigma_akashiwo_virus(100.0%)	1	NA	NA
AXH19640.1|3555053_3556046_-	asparagine synthetase A	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	37.7	2.2e-50
>prophage 264
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	3568002	3575517	5214712		Chrysochromulina_ericina_virus(25.0%)	6	NA	NA
AXH19655.1|3568002_3569373_+	bifunctional N-acetylglucosamine-1-phosphate uridyltransferase/glucosamine-1-phosphate acetyltransferase	NA	A0A0N7G7I9	Chrysochromulina_ericina_virus	36.7	2.4e-34
AXH19656.1|3569533_3571363_+	glutamine--fructose-6-phosphate aminotransferase	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	43.2	5.6e-132
AXH19657.1|3571676_3572717_+	phosphate-binding protein	NA	A0A1D7SRJ6	Cyanophage	38.3	2.7e-51
AXH19658.1|3572803_3573763_+	phosphate ABC transporter permease	NA	NA	NA	NA	NA
AXH19659.1|3573762_3574653_+	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
AXH19660.1|3574743_3575517_+	phosphate ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	31.7	4.0e-15
>prophage 265
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	3585888	3587226	5214712		Moraxella_phage(100.0%)	1	NA	NA
AXH19669.1|3585888_3587226_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	35.7	2.6e-62
>prophage 266
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	3597424	3604793	5214712		Staphylococcus_phage(33.33%)	8	NA	NA
AXH19678.1|3597424_3597682_-	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	56.7	5.4e-17
AXH19679.1|3597645_3598005_-	ribonuclease P protein component	NA	NA	NA	NA	NA
AXH19680.1|3598021_3598162_-	50S ribosomal protein L34	NA	NA	NA	NA	NA
AXH19681.1|3598274_3598475_+	hypothetical protein	NA	NA	NA	NA	NA
AXH19682.1|3598768_3600172_+	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
AXH19683.1|3600176_3601277_+	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	35.0	4.1e-53
AXH19684.1|3601276_3602350_+	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
AXH19685.1|3602378_3604793_+	DNA gyrase subunit B	NA	G3M9Z3	Bacillus_virus	34.6	4.8e-115
>prophage 267
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	3609498	3610647	5214712		Oenococcus_phage(100.0%)	1	NA	NA
AXH19692.1|3609498_3610647_+	galactonate dehydratase	NA	Q6A202	Oenococcus_phage	32.8	4.7e-52
>prophage 268
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	3615076	3626954	5214712		Cyanophage(16.67%)	13	NA	NA
AXH19696.1|3615076_3615490_+	heat-shock protein IbpA	NA	A0A1D7SU06	Cyanophage	36.2	1.0e-17
AXH19697.1|3615601_3616030_+	heat-shock protein IbpB	NA	A0A1D8KPX5	Synechococcus_phage	36.4	2.1e-13
AXH19698.1|3616226_3617888_+	putative transporter	NA	NA	NA	NA	NA
AXH19699.1|3617977_3618844_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AXH19700.1|3619010_3620726_+	solute:sodium symporter family transporter	NA	A0A240F3J2	Aeromonas_phage	29.4	1.2e-40
AXH19701.1|3620722_3622216_+	DUF4976 domain-containing protein	NA	A0A2K9L1A5	Tupanvirus	27.9	2.9e-30
AXH19702.1|3622275_3622623_+	DUF202 domain-containing protein	NA	NA	NA	NA	NA
AXH19703.1|3622612_3622975_+	DUF202 domain-containing protein	NA	NA	NA	NA	NA
AXH19704.1|3622971_3623469_+	radical SAM protein	NA	NA	NA	NA	NA
AXH19705.1|3623476_3624661_-	multidrug transporter EmrD	NA	S4TR35	Salmonella_phage	23.5	1.2e-13
AXH19706.1|3624700_3624892_-	hypothetical protein	NA	NA	NA	NA	NA
AXH19707.1|3625061_3625160_+	ilvB operon leader peptide IvbL	NA	NA	NA	NA	NA
AXH19708.1|3625265_3626954_+	acetolactate synthase large subunit	NA	E5EQ70	Micromonas_sp._RCC1109_virus	29.7	4.2e-57
>prophage 269
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	3634258	3635593	5214712		Moraxella_phage(100.0%)	1	NA	NA
AXH21314.1|3634258_3635593_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	36.9	8.6e-66
>prophage 270
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	3641033	3642071	5214712		Wolbachia_phage(100.0%)	1	NA	NA
AXH19723.1|3641033_3642071_-	hydroxyacid dehydrogenase	NA	Q9JMN3	Wolbachia_phage	43.6	5.7e-73
>prophage 271
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	3655332	3656724	5214712		environmental_Halophage(100.0%)	1	NA	NA
AXH19735.1|3655332_3656724_-	xanthine permease XanP	NA	H9YQ34	environmental_Halophage	100.0	1.4e-71
>prophage 272
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	3661025	3667775	5214712		Bordetella_phage(25.0%)	5	NA	NA
AXH19739.1|3661025_3663134_-	bifunctional GTP diphosphokinase/guanosine-3',5'-bis(diphosphate) 3'-diphosphatase	NA	A0A291L9W9	Bordetella_phage	34.5	4.8e-10
AXH19740.1|3663152_3663428_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
AXH19741.1|3663482_3664106_-	guanylate kinase	NA	K4JYM5	Abalone_herpesvirus	34.5	4.1e-18
AXH19742.1|3664363_3666046_+	NAD-dependent DNA ligase LigB	NA	A0A1Q2U2Q6	Vibrio_phage	23.2	2.5e-22
AXH19743.1|3666950_3667775_-	DNA damage-inducible protein D	NA	A0A1W6JPJ7	Morganella_phage	77.5	1.3e-91
>prophage 273
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	3671149	3675712	5214712		Xanthomonas_phage(25.0%)	7	NA	NA
AXH21316.1|3671149_3671605_-	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	59.5	7.3e-49
AXH19748.1|3671585_3672806_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	34.1	2.2e-44
AXH19749.1|3672977_3673646_+	JAB domain-containing protein	NA	NA	NA	NA	NA
AXH19750.1|3673862_3674099_+	50S ribosomal protein L28	NA	NA	NA	NA	NA
AXH19751.1|3674119_3674287_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
AXH19752.1|3674384_3675194_+	formamidopyrimidine-DNA glycosylase	NA	F8WPX6	Bacillus_phage	31.2	5.9e-25
AXH19753.1|3675232_3675712_-	phosphopantetheine adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	42.6	6.3e-27
>prophage 274
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	3683154	3685248	5214712		Archaeal_BJ1_virus(50.0%)	2	NA	NA
AXH19760.1|3683154_3684183_+	UDP-galactose--(galactosyl) LPS alpha1,2-galactosyltransferase	NA	A0ZYL4	Archaeal_BJ1_virus	25.9	5.5e-12
AXH19761.1|3684264_3685248_+	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	38.5	1.8e-12
>prophage 275
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	3688656	3698162	5214712		Synechococcus_phage(16.67%)	9	NA	NA
AXH19765.1|3688656_3689589_-	ADP-L-glycero-D-mannoheptose-6-epimerase	NA	E3SL51	Synechococcus_phage	39.3	8.5e-36
AXH19766.1|3689802_3690999_+	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	29.0	1.4e-35
AXH19767.1|3691008_3692034_+	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	84.6	2.1e-19
AXH19768.1|3692272_3693307_+	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	29.6	3.4e-09
AXH19769.1|3693293_3694253_-	divergent polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
AXH19770.1|3694256_3695540_-	murein hydrolase activator EnvC	NA	G9BW84	Planktothrix_phage	34.3	1.0e-07
AXH19771.1|3695549_3697094_-	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
AXH19772.1|3697338_3697770_+	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
AXH19773.1|3697910_3698162_+	glutaredoxin	NA	V9QKN6	Rhizobium_phage	54.8	2.0e-16
>prophage 276
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	3720689	3725303	5214712	tRNA	Tupanvirus(50.0%)	3	NA	NA
AXH19792.1|3720689_3722534_+|tRNA	selenocysteinyl-tRNA-specific translation elongation factor SelB	tRNA	A0A2K9KZ60	Tupanvirus	27.2	1.9e-15
AXH19793.1|3722724_3723876_+	L-threonine dehydrogenase	NA	NA	NA	NA	NA
AXH19794.1|3724007_3725303_+	Fic family protein	NA	A0A1V0E025	Clostridioides_phage	30.9	2.8e-21
>prophage 277
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	3744878	3746420	5214712		Staphylococcus_phage(100.0%)	1	NA	NA
AXH19813.1|3744878_3746420_-	D-xylose ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.3	1.1e-16
>prophage 278
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	3751737	3752733	5214712		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
AXH19819.1|3751737_3752733_-	acyltransferase	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	26.7	5.9e-11
>prophage 279
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	3756953	3757166	5214712		Morganella_phage(100.0%)	1	NA	NA
AXH19823.1|3756953_3757166_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	72.9	2.7e-22
>prophage 280
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	3760820	3763154	5214712		Escherichia_phage(100.0%)	1	NA	NA
AXH19828.1|3760820_3763154_+	molybdopterin guanine dinucleotide-containing S/N-oxide reductase	NA	A0A077SK27	Escherichia_phage	29.5	1.8e-71
>prophage 281
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	3773195	3775180	5214712		Planktothrix_phage(50.0%)	2	NA	NA
AXH19837.1|3773195_3774179_+	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.4	7.4e-14
AXH19838.1|3774175_3775180_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	29.9	1.5e-17
>prophage 282
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	3821118	3822588	5214712		Bacillus_virus(50.0%)	2	NA	NA
AXH21320.1|3821118_3821766_+	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	40.0	8.0e-17
AXH19873.1|3821817_3822588_-	hemin import ATP-binding protein HmuV	NA	W5SAS9	Pithovirus	29.6	2.3e-18
>prophage 283
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	3833262	3838671	5214712		uncultured_Caudovirales_phage(50.0%)	6	NA	NA
AXH19884.1|3833262_3833688_-	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.0	4.7e-50
AXH19885.1|3833779_3834001_-	hypothetical protein	NA	NA	NA	NA	NA
AXH19886.1|3834022_3834106_+	Damage inducible protein	NA	NA	NA	NA	NA
AXH19887.1|3834159_3835512_-	glutathione-disulfide reductase	NA	NA	NA	NA	NA
AXH19888.1|3835583_3836426_-	23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ	NA	NA	NA	NA	NA
AXH19889.1|3836628_3838671_+	oligopeptidase A	NA	A0A1V0SD92	Indivirus	23.2	8.9e-46
>prophage 284
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	3848357	3851093	5214712		Staphylococcus_phage(100.0%)	1	NA	NA
AXH19899.1|3848357_3851093_+	ABC transporter ATP-binding protein/permease	NA	A0A2H4PQG7	Staphylococcus_phage	30.6	4.1e-22
>prophage 285
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	3858531	3859338	5214712		Bacillus_virus(100.0%)	1	NA	NA
AXH19909.1|3858531_3859338_-	nickel import ATP-binding protein NikE	NA	G3M9Y6	Bacillus_virus	29.1	3.4e-17
>prophage 286
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	3867231	3871530	5214712		Dickeya_phage(50.0%)	4	NA	NA
AXH19918.1|3867231_3867897_-	7-cyano-7-deazaguanine/7-aminomethyl-7- deazaguanine transporter	NA	A0A2I7SAW6	Vibrio_phage	53.6	7.4e-58
AXH19919.1|3868117_3868363_+	sulfurtransferase TusA	NA	A0A140XB86	Dickeya_phage	83.3	8.0e-10
AXH19920.1|3868631_3870830_-	zinc/cadmium/mercury/lead-transporting ATPase	NA	E4ZFI9	Streptococcus_phage	38.3	3.8e-119
AXH19921.1|3870903_3871530_-	lysoplasmalogenase	NA	A0A140XAH6	Dickeya_phage	61.9	1.2e-30
>prophage 287
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	3874536	3879263	5214712		Staphylococcus_phage(33.33%)	5	NA	NA
AXH19926.1|3874536_3875205_+	cell division ATP-binding protein FtsE	NA	A0A2H4PQG7	Staphylococcus_phage	25.1	5.0e-14
AXH19927.1|3875197_3876256_+	ABC transporter permease	NA	NA	NA	NA	NA
AXH19928.1|3876500_3877355_+	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	41.9	3.5e-44
AXH19929.1|3877458_3878343_-	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
AXH19930.1|3878342_3879263_-	phosphoglycerate dehydrogenase	NA	Q89388	Paramecium_bursaria_Chlorella_virus	31.0	5.1e-25
>prophage 288
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	3888154	3889637	5214712		Anomala_cuprea_entomopoxvirus(50.0%)	2	NA	NA
AXH19940.1|3888154_3888922_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.6	4.9e-13
AXH19941.1|3888923_3889637_+	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivF	NA	G9BWD6	Planktothrix_phage	30.3	2.0e-13
>prophage 289
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	3893178	3894989	5214712		Planktothrix_phage(50.0%)	2	NA	NA
AXH19945.1|3893178_3894249_+	sn-glycerol-3-phosphate import ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	33.7	1.7e-19
AXH19946.1|3894245_3894989_+	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	25.7	2.0e-11
>prophage 290
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	3914860	3917308	5214712		Dickeya_phage(100.0%)	1	NA	NA
AXH19963.1|3914860_3917308_+	glycogen phosphorylase	NA	A0A140XAG6	Dickeya_phage	81.0	2.1e-33
>prophage 291
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	3932712	3933939	5214712		Ralstonia_phage(100.0%)	1	NA	NA
AXH21324.1|3932712_3933939_+	RtcB family protein	NA	A0A1L7N133	Ralstonia_phage	60.0	2.0e-133
>prophage 292
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	3938329	3940723	5214712		Iris_mild_mosaic_virus(100.0%)	1	NA	NA
AXH19981.1|3938329_3940723_+	maltodextrin phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	42.5	4.3e-15
>prophage 293
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	3946952	3947846	5214712		Sodalis_phage(100.0%)	1	NA	NA
AXH19987.1|3946952_3947846_-	recombination-promoting nuclease RpnA	NA	Q2A0A7	Sodalis_phage	52.8	2.5e-69
>prophage 294
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	3954428	3958196	5214712		Bacillus_phage(66.67%)	3	NA	NA
AXH19995.1|3954428_3955148_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	34.7	3.5e-29
AXH19996.1|3955144_3956497_+	two-component system sensor histidine kinase EnvZ	NA	W8CYF6	Bacillus_phage	23.8	4.7e-11
AXH19997.1|3956573_3958196_-	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	52.3	1.5e-141
>prophage 295
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	3975101	3975938	5214712		Vibrio_phage(100.0%)	1	NA	NA
AXH20012.1|3975101_3975938_+	adenine-specific DNA-methyltransferase	NA	A0A1S6L1V5	Vibrio_phage	49.1	2.9e-67
>prophage 296
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	3994848	4004400	5214712		Acinetobacter_phage(25.0%)	10	NA	NA
AXH20033.1|3994848_3995412_+	aminodeoxychorismate synthase component 2	NA	A0A0P0IKJ1	Acinetobacter_phage	56.3	7.1e-62
AXH20034.1|3995497_3996718_+	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
AXH20035.1|3996795_3998898_-	hypothetical protein	NA	H9YQA8	environmental_Halophage	99.3	2.9e-76
AXH20036.1|3998936_3999569_-	cAMP-activated global transcriptional regulator CRP	NA	NA	NA	NA	NA
AXH20037.1|3999575_3999791_-	hypothetical protein	NA	NA	NA	NA	NA
AXH20038.1|3999870_4000275_+	OsmC family protein	NA	NA	NA	NA	NA
AXH20039.1|4000329_4001199_-	phosphoribulokinase	NA	NA	NA	NA	NA
AXH20040.1|4001252_4001471_-	YheU family protein	NA	A0A2H4J8A7	uncultured_Caudovirales_phage	40.3	3.1e-05
AXH20041.1|4001464_4002487_-	hydrolase	NA	NA	NA	NA	NA
AXH20042.1|4002486_4004400_-	ABC transporter ATP-binding protein	NA	A0A2K9L0W2	Tupanvirus	33.5	4.3e-74
>prophage 297
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	4009970	4018505	5214712		uncultured_Caudovirales_phage(50.0%)	7	NA	NA
AXH20051.1|4009970_4010357_+	sulfurtransferase TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	39.8	2.5e-18
AXH20052.1|4010356_4010716_+	sulfurtransferase TusC	NA	A0A2H4J8C0	uncultured_Caudovirales_phage	31.0	1.4e-10
AXH20053.1|4010722_4011010_+	sulfurtransferase TusB	NA	NA	NA	NA	NA
AXH20054.1|4011135_4011510_+	30S ribosomal protein S12	NA	NA	NA	NA	NA
AXH20055.1|4011606_4012077_+	30S ribosomal protein S7	NA	NA	NA	NA	NA
AXH20056.1|4012173_4014288_+	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.5	5.2e-57
AXH20057.1|4015835_4018505_+	lysozyme	NA	M1HC48	Acanthocystis_turfacea_Chlorella_virus	35.7	1.9e-40
>prophage 298
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	4027333	4029286	5214712		Vibrio_phage(100.0%)	1	NA	NA
AXH21327.1|4027333_4029286_-	type II secretion system protein GspD	NA	R9TEZ5	Vibrio_phage	30.9	1.2e-31
>prophage 299
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	4050510	4051982	5214712	tRNA	Prochlorococcus_phage(50.0%)	2	NA	NA
AXH20107.1|4050510_4051458_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	35.7	1.4e-06
AXH20108.1|4051472_4051982_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	41.9	3.9e-19
>prophage 300
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	4062325	4066479	5214712		Bacillus_virus(50.0%)	3	NA	NA
AXH20116.1|4062325_4063084_-	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	1.2e-19
AXH20117.1|4063091_4064195_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
AXH20118.1|4065453_4066479_-	amino acid ABC transporter substrate-binding protein	NA	A0A1B1IT51	uncultured_Mediterranean_phage	39.8	2.4e-71
>prophage 301
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	4072983	4073868	5214712		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
AXH20126.1|4072983_4073868_-	adenine-specific DNA-methyltransferase	NA	M4QNN5	Ostreococcus_lucimarinus_virus	29.8	9.2e-24
>prophage 302
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	4079205	4083718	5214712		Escherichia_phage(50.0%)	4	NA	NA
AXH20133.1|4079205_4080036_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	27.0	1.2e-09
AXH20134.1|4080377_4081232_+	tagatose bisphosphate family class II aldolase	NA	NA	NA	NA	NA
AXH20135.1|4081267_4082158_+	sugar ABC transporter	NA	NA	NA	NA	NA
AXH20136.1|4082218_4083718_+	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	31.8	1.4e-11
>prophage 303
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	4093005	4094049	5214712		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
AXH20146.1|4093005_4094049_+	rod shape-determining protein	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
>prophage 304
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	4111699	4113067	5214712	protease	uncultured_Mediterranean_phage(100.0%)	1	NA	NA
AXH20161.1|4111699_4113067_-|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	26.0	1.7e-21
>prophage 305
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	4117033	4121044	5214712		Pseudomonas_phage(50.0%)	4	NA	NA
AXH20167.1|4117033_4117531_+	stringent starvation protein B	NA	A0A1S5R3H3	Pseudomonas_phage	54.8	2.5e-26
AXH20168.1|4117638_4118430_+	transcriptional regulator NanR	NA	NA	NA	NA	NA
AXH20169.1|4118551_4119445_+	N-acetylneuraminate lyase	NA	NA	NA	NA	NA
AXH20170.1|4119553_4121044_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	23.9	4.9e-09
>prophage 306
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	4129749	4144544	5214712		Staphylococcus_phage(25.0%)	17	NA	NA
AXH21330.1|4129749_4130679_+	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	35.0	8.8e-17
AXH20176.1|4130774_4133111_+	aerobic respiration two-component sensor histidine kinase ArcB	NA	A0A1V0SGX0	Hokovirus	31.2	9.9e-41
AXH20177.1|4133340_4133994_+	glutamine amidotransferase	NA	NA	NA	NA	NA
AXH20178.1|4133990_4134719_+	monofunctional biosynthetic peptidoglycan transglycosylase	NA	NA	NA	NA	NA
AXH20179.1|4134715_4135348_-	PhoP regulatory network protein YrbL	NA	NA	NA	NA	NA
AXH20180.1|4135561_4135834_-	phosphocarrier protein NPr	NA	NA	NA	NA	NA
AXH20181.1|4135830_4136685_-	RNase adaptor protein RapZ	NA	A0A0R8VB27	Thermobifida_phage	28.4	1.1e-05
AXH20182.1|4136730_4137222_-	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
AXH20183.1|4137339_4137627_-	ribosome hibernation promoting factor	NA	A0A0M7QCF2	Escherichia_phage	44.3	2.5e-10
AXH20184.1|4137649_4139083_-	RNA polymerase sigma-54 factor	NA	NA	NA	NA	NA
AXH20185.1|4139130_4139856_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	3.2e-22
AXH20186.1|4139862_4140420_-	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
AXH20187.1|4140388_4140964_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
AXH20188.1|4140960_4141527_-	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	75.0	4.2e-54
AXH20189.1|4141547_4142534_-	arabinose 5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	31.5	1.9e-38
AXH20190.1|4142547_4143525_-	calcium/sodium antiporter	NA	NA	NA	NA	NA
AXH20191.1|4143734_4144544_+	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	29.3	2.2e-19
>prophage 307
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	4148612	4150095	5214712		Vibrio_phage(50.0%)	2	NA	NA
AXH20196.1|4148612_4148891_-	sugar fermentation stimulation protein B	NA	A0A2I7S995	Vibrio_phage	71.4	2.6e-17
AXH20197.1|4149123_4150095_-	octaprenyl-diphosphate synthase	NA	A0A1V0SE37	Indivirus	25.8	6.0e-08
>prophage 308
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	4156724	4159597	5214712	protease	Micromonas_pusilla_virus(50.0%)	2	NA	NA
AXH20206.1|4156724_4158659_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	G8DDJ2	Micromonas_pusilla_virus	43.6	6.3e-118
AXH20207.1|4158748_4159597_+	dihydropteroate synthase	NA	S4W084	Pandoravirus	29.9	3.4e-23
>prophage 309
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	4163678	4170317	5214712		Dickeya_phage(50.0%)	4	NA	NA
AXH20210.1|4163678_4165022_-	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	92.9	1.1e-63
AXH21334.1|4165652_4166105_+	ribosome maturation factor	NA	NA	NA	NA	NA
AXH20211.1|4166132_4167620_+	transcription termination protein NusA	NA	NA	NA	NA	NA
AXH20212.1|4167644_4170317_+	translation initiation factor IF-2	NA	E3T4N3	Cafeteria_roenbergensis_virus	26.3	3.3e-24
>prophage 310
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	4175798	4177688	5214712		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
AXH20219.1|4175798_4177688_+	DEAD/DEAH box family ATP-dependent RNA helicase	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	30.8	2.0e-52
>prophage 311
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	4183400	4191196	5214712		Diadromus_pulchellus_ascovirus(25.0%)	10	NA	NA
AXH20225.1|4183400_4183703_-	GIY-YIG nuclease family protein	NA	F2NZ06	Diadromus_pulchellus_ascovirus	52.5	3.9e-14
AXH20226.1|4183753_4184197_+	hypothetical protein	NA	NA	NA	NA	NA
AXH20227.1|4184176_4184695_-	glutamine amidotransferase	NA	A0A0N7KVR4	Yellowstone_lake_phycodnavirus	27.0	4.4e-10
AXH20228.1|4184822_4185458_+	NAD-dependent epimerase/dehydratase family protein	NA	NA	NA	NA	NA
AXH20229.1|4185530_4186571_+	permease	NA	NA	NA	NA	NA
AXH20230.1|4186683_4187259_-	osmotically-inducible protein OsmY	NA	NA	NA	NA	NA
AXH20231.1|4187268_4187859_-	DnaA initiator-associating protein DiaA	NA	A0A067XQR2	Caulobacter_phage	31.1	5.4e-12
AXH20232.1|4187878_4188274_-	YraN family protein	NA	NA	NA	NA	NA
AXH20233.1|4188231_4190268_-	penicillin-binding protein activator	NA	NA	NA	NA	NA
AXH20234.1|4190332_4191196_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	43.6	9.6e-50
>prophage 312
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	4208816	4209962	5214712		Streptococcus_phage(100.0%)	1	NA	NA
AXH20254.1|4208816_4209962_+	glycerate 2-kinase	NA	W6LM47	Streptococcus_phage	41.6	9.7e-50
>prophage 313
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	4216108	4218403	5214712		Tetraselmis_virus(100.0%)	1	NA	NA
AXH20260.1|4216108_4218403_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.2	3.9e-159
>prophage 314
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	4243642	4244608	5214712		Escherichia_phage(100.0%)	1	NA	NA
AXH20285.1|4243642_4244608_-	TerC family protein	NA	A0A291LBC5	Escherichia_phage	33.8	5.2e-36
>prophage 315
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	4256938	4273086	5214712	tRNA	Herpes_simplex_virus(16.67%)	15	NA	NA
AXH20296.1|4256938_4260031_-	beta-galactosidase subunit alpha	NA	L0N6M2	Herpes_simplex_virus	34.1	3.8e-157
AXH20297.1|4260214_4261198_-	transcriptional regulator EbgR	NA	NA	NA	NA	NA
AXH20298.1|4261416_4261749_+|tRNA	tRNA-binding protein	tRNA	NA	NA	NA	NA
AXH20299.1|4261790_4263170_-	putrescine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	28.9	1.5e-33
AXH21339.1|4263105_4263312_-	hypothetical protein	NA	NA	NA	NA	NA
AXH20300.1|4263587_4265108_+	PAS domain S-box protein	NA	A0A1B0V854	Salmonella_phage	51.5	4.0e-35
AXH20301.1|4265214_4265838_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
AXH20302.1|4266125_4266890_+	siderophore-interacting protein	NA	NA	NA	NA	NA
AXH20303.1|4267143_4267650_+	mismatch-specific DNA-glycosylase	NA	NA	NA	NA	NA
AXH20304.1|4267727_4269569_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.3e-35
AXH20305.1|4269627_4269750_-	RNA polymerase subunit sigma	NA	NA	NA	NA	NA
AXH20306.1|4269763_4271509_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.4	1.1e-76
AXH20307.1|4271619_4271835_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
AXH20308.1|4271833_4272064_+	hypothetical protein	NA	NA	NA	NA	NA
AXH20309.1|4272072_4273086_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.5	9.7e-110
>prophage 316
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	4279494	4280733	5214712		Sinorhizobium_phage(100.0%)	1	NA	NA
AXH20317.1|4279494_4280733_-	multifunctional CCA addition/repair protein	NA	A0A0F6YPT7	Sinorhizobium_phage	51.6	5.9e-93
>prophage 317
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	4285870	4287304	5214712		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
AXH20321.1|4285870_4287304_+	bifunctional heptose 7-phosphate kinase/heptose 1-phosphate adenyltransferase	NA	A0A1B1IUK5	uncultured_Mediterranean_phage	29.4	3.0e-40
>prophage 318
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	4291217	4291871	5214712		Staphylococcus_phage(100.0%)	1	NA	NA
AXH20327.1|4291217_4291871_+	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	44.3	8.3e-46
>prophage 319
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	4297762	4299600	5214712		Ralstonia_phage(50.0%)	2	NA	NA
AXH20334.1|4297762_4298923_-	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.1	1.6e-87
AXH20335.1|4298928_4299600_-	DUF1190 family protein	NA	A0A173GEW8	Erwinia_phage	44.3	4.8e-33
>prophage 320
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	4303948	4305841	5214712		Bacillus_virus(100.0%)	1	NA	NA
AXH20341.1|4303948_4305841_+	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	35.2	2.6e-92
>prophage 321
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	4316749	4318539	5214712		Anomala_cuprea_entomopoxvirus(50.0%)	2	NA	NA
AXH20350.1|4316749_4317559_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	30.4	2.7e-14
AXH20351.1|4317555_4318539_+	iron ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	27.0	5.0e-10
>prophage 322
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	4326381	4331421	5214712		Stx_converting_phage(50.0%)	4	NA	NA
AXH20360.1|4326381_4326774_+	TIGR00156 family protein	NA	A0A1I9LJU6	Stx_converting_phage	49.1	9.4e-21
AXH20361.1|4326826_4327309_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AXH20362.1|4327417_4329025_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AXH20363.1|4329162_4331421_+	DNA topoisomerase 4 subunit A	NA	G3M9Z5	Bacillus_virus	34.9	5.4e-84
>prophage 323
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	4338879	4346198	5214712		Ostreococcus_tauri_virus(33.33%)	6	NA	NA
AXH20371.1|4338879_4340352_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	33.0	2.6e-47
AXH20372.1|4340674_4341424_-	FCD domain-containing protein	NA	NA	NA	NA	NA
AXH20373.1|4341675_4343895_+	YgiQ family radical SAM protein	NA	M1QSD9	Pseudomonas_phage	70.4	7.8e-104
AXH20374.1|4343936_4344194_-	hypothetical protein	NA	NA	NA	NA	NA
AXH20375.1|4344244_4345171_-	DUF3828 domain-containing protein	NA	NA	NA	NA	NA
AXH20376.1|4345370_4346198_-	2,5-didehydrogluconate reductase DkgA	NA	A0A2H4PQR8	Staphylococcus_phage	45.2	1.6e-62
>prophage 324
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	4352041	4352926	5214712		Diadromus_pulchellus_ascovirus(100.0%)	1	NA	NA
AXH21342.1|4352041_4352926_-	NAD(P)-dependent oxidoreductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	47.1	1.7e-65
>prophage 325
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	4375158	4376331	5214712		Emiliania_huxleyi_virus(100.0%)	1	NA	NA
AXH20407.1|4375158_4376331_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	D2TEZ5	Emiliania_huxleyi_virus	30.7	2.1e-39
>prophage 326
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	4409010	4409670	5214712		Amsacta_moorei_entomopoxvirus(100.0%)	1	NA	NA
AXH20433.1|4409010_4409670_+	polysialic acid transport ATP-binding protein KpsT	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	25.7	2.9e-06
>prophage 327
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	4423254	4424274	5214712		Tetraselmis_virus(100.0%)	1	NA	NA
AXH20445.1|4423254_4424274_-	KpsF/GutQ family sugar-phosphate isomerase	NA	A0A2P0VNK5	Tetraselmis_virus	31.1	5.5e-36
>prophage 328
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	4428187	4430600	5214712		Klebsiella_phage(33.33%)	5	NA	NA
AXH20449.1|4428187_4428409_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.4e-10
AXH21347.1|4428477_4428924_-	DNA repair protein RadC	NA	NA	NA	NA	NA
AXH20450.1|4428969_4429443_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	31.2	4.3e-12
AXH20451.1|4429536_4429782_-	antirestriction protein	NA	NA	NA	NA	NA
AXH20452.1|4429781_4430600_-	DUF945 domain-containing protein	NA	K4F5L3	Cronobacter_phage	38.7	3.0e-45
>prophage 329
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	4448183	4449352	5214712	transposase	Acinetobacter_phage(100.0%)	1	NA	NA
AXH20472.1|4448183_4449352_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	4.0e-51
>prophage 330
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	4456321	4458046	5214712		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
AXH20478.1|4456321_4457278_+	iron-dicitrate ABC transporter permease FecD	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.1	1.1e-17
AXH20479.1|4457278_4458046_+	Fe(3+) dicitrate transport ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	24.8	6.4e-13
>prophage 331
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	4461748	4463941	5214712		Bacillus_phage(100.0%)	2	NA	NA
AXH20482.1|4461748_4463221_-	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	27.9	1.9e-21
AXH20483.1|4463221_4463941_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	35.2	3.3e-35
>prophage 332
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	4470572	4472696	5214712		Bacillus_phage(100.0%)	1	NA	NA
AXH20490.1|4470572_4472696_+	type I secretion system permease/ATPase	NA	W8CYL7	Bacillus_phage	29.7	8.4e-47
>prophage 333
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	4480244	4482631	5214712	transposase	Stx2-converting_phage(66.67%)	3	NA	NA
AXH21349.1|4480244_4480685_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	78.7	4.9e-34
AXH20495.1|4480681_4481032_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBY2	Stx2-converting_phage	63.8	5.2e-39
AXH20496.1|4481062_4482631_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	61.0	5.3e-147
>prophage 334
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	4495479	4495776	5214712		Enterobacterial_phage(100.0%)	1	NA	NA
AXH20503.1|4495479_4495776_+	LuxR family transcriptional regulator	NA	Q9LA59	Enterobacterial_phage	44.6	3.2e-13
>prophage 335
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	4515783	4517049	5214712		Pseudomonas_phage(100.0%)	1	NA	NA
AXH20519.1|4515783_4517049_-	DUF4102 domain-containing protein	NA	A0A1B0VMI6	Pseudomonas_phage	42.8	7.6e-80
>prophage 336
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	4539738	4540893	5214712		Staphylococcus_phage(100.0%)	1	NA	NA
AXH20544.1|4539738_4540893_-	S-adenosylmethionine synthase	NA	A0A2H4PQS6	Staphylococcus_phage	63.2	4.0e-128
>prophage 337
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	4549047	4549992	5214712		Yersinia_phage(100.0%)	1	NA	NA
AXH20552.1|4549047_4549992_-	prohibitin family protein	NA	A0A2C9D0H9	Yersinia_phage	55.7	3.5e-53
>prophage 338
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	4555007	4555685	5214712		Bacillus_virus(100.0%)	1	NA	NA
AXH20559.1|4555007_4555685_-	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	26.2	9.9e-10
>prophage 339
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	4569222	4570455	5214712		Catovirus(100.0%)	1	NA	NA
AXH20575.1|4569222_4570455_+	D-3-phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	48.4	1.9e-104
>prophage 340
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	4578591	4583070	5214712		Prochlorococcus_phage(50.0%)	2	NA	NA
AXH20585.1|4578591_4581465_+	glycine dehydrogenase	NA	E3SN07	Prochlorococcus_phage	52.0	8.2e-263
AXH20586.1|4581630_4583070_-	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	26.3	1.5e-31
>prophage 341
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	4586869	4602261	5214712	tRNA	Brevibacillus_phage(14.29%)	14	NA	NA
AXH20593.1|4586869_4587766_+	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	28.6	6.7e-30
AXH20594.1|4587790_4588501_+	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
AXH20595.1|4588506_4590240_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	28.7	1.4e-60
AXH20596.1|4590330_4591428_+	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	39.0	1.8e-05
AXH20597.1|4591438_4592956_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.7	5.9e-87
AXH20598.1|4592998_4593547_-	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
AXH20599.1|4593669_4593795_-	hypothetical protein	NA	NA	NA	NA	NA
AXH20600.1|4593796_4595245_-	uric acid transporter UacT	NA	Q9KX94	Enterobacteria_phage	27.0	4.3e-26
AXH20601.1|4595189_4595378_-	hypothetical protein	NA	NA	NA	NA	NA
AXH20602.1|4595680_4597600_+	oxidoreductase (Fe-S)-binding subunit	NA	NA	NA	NA	NA
AXH20603.1|4597599_4598088_+	4Fe-4S dicluster domain-containing protein	NA	NA	NA	NA	NA
AXH20604.1|4598123_4599491_-	guanine/hypoxanthine permease GhxQ	NA	A0A0R6PHV4	Moraxella_phage	72.8	2.8e-160
AXH20605.1|4599526_4600846_-	guanine deaminase	NA	NA	NA	NA	NA
AXH20606.1|4600860_4602261_-	xanthine permease XanP	NA	H9YQ34	environmental_Halophage	46.1	1.7e-19
>prophage 342
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	4626540	4627296	5214712		Clostridium_phage(100.0%)	1	NA	NA
AXH20621.1|4626540_4627296_+	LysM peptidoglycan-binding domain-containing protein	NA	I2E8W3	Clostridium_phage	36.8	1.1e-12
>prophage 343
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	4632657	4634076	5214712		Aichi_virus(100.0%)	1	NA	NA
AXH21359.1|4632657_4634076_+	sugar porter family MFS transporter	NA	O13311	Aichi_virus	26.9	1.8e-24
>prophage 344
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	4643707	4650480	5214712		Moraxella_phage(33.33%)	6	NA	NA
AXH20633.1|4643707_4644421_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	47.3	2.6e-45
AXH20634.1|4644489_4645179_-	DNA mismatch repair protein MutH	NA	NA	NA	NA	NA
AXH20635.1|4645863_4646394_+	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
AXH20636.1|4646406_4648653_+	phosphoenolpyruvate-protein phosphotransferase PtsP	NA	A0A1V0SGR7	Hokovirus	26.2	2.7e-11
AXH20637.1|4648803_4649679_+	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
AXH20638.1|4649685_4650480_+	thymidylate synthase	NA	A6M9A2	Geobacillus_virus	70.8	7.6e-118
>prophage 345
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	4655957	4672572	5214712	protease	Klosneuvirus(14.29%)	10	NA	NA
AXH20645.1|4655957_4658846_+|protease	protease 3	protease	A0A1V0SJA4	Klosneuvirus	25.6	9.0e-68
AXH20646.1|4658838_4662381_+	exodeoxyribonuclease V subunit beta	NA	G3MA40	Bacillus_virus	21.6	1.5e-08
AXH20647.1|4662380_4664207_+	exodeoxyribonuclease V subunit alpha	NA	A0A1P8DII4	Virus_Rctr197k	26.7	7.8e-25
AXH20648.1|4664268_4665600_-	N-acetylglutamate synthase	NA	NA	NA	NA	NA
AXH20649.1|4665831_4667085_+	N-acetylmuramoyl-L-alanine amidase	NA	Q5YA51	Bacillus_phage	28.6	2.2e-15
AXH21360.1|4667342_4668167_+	PRD domain-containing protein	NA	NA	NA	NA	NA
AXH20650.1|4668198_4669779_+	PTS glucose transporter subunit IIBC	NA	A0A2I7SAJ6	Vibrio_phage	35.7	2.0e-05
AXH20651.1|4669778_4670954_+	putative C-S lyase	NA	NA	NA	NA	NA
AXH20652.1|4670956_4671553_+	SIS domain-containing protein	NA	A0A2P0VNK5	Tetraselmis_virus	33.5	1.8e-23
AXH20653.1|4671624_4672572_+	phosphoglycerate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	25.6	1.5e-16
>prophage 346
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	4697016	4702175	5214712		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
AXH20669.1|4697016_4699527_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	27.8	6.7e-19
AXH20670.1|4699538_4702175_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	30.5	8.4e-97
>prophage 347
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	4711007	4713513	5214712	tRNA	Pandoravirus(50.0%)	3	NA	NA
AXH20678.1|4711007_4711814_+|tRNA	tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA	tRNA	S4VW33	Pandoravirus	33.3	2.9e-16
AXH20679.1|4711864_4712308_-	sulfur acceptor protein CsdE	NA	NA	NA	NA	NA
AXH20680.1|4712307_4713513_-	cysteine desulfurase CsdA	NA	Q2XUY6	environmental_halophage	37.2	2.1e-74
>prophage 348
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	4725089	4725845	5214712		Bacillus_phage(100.0%)	1	NA	NA
AXH20691.1|4725089_4725845_-	flap endonuclease Xni	NA	F8WQ40	Bacillus_phage	33.5	2.5e-09
>prophage 349
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	4730703	4731552	5214712		Vibrio_phage(100.0%)	1	NA	NA
AXH20695.1|4730703_4731552_-	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	37.5	2.7e-41
>prophage 350
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	4739083	4743198	5214712		Hokovirus(50.0%)	2	NA	NA
AXH20702.1|4739083_4741840_-	signal transduction histidine kinase	NA	A0A1V0SGX0	Hokovirus	30.6	6.4e-55
AXH20703.1|4741896_4743198_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	29.8	2.0e-38
>prophage 351
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	4747229	4750253	5214712		Only_Syngen_Nebraska_virus(50.0%)	2	NA	NA
AXH20708.1|4747229_4748867_+	CTP synthetase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	50.4	3.0e-153
AXH20709.1|4748954_4750253_+	enolase	NA	A0A1X9I5Z8	Streptococcus_phage	58.8	2.0e-131
>prophage 352
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	4754062	4757261	5214712		Vibrio_phage(50.0%)	3	NA	NA
AXH20714.1|4754062_4754734_+	7-carboxy-7-deazaguanine synthase QueE	NA	A0A2I7S8X1	Vibrio_phage	25.0	3.0e-14
AXH20715.1|4754818_4755826_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
AXH20716.1|4755851_4757261_-	glycosyl hydrolase family 32	NA	F8WPR5	Bacillus_phage	22.9	1.9e-15
>prophage 353
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	4764558	4765344	5214712		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
AXH20720.1|4764558_4765344_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.5	6.5e-21
>prophage 354
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	4779993	4782026	5214712		Hokovirus(50.0%)	2	NA	NA
AXH20735.1|4779993_4781421_+	sulfate adenylyltransferase subunit CysN	NA	A0A1V0SGC3	Hokovirus	27.6	9.7e-31
AXH20736.1|4781420_4782026_+	adenylyl-sulfate kinase	NA	A0A2K9L4R9	Tupanvirus	38.1	3.2e-28
>prophage 355
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	4785137	4788853	5214712		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
AXH20742.1|4785137_4785899_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	52.8	3.1e-68
AXH20743.1|4785892_4786519_+	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
AXH20744.1|4786658_4787798_+	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
AXH20745.1|4787860_4788853_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
>prophage 356
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	4793226	4800366	5214712		Escherichia_phage(83.33%)	6	NA	NA
AXH20750.1|4793226_4793865_-	class II aldolase	NA	A0A077SK32	Escherichia_phage	75.0	2.8e-83
AXH20751.1|4793861_4795124_-	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	2.8e-135
AXH20752.1|4795120_4796029_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.5	1.5e-117
AXH20753.1|4796224_4796992_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	57.4	2.2e-69
AXH20754.1|4797042_4797699_-	protein-serine/threonine phosphatase	NA	A0A077SLQ6	Escherichia_phage	46.6	1.1e-50
AXH20755.1|4797804_4800366_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.7	6.0e-31
>prophage 357
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	4819888	4820899	5214712		Enterobacteria_phage(100.0%)	1	NA	NA
AXH21367.1|4819888_4820899_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	28.0	5.1e-26
>prophage 358
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	4828468	4829434	5214712		Tetraselmis_virus(100.0%)	1	NA	NA
AXH20779.1|4828468_4829434_-	arabinose-5-phosphate isomerase GutQ	NA	A0A2P0VNK5	Tetraselmis_virus	34.3	2.3e-36
>prophage 359
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	4834900	4840287	5214712	tRNA	Pseudomonas_phage(25.0%)	5	NA	NA
AXH20786.1|4834900_4835398_+	nicotinamide-nucleotide amidase	NA	B5TK85	Pseudomonas_phage	49.7	2.6e-31
AXH20787.1|4835477_4836539_+	DNA recombination/repair protein RecA	NA	A0A2D1GPX2	Mycobacterium_phage	63.4	1.2e-113
AXH20788.1|4836607_4837108_+	regulatory protein RecX	NA	NA	NA	NA	NA
AXH20789.1|4837236_4839867_+|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	38.6	5.5e-80
AXH20790.1|4840101_4840287_+	carbon storage regulator	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
>prophage 360
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	4844898	4845357	5214712	transposase	Saccharomonospora_phage(100.0%)	1	NA	NA
AXH20795.1|4844898_4845357_-|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	32.3	8.5e-13
>prophage 361
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	4853678	4858976	5214712		Bacillus_virus(20.0%)	6	NA	NA
AXH20804.1|4853678_4854881_-	glycine betaine/L-proline ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	39.4	4.9e-28
AXH20805.1|4854870_4855119_-	hypothetical protein	NA	NA	NA	NA	NA
AXH20806.1|4855237_4856197_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	72.4	1.1e-134
AXH20807.1|4856206_4858351_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	48.4	4.2e-195
AXH20808.1|4858323_4858734_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	44.4	4.6e-18
AXH20809.1|4858730_4858976_-	NrdH-redoxin	NA	Q5K5J3	Oenococcus_phage	35.3	1.8e-06
>prophage 362
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	4864193	4868244	5214712		Clostridium_phage(50.0%)	4	NA	NA
AXH20820.1|4864193_4864643_+	peptidoglycan-binding protein LysM	NA	A0A090DBR9	Clostridium_phage	39.5	2.6e-06
AXH20821.1|4864643_4865306_-	DNA-binding transcriptional regulator CsiR	NA	NA	NA	NA	NA
AXH20822.1|4865326_4866727_-	GABA permease	NA	NA	NA	NA	NA
AXH20823.1|4866963_4868244_-	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	30.3	4.9e-34
>prophage 363
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	4873252	4873735	5214712		Staphylococcus_phage(100.0%)	1	NA	NA
AXH20828.1|4873252_4873735_-	SsrA-binding protein	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
>prophage 364
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	4887360	4888431	5214712		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
AXH20843.1|4887360_4888431_+	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	4.0e-90
>prophage 365
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	4894336	4896910	5214712		Enterobacteria_phage(100.0%)	1	NA	NA
AXH20851.1|4894336_4896910_+	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	3.4e-127
>prophage 366
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	4905390	4906689	5214712		Burkholderia_virus(100.0%)	1	NA	NA
AXH20855.1|4905390_4906689_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	31.7	2.8e-45
>prophage 367
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	4911982	4918065	5214712	tRNA	Achromobacter_phage(25.0%)	8	NA	NA
AXH20859.1|4911982_4912402_-	thiol disulfide reductase thioredoxin	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
AXH20860.1|4912415_4912619_+	hypothetical protein	NA	NA	NA	NA	NA
AXH20861.1|4912608_4913646_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
AXH20862.1|4913693_4914383_-	uracil-DNA glycosylase	NA	A0A077BCN4	Equid_alphaherpesvirus	52.1	2.1e-55
AXH20863.1|4914687_4915071_+	autonomous glycyl radical cofactor GrcA	NA	A0A088FS37	Shigella_phage	70.9	4.7e-33
AXH20864.1|4915126_4915714_-	cysteine/O-acetylserine efflux protein	NA	NA	NA	NA	NA
AXH21373.1|4915816_4916698_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AXH20865.1|4916730_4918065_-	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	2.9e-45
>prophage 368
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	4923836	4927577	5214712		Tupanvirus(50.0%)	3	NA	NA
AXH20872.1|4923836_4925636_+	elongation factor 4	NA	A0A2K9L6L3	Tupanvirus	41.9	4.2e-23
AXH20873.1|4925651_4926626_+	S26 family signal peptidase	NA	NA	NA	NA	NA
AXH20874.1|4926896_4927577_+	ribonuclease 3	NA	A0A2P0VNZ5	Tetraselmis_virus	39.6	5.6e-21
>prophage 369
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	4931036	4931297	5214712		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
AXH20881.1|4931036_4931297_-	4Fe-4S dicluster domain-containing protein	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	53.5	3.8e-18
>prophage 370
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	4935416	4946725	5214712		Bacillus_phage(50.0%)	7	NA	NA
AXH20887.1|4935416_4939304_+	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	59.4	2.9e-130
AXH20888.1|4939879_4941307_+	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	24.9	3.0e-16
AXH20889.1|4941471_4942185_+	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
AXH20890.1|4942174_4943509_+	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	37.3	3.9e-10
AXH20891.1|4943569_4943908_+	nitrogen regulatory protein P-II 1	NA	NA	NA	NA	NA
AXH20892.1|4943952_4945143_-	flavohemoprotein	NA	NA	NA	NA	NA
AXH20893.1|4945471_4946725_+	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	52.7	7.8e-101
>prophage 371
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	4952483	4953995	5214712		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
AXH20897.1|4952483_4953995_+	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	28.9	2.5e-08
>prophage 372
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	4964113	4970451	5214712		Faustovirus(20.0%)	8	NA	NA
AXH20907.1|4964113_4965328_+	IscS subfamily cysteine desulfurase	NA	A0A1X7C038	Faustovirus	31.8	8.8e-33
AXH20908.1|4965355_4965742_+	iron-sulfur cluster scaffold-like protein	NA	A0A218MKD1	uncultured_virus	78.9	1.4e-53
AXH20909.1|4965758_4966082_+	iron-sulfur cluster assembly accessory protein	NA	A0A2H4N7N5	Lake_Baikal_phage	48.6	5.4e-22
AXH20910.1|4966177_4966693_+	co-chaperone protein HscB	NA	NA	NA	NA	NA
AXH20911.1|4966709_4968560_+	molecular chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	41.6	5.5e-103
AXH20912.1|4968561_4968897_+	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
AXH20913.1|4968908_4969109_+	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
AXH20914.1|4969167_4970451_+	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	37.8	4.9e-34
>prophage 373
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	4980336	4980768	5214712		Powai_lake_megavirus(100.0%)	1	NA	NA
AXH20917.1|4980336_4980768_+	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	37.9	4.8e-18
>prophage 374
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	5001246	5048588	5214712	terminase,integrase,tail,holin	Escherichia_phage(54.17%)	55	5006032:5006048	5020751:5020767
AXH20927.1|5001246_5002623_-	exodeoxyribonuclease VII large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	35.7	1.8e-42
AXH20928.1|5002784_5004251_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	39.1	2.3e-88
AXH20929.1|5004319_5005897_+	GMP synthase (glutamine-hydrolyzing)	NA	NA	NA	NA	NA
5006032:5006048	attL	ATTACCTTAAAGGTATA	NA	NA	NA	NA
AXH20930.1|5006089_5007340_+|integrase	site-specific integrase	integrase	A0A0F6TJM5	Escherichia_coli_O157_typing_phage	99.3	8.0e-239
AXH20931.1|5007343_5007538_-	DUF1382 family protein	NA	A0A0F6R7M7	Escherichia_coli_O157_typing_phage	96.9	6.3e-26
AXH20932.1|5007534_5008185_-	adenine methylase	NA	G9L699	Escherichia_phage	98.1	2.8e-126
AXH21376.1|5008177_5008429_-	PerC family transcriptional regulator	NA	G9L6A0	Escherichia_phage	100.0	3.1e-41
AXH20933.1|5008586_5008835_-	AlpA family phage regulatory protein	NA	A0A0F6TJ45	Escherichia_coli_O157_typing_phage	100.0	3.6e-42
AXH20934.1|5008884_5009907_-	recombination protein RecT	NA	Q858E1	Salmonella_phage	92.1	3.0e-175
AXH20935.1|5009916_5010816_-	endonuclease	NA	Q858E0	Salmonella_phage	90.6	1.6e-156
AXH20936.1|5010812_5011112_-	hypothetical protein	NA	A0A0F6R7M4	Escherichia_coli_O157_typing_phage	96.0	8.4e-46
AXH20937.1|5011420_5012005_-	XRE family transcriptional regulator	NA	A0A0F6R8L7	Escherichia_coli_O157_typing_phage	99.5	2.7e-104
AXH20938.1|5012159_5012390_+	hypothetical protein	NA	G9L6A7	Escherichia_phage	100.0	2.6e-39
AXH20939.1|5012538_5012751_+	hypothetical protein	NA	A0A0F6TJB7	Escherichia_coli_O157_typing_phage	65.4	1.1e-12
AXH20940.1|5012731_5013562_+	hypothetical protein	NA	G9L6A8	Escherichia_phage	96.7	2.6e-153
AXH20941.1|5013533_5014310_+	replication protein	NA	G9L6A9	Escherichia_phage	100.0	4.6e-152
AXH20942.1|5014427_5014775_+	DUF1064 domain-containing protein	NA	A0A0F6R8N5	Escherichia_coli_O157_typing_phage	98.3	3.1e-60
AXH20943.1|5014836_5015397_+	hypothetical protein	NA	G9L6B1	Escherichia_phage	59.1	2.6e-40
AXH20944.1|5015393_5015930_+	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	69.8	3.2e-64
AXH20945.1|5017054_5017384_+	ASCH domain-containing protein	NA	Q9XJG9	Enterobacteria_phage	91.9	6.4e-47
AXH20946.1|5017376_5017715_+	hypothetical protein	NA	A0A0F6TJR3	Escherichia_coli_O157_typing_phage	99.1	8.3e-58
AXH21377.1|5017754_5018429_+|terminase	terminase small subunit	terminase	Q287B7	Escherichia_phage	99.6	3.4e-119
AXH20947.1|5018425_5019895_+|terminase	terminase	terminase	G9L6B8	Escherichia_phage	98.0	1.4e-290
AXH20948.1|5019898_5020747_-	hypothetical protein	NA	NA	NA	NA	NA
AXH20949.1|5021474_5021681_+	hypothetical protein	NA	G9L6C1	Escherichia_phage	100.0	6.0e-11
5020751:5020767	attR	TATACCTTTAAGGTAAT	NA	NA	NA	NA
AXH20950.1|5021695_5023375_+|tail	phage tail protein	tail	A0A0F6TJD8	Escherichia_coli_O157_typing_phage	98.9	1.8e-302
AXH20951.1|5023371_5023668_+	hypothetical protein	NA	G9L6C3	Escherichia_phage	100.0	1.3e-46
AXH20952.1|5023670_5024366_+	peptidase	NA	G9L6C4	Escherichia_phage	98.7	1.5e-93
AXH20953.1|5024380_5025367_+	hypothetical protein	NA	G9L6C5	Escherichia_phage	97.9	3.7e-183
AXH20954.1|5025418_5025856_+	hypothetical protein	NA	G9L6C6	Escherichia_phage	100.0	2.2e-74
AXH20955.1|5025866_5026202_+	hypothetical protein	NA	G9L6C7	Escherichia_phage	100.0	7.7e-56
AXH20956.1|5026252_5026576_+	hypothetical protein	NA	A0A0F6R8M8	Escherichia_coli_O157_typing_phage	98.1	2.6e-53
AXH20957.1|5027179_5029651_+	hypothetical protein	NA	G9L6D0	Escherichia_phage	99.0	0.0e+00
AXH20958.1|5029650_5030115_+	hypothetical protein	NA	G9L6D1	Escherichia_phage	100.0	8.4e-85
AXH20959.1|5030114_5030660_+	hypothetical protein	NA	A0A0F6TJ56	Escherichia_coli_O157_typing_phage	100.0	9.8e-93
AXH20960.1|5030659_5033173_+	hypothetical protein	NA	A0A0F6R8M6	Escherichia_coli_O157_typing_phage	98.4	0.0e+00
AXH20961.1|5033169_5034972_+	hypothetical protein	NA	A0A0F6TJQ3	Escherichia_coli_O157_typing_phage	97.3	0.0e+00
AXH20962.1|5034977_5037452_+	hypothetical protein	NA	A0A0F6TK45	Escherichia_coli_O157_typing_phage	98.9	0.0e+00
AXH20963.1|5037635_5038052_+	hypothetical protein	NA	NA	NA	NA	NA
AXH20964.1|5038083_5038245_-	transmembrane anchored protein	NA	G9L6D9	Escherichia_phage	100.0	2.5e-20
AXH21378.1|5038338_5038662_-	hypothetical protein	NA	NA	NA	NA	NA
AXH20965.1|5038706_5038925_-	hypothetical protein	NA	NA	NA	NA	NA
AXH20966.1|5039123_5039810_-	anti-repressor protein	NA	G9L6E2	Escherichia_phage	81.4	3.8e-102
AXH20967.1|5040204_5040933_+	hypothetical protein	NA	NA	NA	NA	NA
AXH20968.1|5040955_5041213_-	hypothetical protein	NA	G9L6E3	Escherichia_phage	98.8	6.3e-42
AXH20969.1|5041409_5044529_+	peptidase S74	NA	A5VW57	Enterobacteria_phage	95.5	0.0e+00
AXH20970.1|5044835_5045240_+	hypothetical protein	NA	G9L6E6	Escherichia_phage	94.8	7.4e-61
AXH20971.1|5045226_5045535_+|holin	phage holin family protein	holin	G9L6E7	Escherichia_phage	93.1	4.6e-47
AXH20972.1|5045524_5046154_+	glycoside hydrolase family 19 protein	NA	G9L6E8	Escherichia_phage	97.1	3.4e-113
AXH20973.1|5046150_5046648_+	DUF2514 family protein	NA	A0A193GYU6	Enterobacter_phage	72.0	8.8e-56
AXH20974.1|5046842_5047382_-	hypothetical protein	NA	G9L6F0	Escherichia_phage	98.9	1.4e-43
AXH20975.1|5047397_5047916_-	glycine zipper 2TM domain-containing protein	NA	G9L6F1	Escherichia_phage	100.0	1.3e-62
AXH20976.1|5048018_5048165_-	succinate dehydrogenase	NA	NA	NA	NA	NA
AXH20977.1|5048226_5048418_-	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	100.0	7.3e-27
AXH20978.1|5048435_5048588_+	hypothetical protein	NA	G9L6F3	Escherichia_phage	94.0	4.9e-18
>prophage 375
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	5054835	5058839	5214712		Prochlorococcus_phage(33.33%)	5	NA	NA
AXH20982.1|5054835_5055474_-	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	43.4	4.8e-30
AXH20983.1|5055473_5056511_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	43.3	1.1e-71
AXH20984.1|5056529_5056718_-	hypothetical protein	NA	NA	NA	NA	NA
AXH20985.1|5056837_5057464_+	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
AXH20986.1|5057549_5058839_+	uracil permease	NA	Q9KX94	Enterobacteria_phage	37.1	8.6e-63
>prophage 376
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	5066318	5067032	5214712		Synechococcus_phage(100.0%)	1	NA	NA
AXH20995.1|5066318_5067032_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3FGF0	Synechococcus_phage	36.1	6.9e-38
>prophage 377
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	5084271	5085222	5214712		Cyanophage(100.0%)	1	NA	NA
AXH21006.1|5084271_5085222_-	transaldolase	NA	A0A127KNC6	Cyanophage	31.3	5.7e-11
>prophage 378
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	5104176	5125905	5214712		Streptococcus_phage(25.0%)	22	NA	NA
AXH21024.1|5104176_5105046_-	N-acetylmuramoyl-L-alanine amidase AmiA	NA	E5DV68	Deep-sea_thermophilic_phage	27.4	3.2e-13
AXH21025.1|5105259_5105685_+	GNAT family acetyltransferase	NA	NA	NA	NA	NA
AXH21026.1|5105671_5106121_+	DUF2919 domain-containing protein	NA	NA	NA	NA	NA
AXH21027.1|5106181_5106757_+	RpoE-regulated lipoprotein	NA	NA	NA	NA	NA
AXH21028.1|5106852_5107752_+	deferrochelatase/peroxidase	NA	S4VVJ7	Pandoravirus	32.6	4.5e-26
AXH21029.1|5107929_5109354_-	PTS N-acetylmuramic acid transporter subunits IIBC	NA	NA	NA	NA	NA
AXH21030.1|5109357_5110254_-	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
AXH21031.1|5110533_5111325_+	NAD(P)-dependent oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.0	6.8e-18
AXH21032.1|5111482_5112499_+	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AXH21033.1|5112498_5113332_+	sulfate/thiosulfate ABC transporter permease CysT	NA	NA	NA	NA	NA
AXH21034.1|5113331_5114207_+	sulfate ABC transporter permease	NA	NA	NA	NA	NA
AXH21035.1|5114196_5115294_+	sulfate/thiosulfate import ATP-binding protein CysA	NA	G9BWD6	Planktothrix_phage	39.4	2.8e-30
AXH21036.1|5115428_5116340_+	cysteine synthase B	NA	A0A1X9I5F1	Streptococcus_phage	41.9	1.6e-58
AXH21037.1|5116342_5116711_-	hypothetical protein	NA	NA	NA	NA	NA
AXH21038.1|5116815_5117667_+	pyridoxine kinase	NA	NA	NA	NA	NA
AXH21039.1|5117709_5118219_-	glucose-specific phosphotransferase enzyme IIA component	NA	NA	NA	NA	NA
AXH21040.1|5118259_5119987_-	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	31.1	9.6e-17
AXH21041.1|5120031_5120289_-	phosphocarrier protein HPr	NA	NA	NA	NA	NA
AXH21042.1|5120672_5121644_-	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	51.0	3.7e-74
AXH21043.1|5121829_5122591_-	sulfate transporter CysZ	NA	NA	NA	NA	NA
AXH21044.1|5122820_5123819_+	cell division protein ZipA	NA	NA	NA	NA	NA
AXH21045.1|5123889_5125905_+	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	43.4	3.8e-150
>prophage 379
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	5151440	5152178	5214712		Clostridioides_phage(100.0%)	1	NA	NA
AXH21068.1|5151440_5152178_-	DNA-binding response regulator	NA	A0A2R2ZGH8	Clostridioides_phage	25.3	6.1e-13
>prophage 380
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	5155995	5156916	5214712		Morganella_phage(100.0%)	1	NA	NA
AXH21071.1|5155995_5156916_-	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	55.2	2.2e-76
>prophage 381
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	5160605	5168182	5214712		Ostreococcus_lucimarinus_virus(50.0%)	4	NA	NA
AXH21076.1|5160605_5162300_+	oxalyl-CoA decarboxylase	NA	E5ERI2	Ostreococcus_lucimarinus_virus	23.6	8.0e-24
AXH21077.1|5162369_5163314_+	transporter YfdV	NA	NA	NA	NA	NA
AXH21078.1|5163387_5164533_+	CoA:oxalate CoA-transferase	NA	NA	NA	NA	NA
AXH21079.1|5164588_5168182_-	two-component system sensor histidine kinase EvgS	NA	W8CYM9	Bacillus_phage	40.0	6.2e-10
>prophage 382
CP031215	Escherichia coli strain Es_ST80_L1_NDM_10_2017 chromosome, complete genome	5214712	5174822	5213769	5214712	terminase,protease,holin,portal,lysis,head,tail,coat	Enterobacteria_phage(64.81%)	60	NA	NA
AXH21084.1|5174822_5176256_-	glycoside hydrolase family 32 protein	NA	F8WPR5	Bacillus_phage	24.4	1.5e-28
AXH21085.1|5176471_5177389_+	aminoimidazole riboside kinase	NA	NA	NA	NA	NA
AXH21086.1|5177457_5178705_+	MFS transporter	NA	NA	NA	NA	NA
AXH21087.1|5178784_5178937_-	hypothetical protein	NA	NA	NA	NA	NA
AXH21088.1|5179232_5179433_-	transcriptional regulator	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
AXH21089.1|5179490_5179658_-	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	100.0	1.3e-27
AXH21090.1|5179693_5180005_-	hypothetical protein	NA	Q9G076	Enterobacteria_phage	98.1	7.9e-55
AXH21091.1|5180428_5180812_-	DUF551 domain-containing protein	NA	A5LH60	Enterobacteria_phage	42.3	6.0e-28
AXH21385.1|5180808_5181096_-	hypothetical protein	NA	G9L6B3	Escherichia_phage	100.0	9.5e-55
AXH21092.1|5181325_5181850_-	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	70.1	3.9e-46
AXH21093.1|5181846_5182014_-	DUF2737 family protein	NA	Q716F2	Shigella_phage	98.2	8.6e-24
AXH21094.1|5182024_5182318_-	DUF2856 family protein	NA	K7P836	Enterobacteria_phage	100.0	5.0e-51
AXH21095.1|5182334_5182883_-	3'-5' exoribonuclease	NA	K7PM77	Enterobacteria_phage	98.9	9.5e-104
AXH21096.1|5182891_5183407_-	single-stranded DNA-binding protein	NA	A0A220NRQ8	Escherichia_phage	88.3	2.6e-66
AXH21097.1|5183407_5184115_-	recombinase	NA	Q716E7	Shigella_phage	98.3	2.7e-135
AXH21098.1|5184369_5184522_-	host cell division inhibitory peptide Kil	NA	A5VWA5	Enterobacteria_phage	100.0	4.7e-21
AXH21099.1|5184506_5184641_-	hypothetical protein	NA	K7PHK2	Enterobacteria_phage	100.0	3.1e-16
AXH21100.1|5184865_5185489_-	hypothetical protein	NA	K7PKU5	Enterobacteria_phage	99.5	1.2e-110
AXH21101.1|5185500_5185800_-	hypothetical protein	NA	A5VW99	Enterobacteria_phage	99.0	3.4e-31
AXH21102.1|5186320_5186971_-	LexA family transcriptional regulator	NA	A5VW98	Enterobacteria_phage	100.0	1.1e-122
AXH21103.1|5187051_5187237_+	hypothetical protein	NA	A5VW97	Enterobacteria_phage	100.0	1.6e-26
AXH21104.1|5187345_5187624_+	hypothetical protein	NA	K7P8A8	Enterobacteria_phage	97.8	2.6e-41
AXH21105.1|5187658_5187805_+	DUF2740 domain-containing protein	NA	Q687G5	Enterobacteria_phage	100.0	1.1e-19
AXH21106.1|5187797_5188658_+	replication protein	NA	A0A088CPU2	Enterobacteria_phage	99.3	3.3e-159
AXH21107.1|5188765_5190646_+	bifunctional DNA primase/helicase	NA	K7PK08	Enterobacteria_phage	100.0	0.0e+00
AXH21108.1|5190705_5191164_+	recombination protein NinB	NA	A0A220NRM1	Escherichia_phage	99.3	1.2e-80
AXH21109.1|5191160_5191337_+	NinE family protein	NA	A5VW90	Enterobacteria_phage	100.0	4.6e-28
AXH21110.1|5191333_5191759_+	DUF2591 domain-containing protein	NA	A0A088CQ65	Enterobacteria_phage	73.3	5.9e-53
AXH21111.1|5191751_5191928_+	protein ninF	NA	A0A220NRM2	Escherichia_phage	100.0	1.9e-26
AXH21112.1|5191920_5192430_+	HNH endonuclease	NA	U5PWK7	Bacillus_phage	40.4	2.4e-24
AXH21113.1|5192422_5192698_+	hypothetical protein	NA	F1C5C8	Cronobacter_phage	76.9	1.5e-36
AXH21114.1|5192694_5193057_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A220NRL7	Escherichia_phage	100.0	2.0e-62
AXH21115.1|5193053_5193242_+	protein ninH	NA	A5VW84	Enterobacteria_phage	98.4	9.4e-27
AXH21116.1|5193238_5193727_+	antiterminator	NA	M1FPN0	Enterobacteria_phage	99.4	3.5e-89
AXH21117.1|5194216_5194540_+|holin	phage holin, lambda family	holin	G5DA93	Enterobacteria_phage	100.0	1.3e-52
AXH21118.1|5194523_5195000_+	lysozyme	NA	A5VW81	Enterobacteria_phage	100.0	7.5e-89
AXH21119.1|5194996_5195434_+|lysis	lysis protein	lysis	Q9MCN3	Enterobacteria_phage	97.2	7.2e-70
AXH21120.1|5195421_5195574_+	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	100.0	1.2e-21
AXH21121.1|5195881_5196124_+	DUF2560 family protein	NA	A0A0M4R322	Salmonella_phage	100.0	7.5e-37
AXH21122.1|5196125_5196305_+	hypothetical protein	NA	A0A088CPS9	Enterobacteria_phage	96.6	5.4e-24
AXH21386.1|5196328_5196751_+	ubiquitin carboxyl-hydrolase	NA	Q716H4	Shigella_phage	100.0	7.2e-75
AXH21123.1|5196747_5198163_+|terminase	PBSX family phage terminase large subunit	terminase	A5VW75	Enterobacteria_phage	99.6	2.6e-278
AXH21124.1|5198164_5200363_+|portal	portal protein	portal	A0A088CQ69	Enterobacteria_phage	98.6	0.0e+00
AXH21125.1|5200453_5201347_+	scaffolding protein	NA	A0A088CPT0	Enterobacteria_phage	87.5	1.1e-120
AXH21126.1|5201365_5202619_+|coat	coat protein	coat	A5VW72	Enterobacteria_phage	99.0	1.8e-235
AXH21127.1|5202660_5202849_+	hypothetical protein	NA	A0A088CPR7	Enterobacteria_phage	100.0	2.9e-28
AXH21128.1|5202829_5203291_+|head	head DNA stabilization protein	head	A5VW70	Enterobacteria_phage	99.3	2.1e-83
AXH21129.1|5203300_5204719_+	hypothetical protein	NA	Q716G7	Shigella_phage	99.2	7.8e-275
AXH21130.1|5204718_5205420_+|tail	phage tail protein	tail	A0A2D1GLK3	Escherichia_phage	98.3	1.8e-118
AXH21131.1|5205419_5205875_+	DUF2824 family protein	NA	A0A2D1GLX4	Escherichia_phage	100.0	1.8e-87
AXH21132.1|5205877_5206570_+	DNA transfer protein	NA	A5VW66	Enterobacteria_phage	98.3	8.9e-115
AXH21133.1|5206580_5207924_+	acyltransferase	NA	A0A0M5M1J8	Salmonella_phage	89.7	3.7e-218
AXH21134.1|5207908_5210032_+	hypothetical protein	NA	A0A0A0P1R1	Enterobacteria_phage	29.3	3.6e-50
AXH21135.1|5210028_5210256_-	hypothetical protein	NA	NA	NA	NA	NA
AXH21136.1|5210630_5211074_+	DUF4065 domain-containing protein	NA	I6R0L8	Salmonella_phage	70.1	1.2e-59
AXH21137.1|5211079_5211502_+	hypothetical protein	NA	I6S1K6	Salmonella_phage	57.7	1.2e-32
AXH21138.1|5211554_5212091_-|protease	Clp protease	protease	NA	NA	NA	NA
AXH21139.1|5212090_5212339_-	Arc family DNA-binding protein	NA	G0ZNE9	Cronobacter_phage	50.0	1.5e-08
AXH21140.1|5212453_5212606_+	Arc family DNA-binding protein	NA	NA	NA	NA	NA
AXH21141.1|5212839_5213769_+	phage antirepressor Ant	NA	A5VW58	Enterobacteria_phage	90.6	6.5e-161
>prophage 1
CP031216	Escherichia coli strain Es_ST80_L1_NDM_10_2017 plasmid pEsST80_L1_NDM, complete sequence	98533	0	2712	98533		Enterobacteria_phage(50.0%)	3	NA	NA
AXH21490.1|730_1705_+	recombinase	NA	A0A0A7NPX4	Enterobacteria_phage	52.0	6.1e-85
AXH21388.1|1707_2151_+	plasmid stability family protein	NA	NA	NA	NA	NA
AXH21389.1|2160_2712_+	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	32.0	1.3e-20
>prophage 2
CP031216	Escherichia coli strain Es_ST80_L1_NDM_10_2017 plasmid pEsST80_L1_NDM, complete sequence	98533	5957	8959	98533		Salmonella_phage(50.0%)	3	NA	NA
AXH21396.1|5957_7241_+	DGQHR domain-containing protein	NA	T1SBJ4	Salmonella_phage	40.1	8.6e-63
AXH21397.1|7846_8026_+	cobalamin biosynthesis protein CbiX	NA	NA	NA	NA	NA
AXH21398.1|8098_8959_+	DUF4942 domain-containing protein	NA	I6RTT5	Marinomonas_phage	30.4	5.6e-18
>prophage 3
CP031216	Escherichia coli strain Es_ST80_L1_NDM_10_2017 plasmid pEsST80_L1_NDM, complete sequence	98533	12626	13061	98533		Pseudomonas_phage(100.0%)	1	NA	NA
AXH21406.1|12626_13061_+	single-stranded DNA-binding protein	NA	A0A0U4K5C0	Pseudomonas_phage	48.8	5.7e-27
>prophage 4
CP031216	Escherichia coli strain Es_ST80_L1_NDM_10_2017 plasmid pEsST80_L1_NDM, complete sequence	98533	20262	21537	98533		Idiomarinaceae_phage(100.0%)	1	NA	NA
AXH21415.1|20262_21537_+	hypothetical protein	NA	A0A088F8A2	Idiomarinaceae_phage	27.4	1.3e-18
>prophage 5
CP031216	Escherichia coli strain Es_ST80_L1_NDM_10_2017 plasmid pEsST80_L1_NDM, complete sequence	98533	40501	77030	98533	transposase,integrase	Enterobacteria_phage(30.0%)	37	47228:47265	78742:78779
AXH21432.1|40501_41362_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
AXH21433.1|42182_43553_-|transposase	IS1182-like element ISCfr1 family transposase	transposase	NA	NA	NA	NA
AXH21434.1|43667_44804_-	DUF3883 domain-containing protein	NA	NA	NA	NA	NA
AXH21435.1|44854_45100_-	hypothetical protein	NA	NA	NA	NA	NA
AXH21436.1|45105_45297_+	hypothetical protein	NA	NA	NA	NA	NA
AXH21437.1|46332_47193_-	aminoglycoside N-acetyltransferase AAC(3)-IId	NA	NA	NA	NA	NA
47228:47265	attL	GGGGTCTGACGCTCAGTGGAACGAAAACTCACGTTAAG	NA	NA	NA	NA
AXH21438.1|47424_48129_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	3.1e-139
AXH21439.1|48250_49156_+	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
AXH21440.1|49152_50391_+	MFS transporter	NA	NA	NA	NA	NA
AXH21441.1|50390_50975_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AXH21442.1|50920_51277_+	hypothetical protein	NA	NA	NA	NA	NA
AXH21496.1|51467_52232_-|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	5.6e-86
AXH21443.1|52260_52443_+	resolvase	NA	NA	NA	NA	NA
AXH21444.1|52458_52764_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
AXH21445.1|52774_53980_-	chromate transporter	NA	NA	NA	NA	NA
AXH21446.1|54207_55212_+|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
AXH21447.1|55393_55666_-	hypothetical protein	NA	NA	NA	NA	NA
AXH21448.1|55684_55864_+	hypothetical protein	NA	NA	NA	NA	NA
AXH21449.1|55793_56633_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
AXH21450.1|56626_56974_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
AXH21497.1|57097_57889_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
AXH21451.1|58822_59635_+	subclass B1 metallo-beta-lactamase NDM-1	NA	NA	NA	NA	NA
AXH21452.1|59638_60004_+	bleomycin binding protein Ble-MBL	NA	NA	NA	NA	NA
AXH21453.1|60008_60647_+	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
AXH21454.1|60657_60996_-	hypothetical protein	NA	NA	NA	NA	NA
AXH21455.1|62324_64397_-	DUF87 domain-containing protein	NA	NA	NA	NA	NA
AXH21456.1|64393_65785_-	hypothetical protein	NA	NA	NA	NA	NA
AXH21457.1|65861_66443_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	48.3	5.5e-41
AXH21458.1|66601_69610_+|transposase	Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	64.6	0.0e+00
AXH21459.1|70712_71552_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
AXH21460.1|72008_72854_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA16	NA	NA	NA	NA	NA
AXH21461.1|73034_73508_-	trimethoprim-resistant dihydrofolate reductase DfrA27	NA	G3MBI7	Bacillus_virus	29.1	1.4e-15
AXH21462.1|73640_74093_-	NAD(+)--rifampin ADP-ribosyltransferase Arr-3	NA	NA	NA	NA	NA
AXH21498.1|74189_74744_-	fluoroquinolone-acetylating aminoglycoside 6'-N-acetyltransferase AAC(6')-Ib-cr5	NA	NA	NA	NA	NA
AXH21463.1|75035_76049_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
AXH21464.1|75987_76290_+|transposase	transposase	transposase	NA	NA	NA	NA
AXH21465.1|76310_77030_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	4.6e-138
78742:78779	attR	CTTAACGTGAGTTTTCGTTCCACTGAGCGTCAGACCCC	NA	NA	NA	NA
>prophage 6
CP031216	Escherichia coli strain Es_ST80_L1_NDM_10_2017 plasmid pEsST80_L1_NDM, complete sequence	98533	86870	89429	98533		Morganella_phage(66.67%)	3	NA	NA
AXH21472.1|86870_87305_+	peptidase	NA	A0A1W6JNS2	Morganella_phage	55.4	4.7e-29
AXH21473.1|87253_88558_+	translesion error-prone DNA polymerase V subunit UmuC	NA	A0A1W6JNT0	Morganella_phage	50.8	1.2e-112
AXH21474.1|88580_89429_-	3'-5' exonuclease	NA	A0A1D9C9N8	Salinivibrio_phage	38.9	5.0e-27
>prophage 7
CP031216	Escherichia coli strain Es_ST80_L1_NDM_10_2017 plasmid pEsST80_L1_NDM, complete sequence	98533	96789	97038	98533		Klebsiella_phage(100.0%)	1	NA	NA
AXH21486.1|96789_97038_+	XRE family transcriptional regulator	NA	A0A248SLB9	Klebsiella_phage	53.0	1.6e-10
