The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP031098	Clostridium botulinum strain CFSAN034202 chromosome, complete genome	3954901	1028624	1036828	3954901	protease	uncultured_Caudovirales_phage(33.33%)	9	NA	NA
AXG95051.1|1028624_1029581_-	chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	38.6	7.2e-14
AXG95052.1|1029727_1030546_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
AXG95053.1|1030847_1031498_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	51.2	1.7e-59
AXG95054.1|1031681_1032272_-	GTP cyclohydrolase I FolE	NA	S4U0J3	uncultured_phage	54.5	9.8e-46
AXG95055.1|1032275_1032941_-	putative 7-carboxy-7-deazaguanine synthase QueE	NA	S4TZT1	uncultured_phage	44.6	1.4e-37
AXG95056.1|1032942_1033374_-	6-carboxytetrahydropterin synthase QueD	NA	A0A1U9WRB3	Streptococcus_virus	33.1	1.4e-12
AXG95057.1|1033391_1034153_-	2-hydroxyglutaryl-CoA dehydratase	NA	NA	NA	NA	NA
AXG95058.1|1034269_1035265_-	2-hydroxyacyl-CoA dehydratase	NA	NA	NA	NA	NA
AXG95059.1|1035883_1036828_+	YafY family transcriptional regulator	NA	A0A1B0RXM1	Streptococcus_phage	31.1	3.2e-14
>prophage 2
CP031098	Clostridium botulinum strain CFSAN034202 chromosome, complete genome	3954901	1344434	1384444	3954901	portal,tail,integrase,plate,coat,terminase,head	Clostridium_phage(52.5%)	54	1370043:1370060	1388678:1388695
AXG95332.1|1344434_1345202_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A2H4J8A3	uncultured_Caudovirales_phage	65.1	3.5e-88
AXG95333.1|1345241_1345436_-	hypothetical protein	NA	NA	NA	NA	NA
AXG95334.1|1345452_1345707_-	hypothetical protein	NA	A0A0A7RTX0	Clostridium_phage	68.4	9.1e-25
AXG95335.1|1345802_1346147_-	hypothetical protein	NA	A0A2H4JGH3	uncultured_Caudovirales_phage	60.0	6.4e-05
AXG95336.1|1346414_1346819_-	hypothetical protein	NA	NA	NA	NA	NA
AXG95337.1|1347228_1347573_-	hypothetical protein	NA	A0A2H4J342	uncultured_Caudovirales_phage	62.6	1.8e-31
AXG95338.1|1347583_1348765_-|tail	phage tail protein	tail	A0A2H4J039	uncultured_Caudovirales_phage	62.3	4.6e-71
AXG95339.1|1348768_1349395_-	DUF2313 domain-containing protein	NA	A0A0A7RVP9	Clostridium_phage	74.1	4.6e-86
AXG95340.1|1349375_1350470_-|plate	baseplate J/gp47 family protein	plate	A0A0A7S096	Clostridium_phage	77.5	4.0e-162
AXG95341.1|1350473_1350881_-	DUF2634 domain-containing protein	NA	A0A0A7RTH1	Clostridium_phage	84.6	3.6e-55
AXG95342.1|1350883_1351228_-	DUF2577 domain-containing protein	NA	A0A0A7RTJ2	Clostridium_phage	73.7	6.3e-37
AXG95343.1|1351230_1352205_-	hypothetical protein	NA	A0A0A7RTZ4	Clostridium_phage	84.9	1.6e-157
AXG95344.1|1352216_1352885_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A0A7RVP5	Clostridium_phage	75.0	2.0e-95
AXG95345.1|1352884_1354909_-	hypothetical protein	NA	A0A0A7S091	Clostridium_phage	51.4	6.8e-155
AXG95346.1|1354949_1355627_-	hypothetical protein	NA	NA	NA	NA	NA
AXG95347.1|1355884_1356298_-	hypothetical protein	NA	A0A0A7RTN3	Clostridium_phage	74.8	1.1e-51
AXG95348.1|1356313_1356778_-|portal	phage portal protein	portal	A0A0A7RVP1	Clostridium_phage	87.7	1.9e-73
AXG95349.1|1356781_1358092_-|tail	phage tail sheath protein	tail	A0A0A7S087	Clostridium_phage	85.8	5.5e-214
AXG95350.1|1358253_1358712_-	hypothetical protein	NA	A0A0A7RTI2	Clostridium_phage	76.2	3.8e-53
AXG95351.1|1358698_1359190_-	HK97 gp10 family phage protein	NA	A0A0A7RTT0	Clostridium_phage	74.1	2.4e-61
AXG95352.1|1359189_1359576_-	hypothetical protein	NA	A0A0A7S083	Clostridium_phage	75.2	7.8e-44
AXG97682.1|1359577_1359922_-	hypothetical protein	NA	A0A0A7RTX9	Clostridium_phage	77.2	6.3e-45
AXG95353.1|1359941_1361009_-|coat	phage coat protein	coat	A0A0A7RTH8	Clostridium_phage	88.7	1.7e-181
AXG95354.1|1361031_1361601_-	scaffolding protein	NA	A0A0A7RTM5	Clostridium_phage	52.1	1.8e-33
AXG95355.1|1361619_1361979_-	ABC transporter ATPase	NA	A0A2H4J4N9	uncultured_Caudovirales_phage	82.4	1.8e-50
AXG95356.1|1362093_1362366_-	hypothetical protein	NA	NA	NA	NA	NA
AXG95357.1|1362432_1363455_-|head	phage head morphogenesis protein	head	A0A0A7RVY7	Clostridium_phage	78.2	1.0e-151
AXG95358.1|1363444_1364887_-|portal	phage portal protein	portal	A0A0A7S074	Clostridium_phage	89.1	4.7e-251
AXG95359.1|1364899_1366309_-|terminase	terminase	terminase	A0A0A7RTS1	Clostridium_phage	87.9	3.2e-212
AXG95360.1|1366301_1366877_-|terminase	terminase small subunit	terminase	Q6SED9	Lactobacillus_prophage	31.6	2.9e-10
AXG95361.1|1366975_1367167_-	hypothetical protein	NA	NA	NA	NA	NA
AXG95362.1|1367352_1367790_-	siderophore-interacting protein	NA	A0A2H4J015	uncultured_Caudovirales_phage	40.4	5.2e-20
AXG95363.1|1368154_1368334_-	hypothetical protein	NA	NA	NA	NA	NA
AXG95364.1|1368363_1370229_-	DNA primase	NA	A0A2H4J1M0	uncultured_Caudovirales_phage	88.2	0.0e+00
1370043:1370060	attL	TTTTATATAAAATATCTG	NA	NA	NA	NA
AXG95365.1|1370255_1371245_-	DNA polymerase III subunit beta	NA	NA	NA	NA	NA
AXG95366.1|1371241_1371565_-	hypothetical protein	NA	NA	NA	NA	NA
AXG95367.1|1371567_1371897_-	nucleotide pyrophosphohydrolase	NA	A0A2H4J7H8	uncultured_Caudovirales_phage	78.0	5.1e-44
AXG95368.1|1371897_1372167_-	DUF1599 domain-containing protein	NA	A0A2H4J4N1	uncultured_Caudovirales_phage	82.8	3.3e-33
AXG95369.1|1372352_1372568_-	hypothetical protein	NA	NA	NA	NA	NA
AXG95370.1|1372596_1372914_-	hypothetical protein	NA	NA	NA	NA	NA
AXG95371.1|1372958_1374653_-	hypothetical protein	NA	A0A2H4J041	uncultured_Caudovirales_phage	84.6	3.8e-292
AXG95372.1|1374869_1375328_-	DUF669 domain-containing protein	NA	A0A2H4J1S8	uncultured_Caudovirales_phage	66.7	3.3e-57
AXG95373.1|1375330_1375651_-	hypothetical protein	NA	NA	NA	NA	NA
AXG95374.1|1375650_1377333_-	NTP-binding protein	NA	A0A2H4J7Q2	uncultured_Caudovirales_phage	74.1	1.3e-215
AXG95375.1|1377378_1377675_-	VRR-NUC domain-containing protein	NA	A0A2H4J095	uncultured_Caudovirales_phage	80.2	1.1e-40
AXG95376.1|1377747_1378572_-	DUF1351 domain-containing protein	NA	A0A2H4J082	uncultured_Caudovirales_phage	67.9	2.9e-96
AXG95377.1|1378572_1379673_-	DEAD/DEAH box helicase	NA	A0A2H4J064	uncultured_Caudovirales_phage	78.5	2.4e-170
AXG95378.1|1380017_1380311_-	histidine kinase	NA	NA	NA	NA	NA
AXG95379.1|1380330_1381080_-	hypothetical protein	NA	Q332L4	Clostridium_botulinum_C_phage	36.6	1.0e-15
AXG95380.1|1381096_1381426_-	hypothetical protein	NA	NA	NA	NA	NA
AXG95381.1|1381425_1381629_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AXG95382.1|1381837_1382350_+	helix-turn-helix domain-containing protein	NA	A0A0A7RTK4	Clostridium_phage	29.5	6.1e-12
AXG95383.1|1382397_1382814_+	ImmA/IrrE family metallo-endopeptidase	NA	I3VYZ2	Thermoanaerobacterium_phage	30.1	2.4e-06
AXG95384.1|1383373_1384444_+|integrase	site-specific integrase	integrase	B3GVW7	Streptococcus_phage	33.1	1.5e-31
1388678:1388695	attR	TTTTATATAAAATATCTG	NA	NA	NA	NA
>prophage 3
CP031098	Clostridium botulinum strain CFSAN034202 chromosome, complete genome	3954901	3515090	3547393	3954901		Clostridium_phage(74.07%)	37	NA	NA
AXG97245.1|3515090_3516578_-	MBOAT family protein	NA	A0A125RNP0	Pseudomonas_phage	38.3	4.3e-66
AXG97246.1|3517672_3517822_-	hypothetical protein	NA	NA	NA	NA	NA
AXG97247.1|3518123_3518534_-	helix-turn-helix domain-containing protein	NA	A0A0A7RUJ5	Clostridium_phage	56.2	1.0e-09
AXG97248.1|3518725_3518935_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AXG97249.1|3518975_3519209_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AXG97250.1|3519293_3520208_+	hypothetical protein	NA	A8ASN4	Listeria_phage	40.2	4.3e-40
AXG97251.1|3520149_3520998_+	AAA family ATPase	NA	A0A2K9V3L7	Faecalibacterium_phage	35.2	3.6e-33
AXG97252.1|3521054_3521375_+	hypothetical protein	NA	NA	NA	NA	NA
AXG97253.1|3521488_3522010_+	hypothetical protein	NA	A0A0A7RVS1	Clostridium_phage	50.6	3.6e-36
AXG97254.1|3522676_3522961_+	hypothetical protein	NA	A0A0A7S0R4	Clostridium_phage	59.2	3.0e-24
AXG97255.1|3522960_3523326_+	hypothetical protein	NA	A0A0A7RW73	Clostridium_phage	57.9	1.2e-33
AXG97256.1|3523330_3523678_+	hypothetical protein	NA	A0A0A7RU51	Clostridium_phage	58.9	7.8e-35
AXG97257.1|3523683_3524103_+	hypothetical protein	NA	A0A0A7RU17	Clostridium_phage	71.9	1.1e-56
AXG97258.1|3524107_3524995_+	hypothetical protein	NA	A0A0A7RTZ9	Clostridium_phage	75.0	1.2e-119
AXG97259.1|3525009_3525426_+	esterase	NA	A0A0A7S0S0	Clostridium_phage	71.2	9.0e-46
AXG97724.1|3525460_3525628_+	hypothetical protein	NA	A0A0A7RW80	Clostridium_phage	70.4	1.9e-15
AXG97260.1|3525791_3527195_+	hypothetical protein	NA	A0A0A7RU22	Clostridium_phage	42.4	5.2e-05
AXG97261.1|3527207_3527642_+	hypothetical protein	NA	NA	NA	NA	NA
AXG97262.1|3527628_3528714_+	hypothetical protein	NA	NA	NA	NA	NA
AXG97263.1|3528726_3529068_+	hypothetical protein	NA	A0A0A7S0S4	Clostridium_phage	55.7	2.1e-16
AXG97264.1|3529082_3530432_+	caspase family protein	NA	A0A0A7RW86	Clostridium_phage	74.6	2.1e-75
AXG97265.1|3530433_3531411_+	hypothetical protein	NA	A0A0A7RU61	Clostridium_phage	60.2	9.3e-110
AXG97266.1|3531433_3532942_+	hypothetical protein	NA	A0A0A7RU28	Clostridium_phage	37.7	5.5e-93
AXG97267.1|3532953_3534975_+	hypothetical protein	NA	A0A0A7RU09	Clostridium_phage	48.5	1.1e-56
AXG97268.1|3534977_3535253_+	hypothetical protein	NA	A0A223LE82	Bacillus_phage	38.8	3.9e-05
AXG97269.1|3535264_3536263_+	hypothetical protein	NA	A0A0A7RW91	Clostridium_phage	72.6	2.1e-141
AXG97270.1|3536274_3537360_+	signal peptidase II	NA	A0A0A7RU66	Clostridium_phage	70.4	4.2e-143
AXG97271.1|3537392_3538310_+	hypothetical protein	NA	NA	NA	NA	NA
AXG97272.1|3538312_3539092_+	hypothetical protein	NA	NA	NA	NA	NA
AXG97273.1|3539143_3539911_+	hypothetical protein	NA	NA	NA	NA	NA
AXG97274.1|3539976_3540801_+	carbohydrate-binding protein	NA	A0A0A7RU33	Clostridium_phage	30.4	7.3e-15
AXG97275.1|3540866_3541676_+	cell adhesion protein	NA	A0A0A7RU33	Clostridium_phage	34.7	2.8e-27
AXG97276.1|3541831_3542086_+	hypothetical protein	NA	A0A0A7RTX0	Clostridium_phage	70.9	4.8e-26
AXG97277.1|3542104_3542299_+	hypothetical protein	NA	NA	NA	NA	NA
AXG97278.1|3542445_3543225_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A2H4J8A3	uncultured_Caudovirales_phage	63.4	1.2e-88
AXG97279.1|3543623_3544748_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	28.5	3.8e-30
AXG97280.1|3544765_3547393_+	DNA polymerase I	NA	F8WQ35	Bacillus_phage	35.4	4.2e-64
>prophage 4
CP031098	Clostridium botulinum strain CFSAN034202 chromosome, complete genome	3954901	3563422	3651374	3954901	portal,tRNA,tail,integrase,plate,protease,coat,transposase,terminase,head	Clostridium_phage(75.51%)	90	3583377:3583436	3627822:3627882
AXG97300.1|3563422_3564274_+|protease	metalloprotease	protease	NA	NA	NA	NA
AXG97301.1|3564386_3566237_+	TIGR03960 family B12-binding radical SAM protein	NA	NA	NA	NA	NA
AXG97302.1|3566214_3566928_+	DUF2344 domain-containing protein	NA	NA	NA	NA	NA
AXG97303.1|3566966_3568406_+	ribonuclease E/G	NA	NA	NA	NA	NA
AXG97304.1|3568529_3568844_+	50S ribosomal protein L21	NA	NA	NA	NA	NA
AXG97305.1|3568846_3569173_+|protease	ribosomal-processing cysteine protease Prp	protease	NA	NA	NA	NA
AXG97306.1|3569175_3569478_+	50S ribosomal protein L27	NA	NA	NA	NA	NA
AXG97307.1|3569856_3571131_+	GTPase Obg	NA	NA	NA	NA	NA
AXG97308.1|3571157_3571451_+	ribosome assembly RNA-binding protein YhbY	NA	NA	NA	NA	NA
AXG97309.1|3571693_3572299_+	nicotinate-nucleotide adenylyltransferase	NA	NA	NA	NA	NA
AXG97310.1|3572381_3572951_+	HD domain-containing protein	NA	NA	NA	NA	NA
AXG97311.1|3572961_3574236_+	LytR family transcriptional regulator	NA	A0A1X9I5X1	Streptococcus_phage	29.2	1.7e-18
AXG97312.1|3574251_3574632_+	RidA family protein	NA	NA	NA	NA	NA
AXG97313.1|3574957_3575860_+	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
AXG97314.1|3575967_3577215_-	D-alanyl-D-alanine carboxypeptidase	NA	NA	NA	NA	NA
AXG97315.1|3577403_3578012_+	DNA-binding protein	NA	NA	NA	NA	NA
AXG97316.1|3578117_3579197_+	selenide, water dikinase SelD	NA	NA	NA	NA	NA
AXG97317.1|3579263_3580652_+|tRNA	L-seryl-tRNA(Sec) selenium transferase	tRNA	NA	NA	NA	NA
AXG97318.1|3580670_3582578_+	selenocysteine-specific translation elongation factor	NA	A0A2K9KZ60	Tupanvirus	30.9	2.8e-17
3583377:3583436	attL	GGGTGGGTTCGATTCCCACATATTCCCGCCAAATTTTAAAATGAACCTCTAAGCGAGTAA	NA	NA	NA	NA
AXG97319.1|3583553_3584717_-|integrase	site-specific integrase	integrase	A0A2H4JCB7	uncultured_Caudovirales_phage	31.4	5.3e-35
AXG97320.1|3584765_3585218_-	ImmA/IrrE family metallo-endopeptidase	NA	I3VYZ2	Thermoanaerobacterium_phage	40.0	6.2e-16
AXG97321.1|3585226_3585721_-	helix-turn-helix domain-containing protein	NA	M9Q2L3	Clostridium_phage	39.1	1.4e-13
AXG97322.1|3585878_3586073_+	XRE family transcriptional regulator	NA	A0A0A8WE47	Clostridium_phage	36.5	6.1e-05
AXG97323.1|3586090_3586351_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AXG97324.1|3586365_3586545_+	hypothetical protein	NA	NA	NA	NA	NA
AXG97325.1|3586755_3587040_+	hypothetical protein	NA	A0A0A7RTW4	Clostridium_phage	63.8	1.1e-21
AXG97326.1|3587092_3587446_+	hypothetical protein	NA	A0A0A7RVM0	Clostridium_phage	69.8	3.4e-38
AXG97327.1|3587463_3587709_+	hypothetical protein	NA	A0A0A7RTK9	Clostridium_phage	65.0	1.1e-24
AXG97328.1|3587742_3588192_+	hypothetical protein	NA	A0A0A7RTD8	Clostridium_phage	50.9	1.9e-09
AXG97329.1|3588191_3589337_+	DUF2800 domain-containing protein	NA	A0A0A7S066	Clostridium_phage	88.5	5.0e-195
AXG97330.1|3589348_3589969_+	DUF2815 family protein	NA	A0A0A7RVM4	Clostridium_phage	85.5	6.8e-90
AXG97331.1|3590139_3592101_+	DNA polymerase I	NA	A0A0A7RTL3	Clostridium_phage	72.4	3.3e-279
AXG97332.1|3592139_3592370_+	glutamate racemase	NA	NA	NA	NA	NA
AXG97333.1|3592406_3593432_+	nucleoid-associated protein	NA	A0A090D855	Clostridium_phage	33.1	1.9e-44
AXG97334.1|3593477_3595904_+	hypothetical protein	NA	A0A0A7RTG3	Clostridium_phage	60.6	5.4e-276
AXG97335.1|3596298_3596574_+	VRR-NUC domain-containing protein	NA	A0A0A7RTE1	Clostridium_phage	86.7	5.4e-23
AXG97336.1|3597999_3598479_+	hypothetical protein	NA	I2E8Y5	Clostridium_phage	43.7	2.7e-25
AXG97337.1|3599110_3599455_+	hypothetical protein	NA	NA	NA	NA	NA
AXG97338.1|3599521_3600115_+|terminase	terminase small subunit	terminase	U5PZD3	Bacillus_phage	36.8	1.4e-20
AXG97339.1|3600107_3601517_+|terminase	terminase	terminase	A0A0A7RTS1	Clostridium_phage	87.2	3.6e-211
AXG97725.1|3601530_3602982_+|portal	phage portal protein	portal	A0A0A7S074	Clostridium_phage	85.8	4.4e-233
AXG97340.1|3602962_3604003_+|head	phage head morphogenesis protein	head	A0A0A7RVY7	Clostridium_phage	75.7	2.3e-146
AXG97341.1|3604099_3604681_+	hypothetical protein	NA	NA	NA	NA	NA
AXG97342.1|3604748_3605108_+	ABC transporter ATPase	NA	A0A2H4J4N9	uncultured_Caudovirales_phage	81.5	2.0e-49
AXG97343.1|3605130_3605703_+	scaffolding protein	NA	A0A0A7RTM5	Clostridium_phage	54.7	1.7e-39
AXG97344.1|3605725_3606793_+|coat	phage coat protein	coat	A0A0A7RTH8	Clostridium_phage	88.5	2.5e-180
AXG97726.1|3606812_3607157_+	hypothetical protein	NA	A0A0A7RTX9	Clostridium_phage	75.4	2.6e-43
AXG97345.1|3607158_3607542_+	hypothetical protein	NA	A0A0A7S083	Clostridium_phage	83.5	3.7e-54
AXG97346.1|3607541_3608033_+	HK97 gp10 family phage protein	NA	A0A0A7RTT0	Clostridium_phage	75.3	2.1e-62
AXG97347.1|3608034_3608466_+	hypothetical protein	NA	A0A0A7RTI2	Clostridium_phage	75.4	5.1e-52
AXG97348.1|3608627_3609938_+|tail	phage tail sheath protein	tail	A0A0A7S087	Clostridium_phage	85.1	1.3e-212
AXG97349.1|3609941_3610406_+|portal	phage portal protein	portal	A0A0A7RVP1	Clostridium_phage	83.1	1.1e-68
AXG97350.1|3610421_3610835_+	hypothetical protein	NA	A0A0A7RTN3	Clostridium_phage	77.0	2.1e-55
AXG97727.1|3610834_3611029_+	hypothetical protein	NA	NA	NA	NA	NA
AXG97351.1|3611089_3611851_+	SHOCT domain-containing protein	NA	X5JB37	Clostridium_phage	42.8	2.6e-43
AXG97352.1|3611908_3614068_+	hypothetical protein	NA	A0A0A7S091	Clostridium_phage	48.0	1.6e-133
AXG97353.1|3614067_3614745_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A0A7RVP5	Clostridium_phage	75.0	4.6e-92
AXG97354.1|3614756_3615731_+	hypothetical protein	NA	A0A0A7RTZ4	Clostridium_phage	84.9	2.7e-157
AXG97355.1|3615733_3616078_+	DUF2577 domain-containing protein	NA	A0A0A7RTJ2	Clostridium_phage	74.6	7.4e-38
AXG97356.1|3616080_3616488_+	DUF2634 domain-containing protein	NA	A0A0A7RTH1	Clostridium_phage	78.5	1.1e-51
AXG97357.1|3616488_3617583_+|plate	baseplate J/gp47 family protein	plate	A0A0A7S096	Clostridium_phage	76.1	1.3e-160
AXG97358.1|3617563_3618187_+	DUF2313 domain-containing protein	NA	A0A0A7RVP9	Clostridium_phage	71.4	2.4e-79
AXG97359.1|3618189_3619929_+|tail	phage tail protein	tail	A0A0A7RTQ0	Clostridium_phage	51.1	1.9e-60
AXG97360.1|3619961_3620354_+	hypothetical protein	NA	B6SBV4	Clostridium_virus	37.6	4.5e-07
AXG97361.1|3620346_3620469_+	XkdX family protein	NA	A0A0A7S0E7	Clostridium_phage	57.5	4.5e-06
AXG97728.1|3620792_3621989_+|transposase	IS110 family transposase	transposase	A0A0U3ULR1	Bacillus_phage	44.4	4.7e-87
AXG97362.1|3622156_3622576_+	hypothetical protein	NA	A0A0A7S099	Clostridium_phage	66.2	1.1e-43
AXG97363.1|3622620_3623391_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A2H4J8A3	uncultured_Caudovirales_phage	66.1	2.2e-90
AXG97364.1|3623569_3625138_+	hypothetical protein	NA	NA	NA	NA	NA
AXG97365.1|3625226_3626090_+	DNA adenine methylase	NA	NA	NA	NA	NA
AXG97366.1|3626940_3627129_+	hypothetical protein	NA	A0A0A7RTH9	Clostridium_phage	70.9	2.9e-12
AXG97367.1|3627130_3627373_+	hypothetical protein	NA	NA	NA	NA	NA
AXG97368.1|3628701_3630216_+	DUF1538 domain-containing protein	NA	NA	NA	NA	NA
3627822:3627882	attR	GGGTGGGTTCGATTCCCACATATTCCCGCCAAATTTTAAAATGAACCTCTAAGCGAGTAAT	NA	NA	NA	NA
AXG97369.1|3630723_3633318_+	cation-transporting P-type ATPase	NA	NA	NA	NA	NA
AXG97370.1|3633422_3633653_+	hypothetical protein	NA	NA	NA	NA	NA
AXG97371.1|3633664_3635452_+	ComEC/Rec2 family competence protein	NA	NA	NA	NA	NA
AXG97372.1|3635480_3636512_+	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
AXG97373.1|3636546_3636813_-	30S ribosomal protein S20	NA	NA	NA	NA	NA
AXG97374.1|3637022_3637997_+	GPR endopeptidase	NA	NA	NA	NA	NA
AXG97375.1|3638181_3639273_+	stage II sporulation protein P	NA	NA	NA	NA	NA
AXG97376.1|3639343_3639739_+	hypothetical protein	NA	NA	NA	NA	NA
AXG97377.1|3639879_3641688_+	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	25.3	4.2e-23
AXG97378.1|3641714_3642857_+	oxygen-independent coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
AXG97379.1|3643057_3644089_+	heat-inducible transcriptional repressor HrcA	NA	NA	NA	NA	NA
AXG97380.1|3644115_3644760_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
AXG97381.1|3644814_3646686_+	molecular chaperone DnaK	NA	A0A2P1EIW2	Megavirus	46.7	1.6e-142
AXG97382.1|3646828_3647974_+	molecular chaperone DnaJ	NA	A0A1V0SBY2	Catovirus	29.0	2.2e-25
AXG97383.1|3648281_3649220_+	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
AXG97384.1|3649317_3650076_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
AXG97385.1|3650075_3651374_+|tRNA	tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))- methylthiotransferase MtaB	tRNA	NA	NA	NA	NA
>prophage 5
CP031098	Clostridium botulinum strain CFSAN034202 chromosome, complete genome	3954901	3728989	3738473	3954901		Synechococcus_phage(42.86%)	8	NA	NA
AXG97454.1|3728989_3731560_+	selenium-dependent xanthine dehydrogenase	NA	A0A0P0IVM8	Acinetobacter_phage	32.4	1.3e-09
AXG97455.1|3731580_3731715_-	hypothetical protein	NA	NA	NA	NA	NA
AXG97456.1|3732235_3732715_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	48.7	1.1e-26
AXG97457.1|3732714_3733419_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	G8EYA2	Synechococcus_phage	42.1	1.0e-41
AXG97458.1|3733510_3734959_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	35.1	7.2e-58
AXG97459.1|3735019_3736015_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	M4QRQ6	Synechococcus_phage	44.0	3.4e-67
AXG97460.1|3736142_3736760_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	40.6	1.5e-25
AXG97461.1|3736973_3738473_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/inosine monophosphate cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	46.9	1.1e-69
>prophage 1
CP031100	Clostridium botulinum strain CFSAN034202 plasmid p1_CFSAN034202, complete sequence	57676	0	28242	57676	tail,head,terminase,capsid,portal	uncultured_Caudovirales_phage(18.75%)	40	NA	NA
AXG97740.1|2675_3038_-	hypothetical protein	NA	NA	NA	NA	NA
AXG97741.1|3061_3271_-	hypothetical protein	NA	NA	NA	NA	NA
AXG97742.1|3286_3703_-	hypothetical protein	NA	NA	NA	NA	NA
AXG97743.1|3717_4749_-	DUF3383 family protein	NA	A0A2D1GQ64	Lysinibacillus_phage	31.9	4.7e-19
AXG97744.1|4753_5281_-	hypothetical protein	NA	NA	NA	NA	NA
AXG97745.1|5273_5615_-	hypothetical protein	NA	NA	NA	NA	NA
AXG97746.1|5634_6144_-	hypothetical protein	NA	E5DV55	Deep-sea_thermophilic_phage	40.9	3.3e-26
AXG97747.1|6140_6746_-|head,tail	phage gp6-like head-tail connector protein	head,tail	NA	NA	NA	NA
AXG97748.1|6792_6990_-	hypothetical protein	NA	NA	NA	NA	NA
AXG97749.1|6998_7325_-	hypothetical protein	NA	NA	NA	NA	NA
AXG97750.1|7338_8436_-|capsid	phage major capsid protein	capsid	B0VK33	Azospirillum_phage	35.4	2.4e-66
AXG97751.1|8435_9365_-	hypothetical protein	NA	A0A2D1GNL2	Pseudomonas_phage	37.6	4.1e-14
AXG97752.1|9510_9756_-	hypothetical protein	NA	NA	NA	NA	NA
AXG97753.1|9971_10361_-	single-stranded DNA-binding protein	NA	A0A0K0MWE1	Streptococcus_phage	48.9	1.3e-27
AXG97754.1|10903_11122_-	hypothetical protein	NA	NA	NA	NA	NA
AXG97755.1|11124_12093_-	hypothetical protein	NA	NA	NA	NA	NA
AXG97822.1|12092_12356_-	DUF1599 domain-containing protein	NA	A0A2H4J4N1	uncultured_Caudovirales_phage	79.1	1.0e-31
AXG97756.1|12658_12865_-	hypothetical protein	NA	NA	NA	NA	NA
AXG97757.1|13193_13454_-	hypothetical protein	NA	NA	NA	NA	NA
AXG97758.1|13484_13835_-	hypothetical protein	NA	NA	NA	NA	NA
AXG97759.1|13866_14049_-	hypothetical protein	NA	NA	NA	NA	NA
AXG97823.1|14090_14750_-	DNA modification methylase	NA	A0A1S5S9L2	Streptococcus_phage	67.6	8.0e-89
AXG97760.1|14791_15220_-	phage N-6-adenine-methyltransferase	NA	A0A0A7RUD1	Clostridium_phage	87.1	3.5e-69
AXG97824.1|15266_15506_-	hypothetical protein	NA	NA	NA	NA	NA
AXG97761.1|15666_16434_-|head	phage head morphogenesis protein	head	W8VT12	Pseudomonas_phage	33.9	1.4e-07
AXG97762.1|16475_17789_-|portal	phage portal protein	portal	A0A0F7L7L5	uncultured_marine_virus	23.0	1.1e-23
AXG97763.1|18075_18474_-	hypothetical protein	NA	NA	NA	NA	NA
AXG97764.1|18707_18962_-	hypothetical protein	NA	NA	NA	NA	NA
AXG97765.1|19057_19441_-	hypothetical protein	NA	NA	NA	NA	NA
AXG97766.1|19455_19698_-	hypothetical protein	NA	NA	NA	NA	NA
AXG97767.1|19825_20530_-	helix-turn-helix domain-containing protein	NA	F0PIG9	Enterococcus_phage	46.8	9.3e-19
AXG97768.1|20549_20813_-	hypothetical protein	NA	NA	NA	NA	NA
AXG97769.1|21301_21493_-	DUF4236 domain-containing protein	NA	A0A2K9V2W7	Faecalibacterium_phage	58.7	4.1e-14
AXG97770.1|21694_22111_-	hypothetical protein	NA	NA	NA	NA	NA
AXG97771.1|23234_24479_-|terminase	PBSX family phage terminase large subunit	terminase	A0A0S0KEN9	Bacillus_phage	61.7	7.6e-149
AXG97772.1|24481_24892_-|terminase	terminase small subunit	terminase	A0A0A8WDX8	Clostridium_phage	42.8	4.0e-22
AXG97773.1|24881_25187_-	hypothetical protein	NA	NA	NA	NA	NA
AXG97774.1|25256_27608_-	hypothetical protein	NA	A0A2H4J056	uncultured_Caudovirales_phage	40.5	1.1e-156
AXG97775.1|27592_27826_-	hypothetical protein	NA	NA	NA	NA	NA
AXG97776.1|27837_28242_-	hypothetical protein	NA	A0A2H4J7M8	uncultured_Caudovirales_phage	37.0	3.3e-13
>prophage 2
CP031100	Clostridium botulinum strain CFSAN034202 plasmid p1_CFSAN034202, complete sequence	57676	32794	49679	57676		Clostridium_phage(57.14%)	25	NA	NA
AXG97784.1|32794_32977_-	hypothetical protein	NA	A0A0A7RTH9	Clostridium_phage	82.5	6.5e-17
AXG97785.1|33500_34130_-	FAD-dependent thymidylate synthase	NA	F8UBK4	Clostridium_phage	47.1	2.0e-44
AXG97786.1|34424_34892_-	hypothetical protein	NA	D9ZNH9	Clostridium_phage	39.5	9.2e-15
AXG97787.1|34948_35839_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AXG97788.1|35859_36369_-	dUTPase	NA	S6AVW3	Thermus_phage	39.9	8.2e-25
AXG97789.1|36369_36579_-	hypothetical protein	NA	NA	NA	NA	NA
AXG97790.1|36581_37136_-	hypothetical protein	NA	Q332D2	Clostridium_botulinum_C_phage	50.5	4.3e-43
AXG97791.1|37150_37384_-	hypothetical protein	NA	NA	NA	NA	NA
AXG97792.1|37567_37834_-	hypothetical protein	NA	NA	NA	NA	NA
AXG97793.1|37827_39684_-	bifunctional DNA primase/helicase	NA	K4NWL6	Pseudomonas_phage	24.2	6.3e-14
AXG97794.1|39696_40452_-	hypothetical protein	NA	NA	NA	NA	NA
AXG97795.1|40475_40721_-	stage III sporulation protein D	NA	M9Q261	Clostridium_phage	52.0	6.3e-15
AXG97796.1|40720_41038_-	hypothetical protein	NA	NA	NA	NA	NA
AXG97797.1|41336_41948_-	hypothetical protein	NA	A0A0A7RVW0	Clostridium_phage	62.3	2.7e-62
AXG97798.1|41963_42851_-	hypothetical protein	NA	A0A088FAU5	Sulfitobacter_phage	47.3	1.9e-69
AXG97799.1|42869_43355_-	hypothetical protein	NA	A0A059T5F1	Listeria_phage	39.6	1.2e-20
AXG97800.1|43822_44206_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AXG97801.1|44480_45530_-	hypothetical protein	NA	A0A2H4JAA4	uncultured_Caudovirales_phage	43.2	3.3e-20
AXG97802.1|45933_46500_+	hypothetical protein	NA	NA	NA	NA	NA
AXG97803.1|46617_47529_+	ATPase	NA	NA	NA	NA	NA
AXG97804.1|47512_47800_+	hypothetical protein	NA	NA	NA	NA	NA
AXG97805.1|47877_48294_-	hypothetical protein	NA	I2E8W8	Clostridium_phage	27.7	8.2e-07
AXG97806.1|48304_49096_-	N-acetylmuramoyl-L-alanine amidase	NA	I1TJX3	Clostridium_phage	52.5	5.5e-68
AXG97807.1|49097_49427_-	hypothetical protein	NA	NA	NA	NA	NA
AXG97808.1|49526_49679_-	XkdX family protein	NA	A0A249XXC6	Clostridium_phage	62.2	2.4e-09
>prophage 3
CP031100	Clostridium botulinum strain CFSAN034202 plasmid p1_CFSAN034202, complete sequence	57676	52974	56186	57676		Aeribacillus_phage(66.67%)	5	NA	NA
AXG97814.1|52974_54141_-	hypothetical protein	NA	G0YPL8	Erwinia_phage	36.9	1.9e-21
AXG97815.1|54133_54505_-	hypothetical protein	NA	NA	NA	NA	NA
AXG97816.1|54509_55046_-	hypothetical protein	NA	NA	NA	NA	NA
AXG97817.1|55045_55858_-	hypothetical protein	NA	A0A1L2JY62	Aeribacillus_phage	30.6	1.4e-31
AXG97818.1|55850_56186_-	hypothetical protein	NA	A0A1L2JY63	Aeribacillus_phage	34.5	3.5e-08
