The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP031158	Deinococcus wulumuqiensis strain NEB 479 chromosome, complete genome	2658929	225807	293958	2658929	transposase,protease,tRNA	uncultured_Mediterranean_phage(25.0%)	54	NA	NA
AXG98022.1|225807_227028_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
AXG98023.1|227294_228593_-	putative 5-methylcytosine-specific restriction enzyme DrdMcrBCP, subunit McrC	NA	NA	NA	NA	NA
AXG98024.1|230970_234981_-	Type II restriction endonuclease and methyltransferase DrdVIII	NA	A0A1B1IUC6	uncultured_Mediterranean_phage	24.5	7.6e-49
AXG99973.1|234977_235397_-	PIN domain-containing protein	NA	NA	NA	NA	NA
AXG98025.1|235420_235744_-	hypothetical protein	NA	NA	NA	NA	NA
AXG98026.1|235801_238621_-	ATP-dependent helicase	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	27.4	5.7e-35
AXG98027.1|238625_243725_-	DUF1998 domain-containing protein	NA	A0A1B1IUF6	uncultured_Mediterranean_phage	22.6	1.8e-50
AXG98028.1|244081_245134_-	hypothetical protein	NA	NA	NA	NA	NA
AXG99974.1|245250_245700_-	hypothetical protein	NA	NA	NA	NA	NA
AXG98029.1|245737_247177_-	M20/M25/M40 family metallo-hydrolase	NA	NA	NA	NA	NA
AXG98030.1|247394_247583_-	hypothetical protein	NA	NA	NA	NA	NA
AXG98031.1|247712_248978_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
AXG98032.1|248982_249603_+	VOC family protein	NA	NA	NA	NA	NA
AXG98033.1|250163_251162_-	class II fructose-bisphosphatase	NA	NA	NA	NA	NA
AXG98034.1|251404_252751_+	acyltransferase	NA	NA	NA	NA	NA
AXG98035.1|252730_253597_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
AXG98036.1|253601_254168_-	16S rRNA processing protein RimM	NA	NA	NA	NA	NA
AXG98037.1|254164_254413_-	KH domain-containing protein	NA	NA	NA	NA	NA
AXG98038.1|254906_255917_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
AXG98039.1|256072_256312_+	DUF3248 domain-containing protein	NA	NA	NA	NA	NA
AXG99975.1|256335_256809_+	DUF3809 domain-containing protein	NA	NA	NA	NA	NA
AXG98040.1|256981_257182_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
AXG98041.1|257185_257542_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
AXG98042.1|257688_258288_+	hypothetical protein	NA	NA	NA	NA	NA
AXG98043.1|258314_258719_+	hypothetical protein	NA	NA	NA	NA	NA
AXG98044.1|260458_262069_-	catalase	NA	A0A2K9L572	Tupanvirus	46.8	1.6e-103
AXG98045.1|262241_262877_+	NYN domain-containing protein	NA	NA	NA	NA	NA
AXG99976.1|262959_263958_+	phosphate acyltransferase PlsX	NA	NA	NA	NA	NA
AXG98046.1|264037_265240_+	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
AXG98047.1|265291_265876_+	DUF1282 domain-containing protein	NA	NA	NA	NA	NA
AXG98048.1|266004_266829_-	transglutaminase family protein	NA	NA	NA	NA	NA
AXG98049.1|266928_267630_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
AXG98050.1|267687_268767_+|tRNA	tRNA pseudouridine(13) synthase TruD	tRNA	NA	NA	NA	NA
AXG98051.1|268799_269243_+	DUF3293 domain-containing protein	NA	NA	NA	NA	NA
AXG98052.1|269570_270632_+	PhoH family protein	NA	H6X2N1	Pseudomonas_phage	48.5	4.6e-46
AXG99977.1|271109_271616_+	hypothetical protein	NA	NA	NA	NA	NA
AXG98053.1|271877_272735_+	DegV family protein	NA	A0A0N9SI50	Staphylococcus_phage	36.4	2.9e-14
AXG98054.1|272737_274039_+	serine hydrolase	NA	NA	NA	NA	NA
AXG98055.1|274257_274881_+	thymidine kinase	NA	Q6GYZ9	Mycoplasma_phage	33.5	1.2e-22
AXG99978.1|274956_276858_-	30S ribosomal protein S1	NA	NA	NA	NA	NA
AXG99979.1|277309_278296_+	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	45.5	6.8e-68
AXG98056.1|278410_278935_+	HD domain-containing protein	NA	NA	NA	NA	NA
AXG98057.1|279136_280102_-	complex I NDUFA9 subunit family protein	NA	NA	NA	NA	NA
AXG99980.1|280429_280906_-	hypothetical protein	NA	NA	NA	NA	NA
AXG98058.1|281180_283481_+	endonuclease MutS2	NA	F2QAG1	Chrysochromulina_ericina_virus	28.9	1.2e-17
AXG98059.1|283547_284822_+	MFS transporter	NA	NA	NA	NA	NA
AXG98060.1|284919_286143_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
AXG98061.1|286318_288763_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	42.9	4.9e-176
AXG98062.1|288896_290108_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	51.3	1.1e-112
AXG98063.1|290104_290719_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	52.6	4.7e-51
AXG98064.1|290808_291969_-	MFS transporter	NA	NA	NA	NA	NA
AXG98065.1|292166_292652_+	transcription elongation factor GreA	NA	NA	NA	NA	NA
AXG98066.1|292756_293275_+	hypothetical protein	NA	NA	NA	NA	NA
AXG98067.1|293448_293958_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 2
CP031158	Deinococcus wulumuqiensis strain NEB 479 chromosome, complete genome	2658929	501725	568444	2658929	transposase,tRNA	Hokovirus(20.0%)	51	NA	NA
AXG98229.1|501725_502949_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
AXG98230.1|504095_504614_+	hypothetical protein	NA	NA	NA	NA	NA
AXG98231.1|504605_505118_-	hypothetical protein	NA	NA	NA	NA	NA
AXG98232.1|505264_506488_+	MFS transporter	NA	NA	NA	NA	NA
AXG98233.1|506659_507784_-|transposase	IS4/IS5 family transposase	transposase	NA	NA	NA	NA
AXG98234.1|507904_509524_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
AXG98235.1|509970_511227_-	DUF4127 family protein	NA	A0A218KDG5	Bacillus_phage	24.0	2.7e-08
AXG98236.1|511401_513327_-	2',3'-cyclic-nucleotide 2'-phosphodiesterase	NA	NA	NA	NA	NA
AXG98237.1|513361_514072_-	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
AXG98238.1|514075_515512_-	FAD-binding protein	NA	NA	NA	NA	NA
AXG98239.1|515696_516974_-	glycolate oxidase iron-sulfur subunit	NA	NA	NA	NA	NA
AXH00004.1|517045_517879_-	pyruvate, phosphate dikinase/phosphoenolpyruvate synthase regulator	NA	NA	NA	NA	NA
AXG98240.1|518002_520345_+	pyruvate, water dikinase	NA	A0A1V0SGR7	Hokovirus	37.7	1.1e-169
AXG98241.1|521923_524644_-	aconitate hydratase AcnA	NA	NA	NA	NA	NA
AXG98242.1|524831_525695_+	hypothetical protein	NA	NA	NA	NA	NA
AXG98243.1|526544_527558_+	nitronate monooxygenase	NA	NA	NA	NA	NA
AXG98244.1|527658_528315_-	hypothetical protein	NA	NA	NA	NA	NA
AXG98245.1|528301_528934_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
AXG98246.1|529022_530609_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AXG98247.1|530605_531775_+	amidohydrolase	NA	NA	NA	NA	NA
AXG98248.1|532071_532602_+	hypothetical protein	NA	NA	NA	NA	NA
AXG98249.1|532707_535458_+	DNA polymerase I	NA	A0A1B1IST8	uncultured_Mediterranean_phage	30.4	2.3e-44
AXG98250.1|535654_536905_+|transposase	IS4 family transposase	transposase	A0A218MNH3	uncultured_virus	27.8	3.0e-36
AXG98251.1|537013_538381_-	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
AXG98252.1|538379_538661_+	hypothetical protein	NA	NA	NA	NA	NA
AXH00005.1|538792_539923_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
AXG98253.1|539992_541063_+	alpha-hydroxy-acid oxidizing protein	NA	NA	NA	NA	NA
AXG98254.1|541588_542809_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
AXG98255.1|542906_543731_+	ZIP family metal transporter	NA	NA	NA	NA	NA
AXG98256.1|543759_544296_-	hypothetical protein	NA	NA	NA	NA	NA
AXG98257.1|544338_544596_-	hypothetical protein	NA	NA	NA	NA	NA
AXG98258.1|544672_544969_-	hypothetical protein	NA	NA	NA	NA	NA
AXG98259.1|544859_545588_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.0	1.5e-16
AXG98260.1|545587_546412_-	ABC transporter ATP-binding protein	NA	A0A1V0SGN0	Hokovirus	26.5	7.1e-10
AXG98261.1|546408_547833_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
AXG98262.1|547835_548825_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
AXG98263.1|549084_550239_-	branched-chain amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AXG98264.1|550658_553145_+	DNA mismatch repair protein MutS	NA	A0A1V0SC35	Catovirus	24.0	4.1e-29
AXG98265.1|553141_553558_+	hypothetical protein	NA	NA	NA	NA	NA
AXG98266.1|553565_554225_-	DsbA family protein	NA	NA	NA	NA	NA
AXG98267.1|554809_557368_+	ATP-dependent chaperone ClpB	NA	K4FB40	Cronobacter_phage	36.5	8.7e-123
AXG98268.1|558137_558830_+	hypothetical protein	NA	NA	NA	NA	NA
AXG98269.1|559643_559847_+	DUF2892 domain-containing protein	NA	NA	NA	NA	NA
AXG98270.1|559923_561231_-|tRNA	aspartate--tRNA(Asn) ligase	tRNA	A0A2K9L0E9	Tupanvirus	33.7	8.5e-58
AXG98271.1|561524_562544_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
AXG98272.1|563781_565179_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
AXG98273.1|565180_566098_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
AXG98274.1|566090_567026_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
AXG98275.1|567289_567493_-	hypothetical protein	NA	NA	NA	NA	NA
AXG98276.1|567477_568179_-|transposase	IS630 family transposase	transposase	A0A1V0SCG6	Indivirus	24.0	1.5e-13
AXG98277.1|568060_568444_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 3
CP031158	Deinococcus wulumuqiensis strain NEB 479 chromosome, complete genome	2658929	1161072	1233247	2658929	transposase,tRNA	Hokovirus(11.11%)	57	NA	NA
AXG98744.1|1161072_1161426_+|transposase	transposase	transposase	NA	NA	NA	NA
AXG98745.1|1161431_1162922_+	PAS domain-containing protein	NA	A0A1V0SGR3	Hokovirus	21.7	1.1e-08
AXG98746.1|1162960_1163716_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
AXG98747.1|1163988_1164777_-	DUF554 domain-containing protein	NA	NA	NA	NA	NA
AXG98748.1|1165080_1166223_-	GTP pyrophosphokinase family protein	NA	NA	NA	NA	NA
AXG98749.1|1166371_1168186_+	N-acetylmuramoyl-L-alanine amidase	NA	NA	NA	NA	NA
AXG98750.1|1168323_1169814_-	CHASE2 domain-containing protein	NA	NA	NA	NA	NA
AXG98751.1|1171452_1173342_+	ABC transporter ATP-binding protein	NA	A0A2K9L0W2	Tupanvirus	29.0	1.1e-50
AXG98752.1|1173439_1174948_+	4-alpha-glucanotransferase	NA	NA	NA	NA	NA
AXG98753.1|1175018_1175579_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
AXG98754.1|1175753_1176647_+	ROK family protein	NA	NA	NA	NA	NA
AXH00054.1|1176643_1176835_+	hypothetical protein	NA	NA	NA	NA	NA
AXG98755.1|1176893_1177388_+	DinB family protein	NA	NA	NA	NA	NA
AXG98756.1|1177475_1178222_-	glycosyltransferase	NA	NA	NA	NA	NA
AXG98757.1|1178338_1179034_+	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
AXG98758.1|1179130_1180699_+	bacillithiol biosynthesis cysteine-adding enzyme BshC	NA	NA	NA	NA	NA
AXG98759.1|1180804_1181605_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.5	2.0e-33
AXG98760.1|1181834_1182794_+	TRAP transporter substrate-binding protein	NA	NA	NA	NA	NA
AXH00055.1|1183042_1185076_+	TRAP transporter permease	NA	NA	NA	NA	NA
AXG98761.1|1185183_1185732_+	hypothetical protein	NA	NA	NA	NA	NA
AXG98762.1|1185804_1186818_+	aliphatic sulfonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AXG98763.1|1186893_1188393_+	ATP-binding protein	NA	NA	NA	NA	NA
AXG98764.1|1188581_1190624_-	M3 family peptidase	NA	NA	NA	NA	NA
AXG98765.1|1190696_1191656_+	N-acetyltransferase	NA	NA	NA	NA	NA
AXG98766.1|1191886_1192192_+	stage V sporulation protein S	NA	A0A1J0GVV0	Streptomyces_phage	40.8	4.3e-05
AXG98767.1|1192393_1193428_-	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	84.6	2.8e-19
AXG98768.1|1193862_1194315_+	uracil-DNA glycosylase	NA	NA	NA	NA	NA
AXH00056.1|1194360_1194984_-	futalosine hydrolase	NA	NA	NA	NA	NA
AXG98769.1|1195122_1195578_+	hypothetical protein	NA	NA	NA	NA	NA
AXH00057.1|1195666_1196650_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
AXG98770.1|1197097_1197757_-	TrkA family potassium uptake protein	NA	NA	NA	NA	NA
AXG98771.1|1197770_1199147_-	potassium transporter KtrB	NA	NA	NA	NA	NA
AXG98772.1|1200687_1201788_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
AXG98773.1|1201964_1203431_-|tRNA	cysteine--tRNA ligase	tRNA	A0A1V0SAQ2	Catovirus	31.8	4.7e-49
AXG98774.1|1203806_1205132_+	ornithine--oxo-acid transaminase	NA	NA	NA	NA	NA
AXG98775.1|1205400_1206099_+	hypothetical protein	NA	NA	NA	NA	NA
AXG98776.1|1206071_1207064_+	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
AXG98777.1|1207162_1208164_+	isocitrate/isopropylmalate dehydrogenase family protein	NA	NA	NA	NA	NA
AXG98778.1|1209146_1209920_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AXG98779.1|1210442_1211426_-|tRNA	tRNA (guanine-N7)-methyltransferase	tRNA	NA	NA	NA	NA
AXG98780.1|1211422_1212199_-|tRNA	tRNA uridine 5-carboxymethylaminomethyl modification protein GidA	tRNA	NA	NA	NA	NA
AXG98781.1|1212300_1213197_+	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
AXG98782.1|1213233_1213845_+	ParA family protein	NA	A0A0K1Y6H3	Rhodobacter_phage	29.4	1.1e-10
AXG98783.1|1213846_1214098_+	hypothetical protein	NA	NA	NA	NA	NA
AXG98784.1|1214148_1215024_+|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
AXG98785.1|1215054_1215888_-	hypothetical protein	NA	NA	NA	NA	NA
AXG98786.1|1216103_1217345_-	glucose-1-phosphate adenylyltransferase	NA	H9NC64	Sphingomonas_phage	26.5	4.5e-08
AXG98787.1|1217949_1219170_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
AXG98788.1|1219242_1220151_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
AXG98789.1|1220222_1220654_+	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
AXG98790.1|1221331_1223083_+	long-chain fatty acid--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	28.3	2.8e-40
AXG98791.1|1223149_1223914_+	hypothetical protein	NA	NA	NA	NA	NA
AXH00058.1|1224071_1225211_+	class I SAM-dependent rRNA methyltransferase	NA	NA	NA	NA	NA
AXH00059.1|1226068_1227052_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
AXG98792.1|1227989_1228802_-|transposase	IS5-like element ISDra5 family transposase	transposase	NA	NA	NA	NA
AXG98793.1|1229968_1230337_+	VOC family protein	NA	NA	NA	NA	NA
AXG98794.1|1232026_1233247_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 1
CP031159	Deinococcus wulumuqiensis strain NEB 479 plasmid pDrdA, complete sequence	311711	39796	99342	311711	transposase	Lactobacillus_phage(11.11%)	53	NA	NA
AXH00226.1|39796_41149_-|transposase	transposase	transposase	A0A0P0IJS6	Lactobacillus_phage	34.4	6.1e-43
AXH00227.1|41262_41973_+	PIG-L family deacetylase	NA	NA	NA	NA	NA
AXH00228.1|41969_42557_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AXH00229.1|42587_43589_-	class A beta-lactamase-related serine hydrolase	NA	NA	NA	NA	NA
AXH00230.1|43593_44598_-	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
AXH00231.1|44594_45824_-	anhydro-N-acetylmuramic acid kinase	NA	NA	NA	NA	NA
AXH00232.1|45820_46675_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AXH00233.1|46745_48485_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AXH00234.1|48560_49532_+	ABC transporter permease	NA	NA	NA	NA	NA
AXH00235.1|49528_50638_+	ABC transporter permease	NA	NA	NA	NA	NA
AXH00236.1|50702_52253_+	glycoside hydrolase family 10 protein	NA	NA	NA	NA	NA
AXH00237.1|52550_53147_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AXH00428.1|53381_54314_-	ATPase	NA	NA	NA	NA	NA
AXH00238.1|54655_55354_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
AXH00239.1|55346_56504_-	phosphotransferase family protein	NA	NA	NA	NA	NA
AXH00240.1|56500_57352_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
AXH00241.1|57391_58639_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
AXH00242.1|58635_59025_-	hypothetical protein	NA	NA	NA	NA	NA
AXH00243.1|59014_59500_-	PaaI family thioesterase	NA	NA	NA	NA	NA
AXH00244.1|59678_60137_-	MaoC family dehydratase	NA	NA	NA	NA	NA
AXH00245.1|60133_60910_-	SDR family NAD(P)-dependent oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	35.8	7.1e-20
AXH00246.1|61020_61899_-	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	54.4	7.2e-77
AXH00247.1|61971_63375_-	superoxide dismutase	NA	Q9YMI3	Lymantria_dispar_multicapsid_nuclear_polyhedrosis_virus	35.9	2.6e-12
AXH00248.1|63371_64613_-	sorbosone dehydrogenase family protein	NA	NA	NA	NA	NA
AXH00249.1|64728_65163_-	response regulator	NA	NA	NA	NA	NA
AXH00250.1|65159_66770_-	HAMP domain-containing protein	NA	NA	NA	NA	NA
AXH00251.1|66921_67641_-	hypothetical protein	NA	NA	NA	NA	NA
AXH00252.1|67916_68336_+|transposase	IS200/IS605 family transposase	transposase	W0UUZ0	Sulfolobus_monocaudavirus	42.7	2.5e-27
AXH00429.1|68325_69480_+|transposase	transposase	transposase	A0A068A1P5	Thermus_phage	55.4	5.8e-111
AXH00253.1|69492_71208_-	oligoendopeptidase F	NA	NA	NA	NA	NA
AXH00254.1|71329_72850_-	30S ribosomal protein S12 methylthiotransferase RimO	NA	NA	NA	NA	NA
AXH00255.1|73034_75539_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	36.3	2.9e-163
AXH00430.1|75587_76760_-	cytochrome P450	NA	NA	NA	NA	NA
AXH00256.1|76791_77304_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AXH00257.1|77411_78956_+	Ppx/GppA family phosphatase	NA	NA	NA	NA	NA
AXH00431.1|79226_80210_+	pyridoxal kinase	NA	NA	NA	NA	NA
AXH00258.1|80140_80443_-	hypothetical protein	NA	NA	NA	NA	NA
AXH00259.1|80552_81917_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	34.1	3.2e-55
AXH00432.1|82152_82941_-	hypothetical protein	NA	NA	NA	NA	NA
AXH00260.1|83306_85001_+	DUF839 domain-containing protein	NA	NA	NA	NA	NA
AXH00261.1|85002_85299_+	hypothetical protein	NA	NA	NA	NA	NA
AXH00262.1|85375_85954_+	biotin transporter BioY	NA	NA	NA	NA	NA
AXH00263.1|85950_86652_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.4	7.1e-19
AXH00264.1|86648_87248_+	energy-coupling factor transporter transmembrane protein EcfT	NA	NA	NA	NA	NA
AXH00265.1|87627_89439_+	phosphomethylpyrimidine synthase ThiC	NA	NA	NA	NA	NA
AXH00266.1|89512_90148_+	thiamine phosphate synthase	NA	NA	NA	NA	NA
AXH00267.1|90245_91046_+	thiazole synthase	NA	NA	NA	NA	NA
AXH00268.1|92098_93322_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
AXH00433.1|93468_94452_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
AXH00269.1|94738_95851_-	3-phytase	NA	NA	NA	NA	NA
AXH00270.1|96021_97908_-	hypothetical protein	NA	NA	NA	NA	NA
AXH00271.1|97968_98289_-	hypothetical protein	NA	NA	NA	NA	NA
AXH00434.1|98358_99342_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 1
CP031160	Deinococcus wulumuqiensis strain NEB 479 plasmid pDrdB, complete sequence	70951	5192	66991	70951	integrase,protease,transposase	Streptococcus_phage(22.22%)	56	5121:5180	67970:68138
5121:5180	attL	CGGTAATGCTCCAGGGATTCCTTCCAAAAATCGCCTGACCGATAGGAGGGTCAGGCAAAC	NA	NA	NA	NA
AXH00452.1|5192_5480_+|transposase	transposase	transposase	NA	NA	NA	NA
AXH00453.1|5512_6361_+|integrase	integrase	integrase	S5WIU1	Leptospira_phage	25.3	4.9e-06
AXH00454.1|12553_13153_-	hypothetical protein	NA	NA	NA	NA	NA
AXH00455.1|13661_14888_-	PDZ domain-containing protein	NA	A0A1B1IT49	uncultured_Mediterranean_phage	28.9	3.9e-20
AXH00456.1|15019_15439_-	universal stress protein	NA	NA	NA	NA	NA
AXH00503.1|15693_16671_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
AXH00457.1|17305_20161_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	K4FB40	Cronobacter_phage	39.4	1.8e-124
AXH00458.1|20227_20800_+	HdeD family acid-resistance protein	NA	NA	NA	NA	NA
AXH00459.1|20827_21661_+	DUF2382 domain-containing protein	NA	NA	NA	NA	NA
AXH00460.1|21848_22214_+	hypothetical protein	NA	NA	NA	NA	NA
AXH00461.1|22361_23090_+	hypothetical protein	NA	NA	NA	NA	NA
AXH00462.1|23114_24209_+	two pore domain potassium channel family protein	NA	NA	NA	NA	NA
AXH00504.1|24263_25091_-|integrase	integrase	integrase	A0A0E3M2X0	Bacillus_phage	25.6	4.6e-09
AXH00463.1|27356_27977_-	hypothetical protein	NA	NA	NA	NA	NA
AXH00464.1|28075_28363_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AXH00465.1|28744_29311_-	hypothetical protein	NA	NA	NA	NA	NA
AXH00466.1|29307_29616_-	hypothetical protein	NA	NA	NA	NA	NA
AXH00467.1|29612_29984_-	hypothetical protein	NA	NA	NA	NA	NA
AXH00505.1|30872_31052_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AXH00468.1|31535_31841_+	transcriptional regulator	NA	NA	NA	NA	NA
AXH00469.1|31859_32156_-	hypothetical protein	NA	NA	NA	NA	NA
AXH00470.1|32420_32912_+	hypothetical protein	NA	NA	NA	NA	NA
AXH00506.1|32901_33885_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
AXH00471.1|34055_34673_+	hypothetical protein	NA	NA	NA	NA	NA
AXH00472.1|34854_35787_+	DNA primase	NA	A0A173H0P8	Pseudoalteromonas_phage	27.5	1.8e-09
AXH00473.1|36691_37540_-|integrase	integrase	integrase	S5WIU1	Leptospira_phage	25.3	4.9e-06
AXH00474.1|37572_37860_-|transposase	transposase	transposase	NA	NA	NA	NA
AXH00475.1|38335_39643_+	hypothetical protein	NA	E5AGF0	Erwinia_phage	28.0	5.2e-07
AXH00476.1|39724_40180_-	hypothetical protein	NA	NA	NA	NA	NA
AXH00507.1|40284_41262_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
AXH00508.1|41265_41976_-|transposase	IS6 family transposase	transposase	A0A1X9I6E7	Streptococcus_phage	36.3	1.0e-25
AXH00477.1|42292_42517_+	hypothetical protein	NA	NA	NA	NA	NA
AXH00509.1|42840_43599_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
AXH00478.1|43786_44569_-	S-layer protein	NA	NA	NA	NA	NA
AXH00479.1|44697_45249_+	DUF3105 domain-containing protein	NA	NA	NA	NA	NA
AXH00480.1|45471_46092_-	hypothetical protein	NA	NA	NA	NA	NA
AXH00481.1|46084_46453_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
AXH00482.1|46501_47986_-	hypothetical protein	NA	NA	NA	NA	NA
AXH00483.1|49125_49563_+|transposase	IS200/IS605 family transposase	transposase	Q331U4	Clostridium_botulinum_C_phage	35.2	1.7e-15
AXH00484.1|49571_49856_-	hypothetical protein	NA	NA	NA	NA	NA
AXH00485.1|50250_50760_-	RES domain-containing protein	NA	NA	NA	NA	NA
AXH00486.1|50756_51203_-	DUF2384 domain-containing protein	NA	NA	NA	NA	NA
AXH00487.1|51692_52403_+|transposase	IS6 family transposase	transposase	A0A1X9I6E7	Streptococcus_phage	35.7	1.1e-24
AXH00488.1|52406_52928_-	hypothetical protein	NA	NA	NA	NA	NA
AXH00489.1|53028_54132_-	sensor histidine kinase	NA	A0A1V0SGX0	Hokovirus	27.0	8.9e-16
AXH00490.1|54132_54798_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	39.9	3.2e-37
AXH00491.1|54919_55873_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
AXH00510.1|56082_56607_+	DUF305 domain-containing protein	NA	A0A218MND9	uncultured_virus	39.7	1.9e-16
AXH00492.1|56873_57584_-|transposase	IS6 family transposase	transposase	A0A1X9I6E7	Streptococcus_phage	35.7	3.9e-25
AXH00493.1|58659_60090_-	hypothetical protein	NA	NA	NA	NA	NA
AXH00494.1|60089_60752_-	HNH endonuclease	NA	NA	NA	NA	NA
AXH00495.1|60760_61105_-	hypothetical protein	NA	NA	NA	NA	NA
AXH00511.1|61101_61725_-	ParA family protein	NA	Q94M11	Actinophage	31.2	1.6e-06
AXH00496.1|62019_62730_+|transposase	IS6 family transposase	transposase	A0A1X9I6E7	Streptococcus_phage	35.7	3.9e-25
AXH00497.1|64209_65460_-|transposase	IS4 family transposase	transposase	A0A218MNH3	uncultured_virus	28.6	2.1e-37
AXH00498.1|66043_66991_-|integrase	integrase	integrase	A0A1D8EVX7	Mycobacterium_phage	27.3	1.1e-06
67970:68138	attR	CGGTAATGCTCCAGGGATTCCTTCCAAAAATCGCCTGACCGATAGGAGGGTCAGGCAAACTGGAGGAACTCTATGGGAAAGCAGCGCAAAACTTGGGCATCTGGGGTCAAGGAAGAAATCGTCCTGGCCGTCCTTAGCGGCGAAAAGTCCATCGCGGAACTGGCCCGTC	NA	NA	NA	NA
>prophage 1
CP031163	Deinococcus wulumuqiensis strain NEB 479 plasmid pDrdI, complete sequence	668667	1686	35481	668667	integrase,transposase	Streptococcus_phage(38.46%)	33	18866:18925	35503:35575
AXH00559.1|1686_2397_+|transposase	IS6 family transposase	transposase	A0A1X9I6E7	Streptococcus_phage	35.7	3.0e-25
AXH00560.1|5938_6319_-	PIN domain-containing protein	NA	NA	NA	NA	NA
AXH00561.1|6361_7072_+|transposase	IS6 family transposase	transposase	A0A1X9I6E7	Streptococcus_phage	35.7	3.0e-25
AXH00562.1|7691_8693_+|transposase	IS630 family transposase	transposase	A0A2H4UV16	Bodo_saltans_virus	22.0	4.0e-07
AXH00563.1|8698_10669_-|transposase	Tn3 family transposase	transposase	A0A125RQ78	Bacillus_phage	38.1	1.6e-121
AXH00564.1|10708_11914_-	MFS transporter	NA	NA	NA	NA	NA
AXH01132.1|11944_12628_+	hypothetical protein	NA	NA	NA	NA	NA
AXH01133.1|12760_13597_+|integrase	integrase	integrase	A0A1B1SGM4	Mycobacterium_phage	30.9	4.6e-17
AXH01134.1|14196_14313_+	sporulation protein YjcZ	NA	NA	NA	NA	NA
AXH00565.1|14304_14562_-	hypothetical protein	NA	NA	NA	NA	NA
AXH00566.1|14561_15272_-	PRTRC system protein B	NA	NA	NA	NA	NA
AXH00567.1|15306_16122_-	hypothetical protein	NA	NA	NA	NA	NA
AXH00568.1|16515_17328_-	PRTRC system ThiF family protein	NA	A0A1P8DIW3	Virus_Rctr197k	25.6	6.8e-05
AXH00569.1|17569_18118_-	hypothetical protein	NA	NA	NA	NA	NA
AXH01135.1|18191_18902_-|transposase	IS6 family transposase	transposase	A0A1X9I6E7	Streptococcus_phage	35.7	3.0e-25
18866:18925	attL	GCGGGAATCGATGTCGATAGGGCTTCCGGTCAGTCACAGCTCGGCAGCCTATCAGCGTTA	NA	NA	NA	NA
AXH00570.1|18871_19249_+	hypothetical protein	NA	NA	NA	NA	NA
AXH00571.1|19352_20603_+|transposase	IS4 family transposase	transposase	A0A218MNH3	uncultured_virus	28.3	6.1e-37
AXH00572.1|20745_23451_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
AXH00573.1|23962_24652_+|transposase	IS6 family transposase	transposase	A0A1X9I6E7	Streptococcus_phage	35.7	6.5e-25
AXH00574.1|24730_26092_-	hypothetical protein	NA	NA	NA	NA	NA
AXH00575.1|26622_27318_-	hypothetical protein	NA	NA	NA	NA	NA
AXH00576.1|27468_27669_-	hypothetical protein	NA	NA	NA	NA	NA
AXH00577.1|27665_28568_-	hypothetical protein	NA	A0A1B1INT4	uncultured_Mediterranean_phage	32.8	3.3e-16
AXH00578.1|28603_29362_-	hypothetical protein	NA	NA	NA	NA	NA
AXH00579.1|29360_29603_+	hypothetical protein	NA	NA	NA	NA	NA
AXH00580.1|29633_30299_-	hypothetical protein	NA	NA	NA	NA	NA
AXH00581.1|30392_30803_-	hypothetical protein	NA	NA	NA	NA	NA
AXH01136.1|30938_31145_-	hypothetical protein	NA	NA	NA	NA	NA
AXH00582.1|31198_32347_+|transposase	transposase	transposase	A0A0P0IJS6	Lactobacillus_phage	31.2	2.1e-20
AXH00583.1|32408_33506_-	hypothetical protein	NA	NA	NA	NA	NA
AXH00584.1|33564_34254_-|transposase	IS6 family transposase	transposase	A0A1X9I6E7	Streptococcus_phage	35.0	8.5e-25
AXH00585.1|34312_34600_+|transposase	transposase	transposase	NA	NA	NA	NA
AXH00586.1|34632_35481_+|integrase	integrase	integrase	S5WIU1	Leptospira_phage	25.3	4.9e-06
35503:35575	attR	GCGGGAATCGATGTCGATAGGGCTTCCGGTCAGTCACAGCTCGGCAGCCTATCAGCGTTAAGTTGCCAGAACC	NA	NA	NA	NA
>prophage 2
CP031163	Deinococcus wulumuqiensis strain NEB 479 plasmid pDrdI, complete sequence	668667	64006	98825	668667	transposase	Lactobacillus_phage(22.22%)	31	NA	NA
AXH00615.1|64006_65314_+|transposase	transposase	transposase	A0A0P0IJS6	Lactobacillus_phage	33.7	4.4e-46
AXH00616.1|65321_65732_-	hypothetical protein	NA	NA	NA	NA	NA
AXH01140.1|65730_66411_+	hypothetical protein	NA	NA	NA	NA	NA
AXH00617.1|66452_67169_+	hypothetical protein	NA	NA	NA	NA	NA
AXH01141.1|67292_68441_+|transposase	transposase	transposase	A0A068A1P5	Thermus_phage	49.2	6.9e-96
AXH00618.1|68455_68671_+	hypothetical protein	NA	NA	NA	NA	NA
AXH00619.1|68927_70541_+	hypothetical protein	NA	NA	NA	NA	NA
AXH00620.1|70749_71781_+	hypothetical protein	NA	NA	NA	NA	NA
AXH00621.1|71785_72022_+	hypothetical protein	NA	NA	NA	NA	NA
AXH01142.1|72322_73630_+|transposase	transposase	transposase	A0A0P0IJS6	Lactobacillus_phage	34.4	3.3e-46
AXH00622.1|73639_74137_+	hypothetical protein	NA	NA	NA	NA	NA
AXH01143.1|74872_75247_+	DUF1768 domain-containing protein	NA	V5Q9V2	Xylella_phage	44.2	9.0e-21
AXH00623.1|75791_76109_+	transcriptional regulator	NA	NA	NA	NA	NA
AXH00624.1|76162_77665_+	AAA family ATPase	NA	NA	NA	NA	NA
AXH00625.1|77696_78680_+	type II toxin-antitoxin system prevent-host-death family antitoxin	NA	A0A240F4U1	Ochrobactrum_phage	32.0	8.5e-10
AXH00626.1|78676_79579_+	ParB/RepB/Spo0J family partition protein	NA	A0A1C9EHW0	Gordonia_phage	38.1	3.3e-08
AXH00627.1|81787_82021_+	hypothetical protein	NA	NA	NA	NA	NA
AXH00628.1|82101_82812_+|transposase	IS6 family transposase	transposase	A0A1X9I6E7	Streptococcus_phage	35.7	3.9e-25
AXH00629.1|82815_83691_-	hypothetical protein	NA	NA	NA	NA	NA
AXH00630.1|83687_84335_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	41.7	1.1e-26
AXH00631.1|84331_84781_-	hypothetical protein	NA	NA	NA	NA	NA
AXH00632.1|84869_86615_-	alkaline phosphatase	NA	NA	NA	NA	NA
AXH00633.1|87862_89113_-|transposase	IS4 family transposase	transposase	A0A218MNH3	uncultured_virus	28.1	1.3e-36
AXH00634.1|89917_91267_-|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
AXH00635.1|91551_93438_-	hypothetical protein	NA	NA	NA	NA	NA
AXH00636.1|93589_94027_-	DUF4326 domain-containing protein	NA	NA	NA	NA	NA
AXH00637.1|94513_95812_-	pyruvate carboxyltransferase	NA	NA	NA	NA	NA
AXH00638.1|95880_97092_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
AXH00639.1|97094_97298_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AXH00640.1|97279_97561_-	hypothetical protein	NA	NA	NA	NA	NA
AXH00641.1|97700_98825_+|transposase	IS4/IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 3
CP031163	Deinococcus wulumuqiensis strain NEB 479 plasmid pDrdI, complete sequence	668667	167580	348664	668667	transposase,protease	Streptococcus_phage(17.65%)	147	NA	NA
AXH01147.1|167580_168597_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
AXH00706.1|168743_169274_+	hypothetical protein	NA	NA	NA	NA	NA
AXH00707.1|169459_171268_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	35.2	6.6e-77
AXH00708.1|171283_174535_-	nuclease	NA	NA	NA	NA	NA
AXH00709.1|174623_174812_-	hypothetical protein	NA	NA	NA	NA	NA
AXH00710.1|174971_175223_+	PqqD family protein	NA	NA	NA	NA	NA
AXH00711.1|175411_176128_+	hypothetical protein	NA	NA	NA	NA	NA
AXH01149.1|176105_177419_-	lasso peptide biosynthesis B2 protein	NA	NA	NA	NA	NA
AXH00712.1|177642_178353_+|transposase	IS6 family transposase	transposase	A0A1X9I6E7	Streptococcus_phage	35.7	3.0e-25
AXH00713.1|178409_181346_-	hypothetical protein	NA	NA	NA	NA	NA
AXH00714.1|181811_189176_+	hypothetical protein	NA	NA	NA	NA	NA
AXH00715.1|189328_191803_+	hypothetical protein	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	28.5	3.4e-39
AXH00716.1|191810_192917_+	DUF91 domain-containing protein	NA	NA	NA	NA	NA
AXH00717.1|192877_193492_-	hypothetical protein	NA	NA	NA	NA	NA
AXH00718.1|193556_195023_+	SAM-dependent DNA methyltransferase	NA	A0A2H4UVB0	Bodo_saltans_virus	32.5	2.9e-22
AXH00719.1|195019_195412_+	hypothetical protein	NA	NA	NA	NA	NA
AXH00720.1|196554_199860_-	carbamoyl-phosphate synthase large subunit	NA	NA	NA	NA	NA
AXH01150.1|199856_201596_-	acyl-CoA synthetase	NA	NA	NA	NA	NA
AXH00721.1|201807_202479_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AXH00722.1|203245_203431_-	hypothetical protein	NA	NA	NA	NA	NA
AXH00723.1|203775_204138_-	DNA-binding protein	NA	NA	NA	NA	NA
AXH00724.1|204289_204826_-	hypothetical protein	NA	NA	NA	NA	NA
AXH00725.1|206621_206918_-	hypothetical protein	NA	NA	NA	NA	NA
AXH00726.1|206944_207757_-|transposase	IS5-like element ISDra5 family transposase	transposase	NA	NA	NA	NA
AXH00727.1|207904_208054_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AXH00728.1|208244_210356_-	hypothetical protein	NA	B3GAM1	uncultured_virus	28.2	2.1e-29
AXH00729.1|210488_210944_+	hypothetical protein	NA	NA	NA	NA	NA
AXH01151.1|211218_212202_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
AXH00730.1|212650_213841_+	hypothetical protein	NA	NA	NA	NA	NA
AXH00731.1|215134_215761_-	DNA resolvase	NA	A0A219Y9V9	Aeromonas_phage	30.4	1.7e-08
AXH00732.1|215871_216342_-	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
AXH00733.1|216522_217287_+	SDR family NAD(P)-dependent oxidoreductase	NA	A0A0M4JSW6	Mollivirus	32.5	1.4e-07
AXH00734.1|217301_217913_+	pyridoxamine 5'-phosphate oxidase	NA	NA	NA	NA	NA
AXH00735.1|218088_221049_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	45.2	9.7e-235
AXH00736.1|221074_222286_-|transposase	IS4 family transposase	transposase	A0A218MNH3	uncultured_virus	28.9	1.0e-36
AXH00737.1|222761_224012_-|transposase	IS4 family transposase	transposase	A0A218MNH3	uncultured_virus	28.1	6.7e-36
AXH00738.1|224320_224638_+	hypothetical protein	NA	NA	NA	NA	NA
AXH00739.1|224648_226067_+	deoxyribodipyrimidine photolyase	NA	A0A1V0S949	Catovirus	30.4	9.6e-15
AXH00740.1|226105_227143_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
AXH00741.1|227139_227424_-	DUF3006 domain-containing protein	NA	NA	NA	NA	NA
AXH01152.1|227478_229476_-	DNA polymerase	NA	A0A2I6UGB2	Salinibacter_virus	33.3	5.1e-86
AXH00742.1|230252_232439_-	NERD domain protein	NA	NA	NA	NA	NA
AXH00743.1|232597_233905_+|transposase	transposase	transposase	A0A0P0IJS6	Lactobacillus_phage	34.4	2.6e-46
AXH01153.1|234081_235437_+	ATP-dependent helicase	NA	B2CRJ8	Acidianus_filamentous_virus	23.3	4.1e-15
AXH00744.1|235423_236653_+	DUF790 family protein	NA	NA	NA	NA	NA
AXH00745.1|237086_238037_-	carbohydrate kinase family protein	NA	NA	NA	NA	NA
AXH00746.1|238033_238864_-	PIG-L family deacetylase	NA	NA	NA	NA	NA
AXH00747.1|238863_239742_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
AXH00748.1|239738_240647_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
AXH00749.1|240739_241996_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
AXH00750.1|242020_244276_-	hypothetical protein	NA	NA	NA	NA	NA
AXH00751.1|244272_245682_-	argininosuccinate lyase	NA	NA	NA	NA	NA
AXH00752.1|245671_246688_-	ROK family transcriptional regulator	NA	NA	NA	NA	NA
AXH01154.1|247550_248318_-	N-acyl homoserine lactonase family protein	NA	NA	NA	NA	NA
AXH00753.1|248375_249656_-	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
AXH00754.1|249771_250449_-	response regulator	NA	NA	NA	NA	NA
AXH01155.1|250445_252080_-	sensor histidine kinase	NA	NA	NA	NA	NA
AXH00755.1|252260_253211_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
AXH00756.1|253281_253797_+	tripartite tricarboxylate transporter TctB family protein	NA	NA	NA	NA	NA
AXH00757.1|253796_255323_+	tripartite tricarboxylate transporter permease	NA	NA	NA	NA	NA
AXH00758.1|255635_256103_-	hypothetical protein	NA	NA	NA	NA	NA
AXH00759.1|256153_260398_+	DUF1998 domain-containing protein	NA	A0A1B1IUF6	uncultured_Mediterranean_phage	28.3	1.7e-06
AXH00760.1|260394_263886_+	ATP-dependent DNA helicase RecQ	NA	L7RCS0	Acanthamoeba_polyphaga_moumouvirus	26.8	1.2e-29
AXH00761.1|263882_265058_+	hypothetical protein	NA	NA	NA	NA	NA
AXH00762.1|265006_266515_+	HAD family hydrolase	NA	NA	NA	NA	NA
AXH00763.1|266906_267653_-	hypothetical protein	NA	NA	NA	NA	NA
AXH00764.1|267726_269016_-	plasmid replication initiator protein	NA	NA	NA	NA	NA
AXH00765.1|269725_270193_-	hypothetical protein	NA	NA	NA	NA	NA
AXH00766.1|270282_270531_-	hypothetical protein	NA	NA	NA	NA	NA
AXH00767.1|270527_271241_-	PRTRC system protein B	NA	NA	NA	NA	NA
AXH00768.1|271275_272298_-	hypothetical protein	NA	NA	NA	NA	NA
AXH00769.1|272512_273277_-	PRTRC system ThiF family protein	NA	NA	NA	NA	NA
AXH01156.1|273395_274550_-|transposase	transposase	transposase	A0A068A1P5	Thermus_phage	48.5	8.8e-91
AXH00770.1|274746_274983_+	hypothetical protein	NA	NA	NA	NA	NA
AXH00771.1|275190_275598_+	hypothetical protein	NA	NA	NA	NA	NA
AXH01157.1|275861_276281_+|transposase	IS200/IS605 family transposase	transposase	W0UUZ0	Sulfolobus_monocaudavirus	42.7	4.2e-27
AXH00772.1|276270_277425_+|transposase	transposase	transposase	A0A068A1P5	Thermus_phage	56.2	1.2e-111
AXH00773.1|277437_277791_-	hypothetical protein	NA	NA	NA	NA	NA
AXH00774.1|277765_278212_-	hypothetical protein	NA	NA	NA	NA	NA
AXH00775.1|278300_279161_+	hypothetical protein	NA	NA	NA	NA	NA
AXH00776.1|279157_280309_-|transposase	transposase	transposase	A0A068A1P5	Thermus_phage	53.7	1.9e-106
AXH00777.1|280298_280718_-|transposase	IS200/IS605 family transposase	transposase	W0UUZ0	Sulfolobus_monocaudavirus	41.2	6.1e-26
AXH01158.1|280870_281509_-	PRTRC system protein B	NA	NA	NA	NA	NA
AXH00778.1|281595_282714_-|transposase	transposase	transposase	A0A068A1P5	Thermus_phage	51.2	1.0e-96
AXH01159.1|282714_283113_-|transposase	IS200/IS605 family transposase	transposase	A0A1L2BWN1	Bacteriophage	54.4	2.2e-33
AXH00779.1|283204_284128_-	hypothetical protein	NA	NA	NA	NA	NA
AXH00780.1|284460_284667_-	PRTRC system protein C	NA	NA	NA	NA	NA
AXH00781.1|284706_284997_-	hypothetical protein	NA	NA	NA	NA	NA
AXH00782.1|285105_286374_-	hypothetical protein	NA	NA	NA	NA	NA
AXH00783.1|286483_286963_-	hypothetical protein	NA	NA	NA	NA	NA
AXH00784.1|287050_292207_-	methyltransferase type 11	NA	A0A291L9W0	Bordetella_phage	26.8	3.8e-101
AXH00785.1|292489_292738_+	hypothetical protein	NA	NA	NA	NA	NA
AXH00786.1|293198_293417_+	hypothetical protein	NA	NA	NA	NA	NA
AXH00787.1|295845_296556_+	hypothetical protein	NA	NA	NA	NA	NA
AXH00788.1|297987_298800_+|transposase	IS5-like element ISDra5 family transposase	transposase	NA	NA	NA	NA
AXH00789.1|298827_300126_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AXH00790.1|300344_301541_+|transposase	IS4/IS5 family transposase	transposase	NA	NA	NA	NA
AXH00791.1|301842_302367_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AXH00792.1|302488_302692_+	hypothetical protein	NA	NA	NA	NA	NA
AXH00793.1|302732_304031_-	divalent metal cation transporter	NA	NA	NA	NA	NA
AXH00794.1|304110_304800_+	metal-dependent transcriptional regulator	NA	NA	NA	NA	NA
AXH00795.1|304784_305129_-	hypothetical protein	NA	NA	NA	NA	NA
AXH00796.1|305183_305387_+	hypothetical protein	NA	NA	NA	NA	NA
AXH00797.1|305484_306837_+	acetamidase/formamidase family protein	NA	NA	NA	NA	NA
AXH00798.1|306989_308030_-	Zn-dependent exopeptidase M28	NA	NA	NA	NA	NA
AXH00799.1|308065_308263_-	hypothetical protein	NA	NA	NA	NA	NA
AXH00800.1|308262_308877_-	hypothetical protein	NA	NA	NA	NA	NA
AXH00801.1|308962_310027_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
AXH00802.1|310023_310311_-	DUF3006 domain-containing protein	NA	NA	NA	NA	NA
AXH00803.1|310335_310722_+	SH3 domain-containing protein	NA	NA	NA	NA	NA
AXH01160.1|310726_310951_-	hypothetical protein	NA	NA	NA	NA	NA
AXH00804.1|311224_312052_+	Hin recombinase	NA	NA	NA	NA	NA
AXH00805.1|312060_314145_-	hypothetical protein	NA	NA	NA	NA	NA
AXH00806.1|314165_315239_-	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
AXH00807.1|315177_315624_-	type II secretion system protein	NA	NA	NA	NA	NA
AXH00808.1|315613_316135_-	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
AXH00809.1|316412_317123_-|transposase	IS6 family transposase	transposase	A0A1X9I6E7	Streptococcus_phage	35.7	3.0e-25
AXH00810.1|317502_317949_+	DUF2384 domain-containing protein	NA	NA	NA	NA	NA
AXH00811.1|317945_318455_+	RES domain-containing protein	NA	NA	NA	NA	NA
AXH00812.1|319046_319757_+|transposase	IS6 family transposase	transposase	A0A1X9I6E7	Streptococcus_phage	35.7	3.0e-25
AXH01161.1|320525_321050_+	DUF305 domain-containing protein	NA	A0A218MND9	uncultured_virus	39.7	1.9e-16
AXH00813.1|321178_321949_+	LysM peptidoglycan-binding domain-containing protein	NA	V5R8R0	Arthrobacter_phage	53.5	1.1e-20
AXH00814.1|322186_322504_+	hypothetical protein	NA	NA	NA	NA	NA
AXH00815.1|322524_323235_+|transposase	IS6 family transposase	transposase	A0A1X9I6E7	Streptococcus_phage	35.7	3.9e-25
AXH00816.1|323930_324353_+	group III truncated hemoglobin	NA	NA	NA	NA	NA
AXH00817.1|324342_324636_+	cupin domain-containing protein	NA	NA	NA	NA	NA
AXH00818.1|324983_325658_+	hypothetical protein	NA	NA	NA	NA	NA
AXH00819.1|326077_327421_+	NarK/NasA family nitrate transporter	NA	NA	NA	NA	NA
AXH00820.1|327459_327639_+	hypothetical protein	NA	NA	NA	NA	NA
AXH01162.1|327644_328253_+	formylmethanofuran dehydrogenase	NA	NA	NA	NA	NA
AXH01163.1|328413_328974_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AXH00821.1|328970_330671_-	PAS sensor protein	NA	NA	NA	NA	NA
AXH00822.1|330792_332145_-	NarK/NasA family nitrate transporter	NA	NA	NA	NA	NA
AXH00823.1|332223_332565_-	hypothetical protein	NA	NA	NA	NA	NA
AXH00824.1|332561_333080_-	Rieske (2Fe-2S) protein	NA	NA	NA	NA	NA
AXH00825.1|333076_333727_-	4Fe-4S dicluster domain-containing protein	NA	NA	NA	NA	NA
AXH00826.1|333723_336045_-	nitrite reductase	NA	A0A077SK27	Escherichia_phage	25.5	1.5e-33
AXH00827.1|336044_337157_-	MFS transporter	NA	NA	NA	NA	NA
AXH00828.1|337149_337347_-	hypothetical protein	NA	NA	NA	NA	NA
AXH00829.1|337846_338116_+	hypothetical protein	NA	NA	NA	NA	NA
AXH00830.1|338199_339255_+|protease	PrsW family intramembrane metalloprotease	protease	NA	NA	NA	NA
AXH00831.1|339431_339647_+	DUF4177 domain-containing protein	NA	NA	NA	NA	NA
AXH00832.1|340465_341176_-|transposase	IS6 family transposase	transposase	A0A1X9I6E7	Streptococcus_phage	35.7	3.9e-25
AXH00833.1|341519_342230_+|transposase	IS6 family transposase	transposase	A0A1X9I6E7	Streptococcus_phage	35.7	3.9e-25
AXH01164.1|342495_343413_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A286N2U4	Arthrobacter_phage	37.2	4.1e-06
AXH00834.1|344456_345911_-	apolipoprotein N-acyltransferase	NA	NA	NA	NA	NA
AXH01165.1|345706_348664_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	26.1	2.8e-72
>prophage 4
CP031163	Deinococcus wulumuqiensis strain NEB 479 plasmid pDrdI, complete sequence	668667	359105	420052	668667	transposase	Streptococcus_phage(11.11%)	50	NA	NA
AXH00849.1|359105_359816_+|transposase	IS6 family transposase	transposase	A0A1X9I6E7	Streptococcus_phage	35.7	3.9e-25
AXH00850.1|359856_360069_-	hypothetical protein	NA	NA	NA	NA	NA
AXH00851.1|360142_361465_-	plasmid replication initiator protein	NA	NA	NA	NA	NA
AXH01167.1|361812_362028_-	hypothetical protein	NA	NA	NA	NA	NA
AXH00852.1|362068_363271_-	hypothetical protein	NA	NA	NA	NA	NA
AXH00853.1|363581_364529_-	hypothetical protein	NA	NA	NA	NA	NA
AXH00854.1|364528_364912_-	hypothetical protein	NA	NA	NA	NA	NA
AXH00855.1|364935_366738_-	hypothetical protein	NA	NA	NA	NA	NA
AXH00856.1|366730_367258_-	hypothetical protein	NA	NA	NA	NA	NA
AXH00857.1|367254_368895_-	ATP-dependent helicase	NA	A0A2H4GYC0	Pseudomonas_phage	29.1	2.7e-37
AXH00858.1|368881_369340_-	hypothetical protein	NA	NA	NA	NA	NA
AXH00859.1|369381_370095_-	PRTRC system protein B	NA	NA	NA	NA	NA
AXH00860.1|370130_371096_-	hypothetical protein	NA	NA	NA	NA	NA
AXH00861.1|371325_371556_-	PRTRC system protein C	NA	NA	NA	NA	NA
AXH00862.1|371593_372814_-	hypothetical protein	NA	NA	NA	NA	NA
AXH00863.1|373037_373445_-	hypothetical protein	NA	NA	NA	NA	NA
AXH00864.1|374322_374610_-|transposase	transposase	transposase	NA	NA	NA	NA
AXH00865.1|374939_375119_-	hypothetical protein	NA	NA	NA	NA	NA
AXH00866.1|375461_375953_-	DUF4158 domain-containing protein	NA	A0A1B0V7H9	Salmonella_phage	39.7	1.5e-15
AXH00867.1|376007_376628_+	DNA resolvase	NA	A0A219Y9V9	Aeromonas_phage	31.7	4.5e-09
AXH00868.1|376689_377187_+	GrpB family protein	NA	A0A2K5B2B6	Erysipelothrix_phage	28.8	4.9e-06
AXH00869.1|378109_378688_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
AXH00870.1|380309_380759_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AXH00871.1|380817_383445_-	hypothetical protein	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	28.1	3.7e-36
AXH00872.1|383441_390797_-	hypothetical protein	NA	NA	NA	NA	NA
AXH00873.1|391567_392632_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
AXH00874.1|393083_400010_-	RHS repeat protein	NA	NA	NA	NA	NA
AXH00875.1|400142_401270_+	hypothetical protein	NA	NA	NA	NA	NA
AXH00876.1|401296_403273_+	hypothetical protein	NA	A0A1B0T6A2	Bacillus_phage	31.8	1.1e-21
AXH00877.1|403269_404460_+	type II secretion system protein GspD	NA	NA	NA	NA	NA
AXH00878.1|404480_404906_+	hypothetical protein	NA	NA	NA	NA	NA
AXH00879.1|404943_405441_-	hypothetical protein	NA	NA	NA	NA	NA
AXH00880.1|405616_406051_-	response regulator	NA	NA	NA	NA	NA
AXH01168.1|406142_406514_-	hypothetical protein	NA	NA	NA	NA	NA
AXH01169.1|406930_407275_-	DNA-binding protein	NA	NA	NA	NA	NA
AXH00881.1|407849_408161_-	hypothetical protein	NA	NA	NA	NA	NA
AXH00882.1|408137_408599_+	hypothetical protein	NA	NA	NA	NA	NA
AXH00883.1|408647_409541_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AXH00884.1|409615_410023_+	VOC family protein	NA	NA	NA	NA	NA
AXH00885.1|410041_410620_-	zf-CGNR multi-domain protein	NA	NA	NA	NA	NA
AXH00886.1|410653_411868_+	MFS transporter	NA	NA	NA	NA	NA
AXH00887.1|412064_413224_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	47.7	1.7e-57
AXH00888.1|413301_413577_+	hypothetical protein	NA	NA	NA	NA	NA
AXH00889.1|413640_414816_+	hypothetical protein	NA	NA	NA	NA	NA
AXH00890.1|415183_416533_+|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
AXH00891.1|416698_417622_+	hypothetical protein	NA	NA	NA	NA	NA
AXH00892.1|417794_418439_+	hypothetical protein	NA	NA	NA	NA	NA
AXH00893.1|418557_418929_-	hypothetical protein	NA	NA	NA	NA	NA
AXH00894.1|418986_419340_+	hypothetical protein	NA	NA	NA	NA	NA
AXH00895.1|419352_420052_+|transposase	IS1 family transposase	transposase	A0A077SLN4	Escherichia_phage	36.9	6.0e-26
>prophage 5
CP031163	Deinococcus wulumuqiensis strain NEB 479 plasmid pDrdI, complete sequence	668667	423301	477576	668667	integrase,transposase	Shigella_phage(10.0%)	55	424479:424500	442798:442819
AXH01170.1|423301_423628_-|transposase	transposase	transposase	NA	NA	NA	NA
424479:424500	attL	TGAAGTTGTCACCTACTGAGGG	NA	NA	NA	NA
AXH00899.1|424996_427318_+	hypothetical protein	NA	NA	NA	NA	NA
AXH00900.1|427452_427749_+	hypothetical protein	NA	NA	NA	NA	NA
AXH00901.1|428057_428552_+	hypothetical protein	NA	NA	NA	NA	NA
AXH00902.1|428576_430316_+	Sir2-like deacetylase	NA	NA	NA	NA	NA
AXH00903.1|430929_431256_+	hypothetical protein	NA	NA	NA	NA	NA
AXH00904.1|431290_431563_+	hypothetical protein	NA	NA	NA	NA	NA
AXH00905.1|431696_432080_+	hypothetical protein	NA	NA	NA	NA	NA
AXH01171.1|432868_433138_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A088CBP5	Shigella_phage	41.7	1.3e-05
AXH00906.1|433134_433428_+	Fis family transcriptional regulator	NA	NA	NA	NA	NA
AXH00907.1|433560_433959_+	hypothetical protein	NA	NA	NA	NA	NA
AXH00908.1|434015_434489_+	DUF2247 family protein	NA	NA	NA	NA	NA
AXH00909.1|434682_435237_-|integrase	site-specific integrase	integrase	A0A1B0T6A8	Bacillus_phage	33.7	6.4e-23
AXH01172.1|435384_436368_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
AXH00910.1|436578_439983_-	hypothetical protein	NA	M1I4J8	Acanthocystis_turfacea_Chlorella_virus	20.7	5.5e-08
AXH00911.1|439967_440843_-	hypothetical protein	NA	NA	NA	NA	NA
AXH00912.1|440950_441661_+|transposase	IS6 family transposase	transposase	NA	NA	NA	NA
AXH00913.1|442236_442785_-	hypothetical protein	NA	NA	NA	NA	NA
AXH01173.1|443020_444004_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
442798:442819	attR	CCCTCAGTAGGTGACAACTTCA	NA	NA	NA	NA
AXH00914.1|444217_445465_+	DUF4062 domain-containing protein	NA	NA	NA	NA	NA
AXH00915.1|446866_447727_+	hypothetical protein	NA	NA	NA	NA	NA
AXH00916.1|448114_449008_-	hypothetical protein	NA	S5VKI3	Leptospira_phage	29.8	1.2e-26
AXH00917.1|449112_449328_-	hypothetical protein	NA	NA	NA	NA	NA
AXH00918.1|449491_450325_-	hypothetical protein	NA	NA	NA	NA	NA
AXH00919.1|450321_451215_-	ABC transporter ATP-binding protein	NA	A7K9T9	Acanthocystis_turfacea_chlorella_virus	31.6	1.5e-05
AXH00920.1|451211_451646_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AXH00921.1|451784_452360_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AXH00922.1|452583_457800_-	methyltransferase type 11	NA	A0A291L9W0	Bordetella_phage	27.7	1.8e-106
AXH00923.1|457846_458074_-	hypothetical protein	NA	NA	NA	NA	NA
AXH00924.1|458132_458684_-	hypothetical protein	NA	NA	NA	NA	NA
AXH00925.1|458743_459115_-	hypothetical protein	NA	NA	NA	NA	NA
AXH00926.1|459111_459465_-	hypothetical protein	NA	NA	NA	NA	NA
AXH00927.1|459510_460266_-|transposase	transposase	transposase	A0A068A1P5	Thermus_phage	40.2	5.6e-38
AXH00928.1|460471_460681_-	DUF1472 domain-containing protein	NA	NA	NA	NA	NA
AXH00929.1|461061_461652_+	hypothetical protein	NA	NA	NA	NA	NA
AXH00930.1|462436_463633_-|transposase	transposase	transposase	NA	NA	NA	NA
AXH00931.1|464280_464511_-	hypothetical protein	NA	NA	NA	NA	NA
AXH00932.1|464545_465265_-	hypothetical protein	NA	NA	NA	NA	NA
AXH00933.1|465334_465751_-	hypothetical protein	NA	NA	NA	NA	NA
AXH00934.1|465798_466920_-	hypothetical protein	NA	NA	NA	NA	NA
AXH01174.1|466963_468322_-	VWA domain-containing protein	NA	NA	NA	NA	NA
AXH00935.1|468532_469441_-	ParB/RepB/Spo0J family partition protein	NA	A0A2K9V477	Faecalibacterium_phage	29.9	4.0e-06
AXH00936.1|469440_470208_-	hypothetical protein	NA	A0A0N7E4H5	Mycobacterium_phage	34.8	4.3e-17
AXH00937.1|470296_471103_-	hypothetical protein	NA	NA	NA	NA	NA
AXH00938.1|471235_471430_+	hypothetical protein	NA	NA	NA	NA	NA
AXH00939.1|471448_471820_-	hypothetical protein	NA	NA	NA	NA	NA
AXH00940.1|471855_472107_-	hypothetical protein	NA	NA	NA	NA	NA
AXH00941.1|472249_472462_-	hypothetical protein	NA	NA	NA	NA	NA
AXH00942.1|472458_473496_-	DUF1768 domain-containing protein	NA	V5Q9V2	Xylella_phage	47.9	7.5e-25
AXH00943.1|473576_474080_-	hypothetical protein	NA	NA	NA	NA	NA
AXH00944.1|474308_474575_-	hypothetical protein	NA	NA	NA	NA	NA
AXH00945.1|474574_475387_-	hypothetical protein	NA	NA	NA	NA	NA
AXH00946.1|475480_475870_-|transposase	transposase	transposase	NA	NA	NA	NA
AXH01175.1|475888_476872_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
AXH00947.1|477204_477576_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 6
CP031163	Deinococcus wulumuqiensis strain NEB 479 plasmid pDrdI, complete sequence	668667	490219	587294	668667	integrase,transposase	Streptococcus_phage(22.22%)	107	527676:527735	585679:585855
AXH01178.1|490219_491236_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
AXH01179.1|491161_491422_+	hypothetical protein	NA	NA	NA	NA	NA
AXH00963.1|491741_492053_+	hypothetical protein	NA	NA	NA	NA	NA
AXH00964.1|492504_493740_-	hypothetical protein	NA	NA	NA	NA	NA
AXH00965.1|494067_494511_-	hypothetical protein	NA	NA	NA	NA	NA
AXH00966.1|494529_495126_-	hypothetical protein	NA	NA	NA	NA	NA
AXH00967.1|495194_495638_-	hypothetical protein	NA	NA	NA	NA	NA
AXH00968.1|495673_496195_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AXH00969.1|496391_496898_-	hypothetical protein	NA	NA	NA	NA	NA
AXH00970.1|496931_497474_-	HNH endonuclease	NA	NA	NA	NA	NA
AXH00971.1|497394_498561_-|transposase	transposase	transposase	A0A068A1P5	Thermus_phage	45.2	1.4e-83
AXH00972.1|498796_498994_-	hypothetical protein	NA	NA	NA	NA	NA
AXH00973.1|499104_499527_-	hypothetical protein	NA	NA	NA	NA	NA
AXH00974.1|499567_499858_-	hypothetical protein	NA	NA	NA	NA	NA
AXH00975.1|499844_500993_-|transposase	transposase	transposase	A0A068A1P5	Thermus_phage	42.4	5.0e-78
AXH01180.1|500993_501392_-|transposase	IS200/IS605 family transposase	transposase	G9CU69	Helicobacter_phage	62.7	2.5e-45
AXH00976.1|501507_501696_-	hypothetical protein	NA	NA	NA	NA	NA
AXH00977.1|501685_501922_-	hypothetical protein	NA	NA	NA	NA	NA
AXH00978.1|502017_502746_-	hypothetical protein	NA	NA	NA	NA	NA
AXH00979.1|502799_503483_-	hypothetical protein	NA	NA	NA	NA	NA
AXH00980.1|503516_503966_-	hypothetical protein	NA	NA	NA	NA	NA
AXH00981.1|503967_504318_-	hypothetical protein	NA	NA	NA	NA	NA
AXH00982.1|504314_504662_-	hypothetical protein	NA	NA	NA	NA	NA
AXH00983.1|504654_504903_-	hypothetical protein	NA	NA	NA	NA	NA
AXH00984.1|505152_505425_-	hypothetical protein	NA	NA	NA	NA	NA
AXH00985.1|505624_507547_-	hypothetical protein	NA	NA	NA	NA	NA
AXH00986.1|507658_508219_-	hypothetical protein	NA	NA	NA	NA	NA
AXH00987.1|508320_508755_-	DUF4326 domain-containing protein	NA	NA	NA	NA	NA
AXH00988.1|508972_509365_-	hypothetical protein	NA	NA	NA	NA	NA
AXH00989.1|509401_509728_-	hypothetical protein	NA	NA	NA	NA	NA
AXH00990.1|509815_510175_-	hypothetical protein	NA	NA	NA	NA	NA
AXH00991.1|510304_511012_-	hypothetical protein	NA	NA	NA	NA	NA
AXH00992.1|511170_511437_-	hypothetical protein	NA	NA	NA	NA	NA
AXH00993.1|511683_512154_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AXH00994.1|512416_512638_-	hypothetical protein	NA	NA	NA	NA	NA
AXH00995.1|513516_513702_-	hypothetical protein	NA	NA	NA	NA	NA
AXH00996.1|513885_514167_-	hypothetical protein	NA	NA	NA	NA	NA
AXH00997.1|514203_514470_-	hypothetical protein	NA	NA	NA	NA	NA
AXH00998.1|514512_514716_-	hypothetical protein	NA	NA	NA	NA	NA
AXH00999.1|514761_515256_-	hypothetical protein	NA	NA	NA	NA	NA
AXH01000.1|515338_515704_-	hypothetical protein	NA	NA	NA	NA	NA
AXH01001.1|515797_516211_-	hypothetical protein	NA	NA	NA	NA	NA
AXH01002.1|516244_516703_-	hypothetical protein	NA	NA	NA	NA	NA
AXH01003.1|516760_517117_+	hypothetical protein	NA	NA	NA	NA	NA
AXH01181.1|517091_517277_-	hypothetical protein	NA	NA	NA	NA	NA
AXH01004.1|517387_518098_-|transposase	IS6 family transposase	transposase	A0A1X9I6E7	Streptococcus_phage	36.3	3.9e-25
AXH01005.1|518298_520338_-	type II/IV secretion system protein	NA	NA	NA	NA	NA
AXH01006.1|520349_520901_-	hypothetical protein	NA	NA	NA	NA	NA
AXH01007.1|520946_521540_+	HD domain-containing protein	NA	NA	NA	NA	NA
AXH01008.1|521427_521970_-	hydrolase	NA	NA	NA	NA	NA
AXH01009.1|521956_522541_-	hypothetical protein	NA	NA	NA	NA	NA
AXH01010.1|522616_523807_-	hypothetical protein	NA	NA	NA	NA	NA
AXH01011.1|524086_524779_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AXH01012.1|524881_525814_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
AXH01013.1|525864_526629_-	SDR family NAD(P)-dependent oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	24.6	1.2e-08
AXH01014.1|526641_527565_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
527676:527735	attL	GGTTCTGGCAACTTAACGCTGATAGGCTGCCGAGCTGTGACTGACCGGAAGCCCTATCGA	NA	NA	NA	NA
AXH01015.1|527908_528619_-|transposase	IS6 family transposase	transposase	A0A1X9I6E7	Streptococcus_phage	35.2	1.5e-24
AXH01182.1|529009_529795_+	trehalose-phosphatase	NA	NA	NA	NA	NA
AXH01016.1|529821_530097_+	hypothetical protein	NA	NA	NA	NA	NA
AXH01017.1|530097_531066_+	GGDEF domain-containing protein	NA	NA	NA	NA	NA
AXH01183.1|531195_532179_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
AXH01018.1|532524_532704_-	hypothetical protein	NA	NA	NA	NA	NA
AXH01019.1|532651_533302_-	PIN domain-containing protein	NA	K4HZX4	Acidithiobacillus_phage	49.2	8.5e-43
AXH01020.1|533298_533697_-	helix-turn-helix domain-containing protein	NA	K4ICM4	Acidithiobacillus_phage	48.9	1.4e-16
AXH01021.1|533804_534749_+|integrase	site-specific integrase	integrase	A0A166YH27	Gordonia_phage	28.7	1.1e-11
AXH01022.1|535710_535896_-	hypothetical protein	NA	NA	NA	NA	NA
AXH01023.1|535977_536394_-	type II secretion system protein	NA	NA	NA	NA	NA
AXH01024.1|536414_537107_-	hypothetical protein	NA	A0A0K2FLP8	Brevibacillus_phage	28.5	3.4e-13
AXH01025.1|537093_538260_-|transposase	transposase	transposase	A0A068A1P5	Thermus_phage	43.5	9.8e-82
AXH01026.1|538183_539719_-	hypothetical protein	NA	A0A1P8DII4	Virus_Rctr197k	37.3	2.7e-23
AXH01027.1|539715_539982_-	hypothetical protein	NA	NA	NA	NA	NA
AXH01028.1|540281_541106_+	hypothetical protein	NA	NA	NA	NA	NA
AXH01029.1|541425_542877_+	ATP-binding protein	NA	NA	NA	NA	NA
AXH01030.1|543005_544202_-|transposase	transposase	transposase	NA	NA	NA	NA
AXH01184.1|544269_544866_-	formylmethanofuran dehydrogenase	NA	NA	NA	NA	NA
AXH01031.1|545747_546977_-	NarK/NasA family nitrate transporter	NA	NA	NA	NA	NA
AXH01032.1|547048_549181_-	molybdopterin oxidoreductase	NA	NA	NA	NA	NA
AXH01185.1|549415_551974_+	nitrite reductase large subunit	NA	NA	NA	NA	NA
AXH01033.1|551933_552374_+	nitrite reductase (NAD(P)H) small subunit	NA	NA	NA	NA	NA
AXH01034.1|552352_553177_+	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
AXH01035.1|553307_554120_+|transposase	IS5-like element ISDra5 family transposase	transposase	NA	NA	NA	NA
AXH01186.1|554405_555389_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
AXH01036.1|555520_556558_+|transposase	transposase	transposase	NA	NA	NA	NA
AXH01037.1|556736_557447_-|transposase	IS6 family transposase	transposase	A0A1X9I6E7	Streptococcus_phage	35.7	1.5e-24
AXH01038.1|557595_558762_-	sulfate adenylyltransferase	NA	A0A2P1ELS9	Moumouvirus	29.5	1.4e-40
AXH01039.1|558923_559703_-	phosphoadenylyl-sulfate reductase	NA	NA	NA	NA	NA
AXH01040.1|559692_560214_-	adenylyl-sulfate kinase	NA	A0A2K9L4R9	Tupanvirus	45.9	5.6e-29
AXH01041.1|560288_561854_-	nitrite/sulfite reductase	NA	NA	NA	NA	NA
AXH01042.1|561955_563401_+	cobalamin biosynthesis protein CbiX	NA	NA	NA	NA	NA
AXH01043.1|563393_564905_+	uroporphyrinogen-III C-methyltransferase	NA	NA	NA	NA	NA
AXH01187.1|565094_566516_-	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
AXH01044.1|567139_568336_-	divalent metal cation transporter	NA	NA	NA	NA	NA
AXH01045.1|568553_569765_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
AXH01046.1|569884_571105_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
AXH01047.1|571330_572887_-	hypothetical protein	NA	NA	NA	NA	NA
AXH01048.1|572879_573710_-	LamB/YcsF family protein	NA	NA	NA	NA	NA
AXH01049.1|574258_575905_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	40.9	7.3e-14
AXH01050.1|576082_576547_-	redox-sensitive transcriptional activator SoxR	NA	NA	NA	NA	NA
AXH01051.1|576757_577063_+	hypothetical protein	NA	NA	NA	NA	NA
AXH01052.1|577096_578494_+	MFS transporter	NA	NA	NA	NA	NA
AXH01053.1|581832_583503_-	phospholipase	NA	NA	NA	NA	NA
AXH01054.1|583577_584006_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AXH01055.1|583977_584130_-	hypothetical protein	NA	NA	NA	NA	NA
AXH01056.1|584289_584895_+	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
AXH01057.1|584991_585702_-|transposase	IS6 family transposase	transposase	A0A1X9I6E7	Streptococcus_phage	35.7	3.0e-25
AXH01058.1|585722_585848_-	hypothetical protein	NA	NA	NA	NA	NA
AXH01059.1|586043_587294_-|transposase	IS4 family transposase	transposase	A0A218MNH3	uncultured_virus	28.6	2.1e-37
585679:585855	attR	TCGATAGGGCTTCCGGTCAGTCACAGCTCGGCAGCCTATCAGCGTTAAGTTGCCAGAACCCCTGAAGCACTCTCGGTGTACGTCTTCTGGACTCCAGCCCCTTCCAGGGCCTTCAACTGGAGGGTGGTATCCTGGTCTCCCTTACTGACACGTGCGTAACCAATGAGCATGGGTCAG	NA	NA	NA	NA
>prophage 7
CP031163	Deinococcus wulumuqiensis strain NEB 479 plasmid pDrdI, complete sequence	668667	598937	661863	668667	integrase,transposase	Bacillus_phage(16.0%)	58	639554:639573	664010:664029
AXH01071.1|598937_600053_-	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	29.1	4.6e-28
AXH01072.1|600056_600722_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	41.6	4.3e-42
AXH01073.1|600793_601483_-	DUF305 domain-containing protein	NA	A0A218MND9	uncultured_virus	38.4	2.3e-14
AXH01074.1|601479_602007_-	hypothetical protein	NA	NA	NA	NA	NA
AXH01075.1|602272_603523_-|transposase	IS4 family transposase	transposase	A0A218MNH3	uncultured_virus	28.1	3.9e-36
AXH01076.1|603626_603869_+	MazF family transcriptional regulator	NA	NA	NA	NA	NA
AXH01077.1|603861_604242_+	type II toxin-antitoxin system death-on-curing family toxin	NA	A0A222YZ88	Escherichia_phage	37.9	3.5e-12
AXH01078.1|604496_605369_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	31.5	5.0e-22
AXH01079.1|605774_606569_+	ABC transporter permease	NA	NA	NA	NA	NA
AXH01080.1|606601_607891_-|transposase	transposase	transposase	A0A0P0IJS6	Lactobacillus_phage	32.7	9.3e-41
AXH01189.1|608159_609137_+	sensor histidine kinase	NA	NA	NA	NA	NA
AXH01081.1|609133_609736_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AXH01082.1|609919_610477_+	recombinase family protein	NA	M9Q1K0	Clostridium_phage	43.4	6.0e-29
AXH01083.1|610506_611154_-	DNA-binding protein	NA	K4ICM4	Acidithiobacillus_phage	39.4	4.5e-12
AXH01084.1|611195_611618_+	DNA-binding protein	NA	K4ICM4	Acidithiobacillus_phage	46.3	2.3e-12
AXH01085.1|611614_612121_+	PIN domain-containing protein	NA	K4HZX4	Acidithiobacillus_phage	45.3	1.3e-27
AXH01086.1|612141_612852_+|transposase	IS6 family transposase	transposase	A0A1X9I6E7	Streptococcus_phage	35.7	6.7e-25
AXH01087.1|613253_613715_+	arsenate reductase ArsC	NA	A0A2H4PQT9	Staphylococcus_phage	37.2	5.9e-14
AXH01088.1|613714_615016_+	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	66.0	4.4e-155
AXH01089.1|615063_615378_+	transcriptional regulator	NA	NA	NA	NA	NA
AXH01090.1|615432_618939_+	response regulator	NA	W8CYF6	Bacillus_phage	27.2	4.2e-19
AXH01091.1|619076_619787_-|transposase	IS6 family transposase	transposase	A0A1X9I6E7	Streptococcus_phage	35.2	2.6e-24
AXH01092.1|619807_620488_-	hypothetical protein	NA	NA	NA	NA	NA
AXH01093.1|620488_621613_-|transposase	IS4/IS5 family transposase	transposase	NA	NA	NA	NA
AXH01094.1|621899_622232_-	type II toxin-antitoxin system PemK/MazF family toxin	NA	A9D9Y1	Lactobacillus_prophage	34.3	8.6e-07
AXH01095.1|622231_622489_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
AXH01096.1|622626_623097_-	DUF4326 domain-containing protein	NA	NA	NA	NA	NA
AXH01097.1|623276_623714_-	DUF1768 domain-containing protein	NA	V5Q9V2	Xylella_phage	49.6	3.4e-27
AXH01098.1|623810_624131_-	hypothetical protein	NA	NA	NA	NA	NA
AXH01099.1|624229_624658_-	hypothetical protein	NA	NA	NA	NA	NA
AXH01100.1|624733_625297_-	cell filamentation protein Fic	NA	NA	NA	NA	NA
AXH01101.1|625277_625469_-	hypothetical protein	NA	NA	NA	NA	NA
AXH01102.1|625593_626304_-|transposase	IS6 family transposase	transposase	A0A1X9I6E7	Streptococcus_phage	35.7	8.8e-25
AXH01103.1|626444_626705_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
AXH01104.1|626705_627098_+	PIN domain-containing protein	NA	NA	NA	NA	NA
AXH01105.1|627416_628133_+	hypothetical protein	NA	A0A2H4N819	Lake_Baikal_phage	27.5	2.2e-07
AXH01106.1|628333_629503_+|transposase	transposase	transposase	A0A068A1P5	Thermus_phage	43.2	9.9e-82
AXH01107.1|630094_631078_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
AXH01108.1|631726_632125_-	DNA-binding protein	NA	NA	NA	NA	NA
AXH01109.1|632181_633282_+	sensor histidine kinase KdpD	NA	NA	NA	NA	NA
AXH01110.1|633510_633930_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
AXH01190.1|633997_635464_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
AXH01111.1|635641_636436_+	TlpA family protein disulfide reductase	NA	NA	NA	NA	NA
AXH01112.1|636476_637280_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	28.4	6.7e-13
639554:639573	attL	GGCTTCTCAGACCACGGCAT	NA	NA	NA	NA
AXH01113.1|639559_640726_-|transposase	transposase	transposase	A0A068A1P5	Thermus_phage	45.2	1.4e-83
AXH01114.1|641374_642322_+	1-phosphofructokinase	NA	NA	NA	NA	NA
AXH01115.1|642379_644173_+	PTS fructose-like transporter subunit IIB	NA	NA	NA	NA	NA
AXH01116.1|644922_646296_+	hypothetical protein	NA	NA	NA	NA	NA
AXH01117.1|646787_647648_-	hypothetical protein	NA	NA	NA	NA	NA
AXH01191.1|648328_649312_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
AXH01118.1|649825_650110_-	Txe/YoeB family addiction module toxin	NA	NA	NA	NA	NA
AXH01119.1|650096_650369_-	type II toxin-antitoxin system prevent-host-death family antitoxin	NA	NA	NA	NA	NA
AXH01192.1|651730_652906_-	hypothetical protein	NA	NA	NA	NA	NA
AXH01193.1|653021_653501_-	fasciclin domain-containing protein	NA	NA	NA	NA	NA
AXH01120.1|654236_655433_+|transposase	transposase	transposase	NA	NA	NA	NA
AXH01121.1|656935_657784_-|integrase	integrase	integrase	S5WIU1	Leptospira_phage	25.3	4.9e-06
AXH01122.1|657816_658104_-|transposase	transposase	transposase	NA	NA	NA	NA
AXH01123.1|658848_661863_+|transposase	Tn3 family transposase	transposase	A0A125RQ78	Bacillus_phage	43.6	1.7e-239
664010:664029	attR	GGCTTCTCAGACCACGGCAT	NA	NA	NA	NA
>prophage 1
CP031162	Deinococcus wulumuqiensis strain NEB 479 plasmid pDrdIV, complete sequence	31268	0	16086	31268		Streptococcus_phage(22.22%)	15	NA	NA
AXH00527.1|1570_1951_-	transcriptional regulator	NA	E4ZFI8	Streptococcus_phage	36.0	1.7e-11
AXH00555.1|1947_2202_-	glutaredoxin family protein	NA	G3MBF0	Bacillus_virus	38.0	3.2e-06
AXH00528.1|2252_2882_-	cation transporter	NA	NA	NA	NA	NA
AXH00529.1|3000_5385_-	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	40.3	8.0e-131
AXH00530.1|5416_5968_-	signal peptidase II	NA	NA	NA	NA	NA
AXH00531.1|6200_6761_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	77.5	4.3e-43
AXH00532.1|7011_7383_-	HNH endonuclease	NA	A0A2I7QIM4	Bacillus_phage	54.5	4.0e-05
AXH00533.1|7763_8363_-	ParA family protein	NA	NA	NA	NA	NA
AXH00534.1|8434_9016_-	PIN domain-containing protein	NA	K4HZX4	Acidithiobacillus_phage	43.9	3.0e-23
AXH00535.1|9011_9434_-	helix-turn-helix domain-containing protein	NA	K4ICM4	Acidithiobacillus_phage	36.0	2.9e-15
AXH00536.1|9681_10245_-	hypothetical protein	NA	NA	NA	NA	NA
AXH00537.1|10363_13798_-	class I SAM-dependent DNA methyltransferase	NA	Q6NE04	Leptospira_phage	22.0	1.6e-26
AXH00538.1|13934_14132_-	hypothetical protein	NA	NA	NA	NA	NA
AXH00539.1|15519_15729_+	hypothetical protein	NA	NA	NA	NA	NA
AXH00540.1|15873_16086_-	KTSC domain-containing protein	NA	A0A0K1LMB5	Caulobacter_phage	49.3	8.1e-11
>prophage 2
CP031162	Deinococcus wulumuqiensis strain NEB 479 plasmid pDrdIV, complete sequence	31268	22688	23417	31268		Escherichia_phage(100.0%)	1	NA	NA
AXH00549.1|22688_23417_+	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	45.4	2.7e-37
