The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP031145	Intrasporangium calvum strain C5 chromosome, complete genome	4025044	76984	140060	4025044	transposase,integrase	Mycobacterium_phage(18.18%)	57	133387:133404	145129:145146
AXG12100.1|76984_78844_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
AXG12101.1|78904_80629_+	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AXG12102.1|80625_81639_-	hypothetical protein	NA	NA	NA	NA	NA
AXG12103.1|81733_82561_-	hypothetical protein	NA	NA	NA	NA	NA
AXG12104.1|82536_83358_-	hypothetical protein	NA	NA	NA	NA	NA
AXG12105.1|83483_83876_+	hypothetical protein	NA	NA	NA	NA	NA
AXG12106.1|83899_85567_+	cell division protein FtsK	NA	NA	NA	NA	NA
AXG12107.1|85569_85857_+	hypothetical protein	NA	NA	NA	NA	NA
AXG12108.1|87472_87673_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AXG12109.1|87672_88812_+|integrase	site-specific integrase	integrase	A0A1D8EW73	Mycobacterium_phage	36.6	2.8e-49
AXG12110.1|89517_90606_+	hypothetical protein	NA	NA	NA	NA	NA
AXG12111.1|90527_91106_+	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	66.3	1.5e-70
AXG12112.1|91129_91831_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
AXG15162.1|91990_93109_+	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	31.3	1.4e-21
AXG12113.1|93105_93753_+	ABC transporter permease	NA	NA	NA	NA	NA
AXG12114.1|93749_94535_+	ABC transporter permease	NA	NA	NA	NA	NA
AXG12115.1|94537_95461_+	glycine/betaine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AXG12116.1|95569_97120_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	34.2	1.7e-36
AXG12117.1|97184_97949_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
AXG15163.1|97978_99286_+	cytochrome P450	NA	NA	NA	NA	NA
AXG12118.1|99343_100366_+	hypothetical protein	NA	NA	NA	NA	NA
AXG12119.1|100359_100896_+	WD40 repeat domain-containing protein	NA	NA	NA	NA	NA
AXG12120.1|101089_101278_-	hypothetical protein	NA	NA	NA	NA	NA
AXG12121.1|101395_102115_-	hypothetical protein	NA	NA	NA	NA	NA
AXG12122.1|102226_103489_-	transcriptional regulator	NA	NA	NA	NA	NA
AXG12123.1|103648_105172_+	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
AXG12124.1|105176_105635_+	DUF779 domain-containing protein	NA	NA	NA	NA	NA
AXG12125.1|105849_106647_-	slipin family protein	NA	A0A1V0SB59	Catovirus	26.7	4.3e-12
AXG12126.1|106652_107333_-	hypothetical protein	NA	NA	NA	NA	NA
AXG12127.1|107341_109651_-	nitric-oxide reductase large subunit	NA	NA	NA	NA	NA
AXG12128.1|109860_110541_-	hypothetical protein	NA	NA	NA	NA	NA
AXG12129.1|110554_111358_-	hypothetical protein	NA	NA	NA	NA	NA
AXG12130.1|111367_112090_-	hypothetical protein	NA	NA	NA	NA	NA
AXG12131.1|112173_114537_-	(Fe-S)-binding protein	NA	NA	NA	NA	NA
AXG12132.1|114775_115705_+	cysteine synthase A	NA	A0A1X9I5K7	Streptococcus_phage	53.1	2.9e-84
AXG12133.1|115720_116431_+	serine O-acetyltransferase	NA	NA	NA	NA	NA
AXG15164.1|116902_117841_+	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	31.8	1.5e-16
AXG12134.1|118066_118270_+	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	63.9	1.8e-15
AXG12135.1|118366_119926_-	LytR family transcriptional regulator	NA	NA	NA	NA	NA
AXG12136.1|120018_121584_-	LytR family transcriptional regulator	NA	NA	NA	NA	NA
AXG12137.1|121952_122450_-	hypothetical protein	NA	NA	NA	NA	NA
AXG15165.1|122589_124410_-	phosphoenolpyruvate carboxykinase (GTP)	NA	NA	NA	NA	NA
AXG15166.1|125112_126261_-|integrase	site-specific integrase	integrase	A0A1B0T6A8	Bacillus_phage	32.3	4.2e-45
AXG12138.1|126272_126464_-	DNA-binding protein	NA	NA	NA	NA	NA
AXG15167.1|126479_128036_-	replication initiation protein	NA	NA	NA	NA	NA
AXG12139.1|128062_128347_-	hypothetical protein	NA	NA	NA	NA	NA
AXG15168.1|128350_129538_-	cell division protein FtsK	NA	NA	NA	NA	NA
AXG12140.1|130020_130413_-	hypothetical protein	NA	NA	NA	NA	NA
AXG12141.1|130551_131397_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AXG12142.1|131348_132065_+	HAD family hydrolase	NA	NA	NA	NA	NA
AXG12143.1|132055_133429_-	hypothetical protein	NA	NA	NA	NA	NA
133387:133404	attL	GGCCCTCACCGCGGTCGC	NA	NA	NA	NA
AXG12144.1|133984_134209_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AXG12145.1|134205_135264_+	hypothetical protein	NA	NA	NA	NA	NA
AXG15169.1|135266_136955_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
AXG12146.1|137514_137736_+	DNA-binding protein	NA	NA	NA	NA	NA
AXG12147.1|137725_138925_+|integrase	site-specific integrase	integrase	A0A059VKS6	Mycobacterium_phage	31.1	3.6e-39
AXG12148.1|138986_140060_+|integrase	integrase	integrase	A0A166YH27	Gordonia_phage	32.1	9.6e-07
145129:145146	attR	GGCCCTCACCGCGGTCGC	NA	NA	NA	NA
>prophage 2
CP031145	Intrasporangium calvum strain C5 chromosome, complete genome	4025044	300473	350964	4025044	protease,holin,transposase,integrase	Mycobacterium_phage(42.86%)	51	310686:310730	323723:323767
AXG12272.1|300473_302024_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	34.2	1.7e-36
AXG12273.1|302151_303276_+	YbdK family carboxylate-amine ligase	NA	NA	NA	NA	NA
AXG12274.1|303278_303530_+	hypothetical protein	NA	NA	NA	NA	NA
AXG12275.1|303597_303969_-	hypothetical protein	NA	A0A2D1GP18	Streptomyces_phage	53.3	6.4e-19
AXG12276.1|304217_305066_+	RNA polymerase subunit sigma-28	NA	U5Q0I1	Bacillus_phage	29.4	2.9e-14
AXG15182.1|305971_306358_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AXG12277.1|306659_306947_+	DUF1905 domain-containing protein	NA	NA	NA	NA	NA
AXG12278.1|307040_308153_-	AI-2E family transporter	NA	NA	NA	NA	NA
AXG12279.1|308174_309671_-	phospholipase	NA	NA	NA	NA	NA
310686:310730	attL	GTCGGGGTGACAGGATTTGAACCTGCGACCTCTTCGTCCCGAACG	NA	NA	NA	NA
AXG12280.1|311264_311792_+	hypothetical protein	NA	NA	NA	NA	NA
AXG12281.1|312065_313925_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
AXG15183.1|314197_314839_+	HAD family hydrolase	NA	NA	NA	NA	NA
AXG12282.1|315142_315679_-	hypothetical protein	NA	A0A068F3M6	Mycobacterium_phage	36.4	4.7e-23
AXG12283.1|315683_316112_-	hypothetical protein	NA	NA	NA	NA	NA
AXG12284.1|316257_316914_-	2'-5' RNA ligase family protein	NA	NA	NA	NA	NA
AXG12285.1|316910_317687_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AXG12286.1|317818_318253_+	plasmid replication, integration and excision activator	NA	NA	NA	NA	NA
AXG12287.1|318252_318690_+	hypothetical protein	NA	NA	NA	NA	NA
AXG12288.1|318689_320291_+	cell division protein FtsK	NA	NA	NA	NA	NA
AXG15184.1|320383_320680_+	WhiB family transcriptional regulator	NA	NA	NA	NA	NA
AXG15185.1|321421_321607_-	methyl-CpG-binding protein	NA	NA	NA	NA	NA
AXG12289.1|322251_322482_+	DNA-binding protein	NA	NA	NA	NA	NA
AXG12290.1|322478_323639_+|integrase	site-specific integrase	integrase	G1FGD4	Mycobacterium_phage	30.7	1.2e-31
AXG15186.1|323985_324918_-	metallophosphoesterase	NA	NA	NA	NA	NA
323723:323767	attR	GTCGGGGTGACAGGATTTGAACCTGCGACCTCTTCGTCCCGAACG	NA	NA	NA	NA
AXG12291.1|324994_325450_+	GatB/YqeY domain-containing protein	NA	NA	NA	NA	NA
AXG12292.1|325537_327961_-	PASTA domain-containing protein	NA	NA	NA	NA	NA
AXG12293.1|328229_328535_+	WhiB family transcriptional regulator	NA	A0A2L0HJX8	Mycobacterium_phage	45.7	1.8e-11
AXG12294.1|328614_329835_-	ArsA family ATPase	NA	NA	NA	NA	NA
AXG12295.1|329831_330875_-	ATPase	NA	NA	NA	NA	NA
AXG12296.1|331063_331585_+	hypothetical protein	NA	NA	NA	NA	NA
AXG12297.1|331548_331983_+	hypothetical protein	NA	NA	NA	NA	NA
AXG12298.1|332656_332815_+	DUF4177 domain-containing protein	NA	NA	NA	NA	NA
AXG12299.1|332817_333288_+	RidA family protein	NA	NA	NA	NA	NA
AXG12300.1|333292_334126_+	NUDIX domain-containing protein	NA	NA	NA	NA	NA
AXG15187.1|334252_335011_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
AXG12301.1|335120_335798_-	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
AXG12302.1|335987_336695_+	endonuclease III	NA	NA	NA	NA	NA
AXG12303.1|336691_337438_+	CoA pyrophosphatase	NA	NA	NA	NA	NA
AXG12304.1|337434_338637_+|protease	serine protease	protease	NA	NA	NA	NA
AXG12305.1|338788_339181_-	universal stress protein	NA	NA	NA	NA	NA
AXG12306.1|339177_340701_-	tripartite tricarboxylate transporter permease	NA	NA	NA	NA	NA
AXG12307.1|340700_341228_-	tripartite tricarboxylate transporter TctB family protein	NA	NA	NA	NA	NA
AXG12308.1|341230_342271_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
AXG12309.1|342352_344035_+	GHKL domain-containing protein	NA	NA	NA	NA	NA
AXG12310.1|344031_344706_+	response regulator	NA	NA	NA	NA	NA
AXG12311.1|344884_346120_+	peptidase S8	NA	A0A2K9L570	Tupanvirus	42.1	6.6e-44
AXG15188.1|346178_346949_-	serine hydrolase	NA	NA	NA	NA	NA
AXG12312.1|347020_347932_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
AXG12313.1|347953_348472_-|holin	phage holin family protein	holin	NA	NA	NA	NA
AXG12314.1|348703_349192_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
AXG12315.1|349326_350964_-|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
>prophage 3
CP031145	Intrasporangium calvum strain C5 chromosome, complete genome	4025044	3601990	3647519	4025044	protease,holin,transposase,integrase	Gordonia_phage(16.67%)	49	3601078:3601096	3607677:3607695
3601078:3601096	attL	GCTCGCGGCGATGTGACGC	NA	NA	NA	NA
AXG15506.1|3601990_3603280_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AXG14807.1|3603349_3603814_-	cupin domain-containing protein	NA	NA	NA	NA	NA
AXG14808.1|3603951_3604230_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
AXG14809.1|3604226_3604493_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
AXG14810.1|3604663_3605578_-|integrase	integrase	integrase	A0A2K9VH72	Gordonia_phage	37.8	1.1e-40
AXG14811.1|3605782_3606187_+	NUDIX domain-containing protein	NA	NA	NA	NA	NA
AXG14812.1|3606288_3606954_-	DUF429 domain-containing protein	NA	NA	NA	NA	NA
AXG14813.1|3607365_3607590_-	hypothetical protein	NA	NA	NA	NA	NA
AXG14814.1|3607765_3608389_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
3607677:3607695	attR	GCTCGCGGCGATGTGACGC	NA	NA	NA	NA
AXG14815.1|3609011_3609443_+	hypothetical protein	NA	NA	NA	NA	NA
AXG14816.1|3609502_3610351_-	AAA family ATPase	NA	U5N3V8	Enterobacteria_phage	39.4	1.0e-40
AXG14817.1|3610390_3611755_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
AXG14818.1|3611840_3612485_+	hypothetical protein	NA	NA	NA	NA	NA
AXG15507.1|3612649_3613186_-	N-acetyltransferase	NA	NA	NA	NA	NA
AXG14819.1|3613292_3613535_-	toxin	NA	NA	NA	NA	NA
AXG14820.1|3613531_3613780_-	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
AXG15508.1|3614796_3615420_-	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
AXG14821.1|3615431_3616517_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
AXG15509.1|3616513_3617032_-	hypothetical protein	NA	NA	NA	NA	NA
AXG14822.1|3617057_3618134_-	type III polyketide synthase	NA	NA	NA	NA	NA
AXG14823.1|3618194_3619007_+	hypothetical protein	NA	NA	NA	NA	NA
AXG14824.1|3619045_3621355_+	ATP-dependent DNA ligase	NA	NA	NA	NA	NA
AXG15510.1|3621553_3622330_-	inositol monophosphatase	NA	NA	NA	NA	NA
AXG14825.1|3622552_3623185_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AXG14826.1|3623285_3624464_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
AXG15511.1|3624555_3624891_+	antitoxin	NA	NA	NA	NA	NA
AXG14827.1|3626034_3627276_-	PucR family transcriptional regulator	NA	NA	NA	NA	NA
AXG15512.1|3627663_3629049_-	GTPase	NA	NA	NA	NA	NA
AXG14828.1|3629238_3630453_+	ornithine--oxo-acid transaminase	NA	A0A1V0SKB7	Klosneuvirus	26.0	6.5e-20
AXG14829.1|3631079_3632159_+	NYN domain-containing protein	NA	NA	NA	NA	NA
AXG14830.1|3632193_3635043_-	cation-translocating P-type ATPase	NA	M1HX51	Paramecium_bursaria_Chlorella_virus	27.0	4.3e-70
AXG14831.1|3635039_3635726_-	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AXG14832.1|3635792_3636110_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
AXG14833.1|3636297_3636972_-	phosphodiesterase	NA	NA	NA	NA	NA
AXG14834.1|3637125_3637389_+	transcriptional regulator	NA	NA	NA	NA	NA
AXG14835.1|3637415_3637787_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
AXG14836.1|3637907_3638126_+	DUF2510 domain-containing protein	NA	NA	NA	NA	NA
AXG14837.1|3638225_3638636_+	PRC-barrel domain containing protein	NA	NA	NA	NA	NA
AXG14838.1|3638986_3639607_+	hypothetical protein	NA	NA	NA	NA	NA
AXG14839.1|3639733_3640996_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
AXG14840.1|3641024_3641765_-|protease	serine protease	protease	B4UTS4	Rhizobium_phage	28.5	2.3e-07
AXG14841.1|3641766_3642345_-	hypothetical protein	NA	NA	NA	NA	NA
AXG14842.1|3642436_3643444_+	hypothetical protein	NA	NA	NA	NA	NA
AXG15513.1|3643463_3643988_-	2'-5' RNA ligase family protein	NA	NA	NA	NA	NA
AXG14843.1|3644069_3644279_+	hypothetical protein	NA	NA	NA	NA	NA
AXG14844.1|3644405_3645914_+	long-chain fatty acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	30.7	3.0e-38
AXG14845.1|3646123_3646438_+	hypothetical protein	NA	NA	NA	NA	NA
AXG14846.1|3646344_3647079_+	hypothetical protein	NA	NA	NA	NA	NA
AXG14847.1|3647075_3647519_+|holin	phage holin family protein	holin	NA	NA	NA	NA
