The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP031104	Enterobacteriaceae bacterium w6 chromosome, complete genome	4945486	7848	14550	4945486		Salmonella_phage(87.5%)	10	NA	NA
AXF58069.1|7848_8103_-	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	70.2	1.5e-27
AXF58070.1|10650_10956_+	hypothetical protein	NA	NA	NA	NA	NA
AXF58071.1|10986_11841_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	70.1	2.7e-105
AXF58072.1|11837_12065_-	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	62.7	3.0e-19
AXF58073.1|12064_12301_-	DUF2732 domain-containing protein	NA	E5G6L6	Salmonella_phage	52.7	7.4e-13
AXF58074.1|12368_12569_-	hypothetical protein	NA	A0A0M5M7U3	Salmonella_phage	66.7	1.8e-20
AXF58075.1|12555_12777_-	DUF2724 domain-containing protein	NA	A0A0M4RTI3	Salmonella_phage	70.0	1.0e-19
AXF58076.1|12784_13294_-	hypothetical protein	NA	A0A1S6L008	Salmonella_phage	72.8	1.2e-63
AXF58077.1|13329_13554_-	hypothetical protein	NA	NA	NA	NA	NA
AXF58078.1|13683_14550_+	phage repressor protein CI	NA	A0A0M4RE65	Salmonella_phage	34.5	2.5e-45
>prophage 2
CP031104	Enterobacteriaceae bacterium w6 chromosome, complete genome	4945486	133135	162446	4945486	integrase,tail,terminase	Salmonella_phage(33.33%)	38	121452:121467	151864:151879
121452:121467	attL	GAAGAGGTCGACGAAG	NA	NA	NA	NA
AXF58173.1|133135_134389_+|integrase	site-specific integrase	integrase	A0A0F6TJM5	Escherichia_coli_O157_typing_phage	87.3	4.1e-211
AXF58174.1|134389_134776_-	chromosome partitioning protein ParB	NA	S4TTI6	Salmonella_phage	70.9	9.5e-50
AXF58175.1|134772_135486_-	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	88.7	1.6e-111
AXF58176.1|135491_136244_-	hypothetical protein	NA	M1FN76	Enterobacteria_phage	84.0	1.1e-126
AXF58177.1|136240_136399_-	DUF1317 family protein	NA	T1SAR0	Salmonella_phage	76.9	4.8e-16
AXF58178.1|136391_136691_-	PerC family transcriptional regulator	NA	A0A2R9YJK3	Escherichia_phage	74.7	9.3e-37
AXF58179.1|136800_137049_-	AlpA family phage regulatory protein	NA	T1SA17	Salmonella_phage	81.7	4.0e-33
AXF58180.1|137097_138120_-	recombination protein RecT	NA	Q858E1	Salmonella_phage	95.3	8.9e-180
AXF58181.1|138129_139029_-	endonuclease	NA	Q858E0	Salmonella_phage	87.3	2.9e-150
AXF62450.1|139025_139310_-	hypothetical protein	NA	A0A193GZ81	Enterobacter_phage	63.4	4.1e-26
AXF58182.1|139627_140212_-	XRE family transcriptional regulator	NA	A0A0F6R8L7	Escherichia_coli_O157_typing_phage	77.7	9.9e-83
AXF58183.1|140366_140597_+	hypothetical protein	NA	G9L6A7	Escherichia_phage	77.6	1.6e-28
AXF58184.1|140746_140947_+	hypothetical protein	NA	A0A0F6TJB7	Escherichia_coli_O157_typing_phage	72.7	1.6e-21
AXF58185.1|140962_141733_+	primosomal protein	NA	Q286X4	Escherichia_phage	74.2	1.8e-87
AXF58186.1|141729_142515_+	replication protein	NA	A0A193GYX1	Enterobacter_phage	90.0	1.2e-139
AXF58187.1|142633_143101_+	hypothetical protein	NA	A0A193GYM2	Enterobacter_phage	87.6	3.3e-73
AXF58188.1|143208_143412_+	hypothetical protein	NA	R9TRD3	Aeromonas_phage	77.0	5.7e-22
AXF58189.1|143408_143723_+	ead/Ea22-like family protein	NA	NA	NA	NA	NA
AXF58190.1|143727_143997_+	hypothetical protein	NA	A0A0A6Z584	Enterobacter_phage	51.2	1.2e-11
AXF58191.1|143993_144725_+	DUF551 domain-containing protein	NA	K7P6H7	Enterobacteria_phage	58.7	3.9e-36
AXF58192.1|145117_145345_+	hypothetical protein	NA	NA	NA	NA	NA
AXF58193.1|145337_145676_+	hypothetical protein	NA	A0A193GYX4	Enterobacter_phage	83.9	7.8e-48
AXF58194.1|145753_146083_+	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	57.7	2.0e-24
AXF58195.1|146142_146742_+|terminase	terminase small subunit	terminase	A0A193GYG6	Enterobacter_phage	81.4	2.3e-82
AXF58196.1|149268_149688_-	hypothetical protein	NA	A0A2H4ZJ80	Enterobacter_phage	80.8	1.2e-16
AXF58197.1|150554_150761_+	hypothetical protein	NA	T1SA67	Salmonella_phage	98.5	1.3e-08
AXF58198.1|150775_152446_+|tail	phage tail protein	tail	T1S9Z7	Salmonella_phage	91.4	4.7e-295
151864:151879	attR	CTTCGTCGACCTCTTC	NA	NA	NA	NA
AXF58199.1|152442_152739_+	hypothetical protein	NA	T1SBI9	Salmonella_phage	77.6	1.9e-37
AXF58200.1|152741_153443_+	peptidase	NA	G9L6C4	Escherichia_phage	88.4	2.7e-79
AXF58201.1|153456_154443_+	hypothetical protein	NA	G9L6C5	Escherichia_phage	85.4	1.1e-163
AXF58202.1|154496_154937_+	hypothetical protein	NA	A0A193GYT9	Enterobacter_phage	89.0	7.0e-65
AXF58203.1|154947_155292_+	hypothetical protein	NA	G9L6C7	Escherichia_phage	73.7	5.7e-38
AXF58204.1|155344_155668_+	hypothetical protein	NA	A0A193GYH8	Enterobacter_phage	69.2	8.5e-36
AXF58205.1|155667_156273_+	hypothetical protein	NA	Q858G4	Salmonella_phage	89.1	7.8e-99
AXF58206.1|156272_158750_+	hypothetical protein	NA	Q858G3	Salmonella_phage	90.3	0.0e+00
AXF58207.1|158749_159214_+	hypothetical protein	NA	T1SA73	Salmonella_phage	83.8	1.9e-73
AXF58208.1|159213_159780_+	hypothetical protein	NA	A0A0F6TJ56	Escherichia_coli_O157_typing_phage	69.3	1.4e-57
AXF58209.1|159779_162446_+	Lytic transglycosylase, catalytic	NA	T1SBJ1	Salmonella_phage	44.5	2.7e-42
>prophage 3
CP031104	Enterobacteriaceae bacterium w6 chromosome, complete genome	4945486	761273	785315	4945486	integrase,transposase	Enterobacteria_phage(27.27%)	29	763451:763478	783364:783391
AXF58722.1|761273_761504_-	DNA polymerase III subunit theta	NA	G8C7V1	Escherichia_phage	66.2	5.3e-16
AXF58723.1|761640_762006_+	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
AXF58724.1|762007_762880_+	hypothetical protein	NA	NA	NA	NA	NA
AXF58725.1|762894_763233_+	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
763451:763478	attL	ACAGGAATCGTATTCGGTCTCTTTTTAT	NA	NA	NA	NA
AXF58726.1|763553_764639_-|integrase	integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	67.6	1.2e-145
AXF58727.1|764607_764880_-	excisionase	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	62.2	2.7e-27
AXF58728.1|764944_765184_-	DUF4060 family protein	NA	M9P0E0	Enterobacteria_phage	85.7	2.1e-31
AXF58729.1|765170_765878_-	hypothetical protein	NA	M1F3E2	Salmonella_phage	46.2	1.5e-40
AXF58730.1|765912_767028_-	enterohemolysin	NA	K7PKR8	Enterobacteria_phage	91.1	8.8e-189
AXF58731.1|767039_770756_-	exodeoxyribonuclease	NA	K7P6V4	Enterobacteria_phage	55.1	0.0e+00
AXF58732.1|771362_771776_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AXF58733.1|771890_772121_+	hypothetical protein	NA	H6WRX5	Salmonella_phage	44.0	1.4e-11
AXF58734.1|772123_772681_+	hypothetical protein	NA	K7P7P2	Enterobacteria_phage	39.9	3.0e-20
AXF58735.1|772765_773689_+	hypothetical protein	NA	K7PGZ0	Enterobacteria_phage	71.0	2.8e-108
AXF58736.1|773672_774362_+	phage replication protein	NA	G8C7U6	Escherichia_phage	60.7	2.7e-79
AXF58737.1|774374_774638_+	DUF977 family protein	NA	H6WRX9	Salmonella_phage	68.8	1.5e-25
AXF58738.1|774630_775257_+	hypothetical protein	NA	F1C5B6	Cronobacter_phage	52.7	4.3e-07
AXF58739.1|775256_775514_+	hypothetical protein	NA	NA	NA	NA	NA
AXF58740.1|775510_777388_+	DNA cytosine methyltransferase	NA	H9C171	Pectobacterium_phage	50.6	3.0e-189
AXF58741.1|778222_778822_+	DUF1367 family protein	NA	A0A0M4QX23	Salmonella_phage	86.8	2.5e-97
AXF62482.1|778821_779028_+	hypothetical protein	NA	S4TNP0	Salmonella_phage	64.7	9.3e-20
AXF58742.1|779030_779663_+	hypothetical protein	NA	H6WRY9	Salmonella_phage	46.7	1.3e-43
AXF58743.1|779659_779848_+	hypothetical protein	NA	NA	NA	NA	NA
AXF58744.1|779963_780653_+	antiterminator	NA	I6PDF8	Cronobacter_phage	56.7	1.1e-67
AXF58745.1|780965_782086_-|transposase	IS3-like element ISSen4 family transposase	transposase	S5WIU1	Leptospira_phage	42.8	1.7e-51
AXF58746.1|782488_782728_+	DNA polymerase V	NA	I6PD82	Cronobacter_phage	58.2	1.5e-21
AXF58747.1|782729_783047_+	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	52.9	1.3e-23
AXF62483.1|783545_784412_-	DUF535 domain-containing protein	NA	NA	NA	NA	NA
783364:783391	attR	ACAGGAATCGTATTCGGTCTCTTTTTAT	NA	NA	NA	NA
AXF58748.1|784670_785315_+	protein-serine/threonine phosphatase	NA	M9P0E4	Enterobacteria_phage	48.4	1.5e-55
>prophage 4
CP031104	Enterobacteriaceae bacterium w6 chromosome, complete genome	4945486	1394981	1464941	4945486	coat,tail,lysis,transposase,terminase	Escherichia_phage(33.93%)	72	NA	NA
AXF59265.1|1394981_1396102_-|transposase	IS3-like element ISSen4 family transposase	transposase	S5WIU1	Leptospira_phage	42.8	1.7e-51
AXF59266.1|1396172_1397306_+	acyltransferase	NA	NA	NA	NA	NA
AXF62511.1|1397866_1399912_-	peptidyl-dipeptidase Dcp	NA	A0A1V0SIU1	Klosneuvirus	25.6	2.5e-19
AXF59267.1|1400065_1400812_+	bifunctional NADP-dependent 3-hydroxy acid dehydrogenase/3-hydroxypropionate dehydrogenase YdfG	NA	NA	NA	NA	NA
AXF59268.1|1400903_1401590_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AXF59269.1|1401629_1403090_-	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	32.7	8.6e-43
AXF59270.1|1403318_1404863_-	MFS transporter	NA	NA	NA	NA	NA
AXF59271.1|1404990_1406286_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	26.5	7.7e-27
AXF59272.1|1406613_1407312_-	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	68.1	1.4e-88
AXF59273.1|1407397_1407718_+	transcriptional regulator	NA	A0A2H4J145	uncultured_Caudovirales_phage	45.7	5.9e-21
AXF59274.1|1407762_1409052_+	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	71.8	4.4e-168
AXF59275.1|1409064_1409490_+	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	71.4	7.3e-51
AXF59276.1|1412729_1417664_-	DUF1983 domain-containing protein	NA	G8C7R4	Escherichia_phage	41.2	4.1e-12
AXF59277.1|1417718_1418312_-|tail	tail assembly protein	tail	G8C7R3	Escherichia_phage	87.5	3.8e-90
AXF59278.1|1418299_1419031_-	peptidase P60	NA	G8C7R2	Escherichia_phage	92.1	3.7e-143
AXF59279.1|1419043_1419817_-|tail	phage minor tail protein L	tail	G8C7R1	Escherichia_phage	87.1	1.8e-132
AXF59280.1|1419813_1420164_-	hypothetical protein	NA	G8C7R0	Escherichia_phage	93.1	1.1e-55
AXF59281.1|1420479_1420755_+	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
AXF59282.1|1421261_1421654_-	hypothetical protein	NA	NA	NA	NA	NA
AXF59283.1|1424902_1425190_-	hypothetical protein	NA	I6PD79	Cronobacter_phage	66.2	2.2e-19
AXF59284.1|1425207_1425546_-	hypothetical protein	NA	G8C7Q5	Escherichia_phage	84.8	4.1e-49
AXF59285.1|1425586_1426519_-|tail	phage tail protein	tail	G8C7Q3	Escherichia_phage	91.3	5.3e-155
AXF59286.1|1426565_1427015_-	hypothetical protein	NA	G8C7Q2	Escherichia_phage	92.6	6.5e-74
AXF59287.1|1427004_1427604_-	hypothetical protein	NA	G8C7Q1	Escherichia_phage	88.4	1.3e-98
AXF59288.1|1427606_1427960_-	hypothetical protein	NA	G8C7Q0	Escherichia_phage	91.5	4.5e-54
AXF59289.1|1427961_1428444_-	hypothetical protein	NA	G8C7P9	Escherichia_phage	84.4	3.9e-77
AXF59290.1|1428446_1428680_-	hypothetical protein	NA	G8C7P8	Escherichia_phage	71.4	1.6e-20
AXF59291.1|1428719_1429856_-|coat	P22 coat - protein 5 family protein	coat	G8C7P7	Escherichia_phage	95.0	2.5e-199
AXF59292.1|1429875_1430628_-	hypothetical protein	NA	G8C7P6	Escherichia_phage	82.0	3.0e-108
AXF59293.1|1430752_1431856_-	hypothetical protein	NA	G8C7P5	Escherichia_phage	91.3	6.0e-190
AXF59294.1|1431857_1433261_-	DUF4055 domain-containing protein	NA	G8C7P4	Escherichia_phage	89.9	3.5e-243
AXF59295.1|1433264_1434569_-|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	60.8	1.6e-149
AXF59296.1|1434546_1435533_-|terminase	terminase small subunit	terminase	A0A0U2RXW9	Escherichia_phage	36.9	1.9e-30
AXF59297.1|1435742_1435943_+	glycogen synthesis protein GlgS	NA	NA	NA	NA	NA
AXF59298.1|1436098_1436464_-	hypothetical protein	NA	R9TPM9	Aeromonas_phage	45.3	6.1e-14
AXF59299.1|1436453_1436957_-	lysozyme	NA	A0A2H4JCH1	uncultured_Caudovirales_phage	76.0	1.5e-74
AXF59300.1|1436958_1437198_-|lysis	lysis protein	lysis	A0A2H4JCI1	uncultured_Caudovirales_phage	59.2	1.3e-17
AXF59301.1|1437722_1438046_-	four-helix bundle copper-binding protein	NA	NA	NA	NA	NA
AXF59302.1|1438207_1438393_-	hypothetical protein	NA	NA	NA	NA	NA
AXF59303.1|1439328_1440111_-	antitermination protein	NA	K7PKS8	Enterobacteria_phage	72.8	1.7e-106
AXF59304.1|1440107_1440248_-	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	73.7	6.1e-07
AXF59305.1|1440244_1440850_-	recombination protein NinG	NA	A0A1P8DTE0	Proteus_phage	65.3	3.4e-54
AXF59306.1|1440852_1441053_-	hypothetical protein	NA	S4TNP0	Salmonella_phage	53.0	2.2e-13
AXF59307.1|1441057_1441657_-	DUF1367 family protein	NA	A0A0M4QX23	Salmonella_phage	84.1	4.4e-94
AXF59308.1|1441691_1441931_-	hypothetical protein	NA	K7PHG9	Enterobacteria_phage	54.2	1.6e-15
AXF59309.1|1443274_1443760_+	hypothetical protein	NA	NA	NA	NA	NA
AXF59310.1|1443797_1443977_-	hypothetical protein	NA	G8C7V1	Escherichia_phage	72.7	6.4e-09
AXF59311.1|1443969_1444377_-	Insecticidal toxin complex protein tccz	NA	NA	NA	NA	NA
AXF59312.1|1444376_1444781_-	hypothetical protein	NA	H6WRY2	Salmonella_phage	56.5	1.8e-14
AXF59313.1|1444777_1445362_-	hypothetical protein	NA	F1C5B6	Cronobacter_phage	34.7	2.7e-11
AXF59314.1|1445358_1445670_-	hypothetical protein	NA	NA	NA	NA	NA
AXF59315.1|1445659_1446436_-	DNA replication protein DnaC	NA	S4TNF5	Salmonella_phage	79.1	2.2e-109
AXF59316.1|1446438_1447422_-	hypothetical protein	NA	H6WRX7	Salmonella_phage	81.6	1.3e-127
AXF59317.1|1447500_1448055_-	hypothetical protein	NA	K7P7P2	Enterobacteria_phage	42.5	3.8e-23
AXF59318.1|1448066_1448285_-	Rha family transcriptional regulator	NA	A0A0M4QX15	Salmonella_phage	62.0	9.8e-20
AXF59319.1|1448384_1448777_+	helix-turn-helix domain-containing protein	NA	K7PM35	Enterobacteria_phage	62.3	4.1e-40
AXF59320.1|1449008_1450128_+|transposase	IS3-like element ISSen4 family transposase	transposase	S5WIU1	Leptospira_phage	42.8	1.7e-51
AXF59321.1|1450125_1450941_+	DUF3037 domain-containing protein	NA	NA	NA	NA	NA
AXF59322.1|1451395_1451602_+	cell division inhibitor protein	NA	K7PM31	Enterobacteria_phage	85.3	1.4e-28
AXF59323.1|1451914_1455193_+	exodeoxyribonuclease	NA	K7P6V4	Enterobacteria_phage	61.0	0.0e+00
AXF62512.1|1455207_1456251_+	enterohemolysin	NA	K7P7N5	Enterobacteria_phage	69.3	2.7e-139
AXF59324.1|1456285_1456933_+	hypothetical protein	NA	M1F3E2	Salmonella_phage	51.4	5.9e-52
AXF59325.1|1456919_1457159_+	DUF4060 family protein	NA	M9P0E0	Enterobacteria_phage	85.9	2.1e-31
AXF59326.1|1457258_1457510_+	DNA-binding protein	NA	Q859D3	Escherichia_coli_phage	41.0	2.1e-13
AXF59327.1|1457542_1458826_+	DUF3596 domain-containing protein	NA	Q8W658	Enterobacteria_phage	59.5	1.3e-154
AXF59328.1|1459013_1460030_-	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	27.2	2.3e-18
AXF59329.1|1460041_1461256_-	D-galactonate dehydratase family protein	NA	Q6A202	Oenococcus_phage	30.0	7.4e-48
AXF59330.1|1461365_1461692_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	54.5	9.3e-22
AXF59331.1|1461841_1462171_+	DUF1283 family protein	NA	NA	NA	NA	NA
AXF59332.1|1462209_1462920_-	YnfC family lipoprotein	NA	NA	NA	NA	NA
AXF59333.1|1463025_1463331_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
AXF59334.1|1463480_1464941_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	50.5	6.5e-123
>prophage 5
CP031104	Enterobacteriaceae bacterium w6 chromosome, complete genome	4945486	1751924	1807237	4945486	protease,tRNA,tail,lysis,integrase,transposase,terminase	Enterobacteria_phage(27.78%)	62	1761767:1761782	1814331:1814346
AXF59603.1|1751924_1753045_-|transposase	IS3-like element ISSen4 family transposase	transposase	S5WIU1	Leptospira_phage	42.8	1.7e-51
AXF59604.1|1753278_1753905_+	NUDIX domain-containing protein	NA	NA	NA	NA	NA
AXF62526.1|1755192_1756482_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
AXF59605.1|1756651_1759615_-|tail	tail fiber domain-containing protein	tail	A0A0A0YPY9	Escherichia_phage	28.3	1.2e-51
AXF59606.1|1759667_1762757_-	kinase	NA	A0A286S259	Klebsiella_phage	51.9	5.6e-302
1761767:1761782	attL	TGGCGATAAACAGATC	NA	NA	NA	NA
AXF59607.1|1762753_1763134_-	nitrite transporter	NA	A0A286S2A6	Klebsiella_phage	74.6	2.0e-52
AXF59608.1|1763341_1763896_-	hypothetical protein	NA	NA	NA	NA	NA
AXF59609.1|1763951_1764440_-	DUF1833 domain-containing protein	NA	A0A286S2B1	Klebsiella_phage	70.1	9.2e-58
AXF59610.1|1764436_1764898_-	hypothetical protein	NA	A0A286S298	Klebsiella_phage	56.0	2.8e-48
AXF59611.1|1764897_1767591_-|tail	phage tail tape measure protein	tail	K7PKR0	Enterobacteria_phage	64.1	3.0e-227
AXF59612.1|1767571_1767880_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	50.5	5.1e-22
AXF59613.1|1767888_1768305_-|tail	phage minor tail protein G	tail	M9NZD7	Enterobacteria_phage	49.3	1.9e-24
AXF59614.1|1768345_1769083_-|tail	phage tail protein	tail	M9NYX0	Enterobacteria_phage	71.8	6.2e-98
AXF59615.1|1769090_1769489_-|tail	phage tail protein	tail	K7PHM6	Enterobacterial_phage	64.3	1.6e-44
AXF59616.1|1769485_1770040_-|tail	phage tail protein	tail	K7PKQ5	Enterobacteria_phage	64.0	4.6e-45
AXF59617.1|1770050_1770326_-	ATP-binding protein	NA	NA	NA	NA	NA
AXF59618.1|1770318_1770642_-	DUF2190 family protein	NA	NA	NA	NA	NA
AXF59619.1|1770722_1772783_-|protease	Clp protease ClpP	protease	K7PKX4	Enterobacterial_phage	85.5	0.0e+00
AXF59620.1|1774163_1774385_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	67.6	1.9e-18
AXF59621.1|1774381_1776484_-|terminase	phage terminase large subunit family protein	terminase	K7PH52	Enterobacterial_phage	77.4	0.0e+00
AXF59622.1|1776483_1776972_-	DUF1441 family protein	NA	K7PJY2	Enterobacterial_phage	80.9	1.2e-68
AXF59623.1|1777213_1777555_-	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	34.2	2.5e-09
AXF62527.1|1777696_1777954_-	hypothetical protein	NA	G8C7W3	Escherichia_phage	54.8	4.6e-16
AXF59624.1|1778088_1778313_-	hypothetical protein	NA	A0A2H4J182	uncultured_Caudovirales_phage	60.8	5.9e-20
AXF59625.1|1778554_1778947_-	DUF2570 domain-containing protein	NA	U5P0U9	Shigella_phage	59.7	2.2e-30
AXF59626.1|1778946_1779510_-	lysozyme	NA	M9P0E5	Enterobacteria_phage	87.8	1.5e-80
AXF59627.1|1779487_1779712_-|lysis	lysis protein	lysis	M9NZI9	Enterobacteria_phage	85.1	1.1e-29
AXF59628.1|1780005_1780884_+	hypothetical protein	NA	NA	NA	NA	NA
AXF59629.1|1780887_1781133_+	hypothetical protein	NA	NA	NA	NA	NA
AXF59630.1|1781133_1781508_+	hypothetical protein	NA	NA	NA	NA	NA
AXF59631.1|1781518_1781866_-	antitermination protein	NA	A0A0P0ZCW0	Stx2-converting_phage	83.2	1.3e-53
AXF59632.1|1781875_1782907_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.7	3.4e-110
AXF59633.1|1782906_1783266_-	RusA family crossover junction endodeoxyribonuclease	NA	G8C7V6	Escherichia_phage	66.4	9.8e-41
AXF59634.1|1783307_1783694_+	hypothetical protein	NA	NA	NA	NA	NA
AXF59635.1|1783735_1783942_-	hypothetical protein	NA	NA	NA	NA	NA
AXF59636.1|1784072_1784318_-	hypothetical protein	NA	H6WRY6	Salmonella_phage	65.2	4.5e-21
AXF62528.1|1784358_1784592_-	DNA damage-inducible protein I	NA	K7PM44	Enterobacteria_phage	75.3	7.5e-26
AXF59637.1|1784737_1786621_-	DNA cytosine methyltransferase	NA	H9C171	Pectobacterium_phage	50.8	8.2e-187
AXF59638.1|1786617_1787364_-	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	81.0	1.2e-69
AXF59639.1|1787356_1787713_-	hypothetical protein	NA	NA	NA	NA	NA
AXF59640.1|1787709_1788054_-	hypothetical protein	NA	F1C5B6	Cronobacter_phage	49.1	2.0e-06
AXF59641.1|1788050_1788362_-	hypothetical protein	NA	NA	NA	NA	NA
AXF59642.1|1788365_1788785_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
AXF62529.1|1788800_1789436_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	77.5	2.8e-67
AXF59643.1|1790412_1790967_-	hypothetical protein	NA	NA	NA	NA	NA
AXF59644.1|1790947_1791190_-	XRE family transcriptional regulator	NA	A0A077K9X2	Edwardsiella_phage	59.7	5.6e-16
AXF59645.1|1791296_1791677_+	helix-turn-helix domain-containing protein	NA	K7PH71	Enterobacterial_phage	68.1	2.9e-19
AXF59646.1|1792088_1792271_+	DUF1482 family protein	NA	NA	NA	NA	NA
AXF59647.1|1792435_1792771_+	hypothetical protein	NA	NA	NA	NA	NA
AXF62530.1|1792786_1793116_+	transcriptional regulator	NA	NA	NA	NA	NA
AXF59648.1|1795960_1796206_+	excisionase	NA	NA	NA	NA	NA
AXF59649.1|1796186_1797314_+|integrase	integrase	integrase	O21925	Phage_21	62.6	7.4e-127
AXF59650.1|1797431_1798682_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	1.8e-20
AXF59651.1|1798799_1799471_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
AXF59652.1|1799463_1799937_+	NUDIX hydrolase	NA	NA	NA	NA	NA
AXF59653.1|1799933_1801088_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
AXF59654.1|1801115_1801745_+	lysogenization regulator HflD	NA	NA	NA	NA	NA
AXF59655.1|1801764_1803135_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	46.2	1.1e-108
AXF59656.1|1803259_1803931_+	two-component system response regulator PhoP	NA	NA	NA	NA	NA
AXF59657.1|1803931_1805395_+	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
AXF59658.1|1805484_1806606_+	cupin domain-containing protein	NA	NA	NA	NA	NA
AXF59659.1|1806745_1807237_-|transposase	transposase	transposase	NA	NA	NA	NA
1814331:1814346	attR	TGGCGATAAACAGATC	NA	NA	NA	NA
>prophage 6
CP031104	Enterobacteriaceae bacterium w6 chromosome, complete genome	4945486	3525539	3590293	4945486	tRNA,tail,lysis,capsid,plate,portal,head	Salmonella_phage(70.0%)	74	NA	NA
AXF61147.1|3525539_3526229_+|tRNA	tRNA (guanosine(18)-2'-O)-methyltransferase TrmH	tRNA	NA	NA	NA	NA
AXF61148.1|3526232_3528314_+	ATP-dependent DNA helicase RecG	NA	NA	NA	NA	NA
AXF61149.1|3528314_3529517_-	sodium/glutamate symporter	NA	NA	NA	NA	NA
AXF61150.1|3529742_3531134_+	uracil-xanthine permease	NA	H9YQ34	environmental_Halophage	93.1	1.2e-65
AXF61151.1|3531253_3532954_+	AsmA family protein	NA	NA	NA	NA	NA
AXF61152.1|3533410_3535729_-	alpha-xylosidase	NA	NA	NA	NA	NA
AXF61153.1|3535741_3537136_-	glycoside-pentoside-hexuronide family transporter	NA	NA	NA	NA	NA
AXF61154.1|3537675_3538854_+	DUF4102 domain-containing protein	NA	Q7M297	Enterobacteria_phage	69.3	3.8e-158
AXF61155.1|3538918_3540007_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A0U4JD08	Gordonia_phage	33.0	3.0e-40
AXF61156.1|3539990_3540620_-	hypothetical protein	NA	NA	NA	NA	NA
AXF61157.1|3541080_3542214_-	nickel/cobalt efflux protein RcnA	NA	NA	NA	NA	NA
AXF61158.1|3542226_3542496_-	metal resistance protein	NA	NA	NA	NA	NA
AXF61159.1|3542597_3543896_-	MFS transporter	NA	NA	NA	NA	NA
AXF61160.1|3544131_3545055_+	chromate resistance protein	NA	NA	NA	NA	NA
AXF61161.1|3545008_3546388_+	chromate transporter	NA	A0A219VHC2	Ochrobactrum_phage	53.3	3.3e-28
AXF61162.1|3546418_3547108_-	transmembrane anchor protein	NA	NA	NA	NA	NA
AXF61163.1|3547121_3547859_-	HupE/UreJ family protein	NA	NA	NA	NA	NA
AXF61164.1|3547902_3548268_-	hypothetical protein	NA	NA	NA	NA	NA
AXF61165.1|3548546_3548780_-	hypothetical protein	NA	NA	NA	NA	NA
AXF61166.1|3548863_3549889_-	inovirus Gp2 family protein	NA	NA	NA	NA	NA
AXF61167.1|3550163_3550367_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
AXF61168.1|3550752_3552054_+	hypothetical protein	NA	NA	NA	NA	NA
AXF61169.1|3552362_3552797_+	hypothetical protein	NA	NA	NA	NA	NA
AXF61170.1|3552816_3553620_+	hypothetical protein	NA	NA	NA	NA	NA
AXF61171.1|3553631_3553829_+	hypothetical protein	NA	NA	NA	NA	NA
AXF62593.1|3553864_3554305_+	hypothetical protein	NA	NA	NA	NA	NA
AXF61172.1|3554376_3555198_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.0	1.4e-45
AXF61173.1|3555266_3555737_+	DNA repair protein RadC	NA	NA	NA	NA	NA
AXF61174.1|3555745_3555967_+	DUF987 domain-containing protein	NA	NA	NA	NA	NA
AXF61175.1|3555998_3556364_+	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
AXF61176.1|3556397_3556718_+	toxin	NA	NA	NA	NA	NA
AXF61177.1|3557743_3558040_+	hypothetical protein	NA	NA	NA	NA	NA
AXF61178.1|3558124_3558298_-	DUF3950 domain-containing protein	NA	NA	NA	NA	NA
AXF61179.1|3558559_3558778_-	late control protein B	NA	Q53ZE7	Salmonella_virus	75.0	2.0e-25
AXF61180.1|3558837_3559938_-	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	68.9	1.9e-135
AXF61181.1|3559937_3560399_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	66.4	6.4e-53
AXF61182.1|3563482_3563608_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	64.1	8.4e-08
AXF61183.1|3563619_3563946_-|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	59.3	2.2e-23
AXF61184.1|3563994_3564510_-|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	80.1	1.3e-73
AXF61185.1|3564519_3566469_-	DUF3383 family protein	NA	A0A1S6KZY7	Salmonella_phage	41.3	7.8e-124
AXF61186.1|3566586_3567021_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	51.4	4.7e-37
AXF61187.1|3568212_3569832_-|tail	phage tail protein	tail	A0A0F7LDR4	Escherichia_phage	49.0	5.2e-73
AXF61188.1|3569834_3570356_-|tail	phage tail protein I	tail	Q858V5	Yersinia_virus	61.4	3.1e-59
AXF61189.1|3570348_3571257_-|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	71.9	4.2e-112
AXF61190.1|3571259_3571607_-|plate	baseplate assembly protein	plate	E5G6N7	Salmonella_phage	61.3	5.0e-34
AXF61191.1|3571603_3572167_-|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	56.5	4.6e-53
AXF61192.1|3572231_3572678_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	50.0	1.6e-37
AXF61193.1|3572664_3573108_-|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	58.8	9.9e-43
AXF61194.1|3573203_3573632_-|lysis	LysB family phage lysis regulatory protein	lysis	NA	NA	NA	NA
AXF61195.1|3573610_3574027_-	hypothetical protein	NA	NA	NA	NA	NA
AXF61196.1|3574023_3574539_-	lysozyme	NA	A0A218M4K3	Erwinia_phage	69.2	1.7e-65
AXF61197.1|3574519_3574747_-	hypothetical protein	NA	NA	NA	NA	NA
AXF61198.1|3574737_3574941_-|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	73.1	3.3e-25
AXF62594.1|3574940_3575408_-|head	head completion/stabilization protein	head	E5G6M8	Salmonella_phage	53.5	1.4e-39
AXF61199.1|3575505_3576165_-	hypothetical protein	NA	E5G6M7	Salmonella_phage	60.7	1.7e-62
AXF61200.1|3576161_3577223_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	70.4	1.6e-139
AXF61201.1|3577235_3578078_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	60.1	1.1e-74
AXF61202.1|3578226_3579993_+	oxidoreductase	NA	A0A1S6KZW3	Salmonella_phage	87.1	0.0e+00
AXF61203.1|3579992_3581030_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	80.5	1.3e-162
AXF61204.1|3581026_3581254_-	hypothetical protein	NA	NA	NA	NA	NA
AXF61205.1|3581428_3581686_-	hypothetical protein	NA	J9Q7T5	Salmonella_phage	53.4	2.6e-19
AXF61206.1|3582517_3582856_-	hypothetical protein	NA	G9L6B6	Escherichia_phage	79.1	1.4e-44
AXF62595.1|3582855_3583302_-	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	83.2	2.2e-42
AXF61207.1|3583547_3583844_-	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	66.3	5.4e-29
AXF62596.1|3584006_3586268_-	replication endonuclease	NA	A0A0M4RTM8	Salmonella_phage	62.7	3.6e-237
AXF61208.1|3586393_3586699_+	hypothetical protein	NA	NA	NA	NA	NA
AXF61209.1|3586729_3587584_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	70.1	2.7e-105
AXF61210.1|3587580_3587808_-	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	62.7	3.0e-19
AXF61211.1|3587807_3588044_-	DUF2732 domain-containing protein	NA	E5G6L6	Salmonella_phage	52.7	7.4e-13
AXF61212.1|3588111_3588312_-	hypothetical protein	NA	A0A0M5M7U3	Salmonella_phage	66.7	1.8e-20
AXF61213.1|3588298_3588520_-	DUF2724 domain-containing protein	NA	A0A0M4RTI3	Salmonella_phage	70.0	1.0e-19
AXF61214.1|3588527_3589037_-	hypothetical protein	NA	A0A1S6L008	Salmonella_phage	72.8	1.2e-63
AXF61215.1|3589072_3589297_-	hypothetical protein	NA	NA	NA	NA	NA
AXF61216.1|3589426_3590293_+	phage repressor protein CI	NA	A0A0M4RE65	Salmonella_phage	34.5	2.5e-45
>prophage 7
CP031104	Enterobacteriaceae bacterium w6 chromosome, complete genome	4945486	4338251	4451044	4945486	protease,tRNA,tail,lysis,capsid,plate,integrase,portal,head,transposase,terminase	Salmonella_phage(40.48%)	117	4384334:4384393	4438850:4440072
AXF61889.1|4338251_4339289_-|integrase	site-specific integrase	integrase	F1BUS9	Erwinia_phage	63.8	1.5e-121
AXF61890.1|4339285_4339774_-	BRCT domain-containing protein	NA	NA	NA	NA	NA
AXF61891.1|4339781_4340369_-	phage repressor protein	NA	F1BUS8	Erwinia_phage	39.8	1.9e-33
AXF61892.1|4340508_4340730_+	regulator	NA	NA	NA	NA	NA
AXF61893.1|4340760_4341264_+	hypothetical protein	NA	F1BUN6	Cronobacter_phage	75.4	1.2e-63
AXF61894.1|4341273_4341471_+	hypothetical protein	NA	NA	NA	NA	NA
AXF61895.1|4341460_4341889_+	hypothetical protein	NA	F1BUN5	Cronobacter_phage	54.1	1.5e-27
AXF61896.1|4341888_4342290_+	hypothetical protein	NA	F1BUN2	Cronobacter_phage	56.4	1.2e-39
AXF61897.1|4342357_4342591_+	DUF2732 family protein	NA	NA	NA	NA	NA
AXF61898.1|4342581_4342890_+	DUF3850 domain-containing protein	NA	R9TML3	Aeromonas_phage	48.8	1.5e-10
AXF61899.1|4342879_4343737_+	DNA adenine methylase	NA	F1BUN1	Cronobacter_phage	81.3	1.7e-131
AXF61900.1|4343733_4345749_+	replication endonuclease	NA	F1BUM9	Cronobacter_phage	77.3	0.0e+00
AXF61901.1|4345867_4346056_+	hypothetical protein	NA	NA	NA	NA	NA
AXF61902.1|4346032_4346353_-	transcriptional regulator	NA	F1BUM8	Cronobacter_phage	78.8	5.1e-41
AXF61903.1|4346349_4347381_-|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	80.5	7.2e-161
AXF61904.1|4347377_4349153_-|terminase	terminase	terminase	F1BUM5	Cronobacter_phage	82.9	6.8e-284
AXF62623.1|4349310_4350120_+|capsid	phage capsid protein	capsid	F1BUM4	Cronobacter_phage	55.1	3.9e-77
AXF61905.1|4350173_4351196_+|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	80.3	3.1e-156
AXF61906.1|4351199_4351904_+|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	75.9	1.0e-97
AXF61907.1|4351997_4352450_+|head	head completion protein	head	F1BUL8	Cronobacter_phage	77.3	4.1e-60
AXF61908.1|4352446_4352950_+|tail	phage tail protein	tail	F1BUL7	Cronobacter_phage	72.1	4.2e-66
AXF61909.1|4352949_4353657_+	hypothetical protein	NA	F1BUL6	Cronobacter_phage	82.4	5.0e-105
AXF61910.1|4353653_4354781_+	DUF2586 family protein	NA	F1BUL5	Cronobacter_phage	82.7	1.0e-176
AXF61911.1|4354777_4355233_+	DUF2597 family protein	NA	F1BUL4	Cronobacter_phage	78.1	2.8e-64
AXF61912.1|4355531_4355873_+	M15 family peptidase	NA	F1BUL3	Cronobacter_phage	87.1	5.1e-47
AXF61913.1|4355872_4356238_+	hypothetical protein	NA	F1BUL2	Cronobacter_phage	57.5	7.2e-23
AXF61914.1|4356182_4356371_+	hypothetical protein	NA	F1BUL1	Cronobacter_phage	63.3	2.9e-12
AXF61915.1|4356354_4356615_+	hypothetical protein	NA	A5X9I7	Aeromonas_virus	55.8	1.5e-19
AXF61916.1|4356802_4358770_+|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	68.6	2.7e-257
AXF61917.1|4358766_4359096_+	DUF2590 family protein	NA	F1BUK8	Cronobacter_phage	84.8	7.9e-45
AXF61918.1|4359092_4360277_+	hypothetical protein	NA	F1BUK6	Cronobacter_phage	81.0	6.3e-177
AXF61919.1|4360269_4360908_+	hypothetical protein	NA	F1BUK5	Cronobacter_phage	75.0	1.2e-78
AXF61920.1|4360916_4364546_+	hypothetical protein	NA	F1BUK3	Cronobacter_phage	64.6	6.4e-95
AXF61921.1|4364550_4365264_+	hypothetical protein	NA	F1BUK1	Cronobacter_phage	53.5	5.9e-53
AXF61922.1|4365238_4365784_+	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	70.4	9.9e-61
AXF61923.1|4365787_4367485_+	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	64.1	9.0e-201
AXF61924.1|4367623_4367824_+	hypothetical protein	NA	NA	NA	NA	NA
AXF61925.1|4368049_4368373_+	hypothetical protein	NA	NA	NA	NA	NA
AXF61926.1|4368669_4369986_+|integrase	site-specific integrase	integrase	A0A248SL35	Klebsiella_phage	29.7	7.0e-36
AXF61927.1|4370152_4370794_-	OmpA family protein	NA	NA	NA	NA	NA
AXF61928.1|4370805_4372758_-	hypothetical protein	NA	NA	NA	NA	NA
AXF61929.1|4372754_4373909_-	hypothetical protein	NA	NA	NA	NA	NA
AXF62624.1|4374044_4374992_-	ATP-binding protein	NA	A0A0R6PCP6	Moraxella_phage	39.8	1.6e-42
AXF61930.1|4375520_4375970_-	addiction module antidote protein, HigA family	NA	NA	NA	NA	NA
AXF61931.1|4376153_4378514_+	SAM-dependent DNA methyltransferase	NA	A0A220A2U5	Liberibacter_phage	24.5	1.8e-29
AXF61932.1|4378513_4379896_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
AXF61933.1|4379892_4383141_+	type I restriction endonuclease subunit R	NA	NA	NA	NA	NA
AXF61934.1|4383363_4383831_-	hypothetical protein	NA	NA	NA	NA	NA
AXF61935.1|4383841_4384183_-	DUF4325 domain-containing protein	NA	A0A2H4J4X6	uncultured_Caudovirales_phage	37.6	3.6e-08
4384334:4384393	attL	ATTGACCTGCCCCCACGATTAGATACAACACTCAGTTAGTAACGTCGGAATCTTCATTCT	NA	NA	NA	NA
AXF61936.1|4384364_4385485_-|transposase	IS3-like element ISSen4 family transposase	transposase	S5WIU1	Leptospira_phage	42.8	1.7e-51
AXF61937.1|4385534_4386047_-	hypothetical protein	NA	NA	NA	NA	NA
AXF61938.1|4386307_4387393_-|integrase	integrase	integrase	F1BUS9	Erwinia_phage	60.7	3.1e-122
AXF61939.1|4387394_4388042_-	phage repressor protein	NA	F1BUN8	Cronobacter_phage	33.0	1.1e-26
AXF61940.1|4388126_4388363_+	regulator	NA	NA	NA	NA	NA
AXF61941.1|4388397_4388907_+	hypothetical protein	NA	A0A1S6L008	Salmonella_phage	86.4	7.6e-79
AXF61942.1|4388914_4389139_+	DUF2724 domain-containing protein	NA	A0A0M4RTI3	Salmonella_phage	73.0	1.8e-24
AXF61943.1|4389128_4389329_+	hypothetical protein	NA	A0A0M5M7U3	Salmonella_phage	70.8	4.3e-22
AXF61944.1|4389398_4389632_+	DUF2732 domain-containing protein	NA	E5G6L6	Salmonella_phage	68.8	2.3e-19
AXF61945.1|4389631_4389859_+	TraR/DksA family transcriptional regulator	NA	A0A1S6L007	Salmonella_phage	81.3	3.2e-29
AXF61946.1|4389855_4390170_+	DUF3850 domain-containing protein	NA	R9TML3	Aeromonas_phage	53.5	2.0e-13
AXF61947.1|4390166_4390964_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	69.8	1.6e-104
AXF61948.1|4390956_4393260_+	replication endonuclease	NA	A0A0M4RTM8	Salmonella_phage	63.6	2.2e-271
AXF61949.1|4393411_4394107_+	DNA adenine methylase	NA	A0A0M4S5U3	Salmonella_phage	75.4	3.5e-95
AXF61950.1|4394267_4394456_+	hypothetical protein	NA	A0A1S6L006	Salmonella_phage	93.3	5.7e-24
AXF61951.1|4394468_4394702_+	DinI family protein	NA	A0A1S6L014	Salmonella_phage	87.0	2.0e-31
AXF61952.1|4394832_4395564_-	DUF2971 domain-containing protein	NA	NA	NA	NA	NA
AXF61953.1|4395727_4395979_-	hypothetical protein	NA	NA	NA	NA	NA
AXF61954.1|4396263_4396605_+	hypothetical protein	NA	NA	NA	NA	NA
AXF61955.1|4396691_4397741_-|portal	phage portal protein	portal	E5G6M3	Salmonella_phage	80.9	1.2e-155
AXF61956.1|4397740_4399504_-	oxidoreductase	NA	A0A1S6KZW3	Salmonella_phage	87.7	3.2e-312
AXF61957.1|4399653_4400481_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	57.0	7.7e-73
AXF61958.1|4400496_4401645_+|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	68.8	1.6e-132
AXF61959.1|4401648_4402302_+	hypothetical protein	NA	E5G6M7	Salmonella_phage	56.1	8.8e-56
AXF61960.1|4402400_4402868_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	58.7	1.3e-48
AXF61961.1|4402867_4403071_+|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	100.0	3.8e-34
AXF61962.1|4403074_4403290_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	64.8	4.4e-20
AXF61963.1|4403270_4403786_+	lysozyme	NA	E5G6N1	Salmonella_phage	75.3	1.5e-71
AXF61964.1|4403782_4404211_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	85.7	1.8e-57
AXF61965.1|4404140_4404344_+	hypothetical protein	NA	A0A1S6KZX6	Salmonella_phage	89.6	9.1e-28
AXF61966.1|4404306_4404738_+|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	89.5	3.5e-69
AXF61967.1|4404730_4405177_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	80.3	2.0e-59
AXF61968.1|4405209_4406508_-	hypothetical protein	NA	NA	NA	NA	NA
AXF61969.1|4406593_4407172_+|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	96.9	8.2e-106
AXF61970.1|4407168_4407528_+|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	89.8	2.3e-53
AXF61971.1|4407514_4408423_+|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	89.1	1.5e-141
AXF61972.1|4408415_4409021_+|tail	phage tail protein I	tail	E5G6N9	Salmonella_phage	93.5	1.4e-111
AXF61973.1|4411844_4412432_+	DNA-invertase	NA	A0A0F7LA37	Escherichia_phage	80.9	4.8e-85
AXF61974.1|4412490_4413243_+	site-specific DNA-methyltransferase	NA	Q775B4	Bordetella_phage	50.6	1.1e-62
AXF61975.1|4413323_4414496_+|tail	phage tail protein	tail	A0A1S6KZY7	Salmonella_phage	92.3	2.8e-209
AXF61976.1|4414505_4415021_+|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	93.0	7.6e-87
AXF61977.1|4415075_4415378_+|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	90.0	3.1e-40
AXF61978.1|4415392_4415512_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	92.3	3.3e-14
AXF61979.1|4415504_4418948_+|tail	phage tail tape measure protein	tail	A0A1S6L010	Salmonella_phage	71.9	0.0e+00
AXF61980.1|4418947_4419433_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	91.9	1.0e-72
AXF61981.1|4419429_4420530_+	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	88.0	5.1e-181
AXF62625.1|4420599_4420818_+	DNA-binding transcriptional regulator	NA	Q53ZE7	Salmonella_virus	73.6	2.4e-26
AXF61982.1|4421192_4422500_+|integrase	site-specific integrase	integrase	A0A248SL35	Klebsiella_phage	31.4	1.5e-41
AXF61983.1|4424020_4425154_+	aldehyde dehydrogenase	NA	NA	NA	NA	NA
AXF61984.1|4427168_4428044_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
AXF61985.1|4428228_4429375_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	92.2	1.5e-146
AXF61986.1|4429675_4430599_+	aminoimidazole riboside kinase	NA	NA	NA	NA	NA
AXF61987.1|4430764_4432282_+	porin	NA	NA	NA	NA	NA
AXF61988.1|4432417_4433788_+	PTS sucrose transporter subunit IIBC	NA	NA	NA	NA	NA
AXF61989.1|4433787_4435188_+	glycosyl hydrolase family 32	NA	F8WPR5	Bacillus_phage	25.4	2.9e-19
AXF61990.1|4435217_4436222_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
AXF61991.1|4437547_4437745_-	hypothetical protein	NA	NA	NA	NA	NA
AXF61992.1|4437757_4438877_+|transposase	IS3-like element ISSen4 family transposase	transposase	S5WIU1	Leptospira_phage	42.8	1.7e-51
AXF61993.1|4439321_4440437_-	inovirus Gp2 family protein	NA	NA	NA	NA	NA
4438850:4440072	attR	AGAATGAAGATTCCGACGTTACTAACTGAGTGTTGTATCTAATCGTGGGGGCAGGTCAATAGAGTGCTAAAGCAAAAATATATGAGTGGTGGGGATGCCATGACATTTTTGTCAATAAATGCGCCACGGTATCAAGCGATCCCAAATCTTTAATATAAATTCTTCTGGAAAACCTATCGATATTCCACCGACCGCGTTGACCGTTTCGCCGATTTTTCTTCACCATAGTGTTTGGATTATCGTAAAAAGAAGGAAATAACAACGGCTTAACAACAAAGTCTCTTTTTAGTGCTAATTGTTTTTTAAGCTTTTTTCGGCGTTCTAAATATTTACATCTCCACCATTCATCCTCTGTAATACGTCGATATGCTTTGTTTCCATATATACGGCGTATGTTTTTTTCGATAAGACCCCAGTCATATTCATTATTATTCTCAGTATCCATTTACCCCTCCTGATTTTTAGTGATTTGCTACAGCCAAGCTTTCAATAACCATGGGTTGATTAAATTCGTTGGGTAATTACATAGGTAACGACTTGCAGTCCCTGGATTAAGGTAATACCAGTGACAATATTGCGTAACGCTAATATTGCAAGGCCAGTATTCACGATAGTAGCGCTCAAAGTGACGCAGCCAATGTGGACTAGTGCTTGAATTAATGGTGCTGGACGGTGTGATTAACGGACTGATTTTCTTAAACGCATGCAGTCGCCGTAGTGCTCTTAAAAGAGCTTTACTACGAAATGATTTTTTATCCACCAGCATCGTTACATATGCGAGCAGGGCCTCTGGCGTTTCGTTTTCAATTTGACTGAATTGAGCCCTGTTTTCCTTTTCAGCAAAAAGAGAATCCAGCTTACCGGGCAAAGGGCAATGTTCCTGTGCAGGCACAGAAGAAGCAGGATTAATCTGTAATTGAGCTGGTTTAATGCGCCTGGCTTTTTTCAGGCATGAGTAGTGTTGAGTTCCGGAAAGGCCAATATTGTCAGCGACATGCGTTTTTGAGTAGCGCTTGGCAAAGTAGCTAACCCTTAGAAGCAATGCCGTTAAAGCTTCGGTATCGTCCCGGTTAACCAGATAGTATCCATGCTTAGGTAGCCAGACCCTACCGCCAGTAGCGTGTTTCCAATAGCACTTCACCAGTTGGTTAATTTTGTGAGGATGGCGGACAGCGTTGCCATCCATCATCAGAAGATAATGGTAATGCTGAGCGGGGGCCTTA	NA	NA	NA	NA
AXF61994.1|4440554_4440776_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
AXF61995.1|4440893_4441682_-	hypothetical protein	NA	NA	NA	NA	NA
AXF61996.1|4442000_4442507_+	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
AXF61997.1|4442568_4444545_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	9.0e-35
AXF61998.1|4444574_4446320_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	39.2	3.7e-77
AXF61999.1|4446436_4446652_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
AXF62000.1|4446889_4447903_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	58.6	2.0e-107
AXF62001.1|4447922_4448597_-	DNA-binding response regulator	NA	NA	NA	NA	NA
AXF62002.1|4448968_4451044_+|protease	serine protease	protease	Q2A0D0	Sodalis_phage	25.8	4.0e-25
>prophage 8
CP031104	Enterobacteriaceae bacterium w6 chromosome, complete genome	4945486	4873969	4911199	4945486	protease,tail,lysis,capsid,portal,head,transposase,terminase	Enterobacteria_phage(23.26%)	51	NA	NA
AXF62370.1|4873969_4875090_-|transposase	IS3-like element ISSen4 family transposase	transposase	S5WIU1	Leptospira_phage	42.8	1.7e-51
AXF62371.1|4876206_4878219_+	flagellin FliC	NA	NA	NA	NA	NA
AXF62639.1|4878368_4879295_+|transposase	transposase	transposase	A0A077SL42	Escherichia_phage	45.2	4.4e-69
AXF62372.1|4881019_4881226_-	excisionase	NA	I6PBM8	Cronobacter_phage	68.9	1.7e-21
AXF62373.1|4881265_4881838_-	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	58.9	1.7e-63
AXF62374.1|4881834_4882119_-	hypothetical protein	NA	NA	NA	NA	NA
AXF62375.1|4882447_4883179_-	site-specific DNA-methyltransferase	NA	A0A0H5BBV5	Pseudomonas_phage	65.2	1.1e-83
AXF62376.1|4883175_4883379_-	hypothetical protein	NA	NA	NA	NA	NA
AXF62377.1|4883375_4883594_-	hypothetical protein	NA	NA	NA	NA	NA
AXF62378.1|4883584_4884121_-	HD family hydrolase	NA	A0A192Y8M4	Salmonella_phage	71.3	9.1e-67
AXF62379.1|4884253_4885078_-	DUF2303 family protein	NA	K7PJQ6	Enterobacteria_phage	67.5	2.7e-102
AXF62380.1|4885108_4885480_-	hypothetical protein	NA	Q8HAA1	Salmonella_phage	71.5	1.2e-44
AXF62381.1|4885972_4886224_+	bssS family protein	NA	NA	NA	NA	NA
AXF62640.1|4886483_4887131_-	helix-turn-helix domain-containing protein	NA	H9C160	Pectobacterium_phage	62.0	9.3e-74
AXF62382.1|4887235_4887433_+	hypothetical protein	NA	H9C161	Pectobacterium_phage	66.1	9.2e-17
AXF62383.1|4887461_4888016_+	DNA-binding protein	NA	A0A1C9II13	Salmonella_phage	72.8	1.2e-74
AXF62384.1|4888179_4888398_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	70.4	8.6e-16
AXF62385.1|4888351_4889113_+	helix-turn-helix domain-containing protein	NA	Q8HA96	Salmonella_phage	60.7	9.3e-65
AXF62386.1|4889109_4889988_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1C9II58	Salmonella_phage	70.9	3.5e-124
AXF62387.1|4889997_4890246_+	hypothetical protein	NA	NA	NA	NA	NA
AXF62388.1|4890242_4890611_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A1C9IIA0	Salmonella_phage	85.6	5.9e-57
AXF62389.1|4890712_4891510_+	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	76.2	2.3e-114
AXF62641.1|4891517_4892507_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	67.2	4.7e-133
AXF62390.1|4892524_4893346_+	antitermination protein	NA	A0A1B5FPA5	Escherichia_phage	44.2	1.6e-57
AXF62391.1|4893603_4893843_+|lysis	lysis protein	lysis	A0A2H4JCI1	uncultured_Caudovirales_phage	59.2	1.3e-17
AXF62392.1|4893844_4894348_+	lysozyme	NA	A0A2H4JCH1	uncultured_Caudovirales_phage	76.0	2.5e-74
AXF62393.1|4894337_4894790_+|lysis	lysis protein	lysis	A0A2H4JHL8	uncultured_Caudovirales_phage	57.1	4.5e-35
AXF62394.1|4894802_4895006_+	hypothetical protein	NA	NA	NA	NA	NA
AXF62395.1|4895120_4895414_+	hypothetical protein	NA	G8C7W3	Escherichia_phage	70.1	4.4e-31
AXF62396.1|4895514_4895784_+	hypothetical protein	NA	NA	NA	NA	NA
AXF62397.1|4896026_4896461_+	hypothetical protein	NA	G8C7Q4	Escherichia_phage	44.9	5.0e-07
AXF62398.1|4896460_4896811_+	HNH endonuclease	NA	A0A1B5FP94	Escherichia_phage	80.7	1.2e-51
AXF62399.1|4896807_4897008_+	hypothetical protein	NA	Q6UAR8	Klebsiella_phage	89.4	1.7e-10
AXF62400.1|4897170_4897641_+|terminase	phage terminase small subunit P27 family	terminase	Q8SBI1	Shigella_phage	63.3	2.0e-46
AXF62401.1|4897637_4899368_+|terminase	terminase large subunit	terminase	Q8HAD6	Salmonella_phage	82.0	1.1e-291
AXF62402.1|4899367_4900672_+|portal	phage portal protein	portal	K7PJU5	Enterobacteria_phage	90.1	1.9e-227
AXF62403.1|4900680_4901535_+|protease	Clp protease ClpP	protease	K7PH05	Enterobacteria_phage	77.5	2.8e-118
AXF62404.1|4901547_4902768_+|capsid	phage major capsid protein	capsid	K7PM57	Enterobacteria_phage	95.6	8.1e-212
AXF62405.1|4902820_4903006_+	hypothetical protein	NA	K7PHI6	Enterobacteria_phage	74.0	1.5e-13
AXF62406.1|4903015_4903342_+|head,tail	phage gp6-like head-tail connector protein	head,tail	K7PKT4	Enterobacteria_phage	53.7	6.6e-28
AXF62407.1|4903338_4903680_+|head,tail	head-tail adaptor protein	head,tail	A0A1J0GUY4	Halomonas_phage	47.1	2.0e-06
AXF62408.1|4903676_4904126_+	hypothetical protein	NA	Q9MCS9	Enterobacteria_phage	85.2	7.1e-65
AXF62409.1|4904122_4904452_+	DUF3168 domain-containing protein	NA	A0A1P8DTJ3	Proteus_phage	52.7	6.5e-23
AXF62410.1|4904512_4905217_+|tail	phage tail protein	tail	Q9MCS7	Enterobacteria_phage	83.8	7.0e-107
AXF62411.1|4905251_4905638_+|tail	phage tail protein	tail	K7PKV6	Enterobacterial_phage	93.8	9.8e-63
AXF62412.1|4905646_4905925_+	DUF4035 domain-containing protein	NA	Q9MCS5	Enterobacteria_phage	88.0	7.1e-39
AXF62413.1|4905980_4906316_+	zinc ribbon domain-containing protein	NA	S4TR42	Salmonella_phage	93.7	1.8e-52
AXF62414.1|4906362_4909857_+|tail	phage tail tape measure protein	tail	A0A2H4JHR1	uncultured_Caudovirales_phage	75.0	1.7e-198
AXF62415.1|4909856_4910324_+	hypothetical protein	NA	A0A286S298	Klebsiella_phage	59.6	7.5e-49
AXF62416.1|4910320_4910809_+	DUF1833 domain-containing protein	NA	A0A286S2B1	Klebsiella_phage	71.2	5.4e-58
AXF62417.1|4910818_4911199_+	nitrite transporter	NA	A0A286S2A6	Klebsiella_phage	76.2	2.8e-54
>prophage 9
CP031104	Enterobacteriaceae bacterium w6 chromosome, complete genome	4945486	4938412	4944746	4945486	tail	Salmonella_phage(50.0%)	10	NA	NA
AXF62436.1|4938412_4938538_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	64.1	8.4e-08
AXF62437.1|4938549_4938876_-|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	59.3	2.2e-23
AXF62438.1|4938924_4939383_-|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	81.5	8.1e-64
AXF62439.1|4940185_4940587_-	DUF3383 family protein	NA	NA	NA	NA	NA
AXF62440.1|4940652_4941045_-	DUF3383 family protein	NA	NA	NA	NA	NA
AXF62441.1|4941041_4941392_-	hypothetical protein	NA	E5G6P7	Salmonella_phage	58.5	5.4e-28
AXF62442.1|4941509_4941944_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	51.4	4.7e-37
AXF62443.1|4943200_4943560_-	hypothetical protein	NA	D3TVR9	Enterobacteria_phage	51.4	1.7e-24
AXF62444.1|4943571_4943925_-	hypothetical protein	NA	Q71TP5	Escherichia_phage	63.0	2.3e-26
AXF62445.1|4944098_4944746_-	hypothetical protein	NA	U5N099	Enterobacteria_phage	62.6	1.0e-59
