The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP030939	Escherichia coli strain AMSHJX01 chromosome, complete genome	5023979	1083827	1090967	5023979		Escherichia_phage(83.33%)	6	NA	NA
AXE56307.1|1083827_1084466_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
AXE56308.1|1084462_1085725_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.4	3.7e-135
AXE56309.1|1085721_1086630_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
AXE56310.1|1086825_1087593_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	3.3e-70
AXE56311.1|1087643_1088300_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	8.0e-49
AXE56312.1|1088405_1090967_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.7e-30
>prophage 2
CP030939	Escherichia coli strain AMSHJX01 chromosome, complete genome	5023979	1163692	1171456	5023979	transposase	Escherichia_phage(66.67%)	6	NA	NA
AXE56384.1|1163692_1164854_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
AXE56385.1|1165006_1166725_+	ATP-binding protein	NA	A0A1B5FPD5	Escherichia_phage	99.7	2.1e-306
AXE56386.1|1166726_1168475_+	hypothetical protein	NA	A0A1B5FPH1	Escherichia_phage	99.8	0.0e+00
AXE56387.1|1168546_1168963_-	hypothetical protein	NA	A0A1B5FPM5	Escherichia_phage	100.0	1.1e-72
AXE60071.1|1169001_1170231_-	DUF4102 domain-containing protein	NA	A0A1B5FPC6	Escherichia_phage	100.0	1.5e-234
AXE56388.1|1170973_1171456_-	SsrA-binding protein	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
>prophage 3
CP030939	Escherichia coli strain AMSHJX01 chromosome, complete genome	5023979	1291395	1334016	5023979	integrase,holin,tail,terminase	Escherichia_phage(52.0%)	53	1294494:1294510	1332164:1332180
AXE56495.1|1291395_1292862_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	39.1	2.3e-88
AXE56496.1|1292930_1294508_+	GMP synthase (glutamine-hydrolyzing)	NA	NA	NA	NA	NA
1294494:1294510	attL	ATTGAGTGGGAATGATT	NA	NA	NA	NA
AXE56497.1|1294700_1295957_+|integrase	site-specific integrase	integrase	A0A0F6TJM5	Escherichia_coli_O157_typing_phage	99.3	1.5e-237
AXE56498.1|1295953_1296148_-	DUF1382 family protein	NA	A0A0F6R7M7	Escherichia_coli_O157_typing_phage	100.0	3.3e-27
AXE56499.1|1296144_1296795_-	adenine methylase	NA	A0A0F6TJC3	Escherichia_coli_O157_typing_phage	98.6	9.5e-127
AXE60079.1|1296787_1297039_-	PerC family transcriptional regulator	NA	G9L6A0	Escherichia_phage	98.8	1.5e-40
AXE56500.1|1297196_1297445_-	AlpA family phage regulatory protein	NA	A0A0F6TJ45	Escherichia_coli_O157_typing_phage	100.0	3.6e-42
AXE56501.1|1297494_1298436_-	recombinase RecT	NA	A0A2R9YJJ1	Escherichia_phage	100.0	4.5e-178
AXE56502.1|1298432_1299254_-	exodeoxyribonuclease VIII	NA	A0A2R9YJH7	Escherichia_phage	99.3	6.8e-162
AXE56503.1|1299250_1299550_-	hypothetical protein	NA	A0A0F6R7M4	Escherichia_coli_O157_typing_phage	99.0	1.7e-46
AXE56504.1|1299858_1300443_-	XRE family transcriptional regulator	NA	A0A0F6R8L7	Escherichia_coli_O157_typing_phage	99.5	2.7e-104
AXE56505.1|1300597_1300828_+	hypothetical protein	NA	G9L6A7	Escherichia_phage	97.4	2.9e-38
AXE56506.1|1300978_1301179_+	hypothetical protein	NA	A0A0F6TJB7	Escherichia_coli_O157_typing_phage	98.5	6.0e-32
AXE56507.1|1301194_1302010_+	primosomal protein	NA	Q286X4	Escherichia_phage	95.6	5.9e-118
AXE60080.1|1302006_1302792_+	replication protein	NA	A0A0F6TJ71	Escherichia_coli_O157_typing_phage	100.0	9.3e-153
AXE56508.1|1302909_1303257_+	DUF1064 domain-containing protein	NA	A0A0F6R8N5	Escherichia_coli_O157_typing_phage	96.5	5.9e-59
AXE56509.1|1303318_1303897_+	hypothetical protein	NA	G9L6B1	Escherichia_phage	65.1	5.1e-39
AXE56510.1|1304009_1304552_+	DUF551 domain-containing protein	NA	K7PK20	Enterobacteria_phage	89.4	1.3e-76
AXE56511.1|1304551_1304902_+	DUF2591 domain-containing protein	NA	G9L6B5	Escherichia_phage	72.4	5.6e-41
AXE56512.1|1304894_1305233_+	hypothetical protein	NA	A0A0F6TJR3	Escherichia_coli_O157_typing_phage	99.1	1.3e-58
AXE56513.1|1305273_1305948_+|terminase	terminase small subunit	terminase	Q287B7	Escherichia_phage	99.6	1.5e-119
AXE56514.1|1305944_1307420_+|terminase	terminase	terminase	A0A0F6TK57	Escherichia_coli_O157_typing_phage	99.4	6.4e-296
AXE56515.1|1307510_1307882_-	hypothetical protein	NA	A0A0F6TJP2	Escherichia_coli_O157_typing_phage	99.2	1.1e-63
AXE56516.1|1308589_1308796_+	hypothetical protein	NA	G9L6C1	Escherichia_phage	100.0	6.0e-11
AXE56517.1|1308810_1310490_+|tail	phage tail protein	tail	G9L6C2	Escherichia_phage	99.3	1.4e-302
AXE56518.1|1310486_1310783_+	hypothetical protein	NA	G9L6C3	Escherichia_phage	100.0	1.3e-46
AXE56519.1|1310785_1311481_+	peptidase	NA	G9L6C4	Escherichia_phage	99.6	1.3e-94
AXE56520.1|1311495_1312482_+	hypothetical protein	NA	G9L6C5	Escherichia_phage	100.0	1.5e-187
AXE56521.1|1312533_1312971_+	hypothetical protein	NA	G9L6C6	Escherichia_phage	100.0	2.2e-74
AXE56522.1|1312981_1313317_+	hypothetical protein	NA	G9L6C7	Escherichia_phage	100.0	7.7e-56
AXE56523.1|1313367_1313691_+	hypothetical protein	NA	A0A0F6R8M8	Escherichia_coli_O157_typing_phage	98.1	2.6e-53
AXE56524.1|1313690_1314296_+	hypothetical protein	NA	A0A0F6TJN5	Escherichia_coli_O157_typing_phage	99.0	8.9e-111
AXE56525.1|1314295_1316767_+	hypothetical protein	NA	A0A0F6TJD3	Escherichia_coli_O157_typing_phage	98.9	0.0e+00
AXE56526.1|1316766_1317231_+	hypothetical protein	NA	G9L6D1	Escherichia_phage	100.0	8.4e-85
AXE56527.1|1317230_1317776_+	hypothetical protein	NA	A0A0F6TJ56	Escherichia_coli_O157_typing_phage	100.0	9.8e-93
AXE56528.1|1317775_1320289_+	hypothetical protein	NA	A0A0F6R8M6	Escherichia_coli_O157_typing_phage	98.0	0.0e+00
AXE56529.1|1320285_1322088_+	hypothetical protein	NA	A0A0F6TJQ3	Escherichia_coli_O157_typing_phage	97.3	0.0e+00
AXE56530.1|1322093_1324568_+	hypothetical protein	NA	A0A0F6TK45	Escherichia_coli_O157_typing_phage	99.4	0.0e+00
AXE56531.1|1324763_1325060_+	hypothetical protein	NA	A0A2R9YJP3	Escherichia_phage	99.0	1.6e-49
AXE56532.1|1325091_1325253_-	transmembrane anchored protein	NA	G9L6D9	Escherichia_phage	98.1	7.2e-20
AXE56533.1|1325346_1325886_-	DUF4760 domain-containing protein	NA	NA	NA	NA	NA
AXE56534.1|1326095_1326746_-	phage antirepressor Ant	NA	A0A0N6WET9	Escherichia_phage	66.2	1.7e-43
AXE56535.1|1327063_1327321_-	hypothetical protein	NA	G9L6E3	Escherichia_phage	100.0	1.3e-42
AXE56536.1|1327516_1330156_+	SGNH/GDSL hydrolase family protein	NA	A0A0F6TJC8	Escherichia_coli_O157_typing_phage	78.6	1.3e-97
AXE56537.1|1330255_1330660_+	hypothetical protein	NA	T1SA79	Salmonella_phage	91.8	5.6e-61
AXE56538.1|1330646_1330955_+|holin	phage holin family protein	holin	G9L6E7	Escherichia_phage	94.1	2.7e-47
AXE56539.1|1330944_1331574_+	glycoside hydrolase family 19 protein	NA	G9L6E8	Escherichia_phage	96.1	9.3e-111
AXE56540.1|1331570_1332053_+	DUF2514 domain-containing protein	NA	A0A0F6TK39	Escherichia_coli_O157_typing_phage	89.4	4.6e-70
AXE56541.1|1332270_1332810_-	hypothetical protein	NA	G9L6F0	Escherichia_phage	98.3	4.1e-43
1332164:1332180	attR	ATTGAGTGGGAATGATT	NA	NA	NA	NA
AXE56542.1|1332825_1333344_-	glycine zipper 2TM domain-containing protein	NA	G9L6F1	Escherichia_phage	100.0	1.3e-62
AXE56543.1|1333446_1333593_-	succinate dehydrogenase	NA	NA	NA	NA	NA
AXE56544.1|1333654_1333846_-	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	100.0	7.3e-27
AXE56545.1|1333863_1334016_+	hypothetical protein	NA	G9L6F3	Escherichia_phage	96.0	1.7e-18
>prophage 4
CP030939	Escherichia coli strain AMSHJX01 chromosome, complete genome	5023979	1709364	1718806	5023979		Enterobacteria_phage(85.71%)	10	NA	NA
AXE56883.1|1709364_1710291_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	2.8e-23
AXE56884.1|1710295_1711027_+	ABC transporter permease	NA	NA	NA	NA	NA
AXE56885.1|1711007_1711115_-	hypothetical protein	NA	NA	NA	NA	NA
AXE56886.1|1711174_1711906_-	transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
AXE56887.1|1712127_1713813_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
AXE56888.1|1713809_1714529_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AXE56889.1|1714575_1715046_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
AXE56890.1|1715086_1715548_-	DUF1307 domain-containing protein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
AXE56891.1|1715672_1717673_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	96.1	0.0e+00
AXE56892.1|1717669_1718806_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.4	4.2e-162
>prophage 5
CP030939	Escherichia coli strain AMSHJX01 chromosome, complete genome	5023979	1758786	1825867	5023979	holin,lysis,integrase,protease,terminase,tail,head,portal	Enterobacteria_phage(40.0%)	81	1760415:1760430	1822548:1822563
AXE56925.1|1758786_1760148_-|protease	protease	protease	Q6DW11	Phage_TP	100.0	1.1e-217
AXE56926.1|1760250_1760547_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
1760415:1760430	attL	TCAGAATCTGGAGAAC	NA	NA	NA	NA
AXE56927.1|1760548_1760845_-	type II toxin-antitoxin system ParD family antitoxin	NA	NA	NA	NA	NA
AXE56928.1|1761576_1762299_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	1.9e-30
AXE56929.1|1762295_1763699_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.8	1.6e-33
AXE56930.1|1763695_1765111_-	multidrug transporter subunit MdtD	NA	NA	NA	NA	NA
AXE56931.1|1765111_1768189_-	multidrug resistance protein MdtC	NA	NA	NA	NA	NA
AXE56932.1|1768189_1771312_-	multidrug resistance protein MdtB	NA	NA	NA	NA	NA
AXE56933.1|1771311_1772559_-	multidrug resistance protein MdtA	NA	NA	NA	NA	NA
AXE56934.1|1772902_1773976_-|integrase	integrase	integrase	K7PHK0	Enterobacteria_phage	94.7	1.2e-190
AXE56935.1|1773953_1774172_-	excisionase	NA	Q77WA4	Escherichia_phage	98.6	2.4e-34
AXE56936.1|1774256_1774880_-	phage antirepressor Ant	NA	A0A0P0ZDY7	Stx2-converting_phage	93.3	1.3e-104
AXE56937.1|1775202_1775763_-	hypothetical protein	NA	A0A0P0ZD96	Stx2-converting_phage	100.0	5.2e-97
AXE56938.1|1775995_1776280_-	ASCH domain-containing protein	NA	A0A1I9LJL9	Stx_converting_phage	89.4	2.8e-43
AXE56939.1|1776279_1776501_-	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	94.5	2.1e-33
AXE56940.1|1776599_1776881_-	hypothetical protein	NA	A0A0P0ZE02	Stx2-converting_phage	97.8	1.2e-46
AXE56941.1|1776891_1777083_-	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	96.8	6.2e-26
AXE56942.1|1777055_1777238_-	DUF1317 family protein	NA	A0A0N7CHV0	Escherichia_phage	93.3	5.3e-27
AXE56943.1|1777234_1777915_-	exonuclease	NA	A0A0P0ZCD4	Stx2-converting_phage	99.6	7.9e-132
AXE56944.1|1777911_1778697_-	phage recombination protein Bet	NA	A0A0K2FJF1	Enterobacteria_phage	100.0	1.4e-148
AXE56945.1|1778702_1779119_-	Host-nuclease inhibitor protein gam	NA	C6ZCV5	Enterobacteria_phage	98.6	5.1e-73
AXE56946.1|1779073_1779343_-	host cell division inhibitory peptide Kil	NA	M1FN78	Enterobacteria_phage	96.6	7.3e-41
AXE56947.1|1779422_1779791_-	DUF2528 family protein	NA	M1FPD2	Enterobacteria_phage	98.4	1.3e-64
AXE56948.1|1779973_1780174_-	restriction endonuclease	NA	A0A0K2FJE6	Enterobacteria_phage	100.0	1.4e-33
AXE56949.1|1780444_1780870_-	regulator	NA	F1C5C1	Cronobacter_phage	60.8	4.1e-30
AXE56950.1|1780866_1781040_-	hypothetical protein	NA	NA	NA	NA	NA
AXE56951.1|1781229_1782006_-	DUF1828 domain-containing protein	NA	NA	NA	NA	NA
AXE56952.1|1781993_1782536_-	hypothetical protein	NA	NA	NA	NA	NA
AXE56953.1|1782633_1783341_-	helix-turn-helix transcriptional regulator	NA	G9L676	Escherichia_phage	98.3	3.7e-132
AXE56954.1|1783419_1783647_+	DNA-binding protein	NA	G9L677	Escherichia_phage	100.0	7.8e-36
AXE56955.1|1783753_1784050_+	hypothetical protein	NA	A0A0N7KZD0	Stx2-converting_phage	96.9	8.3e-46
AXE56956.1|1784082_1784982_+	Replication protein O	NA	A0A0K2FJ31	Enterobacteria_phage	98.0	5.7e-170
AXE56957.1|1784978_1785680_+	Replication protein P	NA	K7P6G2	Enterobacteria_phage	99.6	2.2e-129
AXE56958.1|1785676_1785967_+	protein ren	NA	A0A1I9LJP5	Stx_converting_phage	97.9	3.1e-45
AXE56959.1|1786253_1786700_+	recombination protein NinB	NA	A0A0N7C2V1	Escherichia_phage	92.6	3.4e-75
AXE56960.1|1786696_1787224_+	phage N-6-adenine-methyltransferase	NA	K7PJZ4	Enterobacterial_phage	100.0	9.5e-101
AXE56961.1|1787220_1787403_+	NinE family protein	NA	Q8H9Z6	Enterobacteria_phage	98.3	1.3e-28
AXE56962.1|1787906_1789679_-	hypothetical protein	NA	A0A1U9AJG3	Stx1_converting_phage	99.5	0.0e+00
AXE56963.1|1790241_1790808_+	endonuclease	NA	A0A1U9AJK5	Stx1_converting_phage	99.5	6.6e-108
AXE56964.1|1790782_1791385_+	recombination protein NinG	NA	A0A1U9AJF8	Stx1_converting_phage	95.1	1.2e-91
AXE56965.1|1791381_1792047_+	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	100.0	1.3e-131
AXE56966.1|1792043_1792667_+	antitermination protein	NA	K7PM87	Enterobacteria_phage	98.6	9.8e-113
AXE56967.1|1792946_1793663_+	hypothetical protein	NA	NA	NA	NA	NA
AXE56968.1|1793748_1793907_+	DUF3927 domain-containing protein	NA	NA	NA	NA	NA
AXE56969.1|1794528_1794744_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.0e-33
AXE56970.1|1794743_1795241_+	lysozyme	NA	A0A1B5FP97	Escherichia_phage	99.4	2.6e-92
AXE56971.1|1795237_1795705_+|lysis	lysis protein	lysis	H6WZK2	Escherichia_phage	97.4	9.4e-76
AXE56972.1|1795904_1796429_+	Rha family transcriptional regulator	NA	G8C7W4	Escherichia_phage	93.6	1.0e-86
AXE56973.1|1796723_1796918_-	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	96.8	9.7e-27
AXE56974.1|1797307_1797853_+|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	98.9	1.4e-94
AXE56975.1|1797827_1799753_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.4	0.0e+00
AXE56976.1|1799749_1799956_+|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
AXE56977.1|1799952_1801554_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.1	4.9e-310
AXE56978.1|1801534_1802854_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.4	9.0e-233
AXE56979.1|1802863_1803196_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	100.0	1.7e-55
AXE56980.1|1804316_1804712_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	92.4	2.6e-55
AXE56981.1|1804723_1805077_+|tail	phage tail protein	tail	A0A2R9YJJ5	Escherichia_phage	97.4	1.3e-61
AXE56982.1|1805089_1805668_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.5	3.5e-80
AXE56983.1|1805664_1806060_+|tail	phage tail protein	tail	A0A2R9YJI2	Escherichia_phage	99.2	6.5e-70
AXE60091.1|1806067_1806808_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	99.2	6.6e-132
AXE56984.1|1806823_1807246_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	100.0	6.7e-73
AXE56985.1|1807227_1807662_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
AXE56986.1|1807654_1810216_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	97.3	0.0e+00
AXE56987.1|1810212_1810542_+|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	99.1	2.8e-58
AXE56988.1|1810541_1811240_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	100.0	2.3e-134
AXE56989.1|1811245_1811989_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.8	2.5e-147
AXE56990.1|1811886_1812558_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.6	3.1e-104
AXE56991.1|1812617_1816115_+	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	97.8	0.0e+00
AXE56992.1|1816185_1816785_+	Ail/Lom family protein	NA	A5LH44	Enterobacteria_phage	97.5	6.3e-109
AXE56993.1|1816849_1818163_+|tail	phage tail protein	tail	A0A0P0ZD68	Stx2-converting_phage	98.9	9.7e-78
AXE56994.1|1818164_1818434_+|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	96.6	4.6e-43
AXE56995.1|1818539_1819421_+	T3SS effector protein NleH	NA	A5LH48	Enterobacteria_phage	90.4	3.9e-147
AXE56996.1|1819644_1820493_+	type III secretion system effector Cif	NA	A5LH49	Enterobacteria_phage	98.5	3.5e-153
AXE56997.1|1820596_1820968_-|integrase	integrase	integrase	K7PH54	Enterobacteria_phage	95.1	1.1e-58
AXE60092.1|1821411_1821987_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	77.5	1.6e-77
AXE56998.1|1822187_1822568_+	hypothetical protein	NA	NA	NA	NA	NA
1822548:1822563	attR	TCAGAATCTGGAGAAC	NA	NA	NA	NA
AXE60093.1|1822651_1822873_+	hypothetical protein	NA	NA	NA	NA	NA
AXE56999.1|1822885_1823539_-	EspJ family T3SS effector ADP-ribosyltransferase	NA	NA	NA	NA	NA
AXE57000.1|1823948_1824128_-	hypothetical protein	NA	NA	NA	NA	NA
AXE57001.1|1824042_1824519_-	kinase inhibitor	NA	NA	NA	NA	NA
AXE57002.1|1824577_1825867_-	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	28.9	3.8e-18
>prophage 6
CP030939	Escherichia coli strain AMSHJX01 chromosome, complete genome	5023979	1875013	1977038	5023979	plate,lysis,transposase,integrase,protease,tail,capsid,head,portal	Salmonella_phage(62.5%)	112	1866939:1866954	1944803:1944818
1866939:1866954	attL	CAGCGCCACCGCCAGT	NA	NA	NA	NA
AXE57051.1|1875013_1875994_+|transposase	IS110 family transposase IS621	transposase	NA	NA	NA	NA
AXE57052.1|1876249_1877515_-	DUF1479 domain-containing protein	NA	NA	NA	NA	NA
AXE57053.1|1877666_1878482_-	HAD family hydrolase	NA	NA	NA	NA	NA
AXE57054.1|1878627_1881060_-	formate C-acetyltransferase/glycerol dehydratase family glycyl radical enzyme	NA	A0A076YHZ7	Citrobacter_phage	43.5	6.1e-09
AXE57055.1|1881065_1881965_-	glycyl-radical enzyme activating protein	NA	NA	NA	NA	NA
AXE57056.1|1882095_1882758_+	fructose-6-phosphate aldolase	NA	A0A0E3HJ81	Synechococcus_phage	34.6	5.7e-26
AXE57057.1|1882833_1883583_-	molybdopterin-synthase adenylyltransferase MoeB	NA	NA	NA	NA	NA
AXE57058.1|1883582_1884818_-	molybdopterin molybdotransferase	NA	NA	NA	NA	NA
AXE57059.1|1885021_1885987_+	beta-aspartyl-peptidase	NA	NA	NA	NA	NA
AXE57060.1|1885973_1887845_+	glutathione import ATP-binding protein GsiA	NA	G9BWD6	Planktothrix_phage	29.7	4.0e-16
AXE57061.1|1887864_1889403_+	glutathione-binding protein GsiB	NA	NA	NA	NA	NA
AXE57062.1|1889420_1890341_+	glutathione ABC transporter permease	NA	NA	NA	NA	NA
AXE57063.1|1890343_1891255_+	glutathione ABC transporter permease	NA	NA	NA	NA	NA
AXE60095.1|1891432_1893781_+	EAL domain-containing protein	NA	NA	NA	NA	NA
AXE57064.1|1895164_1896490_-	30S ribosomal protein S12 methylthiotransferase RimO	NA	NA	NA	NA	NA
AXE57065.1|1896702_1897086_+	biofilm regulator BssR	NA	NA	NA	NA	NA
AXE57066.1|1897196_1898312_+	soluble aldose sugar dehydrogenase YliI	NA	NA	NA	NA	NA
AXE57067.1|1898308_1898935_-	glutathione S-transferase	NA	NA	NA	NA	NA
AXE60096.1|1899181_1900384_+	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	48.0	8.2e-100
AXE57068.1|1900430_1901189_-	DeoR family transcriptional regulator	NA	NA	NA	NA	NA
AXE57069.1|1901246_1901843_-	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
AXE57070.1|1902127_1903360_+	multidrug transporter MdfA	NA	NA	NA	NA	NA
AXE57071.1|1903400_1903685_-	hypothetical protein	NA	NA	NA	NA	NA
AXE57072.1|1903770_1904586_-	HAD family hydrolase	NA	NA	NA	NA	NA
AXE57073.1|1904585_1905794_-	MFS transporter	NA	NA	NA	NA	NA
AXE57074.1|1905877_1906414_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AXE57075.1|1906564_1906834_-	hypothetical protein	NA	NA	NA	NA	NA
AXE57076.1|1906894_1907926_-|integrase	integrase	integrase	A0A218M4I3	Erwinia_phage	57.0	4.3e-105
AXE57077.1|1908017_1908569_-	DUF4276 family protein	NA	NA	NA	NA	NA
AXE57078.1|1908565_1909765_-	chromosome segregation protein SMC	NA	NA	NA	NA	NA
AXE57079.1|1909773_1910667_-	chromosome partitioning protein ParB	NA	A0A1S6KZZ7	Salmonella_phage	45.5	1.9e-40
AXE57080.1|1910792_1911014_+	regulator	NA	NA	NA	NA	NA
AXE57081.1|1911046_1911556_+	hypothetical protein	NA	E5G6L3	Salmonella_phage	98.8	5.8e-87
AXE57082.1|1911563_1911860_+	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	88.5	1.9e-21
AXE57083.1|1911977_1912319_+	hypothetical protein	NA	E5G6L5	Salmonella_phage	96.5	2.5e-54
AXE57084.1|1912386_1912620_+	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	94.8	4.1e-32
AXE57085.1|1912619_1912847_+	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	100.0	2.7e-36
AXE57086.1|1912843_1913146_+	DUF3850 domain-containing protein	NA	C9E2N9	Enterococcus_phage	53.4	4.4e-10
AXE57087.1|1913142_1914000_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	95.1	5.2e-157
AXE57088.1|1913996_1916411_+	replication endonuclease	NA	E5G6L9	Salmonella_phage	96.1	0.0e+00
AXE57089.1|1916563_1916752_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	96.8	1.6e-26
AXE57090.1|1916690_1916996_+	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
AXE57091.1|1917188_1917524_-	hypothetical protein	NA	NA	NA	NA	NA
AXE57092.1|1917795_1918068_+	hypothetical protein	NA	NA	NA	NA	NA
AXE57093.1|1918052_1918628_+	hypothetical protein	NA	NA	NA	NA	NA
AXE57094.1|1918617_1919592_+	DNA-processing protein DprA	NA	NA	NA	NA	NA
AXE57095.1|1919616_1920642_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	88.5	2.0e-171
AXE57096.1|1920641_1922408_-	oxidoreductase	NA	A0A1S6KZW3	Salmonella_phage	99.7	0.0e+00
AXE57097.1|1922550_1923384_+|capsid	capsid protein	capsid	A0A1S6KZW9	Salmonella_phage	90.3	1.2e-121
AXE57098.1|1923400_1924459_+|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.1	1.9e-180
AXE57099.1|1924462_1925113_+	hypothetical protein	NA	E5G6M7	Salmonella_phage	95.4	3.3e-111
AXE57100.1|1925208_1925673_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.0	1.9e-76
AXE57101.1|1925672_1925876_+|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	91.0	3.0e-31
AXE57102.1|1925879_1926095_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
AXE60097.1|1926114_1926588_+	lysozyme	NA	E5G6N1	Salmonella_phage	91.0	3.7e-80
AXE57103.1|1926589_1926967_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	40.0	3.9e-16
AXE57104.1|1926963_1927392_+|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	77.3	2.9e-47
AXE57105.1|1927321_1927525_+	hypothetical protein	NA	A0A1S6KZX6	Salmonella_phage	77.6	6.1e-24
AXE57106.1|1927487_1927919_+|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	94.4	4.4e-72
AXE57107.1|1927911_1928358_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	85.6	6.6e-63
AXE57108.1|1928426_1929005_+|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	87.5	2.5e-94
AXE57109.1|1929001_1929361_+|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	89.9	2.0e-54
AXE57110.1|1929347_1930256_+|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	91.1	4.1e-144
AXE57111.1|1930248_1930854_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	92.5	1.5e-110
AXE57112.1|1930850_1932410_+|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	69.9	1.5e-194
AXE57113.1|1932409_1933012_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	84.5	5.4e-92
AXE57114.1|1932983_1933424_-|tail	tail assembly chaperone	tail	A0A0F7LDZ0	Escherichia_phage	69.0	8.0e-53
AXE60098.1|1933450_1933744_-	hypothetical protein	NA	NA	NA	NA	NA
AXE57115.1|1933870_1934437_+	DNA-invertase	NA	A0A0F7LA37	Escherichia_phage	86.3	1.1e-86
AXE57116.1|1934579_1935752_+|tail	phage tail protein	tail	A0A1S6KZY7	Salmonella_phage	90.5	2.7e-204
AXE57117.1|1935761_1936277_+|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.9	5.6e-90
AXE57118.1|1936331_1936634_+|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	5.3e-40
AXE57119.1|1936648_1936768_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.8e-13
AXE57120.1|1936760_1939838_+|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	62.7	0.0e+00
AXE57121.1|1939834_1940320_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.0	1.4e-66
AXE57122.1|1940316_1941417_+	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	86.1	2.0e-177
AXE57123.1|1941507_1941726_+	transcriptional regulator	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
AXE57124.1|1941961_1943647_-	transporter	NA	NA	NA	NA	NA
AXE57125.1|1943916_1944294_+	hypothetical protein	NA	NA	NA	NA	NA
AXE57126.1|1944323_1944581_-	glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	61.9	8.6e-23
AXE57127.1|1944740_1945028_+	DUF1418 family protein	NA	NA	NA	NA	NA
1944803:1944818	attR	ACTGGCGGTGGCGCTG	NA	NA	NA	NA
AXE57128.1|1945011_1945734_+	NADPH-dependent oxidoreductase	NA	NA	NA	NA	NA
AXE57129.1|1945794_1946697_+	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	34.4	2.6e-37
AXE57130.1|1946784_1947261_+	YbjN domain-containing protein	NA	NA	NA	NA	NA
AXE57131.1|1947612_1948725_+	putrescine-binding periplasmic protein	NA	NA	NA	NA	NA
AXE57132.1|1948819_1949953_+	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.4	5.0e-30
AXE57133.1|1949962_1950916_+	spermidine/putrescine ABC transporter permease	NA	NA	NA	NA	NA
AXE57134.1|1950912_1951758_+	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
AXE57135.1|1951817_1952306_+	DUF2593 family protein	NA	NA	NA	NA	NA
AXE57136.1|1952346_1953474_+	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	27.6	3.5e-28
AXE57137.1|1953648_1954380_-	arginine/ornithine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AXE57138.1|1954671_1955340_-	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
AXE57139.1|1955339_1956056_-	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
AXE57140.1|1956062_1956794_-	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AXE57141.1|1956811_1957540_-	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.7	6.0e-29
AXE57142.1|1957756_1958272_-	lipoprotein	NA	NA	NA	NA	NA
AXE57143.1|1958397_1958721_+	hypothetical protein	NA	NA	NA	NA	NA
AXE57144.1|1958717_1959548_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	30.0	5.7e-07
AXE60099.1|1959544_1960558_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
AXE57145.1|1960656_1962087_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
AXE57146.1|1962097_1963099_-	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
AXE57147.1|1963135_1964854_-	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.0	5.2e-31
AXE57148.1|1964986_1965955_-	hybrid-cluster NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
AXE57149.1|1965966_1967619_-	hydroxylamine reductase	NA	NA	NA	NA	NA
AXE57150.1|1967762_1968662_-	transporter	NA	NA	NA	NA	NA
AXE57151.1|1969156_1969852_-	aquaporin	NA	NA	NA	NA	NA
AXE57152.1|1970277_1971936_+	DUF2813 domain-containing protein	NA	NA	NA	NA	NA
AXE57153.1|1971932_1972925_-	DUF535 domain-containing protein	NA	NA	NA	NA	NA
AXE57154.1|1973039_1974155_+	MacA family efflux pump subunit	NA	NA	NA	NA	NA
AXE57155.1|1974151_1976098_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.1	5.0e-38
AXE57156.1|1976170_1976395_-	cold-shock protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
AXE57157.1|1976717_1977038_+|protease	ATP-dependent Clp protease adaptor ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
>prophage 7
CP030939	Escherichia coli strain AMSHJX01 chromosome, complete genome	5023979	2248639	2298047	5023979	holin,plate,tRNA,integrase,protease,terminase,tail,head,capsid,portal	Shigella_phage(46.0%)	67	2263430:2263445	2291425:2291440
AXE57413.1|2248639_2249695_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	43.7	3.5e-70
AXE57414.1|2249707_2250043_+|head	head decoration protein	head	NA	NA	NA	NA
AXE57415.1|2250055_2250469_+|head,tail	phage head-tail connector protein	head,tail	NA	NA	NA	NA
AXE57416.1|2250674_2251217_+|terminase	terminase	terminase	O64316	Escherichia_phage	44.2	1.8e-33
AXE57417.1|2251196_2251421_-	hypothetical protein	NA	NA	NA	NA	NA
AXE57418.1|2251472_2251754_+	hypothetical protein	NA	NA	NA	NA	NA
AXE57419.1|2252355_2253816_-	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
AXE57420.1|2253815_2254487_-	two-component system response regulator PhoP	NA	NA	NA	NA	NA
AXE57421.1|2254654_2256025_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	4.2e-108
AXE60111.1|2256028_2256670_-	lysogenization protein HflD	NA	NA	NA	NA	NA
AXE57422.1|2256705_2257812_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
AXE57423.1|2257865_2258327_-	NUDIX hydrolase	NA	NA	NA	NA	NA
AXE57424.1|2258336_2258990_-	23S rRNA pseudouridine synthase E	NA	NA	NA	NA	NA
AXE57425.1|2259161_2260412_+	isocitrate dehydrogenase (NADP(+))	NA	Q77Z09	Phage_21	96.3	1.9e-22
AXE57426.1|2260870_2263993_+	hypothetical protein	NA	NA	NA	NA	NA
2263430:2263445	attL	ACCATGCCTAAAAATA	NA	NA	NA	NA
AXE57427.1|2264419_2264890_-	hypothetical protein	NA	NA	NA	NA	NA
AXE57428.1|2264990_2266118_-|integrase	integrase	integrase	Q77Z04	Phage_21	61.2	6.1e-121
AXE57429.1|2266098_2266344_-	excisionase	NA	NA	NA	NA	NA
AXE57430.1|2266398_2266944_-	HD family hydrolase	NA	K7PKJ9	Enterobacteria_phage	97.7	1.2e-93
AXE57431.1|2267097_2267322_+	hypothetical protein	NA	A0A291AWX8	Escherichia_phage	63.1	5.4e-13
AXE57432.1|2267463_2267655_+	hypothetical protein	NA	S5FM78	Shigella_phage	100.0	3.3e-27
AXE57433.1|2268172_2268865_-	helix-turn-helix transcriptional regulator	NA	S5FUZ3	Shigella_phage	100.0	1.0e-126
AXE57434.1|2268962_2269223_+	XRE family transcriptional regulator	NA	S5FKP1	Shigella_phage	98.8	1.3e-39
AXE57435.1|2269215_2269767_+	protein YmfL	NA	S5FXP0	Shigella_phage	99.5	3.4e-101
AXE57436.1|2269942_2270122_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	70.4	2.1e-15
AXE57437.1|2270111_2271053_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	99.4	8.6e-153
AXE57438.1|2271049_2271544_+	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	98.8	5.6e-87
AXE57439.1|2271510_2271870_+	LexA family transcriptional regulator	NA	A0A0N7KZF7	Stx2-converting_phage	100.0	7.7e-54
AXE57440.1|2271866_2272256_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A291AX14	Escherichia_phage	99.2	1.2e-68
AXE57441.1|2272275_2273073_+	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	99.6	7.5e-150
AXE57442.1|2273080_2274070_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	97.9	9.9e-192
AXE57443.1|2274083_2274836_+	antitermination protein	NA	Q8SBE4	Shigella_phage	98.8	4.5e-136
AXE57444.1|2275050_2275320_+	hypothetical protein	NA	NA	NA	NA	NA
AXE57445.1|2275529_2276324_+	membrane domain protein	NA	NA	NA	NA	NA
AXE57446.1|2276432_2276819_+	hypothetical protein	NA	A0A192Y8P2	Salmonella_phage	99.2	9.2e-61
AXE57447.1|2276805_2277087_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	46.2	9.7e-20
AXE57448.1|2277086_2277701_+	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	81.9	8.5e-93
AXE57449.1|2277708_2277978_+	hypothetical protein	NA	G8C7W1	Escherichia_phage	72.4	5.3e-23
AXE57450.1|2277934_2278117_+	hypothetical protein	NA	A0A286SGR9	Klebsiella_phage	76.8	3.2e-16
AXE57451.1|2278159_2278549_-	hypothetical protein	NA	A0A1L5C299	Pseudoalteromonas_phage	65.5	1.7e-38
AXE57452.1|2278647_2278998_+	HNH endonuclease	NA	Q8HA82	Salmonella_phage	77.6	2.3e-50
AXE57453.1|2279115_2279619_+|terminase	phage terminase small subunit P27 family	terminase	Q8SBI1	Shigella_phage	100.0	1.0e-88
AXE57454.1|2279615_2281349_+|terminase	terminase large subunit	terminase	U5P0Q5	Shigella_phage	98.4	0.0e+00
AXE57455.1|2281360_2281543_+	hypothetical protein	NA	S5FXQ9	Shigella_phage	100.0	1.7e-25
AXE57456.1|2281542_2282784_+|portal	phage portal protein	portal	U5P411	Shigella_phage	99.8	2.0e-242
AXE57457.1|2282725_2283412_+|head,protease	HK97 family phage prohead protease	head,protease	U5P4H2	Shigella_phage	99.1	4.7e-124
AXE57458.1|2283426_2284632_+|capsid	phage major capsid protein	capsid	U5P0G9	Shigella_phage	98.5	8.5e-222
AXE57459.1|2284681_2284909_+	hypothetical protein	NA	S5FNU1	Shigella_phage	98.3	1.5e-23
AXE57460.1|2284883_2285207_+|head,tail	phage gp6-like head-tail connector protein	head,tail	U5P072	Shigella_phage	96.3	4.8e-55
AXE57461.1|2285203_2285614_+|head,tail	head-tail adaptor protein	head,tail	M1FJ87	Enterobacteria_phage	96.3	2.5e-72
AXE57462.1|2285588_2286095_+	hypothetical protein	NA	M1FPE2	Enterobacteria_phage	98.2	7.2e-90
AXE57463.1|2286091_2286652_+	hypothetical protein	NA	M1FQV7	Enterobacteria_phage	97.3	5.7e-104
AXE57464.1|2286660_2286831_+	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	98.2	6.1e-25
AXE57465.1|2286814_2288311_+|tail	phage tail protein	tail	U5P0H3	Shigella_phage	99.0	3.4e-276
AXE57466.1|2288310_2288667_+|tail	phage tail protein	tail	U5P076	Shigella_phage	100.0	5.3e-63
AXE57467.1|2288666_2288936_+|tail	phage tail assembly protein	tail	M1FPE4	Enterobacteria_phage	98.9	6.0e-43
AXE57468.1|2288902_2289085_+	hypothetical protein	NA	NA	NA	NA	NA
AXE57469.1|2289077_2290910_+|tail	phage tail tape measure protein	tail	Q8SBG9	Shigella_phage	97.5	4.8e-301
AXE57470.1|2291001_2291532_+	hypothetical protein	NA	NA	NA	NA	NA
2291425:2291440	attR	ACCATGCCTAAAAATA	NA	NA	NA	NA
AXE57471.1|2291593_2292922_+	DNA circularization protein	NA	Q8SBG8	Shigella_phage	97.3	2.5e-243
AXE57472.1|2292918_2293998_+|plate	baseplate protein	plate	U5P0H6	Shigella_phage	99.7	3.4e-206
AXE57473.1|2293997_2294546_+|plate	phage baseplate assembly protein V	plate	U5P081	Shigella_phage	98.4	3.3e-96
AXE57474.1|2294542_2294971_+|tail	phage tail protein	tail	U5P0R9	Shigella_phage	99.3	1.5e-80
AXE57475.1|2294957_2296016_+|plate	baseplate J/gp47 family protein	plate	M1FQW3	Enterobacteria_phage	99.1	4.3e-201
AXE57476.1|2296006_2296591_+	DUF2313 domain-containing protein	NA	O22003	Shigella_phage	99.5	4.1e-113
AXE57477.1|2297242_2297680_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	66.9	7.2e-46
AXE57478.1|2297651_2298047_-|tail	phage tail protein	tail	A0A0M4S6V4	Salmonella_phage	43.5	3.5e-15
>prophage 8
CP030939	Escherichia coli strain AMSHJX01 chromosome, complete genome	5023979	2712439	2765838	5023979	holin,lysis,integrase,protease,terminase,tail	Enterobacteria_phage(48.84%)	67	2723837:2723852	2767270:2767285
AXE57854.1|2712439_2713030_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	57.8	2.0e-22
AXE57855.1|2713239_2713509_-|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	95.5	1.7e-42
AXE57856.1|2713510_2714824_-|tail	phage tail protein	tail	H6WZM9	Escherichia_phage	96.3	9.4e-73
AXE57857.1|2714883_2718297_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	95.8	0.0e+00
AXE57858.1|2718357_2719005_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	96.7	4.3e-111
AXE57859.1|2718902_2719646_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.2	1.1e-147
AXE57860.1|2719651_2720350_-|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	99.1	6.6e-134
AXE57861.1|2720359_2720689_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
AXE57862.1|2720688_2723754_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	97.4	0.0e+00
AXE57863.1|2723725_2724055_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	99.1	1.3e-55
2723837:2723852	attL	AAGGCTGAAATCAGCC	NA	NA	NA	NA
AXE60130.1|2724063_2724450_-|tail	phage minor tail protein G	tail	K7PLV8	Enterobacteria_phage	100.0	3.3e-66
AXE57864.1|2724509_2725253_-|tail	phage tail protein	tail	K7PGT7	Enterobacteria_phage	100.0	1.6e-133
AXE57865.1|2725263_2725665_-|tail	phage tail protein	tail	A5LH34	Enterobacteria_phage	99.2	1.9e-72
AXE57866.1|2725661_2726240_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	100.0	4.2e-102
AXE57867.1|2726251_2726527_-	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
AXE57868.1|2726519_2726888_-	DUF2190 family protein	NA	K7PLV6	Enterobacteria_phage	99.1	1.1e-50
AXE57869.1|2726929_2729053_-|protease	Clp protease ClpP	protease	A5LH30	Enterobacteria_phage	99.4	0.0e+00
AXE57870.1|2730409_2730622_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
AXE57871.1|2730618_2732721_-|terminase	phage terminase large subunit family protein	terminase	A0A291AWY5	Escherichia_phage	96.7	0.0e+00
AXE57872.1|2732720_2733212_-	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	87.2	1.3e-72
AXE57873.1|2733569_2733752_+	hypothetical protein	NA	NA	NA	NA	NA
AXE57874.1|2733719_2734274_-	Rha family transcriptional regulator	NA	A0A088CBJ5	Shigella_phage	87.0	1.2e-85
AXE57875.1|2734476_2734914_-|lysis	lysis protein	lysis	A0A2I6PIF7	Escherichia_phage	95.9	7.9e-69
AXE57876.1|2734910_2735444_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	98.9	6.7e-102
AXE57877.1|2735507_2735858_-	DUF1327 domain-containing protein	NA	K7PGU6	Enterobacteria_phage	84.5	9.6e-33
AXE57878.1|2735862_2736078_-|holin	holin	holin	M1FN85	Enterobacteria_phage	98.6	5.3e-34
AXE60131.1|2736736_2736844_-	antiterminator	NA	NA	NA	NA	NA
AXE57879.1|2736975_2737857_+	hypothetical protein	NA	NA	NA	NA	NA
AXE57880.1|2737872_2738136_+	hypothetical protein	NA	NA	NA	NA	NA
AXE57881.1|2738125_2738524_+	hypothetical protein	NA	NA	NA	NA	NA
AXE60132.1|2738559_2738925_-	antitermination protein Q	NA	A5LH77	Enterobacteria_phage	89.2	6.4e-56
AXE57882.1|2738917_2739295_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	65.5	4.1e-37
AXE57883.1|2739295_2740351_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	48.1	9.8e-89
AXE57884.1|2740352_2740631_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	46.9	2.2e-11
AXE57885.1|2740798_2741011_-	Hok/Gef family protein	NA	A0A0U2QV81	Escherichia_phage	72.9	1.3e-16
AXE57886.1|2741292_2742051_-	AcfC family adhesin Paa	NA	NA	NA	NA	NA
AXE57887.1|2742910_2743708_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	83.9	2.0e-110
AXE57888.1|2743679_2744426_-	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	79.3	1.3e-111
AXE57889.1|2744432_2745398_-	hypothetical protein	NA	U5P0A0	Shigella_phage	63.9	1.3e-58
AXE57890.1|2745419_2745845_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
AXE57891.1|2745828_2746152_-	transcriptional regulator	NA	NA	NA	NA	NA
AXE57892.1|2746276_2746753_+	hypothetical protein	NA	A0A2D1GNH0	Pseudomonas_phage	44.1	4.4e-12
AXE60133.1|2747073_2747229_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	53.2	2.3e-07
AXE57893.1|2747188_2747806_+	hypothetical protein	NA	NA	NA	NA	NA
AXE57894.1|2748292_2748481_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
AXE57895.1|2748477_2748669_+	DUF1482 family protein	NA	NA	NA	NA	NA
AXE57896.1|2748761_2751242_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	63.0	4.5e-60
AXE57897.1|2751311_2751563_+	DNA-binding protein	NA	S4TND0	Salmonella_phage	50.0	2.2e-15
AXE57898.1|2751582_2752878_+	DUF3596 domain-containing protein	NA	B6DZ48	Enterobacteria_phage	62.1	5.7e-155
AXE57899.1|2752897_2753008_-	transporter	NA	NA	NA	NA	NA
AXE57900.1|2753065_2754085_-	starvation-sensing protein RspB	NA	E3SJ82	Synechococcus_phage	25.9	9.7e-17
AXE57901.1|2754096_2755311_-	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
AXE57902.1|2755291_2755480_-	hypothetical protein	NA	NA	NA	NA	NA
AXE57903.1|2755516_2755843_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
AXE57904.1|2755977_2756319_+	DUF1283 family protein	NA	NA	NA	NA	NA
AXE57905.1|2756353_2756914_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
AXE60134.1|2756916_2757627_-	YnfC family lipoprotein	NA	NA	NA	NA	NA
AXE57906.1|2757734_2758040_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
AXE57907.1|2758238_2759696_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.9	5.1e-120
AXE57908.1|2760192_2761179_-	hypothetical protein	NA	NA	NA	NA	NA
AXE57909.1|2761254_2761746_-	hypothetical protein	NA	NA	NA	NA	NA
AXE60135.1|2761950_2762169_-	hypothetical protein	NA	NA	NA	NA	NA
AXE57910.1|2762177_2762918_-	hypothetical protein	NA	M4R311	Vibrio_phage	30.2	1.8e-12
AXE57911.1|2762919_2763309_-	hypothetical protein	NA	NA	NA	NA	NA
AXE57912.1|2763720_2764089_-	hypothetical protein	NA	NA	NA	NA	NA
AXE57913.1|2764198_2764408_+	hypothetical protein	NA	NA	NA	NA	NA
AXE57914.1|2764500_2765838_-|integrase	integrase	integrase	NA	NA	NA	NA
2767270:2767285	attR	AAGGCTGAAATCAGCC	NA	NA	NA	NA
>prophage 9
CP030939	Escherichia coli strain AMSHJX01 chromosome, complete genome	5023979	3161620	3209194	5023979	holin,lysis,integrase,terminase,tail,head,capsid,portal	Enterobacteria_phage(35.71%)	64	3177009:3177024	3209732:3209747
AXE58302.1|3161620_3161752_-	hypothetical protein	NA	K7PMH7	Enterobacteria_phage	76.5	1.5e-07
AXE58303.1|3162098_3163079_-	type III secretion system effector NleB	NA	Q8HAB2	Salmonella_phage	49.5	2.9e-87
AXE58304.1|3163255_3163525_-|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	96.6	3.5e-43
AXE58305.1|3163526_3164840_-|tail	phage tail protein	tail	Q6H9S9	Enterobacteria_phage	98.6	5.9e-75
AXE60151.1|3164904_3165528_-	hypothetical protein	NA	A0A1U8QHD6	Enterobacteria_phage	61.4	1.7e-69
AXE58306.1|3165596_3169073_-	host specificity protein J	NA	Q6H9T2	Enterobacteria_phage	95.7	0.0e+00
AXE58307.1|3169206_3169734_+	superoxide dismutase	NA	Q9MC02	Salmonella_phage	60.5	1.8e-59
AXE58308.1|3169764_3169971_-	hypothetical protein	NA	NA	NA	NA	NA
AXE58309.1|3169924_3170605_-|tail	tail assembly protein	tail	A0A0P0ZDX8	Stx2-converting_phage	96.4	1.5e-111
AXE58310.1|3170502_3171246_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	99.6	8.3e-151
AXE58311.1|3171251_3171950_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	99.1	2.1e-132
AXE58312.1|3171949_3172279_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	95.4	2.2e-55
AXE58313.1|3172275_3174855_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	83.0	0.0e+00
AXE58314.1|3174835_3175249_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	2.7e-42
AXE58315.1|3175275_3175707_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	4.8e-42
AXE58316.1|3175720_3176473_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	93.6	1.7e-127
AXE58317.1|3176480_3176876_-|tail	phage tail protein	tail	A0A2R9YJI2	Escherichia_phage	87.0	4.2e-61
AXE58318.1|3176872_3177448_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	58.7	7.5e-51
3177009:3177024	attL	TGAATGGGAAGACGAT	NA	NA	NA	NA
AXE58319.1|3177462_3177816_-|tail	phage tail protein	tail	A0A0K2FJB7	Enterobacteria_phage	69.2	2.5e-41
AXE58320.1|3177808_3178231_-	hypothetical protein	NA	NA	NA	NA	NA
AXE58321.1|3178234_3179263_-|capsid	minor capsid protein E	capsid	C6ZCY2	Enterobacteria_phage	61.3	1.3e-114
AXE58322.1|3179320_3179668_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	2.0e-22
AXE58323.1|3179704_3181210_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.0	1.6e-100
AXE58324.1|3181199_3182792_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	61.6	1.9e-184
AXE58325.1|3182788_3182995_-|tail	phage tail protein	tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
AXE58326.1|3182978_3184907_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.7	1.5e-260
AXE58327.1|3184878_3185388_-|terminase	terminase	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
AXE58328.1|3185790_3186015_+	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	88.7	2.9e-19
AXE58329.1|3186096_3186411_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
AXE58330.1|3186653_3186794_-	hypothetical protein	NA	NA	NA	NA	NA
AXE58331.1|3186876_3187344_-|lysis	lysis protein	lysis	Q7AYI6	Enterobacteria_phage	93.5	2.2e-72
AXE58332.1|3187345_3187459_-	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	100.0	6.6e-12
AXE58333.1|3187679_3188213_-	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	94.4	3.1e-99
AXE58334.1|3188245_3188440_-	hypothetical protein	NA	NA	NA	NA	NA
AXE58335.1|3188408_3188645_+	hypothetical protein	NA	NA	NA	NA	NA
AXE58336.1|3188593_3188938_+	hypothetical protein	NA	NA	NA	NA	NA
AXE58337.1|3188900_3189116_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	97.2	1.7e-32
AXE58338.1|3189114_3189276_+	hypothetical protein	NA	NA	NA	NA	NA
AXE58339.1|3189554_3191405_-	DUF1737 domain-containing protein	NA	B6DZ89	Enterobacteria_phage	96.1	0.0e+00
AXE58340.1|3191453_3191582_-	hypothetical protein	NA	NA	NA	NA	NA
AXE58341.1|3192792_3192915_-	antiterminator	NA	NA	NA	NA	NA
AXE58342.1|3192945_3193635_-	antiterminator	NA	I6PDF8	Cronobacter_phage	50.6	9.6e-61
AXE58343.1|3193631_3193991_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	67.3	2.0e-38
AXE58344.1|3194003_3195053_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.7	2.1e-107
AXE58345.1|3195054_3195333_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	2.2e-11
AXE58346.1|3195399_3195651_-	hypothetical protein	NA	NA	NA	NA	NA
AXE58347.1|3195867_3196080_-	type I toxin-antitoxin system hok family toxin	NA	A0A0U2QV81	Escherichia_phage	81.4	1.1e-23
AXE58348.1|3196336_3196972_-	HNH endonuclease	NA	NA	NA	NA	NA
AXE58349.1|3196958_3198332_-	ATP-binding protein	NA	NA	NA	NA	NA
AXE58350.1|3199370_3200213_-	hypothetical protein	NA	NA	NA	NA	NA
AXE58351.1|3200652_3200853_-	hypothetical protein	NA	A0A0U2SAW4	Escherichia_phage	93.9	5.9e-11
AXE58352.1|3200959_3201625_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	98.0	1.2e-84
AXE58353.1|3201623_3201827_+	hypothetical protein	NA	NA	NA	NA	NA
AXE58354.1|3202425_3202977_-	hypothetical protein	NA	NA	NA	NA	NA
AXE58355.1|3202960_3203188_-	transcriptional regulator	NA	NA	NA	NA	NA
AXE58356.1|3203214_3203673_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	45.4	6.2e-24
AXE58357.1|3203864_3204020_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	51.1	8.8e-07
AXE58358.1|3204021_3204150_+	hypothetical protein	NA	NA	NA	NA	NA
AXE58359.1|3204179_3204398_+	hypothetical protein	NA	NA	NA	NA	NA
AXE58360.1|3204401_3204617_-	hypothetical protein	NA	NA	NA	NA	NA
AXE58361.1|3204966_3205155_+	division inhibition protein DicB	NA	NA	NA	NA	NA
AXE58362.1|3205435_3207907_+	exonuclease	NA	K7PLW7	Enterobacteria_phage	60.3	1.5e-58
AXE58363.1|3207965_3208169_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
AXE58364.1|3208168_3209194_+|integrase	integrase	integrase	A0A192Y7M7	Salmonella_phage	58.2	4.0e-103
3209732:3209747	attR	TGAATGGGAAGACGAT	NA	NA	NA	NA
>prophage 10
CP030939	Escherichia coli strain AMSHJX01 chromosome, complete genome	5023979	3324174	3371777	5023979	holin,lysis,integrase,terminase,tail,head,capsid,portal	Enterobacteria_phage(50.77%)	72	3346019:3346034	3373485:3373500
AXE58455.1|3324174_3325416_+	type III secretion system effector NleA	NA	H6WZN2	Escherichia_phage	86.2	1.1e-219
AXE58456.1|3325753_3326314_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	62.8	5.4e-62
AXE58457.1|3326304_3326499_-	hypothetical protein	NA	A0A2R2Z347	Escherichia_phage	87.2	1.1e-09
AXE58458.1|3326443_3326986_-	hypothetical protein	NA	Q9LA55	Enterobacteria_phage	68.6	8.4e-52
AXE58459.1|3327206_3327476_-|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	96.6	4.6e-43
AXE58460.1|3327477_3328791_-|tail	phage tail protein	tail	A0A0P0ZD68	Stx2-converting_phage	98.9	9.7e-78
AXE58461.1|3328855_3329455_-	Ail/Lom family protein	NA	Q687E7	Enterobacteria_phage	98.0	2.6e-110
AXE58462.1|3329521_3332920_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	90.5	0.0e+00
AXE58463.1|3332979_3333651_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.6	3.1e-104
AXE58464.1|3333548_3334292_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.8	2.5e-147
AXE58465.1|3334297_3334996_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	100.0	2.3e-134
AXE58466.1|3334995_3335325_-|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	99.1	2.8e-58
AXE58467.1|3335321_3337883_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	97.3	0.0e+00
AXE58468.1|3337875_3338310_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
AXE58469.1|3338291_3338714_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	100.0	6.7e-73
AXE60159.1|3338729_3339470_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	99.2	6.6e-132
AXE58470.1|3339477_3339873_-|tail	phage tail protein	tail	A0A2R9YJI2	Escherichia_phage	99.2	6.5e-70
AXE58471.1|3339869_3340448_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.5	3.5e-80
AXE58472.1|3340460_3340814_-|tail	phage tail protein	tail	A0A2R9YJJ5	Escherichia_phage	97.4	1.3e-61
AXE58473.1|3340825_3341221_-	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	92.4	2.6e-55
AXE58474.1|3341262_3342288_-|capsid	minor capsid protein E	capsid	C6ZCY2	Enterobacteria_phage	97.4	2.0e-187
AXE58475.1|3342342_3342675_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	100.0	1.7e-55
AXE58476.1|3342684_3344004_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.4	9.0e-233
AXE58477.1|3343984_3345586_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.1	4.9e-310
AXE58478.1|3345582_3345789_-|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
AXE58479.1|3345785_3347711_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.4	0.0e+00
3346019:3346034	attL	GCTCTTCAGCAGTCAG	NA	NA	NA	NA
AXE58480.1|3347685_3348231_-|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	98.9	1.4e-94
AXE58481.1|3348620_3348815_+	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	96.8	9.7e-27
AXE58482.1|3348894_3349035_+	hypothetical protein	NA	NA	NA	NA	NA
AXE58483.1|3349002_3349620_-	hypothetical protein	NA	A0A1R3Y613	Salmonella_virus	85.4	5.5e-92
AXE58484.1|3349769_3350207_-|lysis	lysis protein	lysis	A0A0P0ZBQ9	Stx2-converting_phage	100.0	2.0e-72
AXE58485.1|3350203_3350701_-	lysozyme	NA	A0A0N7KZA0	Stx2-converting_phage	100.0	2.6e-92
AXE58486.1|3350700_3350916_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	7.7e-33
AXE58487.1|3350914_3351076_+	hypothetical protein	NA	NA	NA	NA	NA
AXE58488.1|3351354_3353205_-	DUF1737 domain-containing protein	NA	B6DZ89	Enterobacteria_phage	95.9	0.0e+00
AXE58489.1|3353503_3353662_-	DUF3927 domain-containing protein	NA	NA	NA	NA	NA
AXE58490.1|3353747_3354464_-	hypothetical protein	NA	NA	NA	NA	NA
AXE58491.1|3354675_3355365_-	antitermination protein	NA	I6PDF8	Cronobacter_phage	48.1	1.5e-58
AXE58492.1|3355379_3355502_-	YlcG family protein	NA	NA	NA	NA	NA
AXE58493.1|3355840_3356800_+	lipid A deacylase LpxR family protein	NA	NA	NA	NA	NA
AXE58494.1|3357011_3357200_-	protein ninH	NA	A5VW84	Enterobacteria_phage	100.0	5.5e-27
AXE58495.1|3357196_3357559_-	RusA family crossover junction endodeoxyribonuclease	NA	A5VW85	Enterobacteria_phage	99.2	2.7e-62
AXE58496.1|3357555_3357846_-	DUF1364 domain-containing protein	NA	K7PK25	Enterobacteria_phage	97.9	7.1e-50
AXE58497.1|3357838_3358051_-	hypothetical protein	NA	K7PK10	Enterobacteria_phage	100.0	1.6e-35
AXE58498.1|3358043_3358220_-	protein ninF	NA	A0A220NRM2	Escherichia_phage	100.0	1.9e-26
AXE58499.1|3358219_3358579_-	DUF2591 domain-containing protein	NA	G8EYI2	Enterobacteria_phage	95.0	2.7e-62
AXE58500.1|3358581_3358758_-	NinE family protein	NA	K7PHE6	Enterobacteria_phage	100.0	2.7e-28
AXE58501.1|3358754_3359282_-	phage N-6-adenine-methyltransferase	NA	A0A1I9LJP9	Stx_converting_phage	100.0	9.5e-101
AXE58502.1|3359278_3359737_-	recombination protein NinB	NA	A5VW91	Enterobacteria_phage	100.0	7.3e-81
AXE58503.1|3359792_3360083_-	protein ren	NA	A0A1I9LJP5	Stx_converting_phage	100.0	9.6e-47
AXE58504.1|3360079_3360781_-	Replication protein P	NA	A0A0P0ZD31	Stx2-converting_phage	99.6	1.3e-129
AXE58505.1|3360777_3361677_-	Replication protein O	NA	A0A0K2FJ31	Enterobacteria_phage	99.3	2.1e-172
AXE58506.1|3361711_3361990_-	hypothetical protein	NA	K7P7A2	Enterobacteria_phage	100.0	1.6e-43
AXE58507.1|3362098_3362284_-	hypothetical protein	NA	A5VW97	Enterobacteria_phage	100.0	1.6e-26
AXE58508.1|3362364_3363015_+	LexA family transcriptional regulator	NA	K7PM82	Enterobacteria_phage	98.6	4.1e-122
AXE58509.1|3363327_3363600_+	hypothetical protein	NA	K7PH69	Enterobacterial_phage	96.7	4.0e-26
AXE58510.1|3363616_3364198_-	superinfection exclusion protein B	NA	Q9EYA9	Enterobacteria_phage	100.0	4.0e-100
AXE58511.1|3364458_3364827_+	lambda prophage-derived protein ea10	NA	M1FPD2	Enterobacteria_phage	100.0	2.0e-65
AXE58512.1|3364906_3365176_+	host cell division inhibitory peptide Kil	NA	M1FN78	Enterobacteria_phage	100.0	1.7e-42
AXE58513.1|3365130_3365547_+	Host-nuclease inhibitor protein gam	NA	A0A0P0ZBR6	Stx2-converting_phage	98.6	5.6e-72
AXE58514.1|3365552_3366338_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	99.6	1.4e-148
AXE58515.1|3366334_3367015_+	exonuclease	NA	A0A0P0ZCD4	Stx2-converting_phage	100.0	1.6e-132
AXE58516.1|3367011_3367194_+	DUF1317 family protein	NA	A0A0P0ZD61	Stx2-converting_phage	98.3	2.8e-28
AXE58517.1|3367166_3367358_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	98.4	2.1e-26
AXE58518.1|3367368_3367650_+	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	100.0	2.5e-47
AXE58519.1|3367748_3367970_+	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	95.9	5.5e-34
AXE58520.1|3367966_3368218_+	ead/Ea22-like family protein	NA	A0A0K2FJF6	Enterobacteria_phage	92.3	5.8e-32
AXE58521.1|3369424_3369763_+	hypothetical protein	NA	A0A0F6TJR3	Escherichia_coli_O157_typing_phage	86.6	6.4e-50
AXE58522.1|3369791_3370220_+	DUF2513 domain-containing protein	NA	NA	NA	NA	NA
AXE58523.1|3370303_3370471_+	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	98.2	4.9e-27
AXE58524.1|3370510_3370729_+	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
AXE58525.1|3370706_3371777_+|integrase	integrase	integrase	Q9MCR4	Enterobacteria_phage	99.7	1.9e-201
3373485:3373500	attR	GCTCTTCAGCAGTCAG	NA	NA	NA	NA
>prophage 11
CP030939	Escherichia coli strain AMSHJX01 chromosome, complete genome	5023979	3590540	3658633	5023979	holin,lysis,tRNA,transposase,integrase,protease,tail,capsid,head,terminase,portal	Enterobacteria_phage(42.31%)	74	3602450:3602496	3648426:3648472
AXE58724.1|3590540_3591703_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
AXE58725.1|3591895_3592273_+	hypothetical protein	NA	NA	NA	NA	NA
AXE58726.1|3592789_3593305_+	hypothetical protein	NA	NA	NA	NA	NA
AXE58727.1|3593969_3595106_+|transposase	ISAs1-like element ISEc1 family transposase	transposase	NA	NA	NA	NA
AXE58728.1|3595374_3597612_+	bacteriophage N4 adsorption protein B	NA	NA	NA	NA	NA
AXE58729.1|3597598_3600571_+	phage receptor	NA	NA	NA	NA	NA
AXE58730.1|3600571_3601462_+	DUF4434 family protein	NA	NA	NA	NA	NA
AXE58731.1|3601375_3601588_-	hypothetical protein	NA	NA	NA	NA	NA
AXE58732.1|3601644_3602406_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AXE58733.1|3602399_3602516_+	hypothetical protein	NA	NA	NA	NA	NA
3602450:3602496	attL	AATGGCGCGCCCTGCAGGATTCGAACCTGCGGCCCACGACTTAGAAG	NA	NA	NA	NA
AXE58734.1|3602919_3603873_+|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
AXE58735.1|3604122_3604872_-	transcriptional regulator	NA	NA	NA	NA	NA
AXE60165.1|3605776_3606403_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AXE58736.1|3606950_3607184_+	hypothetical protein	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
AXE58737.1|3607500_3608091_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
AXE58738.1|3608188_3608764_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.8	2.5e-102
AXE58739.1|3608763_3612162_-	short-chain fatty acid transporter	NA	X2KTY7	Enterobacteria_phage	35.5	1.8e-11
AXE58740.1|3612226_3612826_-	Ail/Lom family protein	NA	A5LH44	Enterobacteria_phage	97.5	6.3e-109
AXE58741.1|3612896_3616394_-	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	97.8	0.0e+00
AXE58742.1|3616453_3617125_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.6	3.1e-104
AXE58743.1|3617022_3617766_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.8	2.5e-147
AXE58744.1|3617771_3618470_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	100.0	2.3e-134
AXE58745.1|3618469_3618799_-|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	99.1	2.8e-58
AXE58746.1|3621348_3621783_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
AXE58747.1|3621764_3622187_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	100.0	6.7e-73
AXE60166.1|3622202_3622943_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	99.2	6.6e-132
AXE58748.1|3622950_3623346_-|tail	phage tail protein	tail	A0A2R9YJI2	Escherichia_phage	98.5	8.5e-70
AXE58749.1|3623342_3623921_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.5	3.5e-80
AXE58750.1|3623933_3624287_-|tail	phage tail protein	tail	A0A2R9YJJ5	Escherichia_phage	97.4	1.3e-61
AXE58751.1|3624298_3624694_-	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	92.4	2.6e-55
AXE58752.1|3624735_3625761_-|capsid	minor capsid protein E	capsid	C6ZCY2	Enterobacteria_phage	97.4	2.0e-187
AXE58753.1|3625815_3626148_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	100.0	1.7e-55
AXE58754.1|3626157_3627477_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.4	9.0e-233
AXE58755.1|3627457_3629059_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.1	4.9e-310
AXE58756.1|3629055_3629262_-|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
AXE58757.1|3629258_3631184_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.4	0.0e+00
AXE58758.1|3631158_3631704_-|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	98.9	1.4e-94
AXE58759.1|3632093_3632288_+	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	100.0	8.7e-28
AXE58760.1|3632452_3632659_-	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
AXE58761.1|3632944_3633355_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	98.5	1.2e-71
AXE58762.1|3633645_3633939_+	serum resistance lipoprotein Bor	NA	A0A2R2X2B2	Escherichia_phage	97.9	5.7e-47
AXE58763.1|3633970_3634432_-|lysis	lysis protein	lysis	A0A0K2FJD0	Enterobacteria_phage	97.4	3.9e-74
AXE58764.1|3634428_3634926_-	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	98.2	1.1e-90
AXE58765.1|3634925_3635141_-|holin	holin	holin	A5LH82	Enterobacteria_phage	98.6	3.4e-33
AXE58766.1|3635729_3636827_+	porin	NA	Q1MVN1	Enterobacteria_phage	76.3	4.8e-155
AXE58767.1|3637016_3637400_-	antitermination protein	NA	A0A088CD47	Shigella_phage	84.2	4.0e-56
AXE58768.1|3637417_3638407_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	97.0	2.4e-190
AXE58769.1|3638414_3639212_-	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	99.6	7.5e-150
AXE58770.1|3639231_3639621_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	99.2	1.6e-68
AXE58771.1|3639617_3639977_-	LexA family transcriptional regulator	NA	A0A0N7KZF7	Stx2-converting_phage	97.2	1.5e-52
AXE58772.1|3639943_3640438_-	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	97.5	6.2e-86
AXE58773.1|3640434_3641376_-	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	93.3	1.7e-140
AXE58774.1|3641365_3641545_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
AXE60167.1|3641720_3642272_-	hypothetical protein	NA	U5P4K1	Shigella_phage	98.9	1.7e-100
AXE58775.1|3642309_3642510_-	cell division protein	NA	NA	NA	NA	NA
AXE58776.1|3642607_3643234_+	LexA family transcriptional regulator	NA	K7PM82	Enterobacteria_phage	48.8	2.5e-47
AXE60168.1|3643461_3644022_-	hypothetical protein	NA	NA	NA	NA	NA
AXE58777.1|3644447_3644810_+	hypothetical protein	NA	U5P4J6	Shigella_phage	100.0	3.3e-60
AXE58778.1|3644875_3645700_+	DUF2303 family protein	NA	U5P439	Shigella_phage	100.0	6.0e-150
AXE58779.1|3645827_3646364_+	HD family hydrolase	NA	U5P0T3	Shigella_phage	98.3	4.8e-100
AXE58780.1|3646354_3646717_+	hypothetical protein	NA	K7PH61	Enterobacteria_phage	98.3	4.4e-65
AXE58781.1|3646716_3647022_+	hypothetical protein	NA	U5P0J0	Shigella_phage	94.1	3.2e-48
AXE58782.1|3646937_3647393_+	DNA-binding protein	NA	U5P4J3	Shigella_phage	82.6	1.3e-61
AXE58783.1|3647248_3648412_+|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.6	3.0e-200
AXE60169.1|3648746_3649379_+	DNA-binding response regulator	NA	NA	NA	NA	NA
3648426:3648472	attR	AATGGCGCGCCCTGCAGGATTCGAACCTGCGGCCCACGACTTAGAAG	NA	NA	NA	NA
AXE58784.1|3649381_3649897_-	fimbriae assembly protein	NA	NA	NA	NA	NA
AXE58785.1|3649907_3650915_-	type 1 fimbrin D-mannose specific adhesin FimH	NA	NA	NA	NA	NA
AXE58786.1|3650927_3653537_-	outer membrane usher protein	NA	NA	NA	NA	NA
AXE58787.1|3653567_3654260_-	fimbrial chaperone SfmC	NA	NA	NA	NA	NA
AXE58788.1|3654479_3655022_-	type 1 fimbrial protein subunit FimA	NA	NA	NA	NA	NA
AXE58789.1|3655502_3656369_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
AXE58790.1|3656370_3656583_+	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
AXE58791.1|3656690_3657212_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
AXE58792.1|3657247_3658633_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.9e-45
>prophage 12
CP030939	Escherichia coli strain AMSHJX01 chromosome, complete genome	5023979	3955880	3975676	5023979	transposase,plate	uncultured_Caudovirales_phage(50.0%)	15	NA	NA
AXE59067.1|3955880_3956981_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
AXE59068.1|3956980_3958117_-|transposase	ISAs1-like element ISEc1 family transposase	transposase	NA	NA	NA	NA
AXE59069.1|3958516_3958774_-	hypothetical protein	NA	NA	NA	NA	NA
AXE59070.1|3958775_3963269_-	type IV secretion protein Rhs	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	46.5	1.0e-22
AXE59071.1|3963344_3965486_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.0	1.1e-25
AXE59072.1|3965695_3966214_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
AXE59073.1|3966910_3967411_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
AXE59074.1|3967445_3967670_+	hypothetical protein	NA	NA	NA	NA	NA
AXE59075.1|3967720_3969196_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
AXE59076.1|3969202_3969616_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
AXE59077.1|3969619_3971470_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
AXE59078.1|3971433_3972516_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
AXE59079.1|3972540_3973821_+	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
AXE59080.1|3973817_3974342_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
AXE59081.1|3974344_3975676_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
>prophage 13
CP030939	Escherichia coli strain AMSHJX01 chromosome, complete genome	5023979	4223193	4303450	5023979	plate,holin,tRNA,transposase,integrase,protease,tail,capsid,head,terminase,portal	Shigella_phage(41.67%)	95	4272709:4272724	4304161:4304176
AXE59296.1|4223193_4224174_-|transposase	IS110 family transposase IS621	transposase	NA	NA	NA	NA
AXE59297.1|4224433_4224730_-	DUF2502 domain-containing protein	NA	NA	NA	NA	NA
AXE59298.1|4224943_4226230_-	threonine synthase	NA	NA	NA	NA	NA
AXE59299.1|4226230_4227163_-	homoserine kinase	NA	NA	NA	NA	NA
AXE59300.1|4227164_4229627_-	bifunctional aspartate kinase/homoserine dehydrogenase I	NA	NA	NA	NA	NA
AXE60189.1|4229707_4229773_-	thr operon leader peptide	NA	NA	NA	NA	NA
AXE59301.1|4229986_4230673_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
AXE59302.1|4231072_4231213_-	hypothetical protein	NA	NA	NA	NA	NA
AXE59303.1|4231308_4232025_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AXE59304.1|4232084_4233437_-	cell envelope integrity protein CreD	NA	NA	NA	NA	NA
AXE59305.1|4233494_4234919_-	two-component system sensor histidine kinase CreC	NA	Q8QKV7	Ectocarpus_siliculosus_virus	21.7	1.2e-09
AXE59306.1|4234918_4235608_-	two-component system response regulator CreB	NA	W8CYM9	Bacillus_phage	35.3	8.8e-30
AXE59307.1|4235620_4236094_-	protein CreA	NA	NA	NA	NA	NA
AXE59308.1|4236304_4237174_+	right origin-binding protein	NA	NA	NA	NA	NA
AXE59309.1|4237170_4237818_-	phosphoglycerate mutase GpmB	NA	NA	NA	NA	NA
AXE60190.1|4237869_4238391_+	non-canonical purine NTP phosphatase	NA	NA	NA	NA	NA
AXE59310.1|4238405_4238669_-	hypothetical protein	NA	NA	NA	NA	NA
AXE59311.1|4238660_4239641_+|transposase	IS110 family transposase IS621	transposase	NA	NA	NA	NA
AXE59312.1|4239754_4240081_-	Trp operon repressor	NA	NA	NA	NA	NA
AXE59313.1|4240170_4242108_-	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	34.8	4.0e-11
AXE60191.1|4242216_4242345_-	methionine aminopeptidase	NA	NA	NA	NA	NA
AXE59314.1|4242318_4243986_+	energy-dependent translational throttle protein EttA	NA	A0A1V0SKJ1	Klosneuvirus	26.4	3.7e-42
AXE59315.1|4244292_4245525_-	trifunctional nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase/transcriptional regulator NadR	NA	A0A0C5K935	Enterococcus_phage	42.6	1.6e-82
AXE59316.1|4245545_4246928_-	DNA repair protein RadA	NA	NA	NA	NA	NA
AXE59317.1|4246976_4247945_-	phosphoserine phosphatase	NA	NA	NA	NA	NA
AXE59318.1|4248050_4248695_+	protein Smp	NA	NA	NA	NA	NA
AXE59319.1|4248722_4249739_+	lipoate--protein ligase A	NA	NA	NA	NA	NA
AXE59320.1|4250194_4250914_-	purine-nucleoside phosphorylase	NA	NA	NA	NA	NA
AXE59321.1|4250993_4252217_-	phosphopentomutase	NA	NA	NA	NA	NA
AXE59322.1|4252268_4253591_-	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	39.8	2.3e-79
AXE59323.1|4253717_4254497_-	2-deoxyribose-5-phosphate aldolase	NA	NA	NA	NA	NA
AXE59324.1|4254754_4256305_+	YjjI family glycine radical enzyme	NA	NA	NA	NA	NA
AXE59325.1|4256276_4257140_+	YjjW family glycine radical enzyme activase	NA	NA	NA	NA	NA
AXE59326.1|4257252_4258035_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
AXE59327.1|4258031_4259105_-	patatin family protein	NA	NA	NA	NA	NA
AXE59328.1|4259226_4259406_-	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	64.2	2.0e-10
AXE59329.1|4259514_4260120_-	molecular chaperone OsmY	NA	NA	NA	NA	NA
AXE59330.1|4260512_4262099_-	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	24.9	5.3e-30
AXE59331.1|4262318_4262567_+	damage-inducible protein DinI	NA	K7PLW4	Enterobacteria_phage	100.0	1.8e-38
AXE59332.1|4262875_4263880_+	SppA protein	NA	NA	NA	NA	NA
AXE59333.1|4264093_4264450_-	recombinase family protein	NA	M1T2R9	Escherichia_phage	93.9	3.1e-55
AXE60192.1|4264575_4264869_+	hypothetical protein	NA	NA	NA	NA	NA
AXE59334.1|4264895_4265336_+|tail	tail assembly chaperone	tail	A0A0F7LDZ0	Escherichia_phage	69.0	8.0e-53
AXE59335.1|4265307_4265910_-|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	84.5	5.4e-92
AXE59336.1|4265909_4266710_-|integrase	integrase	integrase	U5P0I1	Shigella_phage	94.4	6.1e-51
AXE59337.1|4266713_4267298_-	DUF2313 domain-containing protein	NA	O22003	Shigella_phage	99.0	5.4e-113
AXE59338.1|4267288_4268347_-|plate	baseplate J/gp47 family protein	plate	M1FQW3	Enterobacteria_phage	99.1	4.3e-201
AXE59339.1|4268333_4268762_-|tail	phage tail protein	tail	U5P0R9	Shigella_phage	99.3	1.5e-80
AXE59340.1|4268758_4269307_-|plate	phage baseplate assembly protein V	plate	U5P081	Shigella_phage	96.7	3.6e-95
AXE59341.1|4269306_4270386_-|plate	baseplate protein	plate	U5P0H6	Shigella_phage	99.4	1.7e-205
AXE59342.1|4270382_4271753_-	DNA circularization protein	NA	S5FUX4	Shigella_phage	97.6	9.0e-252
AXE59343.1|4271771_4273607_-|tail	phage tail tape measure protein	tail	S5FM63	Shigella_phage	98.9	2.5e-305
4272709:4272724	attL	TCGGCATCATCACCAA	NA	NA	NA	NA
AXE59344.1|4273599_4273782_-	hypothetical protein	NA	NA	NA	NA	NA
AXE59345.1|4273748_4274018_-|tail	phage tail assembly protein	tail	M1FPE4	Enterobacteria_phage	100.0	3.5e-43
AXE59346.1|4274017_4274374_-|tail	phage tail protein	tail	U5P076	Shigella_phage	100.0	5.3e-63
AXE59347.1|4274373_4275870_-|tail	phage tail protein	tail	M1FN90	Enterobacteria_phage	96.4	4.5e-265
AXE59348.1|4275853_4276024_-	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	98.2	2.7e-25
AXE59349.1|4276032_4276593_-	hypothetical protein	NA	M1FQV7	Enterobacteria_phage	98.9	8.8e-105
AXE59350.1|4276589_4277096_-	hypothetical protein	NA	Q8SBH5	Shigella_phage	92.9	2.9e-83
AXE59351.1|4277070_4277481_-|head,tail	head-tail adaptor protein	head,tail	M1FJ87	Enterobacteria_phage	93.4	3.3e-69
AXE59352.1|4277477_4277801_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q8SBH7	Shigella_phage	99.1	1.7e-52
AXE59353.1|4277879_4279109_-|capsid	phage major capsid protein	capsid	Q8SBH8	Shigella_phage	99.3	7.6e-226
AXE59354.1|4279119_4279722_-|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	100.0	6.8e-111
AXE59355.1|4279714_4280941_-|portal	phage portal protein	portal	Q8SBI0	Shigella_phage	99.8	3.4e-242
AXE59356.1|4281088_4282822_-|terminase	terminase large subunit	terminase	U5P0Q5	Shigella_phage	98.8	0.0e+00
AXE59357.1|4282835_4283330_-|terminase	phage terminase small subunit P27 family	terminase	Q8SBI1	Shigella_phage	99.4	1.6e-86
AXE59358.1|4283446_4283797_-	HNH endonuclease	NA	M1FQV2	Enterobacteria_phage	94.0	7.5e-62
AXE59359.1|4283924_4284359_-	hypothetical protein	NA	NA	NA	NA	NA
AXE59360.1|4284884_4285277_-	DUF2570 domain-containing protein	NA	A0A192Y6H8	Salmonella_phage	87.5	5.9e-55
AXE59361.1|4285273_4285888_-	glycoside hydrolase family 19 protein	NA	A0A192Y6G4	Salmonella_phage	99.5	2.8e-112
AXE59362.1|4285887_4286169_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	45.2	9.7e-20
AXE59363.1|4286155_4286542_-	hypothetical protein	NA	A0A192Y8P2	Salmonella_phage	99.2	1.6e-60
AXE60193.1|4286621_4286879_-	hypothetical protein	NA	A0A1C9IHX4	Salmonella_phage	95.3	5.6e-38
AXE59364.1|4287029_4287782_-	antitermination protein	NA	Q8SBE4	Shigella_phage	99.6	1.1e-137
AXE59365.1|4287795_4288785_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	100.0	1.5e-195
AXE59366.1|4288792_4289602_-	KilA-N domain-containing protein	NA	Q8SBE6	Shigella_phage	98.5	8.2e-152
AXE59367.1|4289621_4290011_-	RusA family crossover junction endodeoxyribonuclease	NA	A5LH74	Enterobacteria_phage	98.4	1.0e-67
AXE59368.1|4290007_4290367_-	LexA family transcriptional regulator	NA	A0A291AWY9	Escherichia_phage	98.1	6.5e-53
AXE59369.1|4290333_4290828_-	PerC family transcriptional regulator	NA	A0A291AWV6	Escherichia_phage	98.1	2.8e-86
AXE59370.1|4290824_4291643_-	helix-turn-helix domain-containing protein	NA	Q8SBF1	Shigella_phage	100.0	1.8e-122
AXE60194.1|4291639_4291864_-	hypothetical protein	NA	A0A291AX25	Escherichia_phage	98.6	7.0e-37
AXE59371.1|4291868_4292705_-	ash family protein	NA	A0A291AWU3	Escherichia_phage	99.6	8.4e-152
AXE59372.1|4292701_4293253_-	hypothetical protein	NA	A0A291AWW8	Escherichia_phage	99.5	7.6e-101
AXE59373.1|4293296_4293497_-	transcriptional regulator	NA	U5P445	Shigella_phage	100.0	7.9e-32
AXE59374.1|4293587_4294262_+	LexA family transcriptional repressor	NA	U5P0T5	Shigella_phage	99.6	6.0e-132
AXE59375.1|4294331_4294562_+	hypothetical protein	NA	A0A291AWY6	Escherichia_phage	97.4	2.5e-13
AXE59376.1|4294663_4294858_-	hypothetical protein	NA	A0A291AWX8	Escherichia_phage	100.0	1.0e-31
AXE59377.1|4294930_4295293_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
AXE59378.1|4295358_4296183_+	DUF2303 family protein	NA	U5P439	Shigella_phage	99.6	2.3e-149
AXE59379.1|4296310_4296847_+	HD family hydrolase	NA	U5P0T3	Shigella_phage	98.9	1.6e-100
AXE59380.1|4296837_4297200_+	hypothetical protein	NA	U5P092	Shigella_phage	95.8	4.4e-65
AXE59381.1|4297199_4297820_+	DUF551 domain-containing protein	NA	A5LH60	Enterobacteria_phage	91.3	2.2e-112
AXE59382.1|4297819_4298014_+	DNA-binding protein	NA	A5LH59	Enterobacteria_phage	96.9	1.3e-31
AXE59383.1|4298216_4302044_-	hypothetical protein	NA	NA	NA	NA	NA
AXE59384.1|4302226_4303450_-|integrase	site-specific integrase	integrase	A5LH57	Enterobacteria_phage	98.5	4.0e-235
4304161:4304176	attR	TTGGTGATGATGCCGA	NA	NA	NA	NA
>prophage 1
CP030940	Escherichia coli strain AMSHJX01 plasmid pAMSH1, complete sequence	257394	201802	220230	257394	integrase,transposase	Escherichia_phage(37.5%)	19	216647:216660	221713:221726
AXE60418.1|201802_202507_+|transposase	IS6 family transposase IS15DI	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
AXE60419.1|203202_204087_+	DUF3363 domain-containing protein	NA	NA	NA	NA	NA
AXE60420.1|204303_205518_+	chloramphenicol/florfenicol efflux MFS transporter FloR	NA	S4TR35	Salmonella_phage	28.7	5.5e-19
AXE60421.1|205545_205851_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AXE60422.1|206117_207317_-	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
AXE60423.1|207395_208073_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AXE60424.1|208104_208347_-	relaxase	NA	NA	NA	NA	NA
AXE60425.1|208652_209489_-	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
AXE60426.1|209488_210292_-	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
AXE60427.1|210352_211168_-	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	3.5e-09
AXE60428.1|211475_212327_-	replication protein	NA	NA	NA	NA	NA
AXE60429.1|212313_213021_-	hypothetical protein	NA	NA	NA	NA	NA
AXE60430.1|213082_213787_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AXE60431.1|213891_214293_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
AXE60432.1|214442_215303_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
AXE60433.1|215485_216043_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	100.0	7.0e-94
216647:216660	attL	GGCGACAGGGTGGC	NA	NA	NA	NA
AXE60434.1|218030_218735_-|transposase	IS6 family transposase IS15DI	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
AXE60435.1|218963_219278_-|transposase	transposase	transposase	NA	NA	NA	NA
AXE60436.1|219216_220230_-|integrase	integron integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
221713:221726	attR	GCCACCCTGTCGCC	NA	NA	NA	NA
>prophage 2
CP030940	Escherichia coli strain AMSHJX01 plasmid pAMSH1, complete sequence	257394	239647	247643	257394	integrase,transposase	Escherichia_phage(33.33%)	11	238859:238871	244361:244373
238859:238871	attL	CATAACATCAAAC	NA	NA	NA	NA
AXE60458.1|239647_240352_-|transposase	IS6 family transposase IS15DI	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
AXE60459.1|240342_240564_+	hypothetical protein	NA	NA	NA	NA	NA
AXE60460.1|240610_241486_-	class A extended-spectrum beta-lactamase CTX-M-55	NA	A0A1B0VBP7	Salmonella_phage	82.1	2.4e-125
AXE60461.1|242083_242788_-|transposase	IS6 family transposase IS15DI	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
AXE60462.1|243016_243331_-|transposase	transposase	transposase	NA	NA	NA	NA
AXE60463.1|243269_244283_-|integrase	integron integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
AXE60484.1|244574_245129_+	fluoroquinolone-acetylating aminoglycoside 6'-N-acetyltransferase AAC(6')-Ib-cr5	NA	NA	NA	NA	NA
244361:244373	attR	GTTTGATGTTATG	NA	NA	NA	NA
AXE60464.1|245225_245678_+	NAD(+)--rifampin ADP-ribosyltransferase Arr-3	NA	NA	NA	NA	NA
AXE60465.1|245810_246284_+	trimethoprim-resistant dihydrofolate reductase DfrA27	NA	G3MBI7	Bacillus_virus	29.1	1.4e-15
AXE60466.1|246462_246810_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
AXE60467.1|246803_247643_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
