The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP029495	Chromobacterium sp. IIBBL 112-1 chromosome, complete genome	4789562	799561	808604	4789562	tRNA	Caulobacter_phage(16.67%)	10	NA	NA
AXE29144.1|799561_801376_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	40.1	2.7e-70
AXE29145.1|801393_801840_-|tRNA	glutamyl-tRNA amidotransferase	tRNA	A0A292GL36	Xanthomonas_phage	47.9	2.7e-24
AXE29146.1|801950_802163_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
AXE32548.1|802326_803127_-	thiazole synthase	NA	NA	NA	NA	NA
AXE29147.1|803169_803370_-	thiamine biosynthesis protein ThiS	NA	NA	NA	NA	NA
AXE29148.1|803375_805532_-	guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A2K9L285	Tupanvirus	39.2	1.9e-09
AXE29149.1|805552_805759_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
AXE29150.1|805841_806474_-	guanylate kinase	NA	U5J9X2	Bacillus_phage	32.3	4.7e-14
AXE29151.1|806638_807937_+	guanine permease	NA	A0A0R6PHV4	Moraxella_phage	36.4	1.1e-60
AXE29152.1|808046_808604_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	41.9	6.9e-33
>prophage 2
CP029495	Chromobacterium sp. IIBBL 112-1 chromosome, complete genome	4789562	1476569	1581678	4789562	protease,plate,transposase,tail	Burkholderia_phage(44.44%)	91	NA	NA
AXE29658.1|1476569_1477157_+|tail	phage tail protein	tail	A0A0U4JXW2	Arthrobacter_phage	37.9	3.0e-10
AXE29659.1|1477257_1477593_+	hypothetical protein	NA	NA	NA	NA	NA
AXE29660.1|1477655_1478183_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AXE32606.1|1478223_1480281_-	peptidase M50	NA	NA	NA	NA	NA
AXE29661.1|1480326_1481652_-	secretion protein HylD	NA	NA	NA	NA	NA
AXE29662.1|1481655_1482396_-	efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AXE29663.1|1482392_1483913_-	transporter	NA	NA	NA	NA	NA
AXE29664.1|1483998_1491090_-	hypothetical protein	NA	NA	NA	NA	NA
AXE29665.1|1491302_1492079_+	16S rRNA methyltransferase	NA	NA	NA	NA	NA
AXE29666.1|1492070_1492418_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
AXE29667.1|1492414_1493509_-	cytochrome	NA	NA	NA	NA	NA
AXE29668.1|1493505_1494132_-	hypothetical protein	NA	NA	NA	NA	NA
AXE29669.1|1494212_1494926_+	transcriptional regulator	NA	NA	NA	NA	NA
AXE29670.1|1495075_1495573_+	histidine kinase	NA	NA	NA	NA	NA
AXE29671.1|1495644_1496040_-	4-hydroxybenzoyl-CoA thioesterase	NA	NA	NA	NA	NA
AXE32607.1|1496314_1496611_-	DUF2325 domain-containing protein	NA	NA	NA	NA	NA
AXE29672.1|1496814_1498128_+	sodium:proton antiporter	NA	NA	NA	NA	NA
AXE32608.1|1498138_1498357_+	SlyX protein	NA	NA	NA	NA	NA
AXE29673.1|1498713_1499220_+	hypothetical protein	NA	NA	NA	NA	NA
AXE29674.1|1499268_1499844_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AXE29675.1|1499863_1500781_-	EamA/RhaT family transporter	NA	NA	NA	NA	NA
AXE29676.1|1500834_1502040_+	succinyldiaminopimelate transaminase	NA	NA	NA	NA	NA
AXE32609.1|1502107_1502929_+	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase	NA	NA	NA	NA	NA
AXE32610.1|1503243_1504095_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.3	1.1e-21
AXE29677.1|1504087_1504873_+	lipid asymmetry maintenance ABC transporter permease subunit MlaE	NA	NA	NA	NA	NA
AXE29678.1|1504884_1505352_+	outer membrane lipid asymmetry maintenance protein MlaD	NA	NA	NA	NA	NA
AXE29679.1|1505422_1506052_+	ABC transporter	NA	NA	NA	NA	NA
AXE29680.1|1506051_1506339_+	NTP-binding protein	NA	NA	NA	NA	NA
AXE29681.1|1506341_1507148_+	ABC transporter	NA	NA	NA	NA	NA
AXE29682.1|1507231_1507570_+	alkylphosphonate utilization protein	NA	NA	NA	NA	NA
AXE29683.1|1507628_1508249_-	hydrolase	NA	NA	NA	NA	NA
AXE29684.1|1508357_1509221_-	quercetin 2,3-dioxygenase	NA	NA	NA	NA	NA
AXE29685.1|1509340_1510246_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AXE29686.1|1510306_1511560_-	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
AXE29687.1|1511573_1511819_-	BolA family transcriptional regulator	NA	NA	NA	NA	NA
AXE29688.1|1511849_1512605_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
AXE32611.1|1512601_1513504_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	34.1	2.8e-20
AXE29689.1|1513588_1514236_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AXE29690.1|1514446_1515634_+	efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AXE29691.1|1515654_1518798_+	hydrophobe/amphiphile efflux-1 family RND transporter	NA	NA	NA	NA	NA
AXE29692.1|1518790_1520191_+	transporter	NA	NA	NA	NA	NA
AXE29693.1|1520305_1520932_-	hypothetical protein	NA	NA	NA	NA	NA
AXE29694.1|1520931_1522365_-	hypothetical protein	NA	A0A1L2K2Q1	Aeribacillus_phage	49.1	4.5e-20
AXE29695.1|1522364_1522940_-|tail	phage tail protein	tail	A4JWL7	Burkholderia_virus	58.0	3.1e-52
AXE29696.1|1524916_1525663_-|tail	phage tail protein	tail	NA	NA	NA	NA
AXE29697.1|1526353_1527520_-|plate	baseplate protein	plate	Q6QI99	Burkholderia_phage	46.6	1.1e-75
AXE29698.1|1527545_1527938_-|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	56.2	3.1e-32
AXE29699.1|1527974_1528712_-|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	41.9	4.0e-20
AXE29700.1|1528798_1529413_-|tail	phage tail protein	tail	B5TK78	Pseudomonas_phage	45.0	2.1e-11
AXE29701.1|1529413_1531330_-	hypothetical protein	NA	A0A077K818	Ralstonia_phage	54.9	1.1e-77
AXE32612.1|1531371_1532034_-|plate	phage baseplate assembly protein V	plate	Q6QIA1	Burkholderia_phage	50.8	9.7e-26
AXE29702.1|1532045_1533104_-	phage protein D	NA	Q6QIA2	Burkholderia_phage	43.9	1.2e-75
AXE29703.1|1533088_1533304_-	hypothetical protein	NA	Q6QIA3	Burkholderia_phage	57.1	2.5e-15
AXE29704.1|1533307_1534222_-	hypothetical protein	NA	Q6QIA4	Burkholderia_phage	42.6	4.9e-36
AXE29705.1|1534250_1536800_-	hypothetical protein	NA	NA	NA	NA	NA
AXE29706.1|1537064_1537319_-|tail	phage tail assembly protein	tail	Q6QIA8	Burkholderia_phage	50.0	9.4e-14
AXE29707.1|1537489_1538014_-|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	76.4	1.1e-75
AXE29708.1|1538016_1539444_-|tail	phage tail protein	tail	A4JWK5	Burkholderia_virus	73.8	1.4e-202
AXE29709.1|1539446_1539641_-	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	61.4	1.7e-10
AXE29710.1|1539637_1540300_-	hypothetical protein	NA	Q6QIB2	Burkholderia_phage	35.3	2.0e-18
AXE32613.1|1540332_1540653_+	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	55.6	3.9e-25
AXE29711.1|1540790_1541945_+	branched chain amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AXE29712.1|1547897_1549238_+	hypothetical protein	NA	NA	NA	NA	NA
AXE29713.1|1549306_1550653_-	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	29.3	3.9e-42
AXE29714.1|1550697_1551249_-	HslU--HslV peptidase proteolytic subunit	NA	NA	NA	NA	NA
AXE29715.1|1551391_1552084_+	energy transducer TonB	NA	NA	NA	NA	NA
AXE29716.1|1552080_1552758_+	biopolymer transporter ExbB	NA	NA	NA	NA	NA
AXE29717.1|1552744_1553155_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
AXE29718.1|1554022_1555876_+|protease	cysteine protease	protease	NA	NA	NA	NA
AXE29719.1|1556062_1556623_+	aerotaxis receptor Aer	NA	A0A1B0V854	Salmonella_phage	44.2	8.7e-28
AXE29720.1|1556619_1558038_+	chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	48.0	2.0e-12
AXE29721.1|1558124_1558871_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AXE29722.1|1559103_1560609_-	aldehyde dehydrogenase	NA	NA	NA	NA	NA
AXE32614.1|1560946_1562716_+	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
AXE29723.1|1562734_1563814_-	XRE family transcriptional regulator	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	47.1	4.6e-17
AXE29724.1|1563800_1564574_-	isocitrate lyase/phosphoenolpyruvate mutase family protein	NA	NA	NA	NA	NA
AXE29725.1|1564795_1565500_-	16S rRNA pseudouridine(516) synthase	NA	NA	NA	NA	NA
AXE29726.1|1565600_1566584_+	hypothetical protein	NA	NA	NA	NA	NA
AXE29727.1|1566565_1568506_-	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	32.1	4.5e-15
AXE29728.1|1568583_1569468_-	hypothetical protein	NA	NA	NA	NA	NA
AXE29729.1|1569570_1570140_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AXE32615.1|1570127_1570871_-	hypothetical protein	NA	NA	NA	NA	NA
AXE29730.1|1571055_1572471_-	RNA helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.7	2.2e-51
AXE29731.1|1572703_1573363_+	hypothetical protein	NA	NA	NA	NA	NA
AXE29732.1|1573438_1573975_+	hypothetical protein	NA	NA	NA	NA	NA
AXE29733.1|1573938_1574169_-	hypothetical protein	NA	NA	NA	NA	NA
AXE29734.1|1574317_1574848_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AXE32616.1|1575406_1575898_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
AXE29735.1|1576040_1579130_-	ABC transporter	NA	A0A1B1IUG5	uncultured_Mediterranean_phage	24.0	4.1e-10
AXE29736.1|1579244_1580657_-	DUF4263 domain-containing protein	NA	NA	NA	NA	NA
AXE29737.1|1580875_1581678_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 3
CP029495	Chromobacterium sp. IIBBL 112-1 chromosome, complete genome	4789562	1598791	1626979	4789562	plate,transposase,tRNA,tail	Haemophilus_phage(23.53%)	31	NA	NA
AXE29754.1|1598791_1599730_+	alpha/beta hydrolase	NA	A0A167RJ59	Powai_lake_megavirus	25.6	3.5e-21
AXE29755.1|1599799_1600384_-	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	31.3	7.0e-12
AXE29756.1|1600465_1601230_-	phage repressor protein C	NA	A0SML1	Pseudomonas_virus	27.8	2.4e-20
AXE29757.1|1601551_1601971_+	DNA transposition protein	NA	A0A0M3LRS6	Mannheimia_phage	34.5	9.8e-08
AXE29758.1|1602053_1602458_+	peptidase M15	NA	NA	NA	NA	NA
AXE29759.1|1602460_1602682_+	hypothetical protein	NA	A0A0M4UKB4	Ralstonia_phage	53.2	1.1e-10
AXE29760.1|1602678_1603239_+	hypothetical protein	NA	NA	NA	NA	NA
AXE29761.1|1603235_1603433_+	conjugal transfer protein TraR	NA	NA	NA	NA	NA
AXE29762.1|1603443_1603659_+	hypothetical protein	NA	A0A0M4TUU4	Ralstonia_phage	62.8	3.2e-07
AXE29763.1|1603716_1604379_+	hypothetical protein	NA	A0A0F6YNJ5	Sinorhizobium_phage	39.4	5.1e-11
AXE29764.1|1604464_1605157_+	hypothetical protein	NA	NA	NA	NA	NA
AXE29765.1|1605225_1606650_+|tail	phage tail protein	tail	B7SDP8	Haemophilus_phage	49.1	5.5e-103
AXE29766.1|1606775_1607150_+|tail	phage tail protein	tail	F6MIK8	Haemophilus_phage	55.8	1.8e-29
AXE29767.1|1608697_1609348_+	hypothetical protein	NA	NA	NA	NA	NA
AXE29768.1|1609347_1610652_+	hypothetical protein	NA	A0A2H4JGT4	uncultured_Caudovirales_phage	28.3	4.4e-38
AXE32620.1|1610665_1611682_+|tail	phage tail protein	tail	A0A2H4J9E6	uncultured_Caudovirales_phage	41.3	1.1e-65
AXE29769.1|1611692_1612319_+|plate	phage baseplate assembly protein V	plate	F6MIL4	Haemophilus_phage	49.7	1.4e-37
AXE29770.1|1612378_1612729_+	hypothetical protein	NA	A0A2H4JDR8	uncultured_Caudovirales_phage	55.7	6.0e-27
AXE29771.1|1612728_1613817_+|tail	phage tail protein	tail	A0A0M3LQN4	Mannheimia_phage	46.5	1.8e-82
AXE29772.1|1613813_1614392_+|tail	phage tail protein	tail	F6MIL7	Haemophilus_phage	42.0	3.1e-36
AXE29773.1|1616353_1617019_+	hypothetical protein	NA	K4F693	Cronobacter_phage	33.3	1.0e-06
AXE29774.1|1617195_1618155_+	hypothetical protein	NA	D5LGZ0	Escherichia_phage	41.6	1.5e-27
AXE29775.1|1618213_1619104_-	EamA family transporter	NA	NA	NA	NA	NA
AXE29776.1|1619100_1619745_-|tRNA	alanyl-tRNA editing protein	tRNA	NA	NA	NA	NA
AXE29777.1|1619719_1620181_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AXE29778.1|1620377_1620665_+	hypothetical protein	NA	NA	NA	NA	NA
AXE29779.1|1620724_1621918_+	aromatic amino acid aminotransferase	NA	NA	NA	NA	NA
AXE29780.1|1621974_1622955_-	hypothetical protein	NA	NA	NA	NA	NA
AXE29781.1|1623057_1624161_-	hypothetical protein	NA	NA	NA	NA	NA
AXE32621.1|1624347_1624884_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AXE29782.1|1626177_1626979_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 4
CP029495	Chromobacterium sp. IIBBL 112-1 chromosome, complete genome	4789562	2388456	2396419	4789562		Acanthocystis_turfacea_Chlorella_virus(33.33%)	7	NA	NA
AXE32665.1|2388456_2389899_+	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	28.8	4.7e-49
AXE32666.1|2389904_2390831_+	GDP-fucose synthetase	NA	M1I5W5	Acanthocystis_turfacea_Chlorella_virus	54.3	5.2e-94
AXE30449.1|2390853_2391975_+	GDP-mannose 4,6-dehydratase	NA	M1IBC3	Acanthocystis_turfacea_Chlorella_virus	65.8	7.4e-135
AXE32667.1|2391994_2393005_+	NAD-dependent dehydratase	NA	M4QPK0	Synechococcus_phage	30.1	1.2e-24
AXE30450.1|2393011_2394178_+	LegC family aminotransferase	NA	A0A0F7LAY0	uncultured_marine_virus	25.9	7.2e-16
AXE30451.1|2394174_2395341_+	UDP-N-acetylglucosamine 2-epimerase (hydrolyzing)	NA	NA	NA	NA	NA
AXE30452.1|2395333_2396419_+	N-acetylneuraminate synthase	NA	A0A1B1IVE2	uncultured_Mediterranean_phage	27.8	3.1e-21
>prophage 5
CP029495	Chromobacterium sp. IIBBL 112-1 chromosome, complete genome	4789562	2416048	2421527	4789562		Escherichia_phage(50.0%)	6	NA	NA
AXE30471.1|2416048_2416336_+	co-chaperone GroES	NA	A0A221S308	uncultured_virus	43.5	2.5e-15
AXE30472.1|2416383_2418024_+	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	65.0	1.1e-179
AXE30473.1|2418116_2418659_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	58.9	5.4e-51
AXE30474.1|2418665_2419535_-	glucose-1-phosphate thymidylyltransferase	NA	A0A291LA53	Escherichia_phage	61.7	2.0e-100
AXE30475.1|2419531_2420476_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	35.2	3.1e-25
AXE30476.1|2420468_2421527_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	46.9	1.0e-85
>prophage 6
CP029495	Chromobacterium sp. IIBBL 112-1 chromosome, complete genome	4789562	2426119	2466657	4789562	protease,plate	uncultured_Caudovirales_phage(66.67%)	37	NA	NA
AXE30482.1|2426119_2426551_+|protease	ClpXP protease specificity-enhancing factor	protease	NA	NA	NA	NA
AXE30483.1|2426667_2427978_-	ammonia channel protein	NA	NA	NA	NA	NA
AXE32670.1|2428005_2428344_-	P-II family nitrogen regulator	NA	NA	NA	NA	NA
AXE30484.1|2428639_2428927_+	phosphoheptose isomerase	NA	NA	NA	NA	NA
AXE30485.1|2428932_2430438_+|protease	ATP-dependent protease	protease	NA	NA	NA	NA
AXE30486.1|2430496_2431243_+	SPOR domain-containing protein	NA	NA	NA	NA	NA
AXE30487.1|2431272_2431884_+	disulfide bond formation protein DsbA	NA	NA	NA	NA	NA
AXE30488.1|2432816_2433758_+	ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
AXE30489.1|2433764_2435807_+	cytochrome o ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
AXE30490.1|2435822_2436434_+	cytochrome o ubiquinol oxidase subunit III	NA	NA	NA	NA	NA
AXE30491.1|2436433_2436757_+	cytochrome o ubiquinol oxidase subunit IV	NA	NA	NA	NA	NA
AXE30492.1|2436768_2437677_+	protoheme IX farnesyltransferase	NA	NA	NA	NA	NA
AXE30493.1|2437748_2438300_-	hypothetical protein	NA	NA	NA	NA	NA
AXE30494.1|2438483_2439839_-	hypothetical protein	NA	NA	NA	NA	NA
AXE30495.1|2439838_2440276_-	hypothetical protein	NA	NA	NA	NA	NA
AXE30496.1|2440837_2443591_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	27.8	5.7e-88
AXE30497.1|2443610_2444090_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
AXE30498.1|2444086_2444788_-	type VI secretion system protein ImpK	NA	NA	NA	NA	NA
AXE30499.1|2444795_2446142_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
AXE30500.1|2446191_2446725_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
AXE30501.1|2447032_2447743_+	peptidase M15	NA	A8ATW4	Listeria_phage	36.9	1.8e-09
AXE30502.1|2447771_2451554_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
AXE32671.1|2451568_2452585_+	type VI secretion system-associated protein TagF	NA	NA	NA	NA	NA
AXE30503.1|2452625_2453132_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
AXE30504.1|2453128_2454607_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
AXE30505.1|2454675_2455173_+	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
AXE30506.1|2455246_2455684_+	hypothetical protein	NA	NA	NA	NA	NA
AXE30507.1|2455794_2458413_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	27.8	7.8e-87
AXE30508.1|2458409_2459192_+	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
AXE30509.1|2459195_2459651_+	hypothetical protein	NA	NA	NA	NA	NA
AXE30510.1|2459647_2460307_+	hypothetical protein	NA	NA	NA	NA	NA
AXE30511.1|2460340_2460646_+	hypothetical protein	NA	NA	NA	NA	NA
AXE30512.1|2460722_2461376_+	hypothetical protein	NA	NA	NA	NA	NA
AXE30513.1|2461372_2463388_+	DUF2235 domain-containing protein	NA	NA	NA	NA	NA
AXE30514.1|2463406_2465266_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
AXE30515.1|2465336_2465636_+	hypothetical protein	NA	NA	NA	NA	NA
AXE30516.1|2465628_2466657_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
>prophage 7
CP029495	Chromobacterium sp. IIBBL 112-1 chromosome, complete genome	4789562	2975098	2987783	4789562	tRNA	uncultured_Mediterranean_phage(25.0%)	13	NA	NA
AXE30950.1|2975098_2975422_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	41.3	7.8e-13
AXE30951.1|2975646_2976762_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	45.5	1.4e-85
AXE30952.1|2977157_2979059_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	38.0	2.4e-125
AXE30953.1|2979092_2979620_+	translation initiation factor IF-3	NA	A0A2I7S9Q1	Vibrio_phage	29.0	8.0e-07
AXE30954.1|2979773_2979971_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
AXE30955.1|2979984_2980344_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
AXE30956.1|2980482_2981469_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.6	1.2e-32
AXE30957.1|2981487_2983845_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	A0A1L3IZU3	BeAn_58058_virus	24.4	5.2e-05
AXE30958.1|2983916_2984219_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	8.0e-12
AXE30959.1|2984199_2984559_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
AXE30960.1|2984860_2985238_+	hypothetical protein	NA	NA	NA	NA	NA
AXE30961.1|2985294_2985870_+	hypothetical protein	NA	NA	NA	NA	NA
AXE30962.1|2985983_2987783_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	38.5	2.0e-17
>prophage 8
CP029495	Chromobacterium sp. IIBBL 112-1 chromosome, complete genome	4789562	3762882	3767841	4789562		Aeromonas_phage(16.67%)	7	NA	NA
AXE31589.1|3762882_3763377_-	hypothetical protein	NA	A0A1I9KF82	Aeromonas_phage	50.0	7.5e-07
AXE31590.1|3763373_3763700_-	hypothetical protein	NA	NA	NA	NA	NA
AXE31591.1|3763696_3764611_-	recombination-associated protein RdgC	NA	B5AX95	Iodobacteriophage	37.2	1.8e-38
AXE31592.1|3765052_3765466_-	single-stranded DNA-binding protein	NA	K4I3C5	Acinetobacter_phage	32.1	3.4e-13
AXE31593.1|3765473_3766448_-	hypothetical protein	NA	A0A2I7QQ55	Vibrio_phage	46.7	1.4e-25
AXE31594.1|3766449_3767064_-	exonuclease	NA	A0A0U4JVN8	Pseudomonas_phage	60.4	2.4e-63
AXE31595.1|3767067_3767841_-	phage recombination protein Bet	NA	A0A0N7C1T0	Escherichia_phage	68.4	7.5e-70
>prophage 9
CP029495	Chromobacterium sp. IIBBL 112-1 chromosome, complete genome	4789562	3776401	3782300	4789562		Bacteriophage(12.5%)	10	NA	NA
AXE31608.1|3776401_3776914_+	adenine methyltransferase	NA	A0A0C5AN16	Bacteriophage	60.7	1.9e-45
AXE31609.1|3776913_3777120_+	hypothetical protein	NA	NA	NA	NA	NA
AXE31610.1|3777449_3778232_+	hypothetical protein	NA	F8TUJ5	EBPR_podovirus	45.9	1.3e-08
AXE31611.1|3778231_3779041_+	hypothetical protein	NA	A0A067ZJ24	Vibrio_phage	42.4	3.2e-39
AXE32746.1|3779088_3779475_+	hypothetical protein	NA	A5VW91	Enterobacteria_phage	53.7	2.4e-21
AXE31612.1|3779569_3779956_+	hypothetical protein	NA	A0A2K8HR56	Pseudomonas_phage	64.1	3.1e-32
AXE31613.1|3779952_3780141_+	hypothetical protein	NA	NA	NA	NA	NA
AXE31614.1|3780202_3781627_+	hypothetical protein	NA	A0A292GAH2	Xanthomonas_phage	42.8	5.7e-100
AXE32748.1|3781623_3781959_+	hypothetical protein	NA	A0A068CDI5	Rhizobium_phage	63.2	8.6e-31
AXE32747.1|3781955_3782300_+	DUF1064 domain-containing protein	NA	A0A0F6R8N5	Escherichia_coli_O157_typing_phage	71.1	9.1e-44
>prophage 10
CP029495	Chromobacterium sp. IIBBL 112-1 chromosome, complete genome	4789562	3787155	3819145	4789562	terminase,holin,tail,integrase	Mannheimia_phage(17.39%)	39	3814346:3814360	3820847:3820861
AXE31624.1|3787155_3787587_+	hypothetical protein	NA	G5DE94	Salmonella_phage	33.3	7.7e-08
AXE31625.1|3787607_3788201_+	hypothetical protein	NA	A0A2H4J1J5	uncultured_Caudovirales_phage	51.3	8.1e-40
AXE31626.1|3788187_3789462_+|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	64.6	6.6e-156
AXE31627.1|3789503_3790880_+	hypothetical protein	NA	A0A0H5AWC7	Pseudomonas_phage	48.3	6.5e-109
AXE31628.1|3790879_3791953_+	hypothetical protein	NA	A0A0H5BBX3	Pseudomonas_phage	45.6	1.4e-77
AXE31629.1|3792045_3792564_+	hypothetical protein	NA	NA	NA	NA	NA
AXE31630.1|3793270_3794011_+	hypothetical protein	NA	A0A0M3LQV7	Mannheimia_phage	61.4	7.1e-70
AXE31631.1|3794020_3794983_+	hypothetical protein	NA	A0A0M3LQL5	Mannheimia_phage	65.0	5.6e-115
AXE31632.1|3795016_3795325_+	hypothetical protein	NA	NA	NA	NA	NA
AXE31633.1|3795343_3795796_+	hypothetical protein	NA	A0A2D0W9N0	Bordetella_phage	36.8	6.4e-13
AXE31634.1|3795795_3796152_+	hypothetical protein	NA	NA	NA	NA	NA
AXE31635.1|3796414_3796924_+	hypothetical protein	NA	NA	NA	NA	NA
AXE31636.1|3796962_3797376_+	hypothetical protein	NA	NA	NA	NA	NA
AXE31637.1|3797385_3797853_+	hypothetical protein	NA	NA	NA	NA	NA
AXE31638.1|3797942_3798182_+	hypothetical protein	NA	A0A0M3LQT0	Mannheimia_phage	48.9	9.8e-05
AXE32750.1|3798704_3798989_-	hypothetical protein	NA	NA	NA	NA	NA
AXE31639.1|3799817_3803531_+	hypothetical protein	NA	A0A2I2L6P9	Escherichia_phage	31.3	1.3e-39
AXE31640.1|3803545_3803890_+	hypothetical protein	NA	A0A0P0ZDL9	Stx2-converting_phage	35.3	1.2e-08
AXE31641.1|3803891_3804590_+|tail	phage minor tail protein L	tail	A0A0M3LSQ5	Mannheimia_phage	29.7	4.1e-19
AXE31642.1|3804647_3805331_+	peptidase P60	NA	A0A1W6JP31	Morganella_phage	43.6	1.4e-48
AXE31643.1|3805323_3805956_+	hypothetical protein	NA	Q6JIL3	Burkholderia_virus	33.0	1.3e-16
AXE31644.1|3805992_3809652_+	hypothetical protein	NA	A0A2R3UA88	Siphoviridae_environmental_samples	33.2	9.7e-144
AXE31645.1|3809655_3810018_+	hypothetical protein	NA	NA	NA	NA	NA
AXE31646.1|3810014_3810236_+	hypothetical protein	NA	NA	NA	NA	NA
AXE31647.1|3810235_3810901_+	hypothetical protein	NA	NA	NA	NA	NA
AXE31648.1|3810909_3811200_+	hypothetical protein	NA	NA	NA	NA	NA
AXE31649.1|3811218_3811497_+|holin	holin	holin	C7BGD7	Burkholderia_phage	62.1	1.0e-21
AXE31650.1|3811493_3811676_-	hypothetical protein	NA	NA	NA	NA	NA
AXE31651.1|3811779_3812220_+	muraminidase	NA	A0A088FRS5	Escherichia_phage	56.8	1.3e-39
AXE31652.1|3812831_3813473_+	DUF159 family protein	NA	C7BGE4	Burkholderia_phage	41.4	2.6e-44
AXE31653.1|3813472_3813784_+	hypothetical protein	NA	NA	NA	NA	NA
AXE31654.1|3813780_3815055_-	DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	45.6	6.1e-93
3814346:3814360	attL	CTGACGCCGTTCAGC	NA	NA	NA	NA
AXE31655.1|3815051_3815480_-	error-prone repair protein UmuD	NA	A0A2H4J538	uncultured_Caudovirales_phage	50.8	2.7e-29
AXE31656.1|3815547_3816078_-	endonuclease	NA	A0A1B2LRT6	Wolbachia_phage	44.4	3.6e-23
AXE31657.1|3816077_3816281_-	hypothetical protein	NA	NA	NA	NA	NA
AXE31658.1|3816366_3816936_-	hypothetical protein	NA	NA	NA	NA	NA
AXE31659.1|3817064_3817310_-	hypothetical protein	NA	NA	NA	NA	NA
AXE31660.1|3817306_3817924_-	hypothetical protein	NA	A2I303	Vibrio_virus	30.1	1.9e-12
AXE31661.1|3817969_3819145_-|integrase	integrase	integrase	Q7M297	Enterobacteria_phage	40.6	1.7e-81
3820847:3820861	attR	CTGACGCCGTTCAGC	NA	NA	NA	NA
>prophage 11
CP029495	Chromobacterium sp. IIBBL 112-1 chromosome, complete genome	4789562	4517801	4552911	4789562	holin,portal,capsid,plate,integrase,tail,head	Burkholderia_phage(25.81%)	46	4516271:4516319	4553029:4553077
4516271:4516319	attL	ACTTGTAATCAGGGGGTCGCGAGTTCGATTCCTGCCGCCGGCACCAAAT	NA	NA	NA	NA
AXE32221.1|4517801_4518839_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	63.9	7.8e-131
AXE32222.1|4518838_4520602_-	oxidoreductase	NA	E5FFI8	Burkholderia_phage	67.2	3.4e-227
AXE32223.1|4520756_4521578_+|capsid	phage capsid protein	capsid	A0A1S5NPS0	Burkholderia_phage	55.6	4.8e-67
AXE32224.1|4521608_4522634_+|capsid	phage major capsid protein, P2 family	capsid	A4JWU7	Burkholderia_virus	61.3	1.2e-112
AXE32225.1|4522633_4523308_+	hypothetical protein	NA	A4PE31	Ralstonia_virus	51.7	3.2e-53
AXE32226.1|4523397_4523868_+|head	head completion/stabilization protein	head	A4PE32	Ralstonia_virus	55.3	2.1e-35
AXE32227.1|4523867_4524080_+|tail	phage tail protein	tail	A0A077K8R0	Ralstonia_phage	62.9	1.4e-15
AXE32228.1|4524082_4524454_+	hypothetical protein	NA	A0A1S5NRL1	Burkholderia_phage	48.4	4.9e-19
AXE32229.1|4524450_4524762_+|holin	phage holin family protein	holin	A4PE35	Ralstonia_virus	50.0	1.3e-12
AXE32230.1|4524752_4525553_+	peptidoglycan-binding protein	NA	A0A2H4JGJ9	uncultured_Caudovirales_phage	53.3	5.9e-70
AXE32231.1|4525522_4525786_-	hypothetical protein	NA	NA	NA	NA	NA
AXE32232.1|4525874_4526156_+	hypothetical protein	NA	NA	NA	NA	NA
AXE32233.1|4526152_4526365_+	conjugal transfer protein TraR	NA	NA	NA	NA	NA
AXE32234.1|4526361_4526760_+|tail	phage tail protein	tail	A0A077K8R3	Ralstonia_phage	45.8	4.9e-25
AXE32235.1|4526756_4527200_+	phage virion morphogenesis protein	NA	A0A077K9X5	Ralstonia_phage	54.1	3.0e-31
AXE32236.1|4528266_4528914_+|plate	phage baseplate assembly protein V	plate	E5E3R1	Burkholderia_phage	54.0	8.2e-54
AXE32237.1|4528910_4529273_+|plate	baseplate assembly protein	plate	A0A2H4JE52	uncultured_Caudovirales_phage	45.9	1.1e-20
AXE32238.1|4529277_4530219_+	hypothetical protein	NA	R4JDM0	Burkholderia_phage	46.4	3.5e-53
AXE32239.1|4530215_4530782_+|tail	phage tail protein I	tail	A4PE44	Ralstonia_virus	41.9	4.1e-09
AXE32240.1|4530778_4531978_+	hypothetical protein	NA	A0A077K818	Ralstonia_phage	38.1	2.3e-41
AXE32241.1|4531990_4532560_+	hypothetical protein	NA	K7PMH7	Enterobacteria_phage	34.2	1.2e-13
AXE32242.1|4532618_4532876_-	hypothetical protein	NA	NA	NA	NA	NA
AXE32243.1|4532936_4533344_-	hypothetical protein	NA	NA	NA	NA	NA
AXE32244.1|4533473_4534646_+|tail	phage tail protein	tail	A4PE49	Ralstonia_virus	65.9	4.6e-148
AXE32245.1|4534661_4535171_+|tail	phage major tail tube protein	tail	A0A077KER7	Ralstonia_phage	50.9	4.8e-41
AXE32246.1|4535216_4535504_+|tail	phage tail assembly protein	tail	E5E3Q1	Burkholderia_phage	66.3	7.9e-25
AXE32247.1|4535512_4535632_+|tail	GpE family phage tail protein	tail	E5E3Q0	Burkholderia_phage	66.7	6.8e-07
AXE32248.1|4535586_4538475_+|tail	phage tail tape measure protein	tail	A0A1S6L010	Salmonella_phage	40.3	4.9e-114
AXE32249.1|4538493_4538922_+	oxidoreductase	NA	A0A1S5NTH4	Burkholderia_phage	60.6	4.8e-42
AXE32250.1|4538918_4540118_+|tail	phage tail protein	tail	A4PE54	Ralstonia_virus	51.3	7.2e-96
AXE32251.1|4540381_4541206_-	hypothetical protein	NA	NA	NA	NA	NA
AXE32252.1|4541263_4541590_+	hypothetical protein	NA	A0A0F7LDZ2	Escherichia_phage	55.4	3.0e-20
AXE32253.1|4541823_4542828_+	hypothetical protein	NA	NA	NA	NA	NA
AXE32254.1|4543015_4543432_-	hypothetical protein	NA	NA	NA	NA	NA
AXE32255.1|4544401_4544674_+	hypothetical protein	NA	NA	NA	NA	NA
AXE32256.1|4545367_4545943_-	hypothetical protein	NA	Q4ZA70	Staphylococcus_virus	39.7	8.4e-26
AXE32257.1|4546130_4546469_-	transcriptional regulator	NA	Q5ZQZ8	Pseudomonas_phage	37.9	1.9e-06
AXE32258.1|4546780_4547233_+	hypothetical protein	NA	NA	NA	NA	NA
AXE32259.1|4547235_4547517_+	transcriptional regulator	NA	A4PE60	Ralstonia_virus	44.3	2.9e-08
AXE32260.1|4547600_4550303_+	bifunctional DNA primase/helicase	NA	A0A077K8T2	Ralstonia_phage	51.3	9.7e-258
AXE32261.1|4550324_4550510_+	hypothetical protein	NA	NA	NA	NA	NA
AXE32262.1|4550506_4550725_+	hypothetical protein	NA	NA	NA	NA	NA
AXE32263.1|4550735_4551083_+	hypothetical protein	NA	NA	NA	NA	NA
AXE32264.1|4551084_4551384_+	transcriptional regulator	NA	NA	NA	NA	NA
AXE32265.1|4551646_4551877_+	hypothetical protein	NA	NA	NA	NA	NA
AXE32802.1|4551954_4552911_+|integrase	integrase	integrase	C8CLF4	Xylella_phage	42.3	1.0e-52
4553029:4553077	attR	ACTTGTAATCAGGGGGTCGCGAGTTCGATTCCTGCCGCCGGCACCAAAT	NA	NA	NA	NA
