The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP030225	Salmonella enterica strain SA20041605 chromosome, complete genome	4739617	643822	690967	4739617	tRNA,head,tail,lysis,plate,capsid,integrase,portal	Salmonella_phage(82.22%)	59	637889:637907	689682:689700
637889:637907	attL	GATAAGCGCAGCGCCATCA	NA	NA	NA	NA
AXD80164.1|643822_645388_+	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	33.9	1.7e-12
AXD80165.1|645384_646032_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
AXD80166.1|646263_647031_+	siderophore-interacting protein	NA	NA	NA	NA	NA
AXD80167.1|647269_648283_-|integrase	site-specific integrase	integrase	F1BUS9	Erwinia_phage	60.2	2.8e-117
AXD80168.1|648288_648834_-	hypothetical protein	NA	NA	NA	NA	NA
AXD80169.1|648859_649510_-	phage repressor protein	NA	F1BUN8	Cronobacter_phage	33.5	1.9e-26
AXD80170.1|649597_649834_+	regulator	NA	NA	NA	NA	NA
AXD80171.1|649868_650378_+	hypothetical protein	NA	A0A1S6L008	Salmonella_phage	92.9	1.7e-83
AXD83967.1|650385_650586_+	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	90.9	8.7e-31
AXD80172.1|650549_650891_+	hypothetical protein	NA	E5G6L5	Salmonella_phage	85.8	7.6e-51
AXD80173.1|650958_651192_+	DUF2732 domain-containing protein	NA	E5G6L6	Salmonella_phage	80.5	5.4e-24
AXD80174.1|651191_651419_+	TraR/DksA family transcriptional regulator	NA	A0A1S6L007	Salmonella_phage	96.0	4.6e-36
AXD80175.1|651415_652000_+	3'-5' exonuclease	NA	A0A1S6L012	Salmonella_phage	73.2	6.2e-77
AXD80176.1|652846_655255_+	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	96.8	0.0e+00
AXD80177.1|655416_655605_+	hypothetical protein	NA	A0A1S6L006	Salmonella_phage	98.4	6.1e-26
AXD80178.1|655616_655850_+	DinI family protein	NA	A0A1S6L014	Salmonella_phage	92.2	2.2e-33
AXD80179.1|656211_657021_+	TIGR04255 family protein	NA	NA	NA	NA	NA
AXD80180.1|657334_657703_+	hypothetical protein	NA	NA	NA	NA	NA
AXD80181.1|657712_658561_+	hypothetical protein	NA	NA	NA	NA	NA
AXD80182.1|658598_659621_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	93.5	5.2e-180
AXD80183.1|659620_661387_-	oxidoreductase	NA	A0A1S6KZW3	Salmonella_phage	96.8	0.0e+00
AXD80184.1|661529_662363_+|capsid	capsid protein	capsid	E5G6M5	Salmonella_phage	94.6	5.5e-127
AXD80185.1|662379_663444_+|capsid	phage major capsid protein, P2 family	capsid	A0A1S6KZZ3	Salmonella_phage	99.2	9.3e-196
AXD80186.1|663447_664098_+	hypothetical protein	NA	A0A1S6KZX1	Salmonella_phage	99.1	1.6e-113
AXD80187.1|664191_664656_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	96.8	7.9e-83
AXD80188.1|664655_664859_+|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	100.0	3.8e-34
AXD80189.1|664862_665078_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	100.0	5.9e-33
AXD80190.1|665058_665568_+	lysozyme	NA	A0A1S6KZY9	Salmonella_phage	97.0	1.6e-92
AXD80191.1|665572_665947_+	hypothetical protein	NA	NA	NA	NA	NA
AXD80192.1|665943_666372_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	95.0	2.6e-64
AXD80193.1|666467_666899_+|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	95.1	4.0e-73
AXD80194.1|666891_667338_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	89.7	3.8e-66
AXD80195.1|667406_667985_+|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	99.0	1.5e-107
AXD80196.1|667981_668341_+|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	98.3	2.3e-58
AXD80197.1|668327_669236_+|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	97.4	4.7e-156
AXD80198.1|669228_669834_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	98.5	1.1e-116
AXD80199.1|669830_671405_+|tail	phage tail protein	tail	A0A1S6KZZ8	Salmonella_phage	60.9	4.3e-157
AXD80200.1|671374_671992_+|tail	tail fiber assembly protein	tail	A0A1B0VCD0	Salmonella_phage	84.6	3.1e-95
AXD80201.1|671995_672403_-|tail	tail fiber assembly protein	tail	A0A1B0V844	Salmonella_phage	84.4	2.2e-60
AXD80202.1|672409_673489_-	hypothetical protein	NA	A0A1B0V7G4	Salmonella_phage	92.1	5.4e-183
AXD80203.1|673458_674016_+	recombinase family protein	NA	A0A1S6L009	Salmonella_phage	98.9	2.5e-99
AXD80204.1|674118_675291_+|tail	phage tail protein	tail	A0A1S6KZY7	Salmonella_phage	98.7	5.9e-220
AXD80205.1|675300_675816_+|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	98.8	1.0e-91
AXD80206.1|675870_676173_+|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	100.0	2.5e-45
AXD80207.1|676187_676307_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	97.4	8.8e-15
AXD80208.1|676299_679107_+|tail	phage tail tape measure protein	tail	A0A1S6L010	Salmonella_phage	99.6	0.0e+00
AXD80209.1|679103_679589_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	95.0	7.7e-73
AXD80210.1|679585_680686_+	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	92.9	1.6e-187
AXD80211.1|680755_680974_+	DNA-binding transcriptional regulator	NA	Q53ZE7	Salmonella_virus	75.0	4.9e-27
AXD80212.1|681311_681818_+	mismatch-specific DNA-glycosylase	NA	NA	NA	NA	NA
AXD80213.1|681941_683924_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	9.0e-35
AXD80214.1|683938_685684_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.4	2.1e-72
AXD80215.1|685919_686135_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
AXD80216.1|686362_687376_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.5	2.8e-109
AXD80217.1|687279_687618_-	hypothetical protein	NA	NA	NA	NA	NA
AXD80218.1|687625_688237_-	acyl-phosphate--glycerol-3-phosphate O-acyltransferase	NA	NA	NA	NA	NA
AXD80219.1|688343_688703_+	bifunctional dihydroneopterin aldolase/7,8-dihydroneopterin epimerase	NA	NA	NA	NA	NA
AXD80220.1|688800_689622_+	undecaprenyl-diphosphatase	NA	NA	NA	NA	NA
AXD80221.1|689725_690967_-|tRNA	multifunctional CCA tRNA nucleotidyl transferase/2'3'-cyclic phosphodiesterase/2'nucleotidase/phosphatase	tRNA	A0A0F6YPT7	Sinorhizobium_phage	47.9	6.5e-92
689682:689700	attR	GATAAGCGCAGCGCCATCA	NA	NA	NA	NA
>prophage 2
CP030225	Salmonella enterica strain SA20041605 chromosome, complete genome	4739617	1166305	1238568	4739617	tRNA,head,tail,lysis,plate,capsid,integrase,portal	Salmonella_phage(79.59%)	77	1175462:1175509	1209575:1209622
AXD80671.1|1166305_1168639_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	84.5	0.0e+00
AXD80672.1|1168653_1168974_-	hypothetical protein	NA	NA	NA	NA	NA
AXD80673.1|1168970_1169198_-	hypothetical protein	NA	NA	NA	NA	NA
AXD80674.1|1169194_1169746_-	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	71.3	8.6e-36
AXD80675.1|1170546_1171284_+	glycoprotein 3	NA	Q7M2A2	Enterobacteria_phage	63.6	1.3e-79
AXD80676.1|1171280_1171523_+	hypothetical protein	NA	Q7M294	Enterobacteria_phage	77.8	5.2e-30
AXD80677.1|1171539_1172106_+	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	63.2	4.1e-57
AXD80678.1|1172069_1172255_-	hypothetical protein	NA	NA	NA	NA	NA
AXD80679.1|1172637_1174047_+	hypothetical protein	NA	NA	NA	NA	NA
AXD80680.1|1174083_1175280_-	DUF4102 domain-containing protein	NA	A0A1B5FPC6	Escherichia_phage	50.0	4.1e-107
AXD80681.1|1175415_1175598_+	hypothetical protein	NA	NA	NA	NA	NA
1175462:1175509	attL	ATTTGGTGGAGCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACAT	NA	NA	NA	NA
AXD80682.1|1175626_1176652_-|integrase	site-specific integrase	integrase	A0A1S6L016	Salmonella_phage	95.6	7.6e-195
AXD80683.1|1176655_1177288_-	phage repressor protein	NA	A0A1S6KZZ7	Salmonella_phage	56.7	1.5e-63
AXD80684.1|1177407_1177656_+	Rha family transcriptional regulator	NA	A0A1S6KZZ6	Salmonella_phage	70.7	8.9e-25
AXD80685.1|1177688_1178198_+	hypothetical protein	NA	A0A1S6L008	Salmonella_phage	94.7	9.2e-85
AXD80686.1|1178802_1179024_+	hypothetical protein	NA	NA	NA	NA	NA
AXD80687.1|1179055_1179397_+	hypothetical protein	NA	E5G6L5	Salmonella_phage	84.1	6.0e-48
AXD80688.1|1179464_1179692_+	hypothetical protein	NA	A0A0M3UL87	Salmonella_phage	64.0	3.6e-17
AXD80689.1|1179691_1179919_+	TraR/DksA family transcriptional regulator	NA	A0A1S6L007	Salmonella_phage	82.7	2.2e-30
AXD80690.1|1179915_1180215_+	hypothetical protein	NA	NA	NA	NA	NA
AXD80691.1|1180211_1181069_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	69.1	4.1e-109
AXD80692.1|1181065_1183474_+	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	91.5	0.0e+00
AXD80693.1|1183493_1183736_-	hypothetical protein	NA	NA	NA	NA	NA
AXD80694.1|1183858_1184047_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	91.7	5.7e-24
AXD80695.1|1184147_1184354_+	hypothetical protein	NA	NA	NA	NA	NA
AXD80696.1|1184505_1184988_+	hypothetical protein	NA	NA	NA	NA	NA
AXD80697.1|1184977_1185955_+	DNA-processing protein DprA	NA	S6BFL3	Thermus_phage	32.7	1.2e-24
AXD80698.1|1185981_1187013_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	95.3	2.7e-192
AXD80699.1|1187012_1188779_-	oxidoreductase	NA	A0A1S6KZW3	Salmonella_phage	96.8	0.0e+00
AXD80700.1|1188921_1189755_+|capsid	capsid protein	capsid	E5G6M5	Salmonella_phage	100.0	3.1e-130
AXD80701.1|1189771_1190833_+|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	100.0	2.1e-195
AXD80702.1|1190836_1191487_+	hypothetical protein	NA	E5G6M7	Salmonella_phage	100.0	4.9e-115
AXD80703.1|1191580_1192045_+|head	head completion/stabilization protein	head	E5G6M8	Salmonella_phage	98.7	1.9e-84
AXD80704.1|1192044_1192248_+|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	100.0	3.8e-34
AXD80705.1|1192251_1192467_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	100.0	5.9e-33
AXD80706.1|1192447_1192963_+	lysozyme	NA	E5G6N1	Salmonella_phage	99.4	1.2e-95
AXD80707.1|1192959_1193388_+|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	92.9	4.1e-62
AXD80708.1|1193317_1193521_+	hypothetical protein	NA	A0A1S6KZX6	Salmonella_phage	75.4	2.0e-22
AXD80709.1|1193483_1193915_+|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	93.7	1.7e-71
AXD80710.1|1193907_1194357_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	85.0	1.9e-62
AXD80711.1|1194368_1195814_-	hypothetical protein	NA	NA	NA	NA	NA
AXD80712.1|1195893_1196472_+|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	99.0	2.3e-108
AXD80713.1|1196468_1196828_+|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	96.6	6.8e-58
AXD80714.1|1196814_1197723_+|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	99.3	1.0e-158
AXD80715.1|1197715_1198321_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	97.0	3.9e-114
AXD80716.1|1198317_1199892_+|tail	phage tail protein	tail	A0A1S6KZZ8	Salmonella_phage	60.6	6.2e-156
AXD80717.1|1199861_1200479_+|tail	tail fiber assembly protein	tail	A0A1S6KZY8	Salmonella_phage	86.2	3.7e-96
AXD80718.1|1200482_1200890_-|tail	tail fiber assembly protein	tail	A0A1B0V844	Salmonella_phage	91.1	5.9e-66
AXD80719.1|1200896_1201976_-	hypothetical protein	NA	A0A1B0V7G4	Salmonella_phage	90.6	1.1e-180
AXD80720.1|1201945_1202503_+	recombinase family protein	NA	A0A1S6L009	Salmonella_phage	98.9	2.5e-99
AXD80721.1|1202605_1203778_+|tail	phage tail protein	tail	A0A1S6KZY7	Salmonella_phage	99.5	1.3e-222
AXD80722.1|1203787_1204303_+|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	99.4	2.7e-92
AXD80723.1|1204357_1204660_+|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	100.0	1.5e-45
AXD80724.1|1204674_1204794_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	100.0	1.8e-15
AXD80725.1|1204786_1207594_+|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	99.6	0.0e+00
AXD80726.1|1207590_1208076_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	99.2	8.3e-67
AXD80727.1|1208072_1209173_+	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	98.6	9.0e-194
AXD80728.1|1209241_1209460_+	levansucrase regulator	NA	Q53ZE7	Salmonella_virus	98.6	1.0e-37
AXD83985.1|1210011_1211175_-	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
1209575:1209622	attR	ATTTGGTGGAGCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACAT	NA	NA	NA	NA
AXD80729.1|1211182_1213363_-	type I secretion system permease/ATPase	NA	F2Y2R6	Organic_Lake_phycodnavirus	27.4	3.8e-18
AXD80730.1|1213359_1214769_-	type I secretion protein TolC	NA	NA	NA	NA	NA
AXD80731.1|1214833_1226308_-	biofilm-associated protein BapA	NA	NA	NA	NA	NA
AXD83986.1|1226922_1227405_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	5.2e-29
AXD80732.1|1227554_1228031_+	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
AXD80733.1|1228020_1228311_+	RnfH family protein	NA	NA	NA	NA	NA
AXD80734.1|1228476_1228815_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
AXD80735.1|1228963_1230625_-	DNA repair protein RecN	NA	NA	NA	NA	NA
AXD83988.1|1230710_1231589_-	NAD(+) kinase	NA	NA	NA	NA	NA
AXD83987.1|1231712_1232303_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
AXD80736.1|1232337_1232943_-	cytoplasmic protein	NA	NA	NA	NA	NA
AXD80737.1|1233063_1234305_-	DUF21 domain-containing protein	NA	NA	NA	NA	NA
AXD80738.1|1234369_1235161_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
AXD80739.1|1235106_1235403_-	hypothetical protein	NA	NA	NA	NA	NA
AXD80740.1|1235326_1236688_+	signal recognition particle protein	NA	NA	NA	NA	NA
AXD80741.1|1236940_1237189_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
AXD80742.1|1237207_1237756_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
AXD80743.1|1237800_1238568_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
>prophage 3
CP030225	Salmonella enterica strain SA20041605 chromosome, complete genome	4739617	1738883	1748054	4739617	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
AXD81187.1|1738883_1739831_+	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.8	3.7e-10
AXD81188.1|1739814_1740546_+	ABC transporter permease	NA	NA	NA	NA	NA
AXD81189.1|1740526_1740634_-	hypothetical protein	NA	NA	NA	NA	NA
AXD81190.1|1740693_1741425_-	transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
AXD81191.1|1741647_1743333_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.3	4.8e-279
AXD81192.1|1743329_1744049_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AXD81193.1|1744095_1744563_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
AXD81194.1|1744619_1745150_-	DUF1307 domain-containing protein	NA	NA	NA	NA	NA
AXD81195.1|1745321_1745780_-	DUF1307 domain-containing protein	NA	Q9EYF5	Enterobacteria_phage	71.9	2.4e-52
AXD81196.1|1746020_1748054_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
>prophage 4
CP030225	Salmonella enterica strain SA20041605 chromosome, complete genome	4739617	1912740	1923330	4739617		Morganella_phage(25.0%)	12	NA	NA
AXD81340.1|1912740_1913295_-	hypothetical protein	NA	A0A0F6TJ61	Escherichia_coli_O157_typing_phage	79.1	5.4e-22
AXD81341.1|1913941_1914232_-	DUF4102 domain-containing protein	NA	B7SYF8	Stenotrophomonas_phage	49.1	3.0e-08
AXD81342.1|1914603_1915401_-	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
AXD81343.1|1915881_1916043_+	hypothetical protein	NA	NA	NA	NA	NA
AXD81344.1|1916169_1916589_+	DNA polymerase V subunit UmuD	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
AXD81345.1|1916591_1917860_+	protein UmuC	NA	I6RSM4	Salmonella_phage	92.4	3.2e-227
AXD81346.1|1918315_1918528_+	cold-shock protein CspJ	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
AXD84011.1|1918538_1918727_+	cold-shock protein	NA	NA	NA	NA	NA
AXD81347.1|1918892_1920092_-	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	57.2	4.2e-112
AXD81348.1|1920739_1921051_+	hypothetical protein	NA	NA	NA	NA	NA
AXD81349.1|1921130_1921826_+	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.1	2.8e-07
AXD81350.1|1921899_1923330_+	DNA (cytosine-5-)-methyltransferase	NA	E5E3X6	Burkholderia_phage	56.7	5.9e-105
>prophage 5
CP030225	Salmonella enterica strain SA20041605 chromosome, complete genome	4739617	2683332	2725453	4739617	holin,head,tail,lysis,integrase,protease	Salmonella_phage(47.06%)	60	2700021:2700035	2731251:2731265
AXD82103.1|2683332_2683449_+|tail	phage tail protein	tail	NA	NA	NA	NA
AXD82104.1|2683934_2684519_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	80.6	4.4e-83
AXD82105.1|2685958_2686561_-	DUF2612 domain-containing protein	NA	A0A2R3UAM9	Myoviridae_environmental_samples	38.9	4.3e-33
AXD82106.1|2686562_2687804_-	hypothetical protein	NA	A0A077KGW9	Edwardsiella_phage	49.9	1.2e-101
AXD82107.1|2687800_2688157_-	hypothetical protein	NA	A0A077KCA1	Edwardsiella_phage	49.1	9.5e-20
AXD82108.1|2688169_2688847_-	oxidoreductase	NA	A0A077KAY0	Edwardsiella_phage	36.4	3.2e-32
AXD82109.1|2688827_2689697_-	hypothetical protein	NA	A0A077KC17	Edwardsiella_phage	32.4	1.2e-31
AXD82110.1|2689693_2689996_-	hypothetical protein	NA	A0A077K9U4	Edwardsiella_phage	49.5	7.0e-24
AXD82111.1|2689995_2690706_-	hypothetical protein	NA	A0A077KGW3	Edwardsiella_phage	34.6	5.0e-28
AXD82112.1|2690702_2692874_-	lytic transglycosylase domain-containing protein	NA	A0A0M4REK7	Salmonella_phage	67.1	1.4e-49
AXD82113.1|2692857_2693040_-	transcription elongation factor GreA	NA	NA	NA	NA	NA
AXD82114.1|2693081_2693486_-	hypothetical protein	NA	H9C0W7	Aeromonas_phage	44.8	1.8e-19
AXD82115.1|2693485_2693932_-	hypothetical protein	NA	Q2NPD1	Xanthomonas_phage	40.4	4.8e-21
AXD82116.1|2693932_2695417_-	DUF3383 domain-containing protein	NA	A0A077KGV4	Edwardsiella_phage	40.8	5.2e-96
AXD82117.1|2695397_2695943_-	hypothetical protein	NA	NA	NA	NA	NA
AXD82118.1|2695927_2696293_-	hypothetical protein	NA	A0A077KAW7	Edwardsiella_phage	40.5	3.0e-21
AXD82119.1|2696289_2696874_-	hypothetical protein	NA	H9C0W2	Aeromonas_phage	29.8	6.1e-16
AXD82120.1|2696867_2697314_-	DUF4054 domain-containing protein	NA	A0A068CGG9	Acinetobacter_phage	40.6	1.8e-15
AXD82121.1|2697320_2697668_-	hypothetical protein	NA	H9C0V9	Aeromonas_phage	40.2	3.9e-10
AXD82122.1|2697671_2698700_-	DUF2184 domain-containing protein	NA	A0A219YBB0	Aeromonas_phage	48.7	2.3e-82
AXD82123.1|2698699_2699182_-	hypothetical protein	NA	K4HYQ5	Acinetobacter_phage	41.2	5.8e-20
AXD82124.1|2699183_2700530_-	DUF2213 domain-containing protein	NA	A0A219YCD3	Aeromonas_phage	37.9	1.0e-69
2700021:2700035	attL	GCCGACCAGCGCCAC	NA	NA	NA	NA
AXD82125.1|2700526_2701216_-|head	phage head morphogenesis protein	head	H9C0V1	Aeromonas_phage	49.1	1.7e-57
AXD82126.1|2701256_2702777_-	DUF1073 domain-containing protein	NA	A0A2R3UAL5	Myoviridae_environmental_samples	44.1	5.2e-107
AXD82127.1|2702776_2704396_-	TerL protein	NA	A0A0M5M1R6	Salmonella_phage	81.2	9.6e-261
AXD82128.1|2704398_2705025_-	hypothetical protein	NA	A0A0M3ULJ9	Salmonella_phage	97.6	6.8e-106
AXD82129.1|2705099_2705780_-	hypothetical protein	NA	NA	NA	NA	NA
AXD84049.1|2705834_2706287_-|lysis	lysis protein	lysis	Q56118	Enterobacteria_phage	68.9	1.6e-48
AXD82130.1|2706304_2706757_-	lysozyme	NA	A0A0M4R365	Salmonella_phage	98.7	4.6e-80
AXD84048.1|2706740_2707070_-|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
AXD82131.1|2707345_2708032_+|protease	type III secretion system effector protease GogA	protease	Q9MBM2	Phage_Gifsy-1	99.6	3.6e-132
AXD82132.1|2708392_2708842_+	lipoprotein	NA	NA	NA	NA	NA
AXD82133.1|2708977_2709103_-	hypothetical protein	NA	NA	NA	NA	NA
AXD82134.1|2709501_2710299_-	antitermination protein	NA	A0A0M4S661	Salmonella_phage	99.6	4.0e-151
AXD82135.1|2710288_2710435_-	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	97.9	4.3e-19
AXD82136.1|2710431_2711043_-	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	97.0	2.7e-91
AXD82137.1|2711045_2711252_-	hypothetical protein	NA	S4TNP0	Salmonella_phage	100.0	3.5e-35
AXD82138.1|2711251_2711854_-	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	99.5	7.5e-110
AXD82139.1|2711888_2712137_-	hypothetical protein	NA	A0A0U2C0C8	Salmonella_phage	100.0	1.6e-42
AXD82140.1|2712253_2712487_-	DNA damage-inducible protein I	NA	A0A0M4REN2	Salmonella_phage	97.4	1.5e-34
AXD82141.1|2712801_2713830_+	hypothetical protein	NA	A0A0M4S6X1	Salmonella_phage	100.0	1.6e-192
AXD82142.1|2714198_2714489_-	hypothetical protein	NA	A0A0M5M1K8	Salmonella_phage	98.9	2.2e-43
AXD82143.1|2714726_2715041_-	hypothetical protein	NA	A0A0M4RD46	Salmonella_phage	98.1	6.3e-52
AXD82144.1|2715080_2715593_-	DUF551 domain-containing protein	NA	A0A0M4R357	Salmonella_phage	98.2	3.4e-87
AXD84050.1|2715568_2715970_-	chromosome partitioning protein ParB	NA	S4TTI6	Salmonella_phage	99.2	9.2e-72
AXD82145.1|2716014_2716716_-	Replication protein P	NA	A0A0M3ULE2	Salmonella_phage	99.6	8.4e-129
AXD82146.1|2716712_2717618_-	Replication protein O	NA	A0A0M5M7Y1	Salmonella_phage	99.7	9.1e-176
AXD82147.1|2717709_2718084_-	hypothetical protein	NA	S4TTD7	Salmonella_phage	99.2	3.3e-63
AXD82148.1|2718049_2718277_-	Rha family transcriptional regulator	NA	K7PKS2	Enterobacteria_phage	95.9	1.5e-34
AXD82149.1|2718290_2718758_+	helix-turn-helix domain-containing protein	NA	K7PHG0	Enterobacteria_phage	86.5	4.2e-68
AXD82150.1|2718800_2719226_+	hypothetical protein	NA	NA	NA	NA	NA
AXD82151.1|2719227_2719662_+	hypothetical protein	NA	NA	NA	NA	NA
AXD82152.1|2719688_2719895_-	hypothetical protein	NA	K7P7I0	Enterobacteria_phage	67.6	1.6e-16
AXD82153.1|2720181_2720382_+	cell division protein FtsZ	NA	G8C7T2	Escherichia_phage	48.4	2.4e-12
AXD82154.1|2720472_2720769_+	host-nuclease inhibitor protein Gam	NA	A0A0M5M5Z9	Salmonella_phage	92.9	6.0e-44
AXD82155.1|2720774_2721560_+	phage recombination protein Bet	NA	A0A0M4RD39	Salmonella_phage	98.9	8.2e-149
AXD82156.1|2721556_2722237_+	exonuclease	NA	A0A0M3ULE0	Salmonella_phage	98.2	1.1e-130
AXD82157.1|2722720_2722957_+	excisionase	NA	NA	NA	NA	NA
AXD82158.1|2722946_2724089_+|integrase	integrase	integrase	O21929	Phage_21	80.3	8.2e-174
AXD82159.1|2724202_2725453_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	6.7e-20
2731251:2731265	attR	GTGGCGCTGGTCGGC	NA	NA	NA	NA
