The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP030219	Salmonella enterica strain SA20021456 chromosome, complete genome	5431908	448649	456598	5431908		Morganella_phage(33.33%)	15	NA	NA
AXD69888.1|448649_449492_+	hypothetical protein	NA	A0A1W6JPK3	Morganella_phage	37.4	7.2e-10
AXD69889.1|449484_449709_+	hypothetical protein	NA	NA	NA	NA	NA
AXD69890.1|449701_449977_+	hypothetical protein	NA	NA	NA	NA	NA
AXD69891.1|449969_450134_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
AXD69892.1|450126_450321_+	hypothetical protein	NA	NA	NA	NA	NA
AXD69893.1|450322_450517_+	hypothetical protein	NA	NA	NA	NA	NA
AXD69894.1|450509_450845_+	hypothetical protein	NA	NA	NA	NA	NA
AXD69895.1|450850_451516_+	hypothetical protein	NA	NA	NA	NA	NA
AXD69896.1|451526_451832_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
AXD69897.1|451828_453991_+	DNA primase	NA	A0A1W6JPG0	Morganella_phage	53.8	2.6e-181
AXD69898.1|454380_454830_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
AXD74318.1|454967_455483_+	proQ/FINO family protein	NA	Q2A0A1	Sodalis_phage	46.8	1.4e-11
AXD69899.1|455472_455709_+	hypothetical protein	NA	V5YTJ0	Pseudomonas_phage	53.1	2.1e-07
AXD69900.1|456024_456321_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A4JWV2	Burkholderia_virus	49.5	3.5e-20
AXD69901.1|456322_456598_+	putative addiction module antidote protein	NA	A4JWV1	Burkholderia_virus	40.0	7.3e-12
>prophage 2
CP030219	Salmonella enterica strain SA20021456 chromosome, complete genome	5431908	640928	685053	5431908	integrase,plate,portal,lysis,capsid,head,tail,tRNA	Salmonella_phage(75.0%)	56	642505:642521	692396:692412
AXD70069.1|640928_642494_+	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	33.9	1.0e-12
AXD70070.1|642490_643138_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
642505:642521	attL	CGATCTCCAGCGCCGCG	NA	NA	NA	NA
AXD70071.1|643370_644138_+	siderophore-interacting protein	NA	NA	NA	NA	NA
AXD74328.1|644554_645640_-|integrase	site-specific integrase	integrase	F1BUS9	Erwinia_phage	61.7	1.8e-122
AXD70072.1|645643_646537_-	NAD-dependent DNA ligase	NA	NA	NA	NA	NA
AXD70073.1|646547_647162_-	phage repressor protein	NA	A0A1S6KZZ7	Salmonella_phage	39.7	9.5e-36
AXD70074.1|647262_647499_+	regulator	NA	NA	NA	NA	NA
AXD70075.1|647533_648043_+	hypothetical protein	NA	A0A1S6L008	Salmonella_phage	100.0	1.6e-89
AXD74329.1|648050_648251_+	DUF2724 domain-containing protein	NA	A0A1S6L005	Salmonella_phage	100.0	3.2e-33
AXD70076.1|648214_648556_+	hypothetical protein	NA	A0A1S6L019	Salmonella_phage	100.0	2.1e-56
AXD70077.1|648623_648857_+	DUF2732 family protein	NA	A0A1S6L021	Salmonella_phage	98.7	2.9e-33
AXD70078.1|648856_649078_+	TraR/DksA family transcriptional regulator	NA	Q6K1F5	Salmonella_virus	86.1	3.1e-29
AXD70079.1|649078_649375_+	hypothetical protein	NA	A0A2D1GP44	Escherichia_phage	44.3	2.5e-10
AXD70080.1|649371_649650_+	hypothetical protein	NA	A0A0M4R2Q0	Salmonella_phage	70.5	8.4e-32
AXD70081.1|649642_650647_+	hypothetical protein	NA	B7SYG0	Stenotrophomonas_phage	42.9	2.2e-66
AXD74330.1|650736_653067_+	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	96.1	0.0e+00
AXD70082.1|653221_653410_+	hypothetical protein	NA	A0A1S6L006	Salmonella_phage	100.0	2.7e-26
AXD70083.1|653421_653655_+	DinI family protein	NA	A0A1S6L014	Salmonella_phage	98.7	2.8e-36
AXD70084.1|653783_654524_-	DUF4145 domain-containing protein	NA	A0A1S6L018	Salmonella_phage	99.6	1.7e-143
AXD70085.1|654882_655128_+	hypothetical protein	NA	NA	NA	NA	NA
AXD70086.1|655137_655995_+	hypothetical protein	NA	NA	NA	NA	NA
AXD70087.1|656016_657048_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	91.0	3.3e-182
AXD70088.1|657047_658814_-	oxidoreductase	NA	A0A1S6KZW3	Salmonella_phage	98.8	0.0e+00
AXD70089.1|658956_659790_+|capsid	capsid protein	capsid	A0A1S6KZW9	Salmonella_phage	88.8	2.9e-128
AXD70090.1|659806_660871_+|capsid	phage major capsid protein, P2 family	capsid	A0A1S6KZZ3	Salmonella_phage	98.9	2.7e-195
AXD70091.1|660874_661525_+	hypothetical protein	NA	E5G6M7	Salmonella_phage	99.5	4.9e-115
AXD70092.1|661618_662083_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	98.7	6.4e-85
AXD70093.1|662082_662286_+|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	100.0	3.8e-34
AXD70094.1|662289_662505_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	100.0	5.9e-33
AXD70095.1|662485_663001_+	lysozyme	NA	E5G6N1	Salmonella_phage	99.4	1.2e-95
AXD70096.1|662997_663426_+|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	92.9	4.1e-62
AXD70097.1|663355_663559_+	hypothetical protein	NA	A0A1S6KZX6	Salmonella_phage	75.4	2.0e-22
AXD70098.1|663521_663953_+|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	94.4	4.4e-72
AXD70099.1|663945_664392_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	84.9	1.1e-62
AXD70100.1|664460_665039_+|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	88.5	5.9e-96
AXD70101.1|665035_665395_+|plate	baseplate assembly protein	plate	E5G6N7	Salmonella_phage	94.1	5.7e-57
AXD70102.1|665381_666290_+|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	93.7	4.3e-149
AXD70103.1|666282_666888_+|tail	phage tail protein I	tail	E5G6N9	Salmonella_phage	97.5	7.8e-115
AXD70104.1|666884_668219_+|tail	phage tail protein	tail	E5G6P0	Salmonella_phage	70.8	7.7e-123
AXD70105.1|668221_668650_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	56.4	5.3e-41
AXD70106.1|668772_669978_+	acyltransferase	NA	A0A088CPR9	Enterobacteria_phage	26.7	7.7e-21
AXD70107.1|670083_670263_+	hypothetical protein	NA	A0A0F7LDZ0	Escherichia_phage	88.5	3.0e-06
AXD70108.1|670167_670629_-|tail	phage tail protein	tail	A0A0M4S6V4	Salmonella_phage	80.6	2.7e-27
AXD70109.1|671147_672320_+|tail	phage tail protein	tail	A0A1S6KZY7	Salmonella_phage	94.1	3.9e-211
AXD70110.1|672329_672845_+|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	97.7	5.1e-91
AXD70111.1|672899_673202_+|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	96.0	8.0e-44
AXD70112.1|673216_673336_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	97.4	6.7e-15
AXD70113.1|673328_676394_+|tail	phage tail tape measure protein	tail	A0A1S6L010	Salmonella_phage	78.8	0.0e+00
AXD70114.1|676390_676876_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	90.7	2.6e-73
AXD70115.1|676872_677973_+	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	95.1	2.7e-190
AXD70116.1|678040_678259_+	levansucrase regulator	NA	Q53ZE7	Salmonella_virus	76.4	4.9e-27
AXD70117.1|678595_679102_+	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
AXD70118.1|679618_681601_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	9.0e-35
AXD70119.1|681615_683361_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.4	2.1e-72
AXD70120.1|683596_683812_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
AXD70121.1|684039_685053_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.5	2.8e-109
692396:692412	attR	CGCGGCGCTGGAGATCG	NA	NA	NA	NA
>prophage 3
CP030219	Salmonella enterica strain SA20021456 chromosome, complete genome	5431908	782975	829422	5431908	tRNA,transposase,integrase	Pseudomonas_phage(18.18%)	48	788403:788450	830035:830082
AXD70214.1|782975_784085_+|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	25.6	2.6e-07
AXD70215.1|784095_784551_+	hypothetical protein	NA	NA	NA	NA	NA
AXD74335.1|784553_784775_+	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	61.1	1.0e-16
AXD70216.1|785629_786514_+	DNA-binding protein	NA	NA	NA	NA	NA
788403:788450	attL	GTGGTGCCCGGACTCGGAATCGAACCAAGGACACGGGGATTTTCAATC	NA	NA	NA	NA
AXD70217.1|788902_791047_+	hypothetical protein	NA	NA	NA	NA	NA
AXD70218.1|791224_791983_+	hypothetical protein	NA	NA	NA	NA	NA
AXD70219.1|792244_792556_-	hypothetical protein	NA	NA	NA	NA	NA
AXD70220.1|792614_793328_-	transcriptional regulator	NA	NA	NA	NA	NA
AXD70221.1|793430_794180_-	DUF3944 domain-containing protein	NA	NA	NA	NA	NA
AXD70222.1|794322_794706_-	hypothetical protein	NA	NA	NA	NA	NA
AXD70223.1|794783_795023_-	hypothetical protein	NA	NA	NA	NA	NA
AXD70224.1|795001_795466_-	hypothetical protein	NA	NA	NA	NA	NA
AXD70225.1|795524_795953_-	DUF2787 domain-containing protein	NA	NA	NA	NA	NA
AXD70226.1|796000_796432_-	hypothetical protein	NA	NA	NA	NA	NA
AXD70227.1|796424_796778_-	hypothetical protein	NA	NA	NA	NA	NA
AXD70228.1|797296_798607_+	hypothetical protein	NA	Q9T1P3	Pseudomonas_phage	28.3	5.8e-22
AXD70229.1|798692_800606_+	hypothetical protein	NA	A0A1B0VP75	Pseudomonas_phage	27.5	3.9e-19
AXD70230.1|800655_801012_+	DUF4102 domain-containing protein	NA	NA	NA	NA	NA
AXD70231.1|801066_802251_-|integrase	integrase	integrase	A0A221SAN4	Ralstonia_phage	32.0	3.6e-31
AXD70232.1|802651_803149_+	hypothetical protein	NA	NA	NA	NA	NA
AXD70233.1|803559_804846_-	hypothetical protein	NA	NA	NA	NA	NA
AXD70234.1|804849_805935_-	nucleoid-associated protein	NA	NA	NA	NA	NA
AXD70235.1|806266_806551_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
AXD70236.1|806547_807402_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	55.4	6.1e-81
AXD70237.1|807614_808331_-	two-component system response regulator ArcA	NA	NA	NA	NA	NA
AXD70238.1|808426_808567_+	hypothetical protein	NA	NA	NA	NA	NA
AXD70239.1|808848_809043_-	hypothetical protein	NA	NA	NA	NA	NA
AXD70240.1|808966_809653_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
AXD74336.1|809866_809932_+	thr operon leader peptide	NA	NA	NA	NA	NA
AXD70241.1|810013_812476_+	bifunctional aspartate kinase/homoserine dehydrogenase I	NA	NA	NA	NA	NA
AXD70242.1|812477_813407_+	homoserine kinase	NA	NA	NA	NA	NA
AXD70243.1|813410_814697_+	threonine synthase	NA	NA	NA	NA	NA
AXD70244.1|814747_815521_-	peroxide stress protein YaaA	NA	NA	NA	NA	NA
AXD70245.1|815599_817030_-	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
AXD70246.1|817298_818252_+	transaldolase	NA	A0A0E3G6C9	Synechococcus_phage	35.2	9.7e-11
AXD70247.1|818311_818545_-	hypothetical protein	NA	NA	NA	NA	NA
AXD70248.1|818705_819296_+	molybdopterin adenylyltransferase	NA	NA	NA	NA	NA
AXD70249.1|819424_819991_-	acetate uptake transporter	NA	NA	NA	NA	NA
AXD70250.1|820139_820853_-	acidic protein MsyB	NA	NA	NA	NA	NA
AXD70251.1|820888_821293_-	DUF2541 family protein	NA	NA	NA	NA	NA
AXD70252.1|821642_823559_+	molecular chaperone DnaK	NA	G8DDB7	Micromonas_pusilla_virus	48.9	5.8e-148
AXD70253.1|823644_824772_+	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	33.2	5.5e-29
AXD70254.1|825049_825997_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AXD70255.1|826123_826468_+	hypothetical protein	NA	NA	NA	NA	NA
AXD70256.1|826528_827062_-	hypothetical protein	NA	A0A0U2I1S0	Escherichia_phage	56.6	8.8e-54
AXD70257.1|827078_827522_-	transcriptional regulator	NA	NA	NA	NA	NA
AXD70258.1|828286_828571_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
AXD70259.1|828567_829422_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	55.4	6.1e-81
830035:830082	attR	GTGGTGCCCGGACTCGGAATCGAACCAAGGACACGGGGATTTTCAATC	NA	NA	NA	NA
>prophage 4
CP030219	Salmonella enterica strain SA20021456 chromosome, complete genome	5431908	1509750	1515898	5431908	tail,transposase,plate	Shigella_phage(33.33%)	10	NA	NA
AXD70867.1|1509750_1510035_-	VRR-NUC domain-containing protein	NA	B6SD64	Bacteriophage	64.0	3.7e-27
AXD70868.1|1510037_1510517_-	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	80.8	1.3e-69
AXD70869.1|1510517_1510733_-	hypothetical protein	NA	NA	NA	NA	NA
AXD70870.1|1510743_1510947_-	hypothetical protein	NA	NA	NA	NA	NA
AXD70871.1|1510943_1511156_-	hypothetical protein	NA	NA	NA	NA	NA
AXD70872.1|1512647_1512932_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
AXD70873.1|1512928_1513783_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	55.4	6.1e-81
AXD74366.1|1513806_1514883_+|tail	phage tail protein	tail	M1PVV2	Vibrio_phage	32.5	1.0e-45
AXD74367.1|1514921_1515464_+|plate	baseplate assembly protein	plate	A0A077KAY0	Edwardsiella_phage	31.7	3.5e-05
AXD70874.1|1515460_1515898_+	hypothetical protein	NA	A0A0C4UR04	Shigella_phage	50.5	1.2e-16
>prophage 5
CP030219	Salmonella enterica strain SA20021456 chromosome, complete genome	5431908	2102372	2129099	5431908	terminase,holin	Salmonella_phage(78.79%)	37	NA	NA
AXD71377.1|2102372_2103554_+	DUF4102 domain-containing protein	NA	A0A0M4QX09	Salmonella_phage	90.3	6.0e-212
AXD74394.1|2103534_2103726_-	AlpA family transcriptional regulator	NA	A0A0M4RTZ2	Salmonella_phage	77.4	1.6e-21
AXD71378.1|2103902_2104142_-	DUF4060 family protein	NA	H6WRW9	Salmonella_phage	98.7	9.7e-37
AXD71379.1|2104184_2105342_-	enterohemolysin	NA	S4TTE8	Salmonella_phage	100.0	1.6e-217
AXD71380.1|2105304_2108232_-	exodeoxyribonuclease	NA	H6WRX1	Salmonella_phage	97.0	0.0e+00
AXD71381.1|2108358_2108709_-	DNA breaking-rejoining protein	NA	S4TSN6	Salmonella_phage	94.8	3.5e-59
AXD71382.1|2108730_2108901_-	hypothetical protein	NA	H6WRX3	Salmonella_phage	80.0	1.3e-14
AXD71383.1|2109299_2109704_-	transcriptional regulator	NA	H6WRX4	Salmonella_phage	99.3	4.6e-71
AXD71384.1|2109833_2110070_+	Cro/Cl family transcriptional regulator	NA	H6WRX5	Salmonella_phage	96.2	7.4e-37
AXD74395.1|2110143_2110413_+	transcriptional regulator	NA	H6WRX6	Salmonella_phage	56.5	4.6e-19
AXD71385.1|2110503_2111415_+	hypothetical protein	NA	H6WRX7	Salmonella_phage	71.4	3.1e-123
AXD71386.1|2111417_2112167_+	DNA replication protein DnaC	NA	S4TNF5	Salmonella_phage	99.6	7.3e-139
AXD71387.1|2112177_2112525_+	DUF977 family protein	NA	H6WRX9	Salmonella_phage	97.4	2.5e-57
AXD71388.1|2112521_2112923_+	chromosome partitioning protein ParB	NA	S4TTI6	Salmonella_phage	97.7	2.4e-72
AXD71389.1|2112919_2113237_+	hypothetical protein	NA	I6RSM9	Salmonella_phage	87.9	8.1e-23
AXD71390.1|2113236_2113992_+	hypothetical protein	NA	H6WRY1	Salmonella_phage	99.6	4.2e-150
AXD71391.1|2114002_2114704_+	DUF550 domain-containing protein	NA	A0A0M4RTV1	Salmonella_phage	49.8	1.5e-37
AXD71392.1|2114797_2115064_+	hypothetical protein	NA	S4TNF2	Salmonella_phage	96.6	2.2e-45
AXD71393.1|2115243_2115483_+	DinI family protein	NA	H6WRY5	Salmonella_phage	100.0	3.9e-38
AXD71394.1|2115472_2115778_+	hypothetical protein	NA	H6WRY6	Salmonella_phage	100.0	9.8e-42
AXD71395.1|2115817_2116420_+	DUF1367 family protein	NA	A0A0M4QX23	Salmonella_phage	99.0	7.5e-110
AXD71396.1|2116419_2116626_+	hypothetical protein	NA	H6WRY8	Salmonella_phage	100.0	7.8e-35
AXD71397.1|2116628_2117270_+	hypothetical protein	NA	S4TSR3	Salmonella_phage	98.1	5.3e-114
AXD71398.1|2117266_2117413_+	YlcG family protein	NA	H6WRZ0	Salmonella_phage	100.0	1.5e-19
AXD71399.1|2117402_2118200_+	antitermination protein	NA	H6WRZ1	Salmonella_phage	98.9	9.8e-150
AXD71400.1|2118598_2118946_+|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	80.4	1.7e-45
AXD71401.1|2118948_2119575_+	glycoside hydrolase family 19 protein	NA	Q858F0	Salmonella_phage	81.2	3.5e-94
AXD71402.1|2119571_2120123_+	DUF2514 domain-containing protein	NA	NA	NA	NA	NA
AXD71403.1|2120112_2120526_+	hypothetical protein	NA	NA	NA	NA	NA
AXD71404.1|2120615_2120969_+	negative regulator GrlR	NA	NA	NA	NA	NA
AXD71405.1|2121066_2122044_+|terminase	terminase small subunit	terminase	I6NV32	Burkholderia_virus	33.2	1.6e-24
AXD71406.1|2122033_2123305_+	hypothetical protein	NA	A0A0U2JTW9	Escherichia_phage	38.8	6.1e-85
AXD71407.1|2123304_2124735_+	DUF1073 domain-containing protein	NA	A0A0U2S5X9	Escherichia_phage	37.9	3.4e-92
AXD71408.1|2124706_2125582_+	hypothetical protein	NA	A0A0U2I1R8	Escherichia_phage	45.8	1.4e-56
AXD71409.1|2125582_2127157_+	NUDIX hydrolase	NA	Q6UJ14	Burkholderia_virus	48.6	1.7e-20
AXD71410.1|2127177_2128050_+	hypothetical protein	NA	NA	NA	NA	NA
AXD71411.1|2128067_2129099_+	DUF2184 domain-containing protein	NA	A0A0U2QQI2	Escherichia_phage	45.5	5.6e-73
>prophage 6
CP030219	Salmonella enterica strain SA20021456 chromosome, complete genome	5431908	2139112	2150960	5431908	tail	Escherichia_phage(50.0%)	12	NA	NA
AXD71424.1|2139112_2140339_+	hypothetical protein	NA	A0A0U2RJZ0	Escherichia_phage	65.6	9.5e-152
AXD71425.1|2140322_2140949_+	hypothetical protein	NA	A0A0U2RK03	Escherichia_phage	71.6	1.3e-91
AXD71426.1|2140945_2142655_+|tail	tail fiber protein	tail	A0A0U2SAV1	Escherichia_phage	65.6	1.3e-90
AXD71427.1|2142651_2143476_+|tail	phage tail protein	tail	A0A0M4QWS3	Salmonella_phage	92.7	9.2e-151
AXD71428.1|2143465_2144059_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	91.1	5.5e-97
AXD74397.1|2144414_2144849_+	hypothetical protein	NA	NA	NA	NA	NA
AXD71429.1|2144957_2145149_+	DUF2767 family protein	NA	A0A0M4R5C3	Salmonella_phage	97.7	5.8e-16
AXD71430.1|2145164_2145431_-	hypothetical protein	NA	A0A0M3ULK3	Salmonella_phage	92.0	6.1e-40
AXD71431.1|2146033_2148310_+	thiosulfate reductase PhsA	NA	A0A077SK27	Escherichia_phage	26.9	3.8e-37
AXD71432.1|2148324_2148903_+	thiosulfate reductase electron transport protein PhsB	NA	A0A077SL61	Escherichia_phage	38.2	5.1e-23
AXD71433.1|2148899_2149664_+	thiosulfate reductase cytochrome B subunit	NA	NA	NA	NA	NA
AXD71434.1|2149787_2150960_+	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	88.2	2.8e-201
>prophage 7
CP030219	Salmonella enterica strain SA20021456 chromosome, complete genome	5431908	2233431	2247714	5431908		Salmonella_phage(23.08%)	20	NA	NA
AXD71505.1|2233431_2234064_-	hypothetical protein	NA	H6WRY3	Salmonella_phage	89.0	2.4e-98
AXD71506.1|2236180_2236414_-	hypothetical protein	NA	S4TVX5	Salmonella_phage	47.7	1.4e-11
AXD71507.1|2236410_2236998_-	hypothetical protein	NA	Q5G8U6	Enterobacteria_phage	63.1	7.0e-44
AXD74401.1|2236997_2237303_-	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	63.9	9.5e-29
AXD71508.1|2237338_2238154_-	hypothetical protein	NA	A0A2H4JAZ0	uncultured_Caudovirales_phage	65.1	4.2e-87
AXD71509.1|2238159_2240667_-	exonuclease VIII	NA	V5UQJ3	Shigella_phage	45.4	2.7e-113
AXD71510.1|2240824_2241664_-	hypothetical protein	NA	I6XKU1	Burkholderia_virus	33.8	5.1e-48
AXD71511.1|2241737_2241944_-	cell division inhibitor protein	NA	NA	NA	NA	NA
AXD71512.1|2241947_2242223_-	hypothetical protein	NA	NA	NA	NA	NA
AXD71513.1|2242225_2242501_-	hypothetical protein	NA	NA	NA	NA	NA
AXD71514.1|2242775_2243054_+	DUF2622 domain-containing protein	NA	NA	NA	NA	NA
AXD71515.1|2243024_2243450_-	hypothetical protein	NA	NA	NA	NA	NA
AXD71516.1|2243488_2243902_-	post-segregation killing protein PndC	NA	A0A1S6UBS6	Serratia_phage	50.9	1.9e-27
AXD71517.1|2243961_2244123_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	55.3	2.7e-06
AXD71518.1|2244304_2244727_-	hypothetical protein	NA	NA	NA	NA	NA
AXD71519.1|2244806_2245052_-	hypothetical protein	NA	NA	NA	NA	NA
AXD71520.1|2245102_2245756_-	hypothetical protein	NA	A0A0M4RTW7	Salmonella_phage	24.2	4.3e-10
AXD71521.1|2245828_2246059_-	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	35.6	3.8e-06
AXD71522.1|2246048_2246948_-	hypothetical protein	NA	A0A0U2SAW4	Escherichia_phage	33.9	7.0e-19
AXD71523.1|2246967_2247714_-	DNA replication protein DnaC	NA	A0A088CBP4	Shigella_phage	67.9	1.6e-85
>prophage 8
CP030219	Salmonella enterica strain SA20021456 chromosome, complete genome	5431908	2251012	2289457	5431908	tail,terminase,lysis	Escherichia_phage(27.27%)	51	NA	NA
AXD71528.1|2251012_2251450_+	recombination protein NinB	NA	G8C7V3	Escherichia_phage	70.1	3.0e-52
AXD71529.1|2251446_2251641_+	hypothetical protein	NA	S4TNP0	Salmonella_phage	54.8	5.1e-12
AXD71530.1|2251622_2251934_+	hypothetical protein	NA	G8C7V5	Escherichia_phage	77.7	4.7e-39
AXD71531.1|2252047_2252395_-	hypothetical protein	NA	NA	NA	NA	NA
AXD71532.1|2252407_2252806_-	hypothetical protein	NA	NA	NA	NA	NA
AXD71533.1|2252940_2253222_-	addiction module antidote protein, HigA family	NA	A0A0M3LPV0	Mannheimia_phage	34.1	7.2e-07
AXD71534.1|2253228_2253510_-	peptidase	NA	A0A2L1IV28	Escherichia_phage	47.3	2.2e-19
AXD71535.1|2255659_2255911_+	hypothetical protein	NA	NA	NA	NA	NA
AXD74402.1|2255986_2256274_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
AXD71536.1|2256254_2256737_+	lysozyme	NA	M9P0E5	Enterobacteria_phage	72.4	1.1e-58
AXD71537.1|2257164_2258097_+	site-specific DNA-methyltransferase	NA	A0A088FRS2	Escherichia_phage	52.9	6.4e-92
AXD71538.1|2258093_2258558_+|lysis	lysis protein	lysis	S4TNN7	Salmonella_phage	68.8	1.1e-49
AXD71539.1|2258706_2259075_-	hypothetical protein	NA	NA	NA	NA	NA
AXD71540.1|2259145_2259379_-	hypothetical protein	NA	NA	NA	NA	NA
AXD71541.1|2259507_2260785_+	hypothetical protein	NA	A0A1J0MDX3	Mycobacterium_phage	29.8	1.9e-41
AXD71542.1|2260774_2261458_+	hypothetical protein	NA	A0A1J0ME72	Mycobacterium_phage	32.2	3.1e-19
AXD74403.1|2261498_2261696_+	hypothetical protein	NA	NA	NA	NA	NA
AXD71543.1|2261708_2262698_+|terminase	terminase small subunit	terminase	A0A0U2RXW9	Escherichia_phage	50.0	2.1e-56
AXD71544.1|2262666_2263992_+|terminase	terminase	terminase	A0A0N7IRE3	Acinetobacter_phage	72.6	5.7e-187
AXD71545.1|2263991_2265395_+	DUF4055 domain-containing protein	NA	A0A1W6JNV0	Morganella_phage	64.7	8.3e-168
AXD71546.1|2265378_2266494_+	hypothetical protein	NA	I6PD76	Cronobacter_phage	53.0	9.6e-111
AXD71547.1|2266583_2267297_+	hypothetical protein	NA	I6PCW0	Cronobacter_phage	53.8	3.8e-44
AXD71548.1|2267302_2268280_+	hypothetical protein	NA	A0A1W6JNV5	Morganella_phage	74.2	1.7e-132
AXD71549.1|2268323_2268812_+	hypothetical protein	NA	G8C7P9	Escherichia_phage	45.6	3.3e-39
AXD71550.1|2268814_2269198_+	hypothetical protein	NA	NA	NA	NA	NA
AXD71551.1|2269181_2269637_+	HK97 gp10 family phage protein	NA	A0A0H5AWD5	Pseudomonas_phage	36.9	2.7e-19
AXD71552.1|2269633_2270044_+	hypothetical protein	NA	NA	NA	NA	NA
AXD71553.1|2270048_2271026_+	hypothetical protein	NA	A0A0A1IVS4	Pseudomonas_phage	36.8	9.8e-43
AXD71554.1|2271032_2271434_+	hypothetical protein	NA	A0A1B0Z0C9	Vibrio_phage	37.3	7.6e-18
AXD71555.1|2271484_2271703_+	hypothetical protein	NA	NA	NA	NA	NA
AXD71556.1|2271703_2271994_-	putative addiction module antidote protein	NA	A4JWV1	Burkholderia_virus	53.4	4.0e-16
AXD71557.1|2271986_2272295_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A141GEX6	Brucella_phage	56.4	9.3e-24
AXD71558.1|2272357_2275471_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	46.3	1.4e-159
AXD71559.1|2275529_2276381_-	hypothetical protein	NA	A0A077KC96	Edwardsiella_phage	61.0	2.6e-15
AXD71560.1|2276862_2277387_+	Ail/OmpX	NA	A0A1B0VBR9	Salmonella_phage	36.5	5.5e-16
AXD71561.1|2277421_2277988_+	hypothetical protein	NA	NA	NA	NA	NA
AXD71562.1|2278111_2278528_-	transcriptional regulator	NA	NA	NA	NA	NA
AXD71563.1|2278527_2278842_-	addiction module toxin RelE	NA	NA	NA	NA	NA
AXD71564.1|2278929_2279259_+|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	46.3	5.0e-23
AXD71565.1|2279303_2279789_-	heme-binding protein	NA	NA	NA	NA	NA
AXD71566.1|2279951_2280389_+	hydroxyisourate hydrolase	NA	NA	NA	NA	NA
AXD71567.1|2280463_2280994_-	superoxide dismutase [Cu-Zn]	NA	Q9MC02	Salmonella_phage	51.7	9.7e-45
AXD71568.1|2281085_2281637_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	65.9	1.4e-62
AXD71569.1|2281642_2282380_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	75.1	2.6e-112
AXD71570.1|2282277_2283030_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	59.3	1.9e-70
AXD71571.1|2283134_2286353_+	DUF1983 domain-containing protein	NA	A0A0P0ZCI5	Stx2-converting_phage	55.6	5.9e-312
AXD71572.1|2286362_2286719_+	hypothetical protein	NA	NA	NA	NA	NA
AXD71573.1|2286718_2287471_+	hypothetical protein	NA	NA	NA	NA	NA
AXD71574.1|2287493_2287928_-	hypothetical protein	NA	Q7Y3V7	Yersinia_phage	73.4	5.1e-52
AXD71575.1|2287958_2288141_-	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
AXD71576.1|2288227_2289457_+	hypothetical protein	NA	S5MDN9	Escherichia_phage	46.2	2.4e-14
>prophage 9
CP030219	Salmonella enterica strain SA20021456 chromosome, complete genome	5431908	2416320	2421932	5431908	lysis	Enterobacteria_phage(33.33%)	9	NA	NA
AXD74409.1|2416320_2416533_+|lysis	lysis protein	lysis	H9C183	Pectobacterium_phage	39.7	1.9e-07
AXD74410.1|2416516_2416870_+	lysozyme	NA	M9P0E5	Enterobacteria_phage	62.4	2.4e-31
AXD74411.1|2417011_2417086_+	hypothetical protein	NA	NA	NA	NA	NA
AXD71706.1|2417949_2418369_+	subtilase cytotoxin subunit B	NA	NA	NA	NA	NA
AXD71707.1|2418486_2418939_+	subtilase cytotoxin subunit B	NA	NA	NA	NA	NA
AXD71708.1|2418935_2419667_+	pertussis toxin-like subunit ArtA	NA	A0A0U2KD26	Escherichia_phage	52.0	2.3e-60
AXD71709.1|2419863_2420406_+	hypothetical protein	NA	A0A0U2S643	Escherichia_phage	65.4	6.8e-70
AXD74412.1|2420583_2420961_-	DUF1353 domain-containing protein	NA	I1TQ41	Pseudomonas_phage	38.2	7.4e-15
AXD74413.1|2421119_2421932_-	cytolethal distending toxin subunit B family protein	NA	A5LH53	Enterobacteria_phage	48.7	2.7e-62
>prophage 10
CP030219	Salmonella enterica strain SA20021456 chromosome, complete genome	5431908	2477582	2563043	5431908	integrase,terminase,protease,portal,lysis,holin,head,capsid,tail,tRNA	Enterobacteria_phage(27.78%)	99	2476219:2476233	2555892:2555906
2476219:2476233	attL	TTGCGGATATGGTGG	NA	NA	NA	NA
AXD71756.1|2477582_2478278_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
AXD71757.1|2478349_2478931_+	hypothetical protein	NA	NA	NA	NA	NA
AXD71758.1|2478909_2479116_-	hypothetical protein	NA	NA	NA	NA	NA
AXD74415.1|2479135_2480821_+	long-chain-fatty-acid--CoA ligase FadD	NA	A0A2H4PQM9	Staphylococcus_phage	25.8	3.8e-34
AXD71759.1|2480893_2482021_+	ribonuclease D	NA	NA	NA	NA	NA
AXD71760.1|2482142_2482409_-	cell division topological specificity factor	NA	NA	NA	NA	NA
AXD71761.1|2482412_2483225_-	septum site-determining protein MinD	NA	NA	NA	NA	NA
AXD71762.1|2483248_2483956_-	septum site-determining protein MinC	NA	NA	NA	NA	NA
AXD71763.1|2484042_2484375_+	hypothetical protein	NA	NA	NA	NA	NA
AXD74416.1|2484424_2485084_+	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
AXD71764.1|2485161_2485623_+	YcgN family cysteine cluster protein	NA	NA	NA	NA	NA
AXD71765.1|2485973_2486111_+	hypothetical protein	NA	NA	NA	NA	NA
AXD71766.1|2486324_2486498_+	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
AXD71767.1|2486569_2486911_-	DUF1971 domain-containing protein	NA	NA	NA	NA	NA
AXD71768.1|2487101_2488091_-|integrase	integrase	integrase	Q83VS6	Escherichia_phage	54.8	1.2e-101
AXD71769.1|2488163_2488505_-	XRE family transcriptional regulator	NA	Q1JS45	Enterobacteria_phage	45.7	2.0e-14
AXD71770.1|2488617_2489136_+	transcriptional regulator	NA	NA	NA	NA	NA
AXD71771.1|2489247_2489682_-	hypothetical protein	NA	NA	NA	NA	NA
AXD71772.1|2490092_2490566_-	hypothetical protein	NA	NA	NA	NA	NA
AXD71773.1|2490650_2490845_+	hypothetical protein	NA	NA	NA	NA	NA
AXD71774.1|2490841_2491033_+	hypothetical protein	NA	NA	NA	NA	NA
AXD71775.1|2491037_2491622_+	hypothetical protein	NA	NA	NA	NA	NA
AXD71776.1|2491926_2492157_+	hypothetical protein	NA	NA	NA	NA	NA
AXD71777.1|2492157_2494329_+	hypothetical protein	NA	V5UQJ3	Shigella_phage	26.3	3.1e-36
AXD71778.1|2494325_2494721_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	39.3	4.1e-16
AXD71779.1|2494717_2494960_+	hypothetical protein	NA	NA	NA	NA	NA
AXD71780.1|2495420_2495636_+	hypothetical protein	NA	NA	NA	NA	NA
AXD71781.1|2495635_2496109_+	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	81.6	4.6e-70
AXD74417.1|2496466_2497510_+	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	61.5	1.2e-46
AXD71782.1|2497657_2498446_+	hypothetical protein	NA	A0A286S260	Klebsiella_phage	37.1	3.1e-31
AXD71783.1|2498452_2499082_+	hypothetical protein	NA	NA	NA	NA	NA
AXD71784.1|2499078_2501010_+	replication endonuclease	NA	F1BUS0	Erwinia_phage	36.5	7.5e-95
AXD71785.1|2501134_2501434_+	hypothetical protein	NA	Q8W639	Enterobacteria_phage	32.9	7.7e-07
AXD74418.1|2501553_2502582_+	HNH nuclease	NA	Q8SBE5	Shigella_phage	36.6	7.2e-52
AXD71786.1|2502482_2503232_+	hypothetical protein	NA	NA	NA	NA	NA
AXD71787.1|2503374_2503716_-	type II toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
AXD74419.1|2503712_2503826_-	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
AXD71788.1|2503858_2504341_+	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
AXD71789.1|2506784_2507204_-	hypothetical protein	NA	NA	NA	NA	NA
AXD71790.1|2507613_2507895_+	DUF4406 domain-containing protein	NA	A0A1I9KFD3	Aeromonas_phage	63.1	1.5e-23
AXD71791.1|2507974_2508565_+	hypothetical protein	NA	NA	NA	NA	NA
AXD71792.1|2508545_2508743_-	hypothetical protein	NA	NA	NA	NA	NA
AXD71793.1|2508915_2509158_+	hypothetical protein	NA	NA	NA	NA	NA
AXD71794.1|2509241_2509580_+|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	37.5	3.8e-10
AXD71795.1|2509576_2509993_+	structural protein	NA	A0A0E3GMJ2	Enterobacteria_phage	52.8	8.7e-41
AXD71796.1|2510222_2510687_+|lysis	lysis protein	lysis	S4TNN7	Salmonella_phage	75.3	3.9e-58
AXD71797.1|2510958_2511252_+	hypothetical protein	NA	Q8W634	Enterobacteria_phage	69.0	1.6e-28
AXD71798.1|2511320_2511674_+	HNH endonuclease	NA	F1C587	Cronobacter_phage	70.3	2.2e-45
AXD71799.1|2511876_2512341_+|terminase	phage terminase small subunit P27 family	terminase	Q9B019	Phage_GMSE-1	59.5	2.6e-46
AXD71800.1|2512294_2514034_+|terminase	terminase large subunit	terminase	A0A0U2C138	Paracoccus_phage	45.8	1.0e-138
AXD74420.1|2514039_2515365_+|portal	phage portal protein	portal	Q6JIM9	Burkholderia_virus	50.5	8.2e-117
AXD71801.1|2515340_2516045_+|head,protease	HK97 family phage prohead protease	head,protease	Q6JIM8	Burkholderia_virus	63.5	8.0e-71
AXD71802.1|2516054_2517281_+|capsid	phage major capsid protein	capsid	Q6JIM7	Burkholderia_virus	62.7	1.6e-130
AXD71803.1|2517345_2517708_+	hypothetical protein	NA	NA	NA	NA	NA
AXD71804.1|2517715_2518051_+|head,tail	phage gp6-like head-tail connector protein	head,tail	G3ENA1	Psychrobacter_phage	31.8	1.7e-07
AXD71805.1|2518067_2518397_+	hypothetical protein	NA	A0A1B5FP90	Escherichia_phage	37.8	1.1e-09
AXD71806.1|2518386_2518917_+	hypothetical protein	NA	NA	NA	NA	NA
AXD71807.1|2518909_2519275_+	hypothetical protein	NA	NA	NA	NA	NA
AXD71808.1|2519267_2519996_+	hypothetical protein	NA	NA	NA	NA	NA
AXD71809.1|2520004_2520361_+	hypothetical protein	NA	NA	NA	NA	NA
AXD71810.1|2520575_2523056_+	hypothetical protein	NA	A0A0E3GMH8	Enterobacteria_phage	27.8	1.1e-29
AXD71811.1|2523061_2523391_+|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	43.5	3.8e-23
AXD71812.1|2523550_2524687_+	porin	NA	Q1MVN1	Enterobacteria_phage	60.1	2.3e-112
AXD71813.1|2524828_2525380_+|tail	phage minor tail protein L	tail	Q687F1	Enterobacteria_phage	68.2	4.8e-63
AXD71814.1|2525385_2526123_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	76.8	3.6e-114
AXD71815.1|2526020_2526770_+|tail	tail assembly protein	tail	S5MDP1	Escherichia_phage	63.5	1.2e-61
AXD71816.1|2526875_2530094_+	host specificity protein J	NA	A5LH43	Enterobacteria_phage	51.7	4.5e-302
AXD71817.1|2530103_2530460_+	hypothetical protein	NA	NA	NA	NA	NA
AXD71818.1|2530459_2531212_+	hypothetical protein	NA	NA	NA	NA	NA
AXD71819.1|2531405_2531558_+	type I toxin-antitoxin system hok family toxin	NA	NA	NA	NA	NA
AXD71820.1|2531682_2533785_+	hypothetical protein	NA	A0A0P0ZGT8	Escherichia_phage	54.7	1.4e-22
AXD71821.1|2533784_2534297_+	hypothetical protein	NA	J9Q7Y6	Salmonella_phage	37.7	1.9e-13
AXD71822.1|2534359_2534593_+	hypothetical protein	NA	NA	NA	NA	NA
AXD71823.1|2535009_2535588_+	hypothetical protein	NA	Q9LA61	Enterobacterial_phage	49.7	3.1e-44
AXD71824.1|2535711_2536065_+|tail	phage tail protein	tail	I1TQ41	Pseudomonas_phage	39.8	7.0e-15
AXD71825.1|2537152_2537350_-	hypothetical protein	NA	NA	NA	NA	NA
AXD71826.1|2537687_2538167_-	heme-binding protein	NA	NA	NA	NA	NA
AXD71827.1|2538547_2539111_-	recombinase family protein	NA	A0A1S6L009	Salmonella_phage	67.2	4.5e-64
AXD71828.1|2539368_2541021_+	FliC/FljB family flagellin	NA	NA	NA	NA	NA
AXD71829.1|2541080_2541620_+	phase 1 flagellin transcriptional repressor	NA	NA	NA	NA	NA
AXD71830.1|2542414_2542945_-	disulfide bond formation protein DsbB	NA	NA	NA	NA	NA
AXD71831.1|2543086_2544631_-	Na(+)/H(+) antiporter NhaB	NA	NA	NA	NA	NA
AXD71832.1|2544849_2545569_+	fatty acid metabolism transcriptional regulator FadR	NA	NA	NA	NA	NA
AXD71833.1|2545615_2547148_-	SpoVR family protein	NA	NA	NA	NA	NA
AXD71834.1|2547470_2548769_+	D-amino acid dehydrogenase small subunit	NA	NA	NA	NA	NA
AXD71835.1|2548782_2549853_+	alanine racemase	NA	NA	NA	NA	NA
AXD71836.1|2549916_2551650_-	potassium/proton antiporter	NA	NA	NA	NA	NA
AXD71837.1|2551745_2552660_-	muramoyltetrapeptide carboxypeptidase	NA	NA	NA	NA	NA
AXD71838.1|2552898_2553510_+	membrane-bound lytic murein transglycosylase EmtA	NA	NA	NA	NA	NA
AXD71839.1|2553523_2554258_-	flagellar brake protein YcgR	NA	NA	NA	NA	NA
AXD71840.1|2554426_2554681_+	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
AXD71841.1|2554743_2556456_-	alpha,alpha-trehalase	NA	NA	NA	NA	NA
2555892:2555906	attR	CCACCATATCCGCAA	NA	NA	NA	NA
AXD71842.1|2556669_2557944_-	Glu/Leu/Phe/Val dehydrogenase	NA	NA	NA	NA	NA
AXD71843.1|2558338_2558428_-	cytochrome bd-II oxidase subunit CbdX	NA	NA	NA	NA	NA
AXD71844.1|2558440_2559577_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
AXD71845.1|2559588_2561133_-	cytochrome bd-II oxidase subunit 1	NA	NA	NA	NA	NA
AXD71846.1|2561207_2562056_-	hydrogenase expression/formation protein	NA	NA	NA	NA	NA
AXD71847.1|2562052_2562457_-	hydrogenase-1 operon protein HyaE	NA	NA	NA	NA	NA
AXD71848.1|2562446_2563043_-|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
>prophage 11
CP030219	Salmonella enterica strain SA20021456 chromosome, complete genome	5431908	3494858	3518373	5431908	bacteriocin,terminase,portal,lysis,capsid,holin	Escherichia_phage(45.45%)	26	NA	NA
AXD72648.1|3494858_3495131_-|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
AXD72649.1|3495132_3495561_-	hypothetical protein	NA	G9L6M0	Escherichia_phage	67.8	5.4e-38
AXD72650.1|3495573_3496230_-	hypothetical protein	NA	Q08J74	Stx2-converting_phage	56.3	9.8e-55
AXD72651.1|3496290_3496662_-	hypothetical protein	NA	A0A088CC37	Shigella_phage	73.1	9.5e-47
AXD72652.1|3496669_3497269_-	DUF4376 domain-containing protein	NA	Q9LA61	Enterobacterial_phage	41.7	2.7e-35
AXD72653.1|3497385_3497538_-	type I toxin-antitoxin system hok family toxin	NA	NA	NA	NA	NA
AXD72654.1|3497728_3499330_-	DUF1983 domain-containing protein	NA	A0A2L1IV54	Escherichia_phage	60.4	4.7e-127
AXD72655.1|3499326_3500958_-	hypothetical protein	NA	A0A088CBK0	Shigella_phage	64.3	2.0e-202
AXD72656.1|3501476_3501674_+	hypothetical protein	NA	NA	NA	NA	NA
AXD72657.1|3502761_3503115_-	DUF1353 domain-containing protein	NA	I1TQ41	Pseudomonas_phage	39.8	1.2e-14
AXD72658.1|3503238_3503817_-	hypothetical protein	NA	Q9LA61	Enterobacterial_phage	49.7	1.3e-45
AXD72659.1|3504233_3504467_-	hypothetical protein	NA	NA	NA	NA	NA
AXD72660.1|3504530_3505052_-	hypothetical protein	NA	J9Q7Y6	Salmonella_phage	34.6	2.5e-13
AXD72661.1|3505051_3507295_-	hypothetical protein	NA	A0A2L1IV40	Escherichia_phage	67.5	7.5e-38
AXD72662.1|3507291_3507945_-	hypothetical protein	NA	Q08J85	Stx2-converting_phage	64.7	2.2e-78
AXD72663.1|3507944_3508508_-	hypothetical protein	NA	A0A2R2Z349	Escherichia_phage	55.6	8.2e-50
AXD72664.1|3508491_3508944_-	hypothetical protein	NA	A0A2R2Z354	Escherichia_phage	59.2	2.3e-34
AXD72665.1|3509001_3509415_-	hypothetical protein	NA	E7DYW8	Enterobacteria_phage	56.6	1.3e-28
AXD72666.1|3509479_3510694_-|capsid	N4-gp56 family major capsid protein	capsid	A0A2L1IV46	Escherichia_phage	85.6	4.6e-207
AXD72667.1|3510747_3511737_-	hypothetical protein	NA	A0A2L1IV47	Escherichia_phage	52.5	8.6e-79
AXD72668.1|3511890_3514038_-|portal	portal protein	portal	A0A0P0ZG74	Escherichia_phage	82.3	3.6e-311
AXD72669.1|3514037_3515750_-|terminase	terminase	terminase	A0A2R2Z350	Escherichia_phage	86.7	3.5e-293
AXD72670.1|3515730_3516558_-|terminase	terminase	terminase	A0A2L1IV66	Escherichia_phage	67.3	9.4e-71
AXD72671.1|3516903_3517392_-|lysis	lysis protein	lysis	H6WRZ5	Salmonella_phage	73.9	1.8e-53
AXD72672.1|3517621_3518038_-	structural protein	NA	A0A0E3GMJ2	Enterobacteria_phage	53.5	5.1e-41
AXD72673.1|3518034_3518373_-|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	37.5	3.8e-10
>prophage 12
CP030219	Salmonella enterica strain SA20021456 chromosome, complete genome	5431908	3522356	3545123	5431908	protease,integrase	Escherichia_phage(45.45%)	32	3514339:3514352	3544172:3544185
3514339:3514352	attL	TGGTCAATATGCTG	NA	NA	NA	NA
AXD72678.1|3522356_3522746_-	antitermination protein	NA	A0A088CD47	Shigella_phage	79.2	2.4e-53
AXD72679.1|3522748_3523045_-	hypothetical protein	NA	K7P7Q1	Enterobacteria_phage	76.6	1.0e-35
AXD72680.1|3523041_3523644_-	hypothetical protein	NA	A0A0U2RT94	Escherichia_phage	62.3	2.3e-66
AXD72681.1|3523707_3524286_-	Rha family transcriptional regulator	NA	A0A0P0ZGC2	Escherichia_phage	62.3	3.1e-28
AXD72682.1|3524908_3525310_+	DUF805 domain-containing protein	NA	NA	NA	NA	NA
AXD72683.1|3525337_3526072_-	hypothetical protein	NA	A0A088CC21	Shigella_phage	28.0	3.6e-13
AXD72684.1|3526071_3526521_-	hypothetical protein	NA	A0A088CBI9	Shigella_phage	28.5	4.3e-09
AXD72685.1|3526698_3526953_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
AXD74460.1|3526952_3527372_+	VapC toxin family PIN domain ribonuclease	NA	NA	NA	NA	NA
AXD72686.1|3527422_3527626_-	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	58.3	1.6e-11
AXD72687.1|3527739_3527976_-	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	34.8	1.1e-05
AXD72688.1|3527989_3528328_-	hypothetical protein	NA	NA	NA	NA	NA
AXD72689.1|3528324_3529068_-	hypothetical protein	NA	A0A0U2SAW4	Escherichia_phage	30.8	4.3e-14
AXD72690.1|3529087_3529834_-	DNA replication protein DnaC	NA	A0A088CBP4	Shigella_phage	67.2	5.1e-84
AXD72691.1|3530699_3531029_-	hypothetical protein	NA	NA	NA	NA	NA
AXD72692.1|3531116_3531569_-	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	49.6	1.9e-20
AXD72693.1|3531565_3531829_-	transcriptional regulator	NA	NA	NA	NA	NA
AXD74461.1|3532269_3532659_+	XRE family transcriptional regulator	NA	A0A1B5FPF4	Escherichia_phage	49.1	7.4e-10
AXD72694.1|3533413_3534253_+	transcriptional regulator	NA	K7PLX4	Enterobacteria_phage	59.5	3.8e-59
AXD72695.1|3534277_3534496_+	cell division protein FtsZ	NA	G8C7T2	Escherichia_phage	50.7	1.1e-13
AXD72696.1|3534492_3534657_+	hypothetical protein	NA	A0A0U2SHB5	Escherichia_phage	77.4	7.6e-17
AXD72697.1|3534735_3535077_+	hypothetical protein	NA	NA	NA	NA	NA
AXD72698.1|3535219_3538324_+	DNA breaking-rejoining protein	NA	H6WRX1	Salmonella_phage	42.5	1.1e-196
AXD72699.1|3538336_3539431_+	enterohemolysin	NA	K7P7N5	Enterobacteria_phage	45.7	8.1e-86
AXD72700.1|3539464_3539770_+	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	62.9	6.8e-27
AXD72701.1|3539769_3539973_+	hypothetical protein	NA	K7PLX1	Enterobacteria_phage	50.8	5.0e-10
AXD74462.1|3540622_3541672_+	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	68.1	2.6e-57
AXD72702.1|3541816_3542233_+	hypothetical protein	NA	NA	NA	NA	NA
AXD72703.1|3542313_3542562_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
AXD72704.1|3542530_3543559_+|integrase	integrase	integrase	A0A192Y7M7	Salmonella_phage	50.0	5.6e-81
AXD72705.1|3543618_3543927_-	hypothetical protein	NA	NA	NA	NA	NA
AXD72706.1|3544463_3545123_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	52.4	1.2e-44
3544172:3544185	attR	CAGCATATTGACCA	NA	NA	NA	NA
>prophage 1
CP030220	Salmonella enterica strain SA20021456 plasmid pSA20021456.1, complete sequence	159279	92391	104779	159279	transposase	Enterobacteria_phage(25.0%)	14	NA	NA
AXD74640.1|92391_93072_-	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.0	2.8e-28
AXD74641.1|93448_93796_-	hypothetical protein	NA	NA	NA	NA	NA
AXD74642.1|93828_94764_-	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
AXD74643.1|95293_95716_+	peptidase	NA	A0A1W6JNS2	Morganella_phage	54.0	3.5e-29
AXD74644.1|95715_96987_+	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	64.0	4.3e-155
AXD74645.1|97125_98097_-	ParB/RepB/Spo0J family partition protein	NA	Q1MVJ4	Enterobacteria_phage	68.2	4.0e-113
AXD74646.1|98093_99299_-	ParA family protein	NA	Q1MVJ3	Enterobacteria_phage	89.7	6.6e-206
AXD74647.1|99661_100312_+	serine recombinase	NA	M9Q1K0	Clostridium_phage	28.6	1.7e-06
AXD74648.1|100472_100745_-	hypothetical protein	NA	NA	NA	NA	NA
AXD74716.1|100819_101761_+|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	52.5	2.9e-76
AXD74649.1|101757_102366_-	hypothetical protein	NA	NA	NA	NA	NA
AXD74650.1|102427_102556_+	hypothetical protein	NA	NA	NA	NA	NA
AXD74651.1|102515_102908_-	hypothetical protein	NA	NA	NA	NA	NA
AXD74652.1|103249_104779_+	hypothetical protein	NA	A0A2K9L3I8	Tupanvirus	28.5	3.4e-42
