The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP030217	Salmonella enterica strain SA20075157 chromosome, complete genome	4716530	1113615	1209018	4716530	holin,head,terminase,capsid,tRNA,integrase,tail,transposase,portal	Cronobacter_phage(47.73%)	89	1106109:1106125	1170825:1170841
1106109:1106125	attL	GCATCCAGCTCCGCCTG	NA	NA	NA	NA
AXD65944.1|1113615_1114727_-|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	25.0	6.4e-06
AXD69243.1|1114812_1116042_-	DUF4102 domain-containing protein	NA	A0A1B5FPC6	Escherichia_phage	90.7	3.9e-214
AXD69244.1|1116641_1117805_-	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
AXD65945.1|1117812_1119993_-	type I secretion system permease/ATPase	NA	F2Y302	Organic_Lake_phycodnavirus	34.0	9.9e-19
AXD65946.1|1119989_1121399_-	type I secretion protein TolC	NA	NA	NA	NA	NA
AXD65947.1|1121463_1132938_-	biofilm-associated protein BapA	NA	NA	NA	NA	NA
AXD69245.1|1133555_1134038_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	5.2e-29
AXD65948.1|1134187_1134664_+	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
AXD65949.1|1134653_1134944_+	RnfH family protein	NA	NA	NA	NA	NA
AXD65950.1|1135105_1135444_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
AXD65951.1|1135592_1137254_-	DNA repair protein RecN	NA	NA	NA	NA	NA
AXD65952.1|1137339_1138218_-	NAD(+) kinase	NA	NA	NA	NA	NA
AXD69246.1|1138149_1138344_+	molecular chaperone GrpE	NA	NA	NA	NA	NA
AXD65953.1|1138340_1138931_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
AXD65954.1|1138965_1139571_-	cytoplasmic protein	NA	NA	NA	NA	NA
AXD65955.1|1139700_1140942_-	DUF21 domain-containing protein	NA	NA	NA	NA	NA
AXD65956.1|1141006_1141798_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
AXD65957.1|1141743_1142040_-	hypothetical protein	NA	NA	NA	NA	NA
AXD65958.1|1141963_1143325_+	signal recognition particle protein	NA	NA	NA	NA	NA
AXD69247.1|1143460_1144180_+	hypothetical protein	NA	NA	NA	NA	NA
AXD65959.1|1144341_1144590_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
AXD65960.1|1144608_1145157_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
AXD65961.1|1145201_1145969_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
AXD65962.1|1146009_1146357_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
AXD65963.1|1146513_1147734_-	diguanylate cyclase	NA	A0A2K8I9Y5	Pseudomonas_phage	36.2	5.8e-08
AXD65964.1|1147726_1148245_-	YfiR family protein	NA	NA	NA	NA	NA
AXD65965.1|1148684_1149755_+	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.8	2.4e-90
AXD65966.1|1149764_1150886_+	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
AXD65967.1|1150943_1151852_+	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
AXD65968.1|1151812_1152973_-	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
AXD69248.1|1153072_1153120_-	hypothetical protein	NA	NA	NA	NA	NA
AXD65969.1|1153283_1154303_-|integrase	integrase	integrase	A0A0F7LBR0	Escherichia_phage	58.5	6.3e-109
AXD65970.1|1154342_1154642_-	helix-turn-helix domain-containing protein	NA	Q1JS21	Enterobacteria_phage	53.2	3.8e-22
AXD65971.1|1154750_1155089_+	hypothetical protein	NA	NA	NA	NA	NA
AXD65972.1|1155114_1155447_+	hypothetical protein	NA	NA	NA	NA	NA
AXD65973.1|1155456_1156026_+	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	46.3	2.6e-43
AXD65974.1|1156028_1156247_+	hypothetical protein	NA	NA	NA	NA	NA
AXD65975.1|1156285_1158943_+	bifunctional DNA primase/helicase	NA	A0A077K8T2	Ralstonia_phage	47.4	6.0e-244
AXD65976.1|1158970_1159294_-	transcriptional regulator	NA	F1BUM8	Cronobacter_phage	73.1	1.3e-36
AXD65977.1|1159293_1160313_-|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	68.5	1.0e-135
AXD65978.1|1160309_1162094_-|terminase	terminase	terminase	F1BUM5	Cronobacter_phage	69.5	1.9e-246
AXD65979.1|1162304_1163144_+|capsid	phage capsid protein	capsid	F1BUM4	Cronobacter_phage	52.0	3.7e-46
AXD65980.1|1163178_1164207_+|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	71.9	3.4e-134
AXD65981.1|1164218_1164917_+|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	52.2	8.8e-62
AXD65982.1|1164935_1165127_+	hypothetical protein	NA	NA	NA	NA	NA
AXD65983.1|1165220_1165673_+|head	head completion protein	head	F1BUL8	Cronobacter_phage	64.7	1.2e-48
AXD65984.1|1165669_1166152_+|tail	phage tail protein	tail	F1BUL7	Cronobacter_phage	48.7	3.0e-37
AXD65985.1|1166148_1166853_+	hypothetical protein	NA	F1BUL6	Cronobacter_phage	59.9	1.8e-70
AXD65986.1|1166849_1167977_+	DUF2586 domain-containing protein	NA	F1BUL5	Cronobacter_phage	83.4	1.6e-174
AXD65987.1|1167973_1168429_+	DUF2597 family protein	NA	F1BUL4	Cronobacter_phage	71.5	1.7e-58
AXD65988.1|1168441_1168738_+|holin	holin	holin	C7BGD7	Burkholderia_phage	48.2	2.4e-16
AXD65989.1|1168734_1169076_+	M15 family peptidase	NA	F1BUL3	Cronobacter_phage	91.1	2.2e-50
AXD65990.1|1169075_1169408_+	hypothetical protein	NA	F1BUL2	Cronobacter_phage	70.0	4.4e-35
AXD65991.1|1169334_1169568_+	hypothetical protein	NA	F1BUL1	Cronobacter_phage	83.1	1.7e-30
AXD65992.1|1169545_1169812_+	hypothetical protein	NA	A5X9I7	Aeromonas_virus	61.0	3.2e-20
AXD65993.1|1169999_1171967_+|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	69.5	1.9e-266
1170825:1170841	attR	CAGGCGGAGCTGGATGC	NA	NA	NA	NA
AXD65994.1|1171963_1172293_+	DUF2590 family protein	NA	F1BUK8	Cronobacter_phage	72.4	3.8e-39
AXD65995.1|1172289_1173474_+	hypothetical protein	NA	F1BUK6	Cronobacter_phage	78.4	6.7e-179
AXD65996.1|1173460_1174054_+	hypothetical protein	NA	F1BUK5	Cronobacter_phage	82.1	2.5e-89
AXD65997.1|1174063_1176298_+|tail	phage tail protein	tail	Q8HAB4	Salmonella_phage	71.3	2.0e-176
AXD65998.1|1176310_1176865_+|tail	tail fiber assembly protein	tail	S4TUB9	Salmonella_phage	89.0	2.7e-90
AXD65999.1|1176854_1177580_+	hypothetical protein	NA	F1BUK1	Cronobacter_phage	55.6	9.5e-67
AXD66000.1|1177551_1178097_+	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	72.0	1.9e-59
AXD66001.1|1178096_1179800_+	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	81.1	8.4e-223
AXD66002.1|1179698_1180052_-	hypothetical protein	NA	NA	NA	NA	NA
AXD66003.1|1180452_1180635_+	hypothetical protein	NA	NA	NA	NA	NA
AXD66004.1|1180591_1181032_+|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	9.6e-14
AXD66005.1|1181072_1181261_-	hypothetical protein	NA	NA	NA	NA	NA
AXD66006.1|1182060_1182429_-	hypothetical protein	NA	NA	NA	NA	NA
AXD66007.1|1182428_1182896_-	hypothetical protein	NA	A0A1V0E5N7	Salmonella_phage	31.1	8.4e-08
AXD66008.1|1183064_1183403_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
AXD66009.1|1183674_1184412_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
AXD66010.1|1184543_1185524_+	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
AXD66011.1|1185520_1186252_+	peptidoglycan editing factor PgeF	NA	NA	NA	NA	NA
AXD66012.1|1186381_1188955_+	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.5	2.0e-127
AXD66013.1|1194818_1195274_+	DUF4385 domain-containing protein	NA	E3SMI8	Prochlorococcus_phage	50.0	3.0e-34
AXD66014.1|1195377_1196679_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	30.6	3.1e-44
AXD66015.1|1196675_1196999_-	YfiM family lipoprotein	NA	NA	NA	NA	NA
AXD66016.1|1197043_1198399_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
AXD66017.1|1198513_1201174_-	protein lysine acetyltransferase	NA	NA	NA	NA	NA
AXD66018.1|1201227_1201908_-	DTW domain-containing protein	NA	NA	NA	NA	NA
AXD66019.1|1201980_1202400_-	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	40.6	1.2e-16
AXD66020.1|1202603_1203641_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
AXD66021.1|1203756_1204446_-	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	49.5	4.6e-55
AXD66022.1|1204764_1205148_+	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	74.0	6.1e-33
AXD66023.1|1205209_1205797_-	cysteine/O-acetylserine efflux protein	NA	NA	NA	NA	NA
AXD69249.1|1205899_1206799_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AXD66024.1|1206816_1208151_-	ATP-dependent RNA helicase SrmB	NA	A0A1B1IS59	uncultured_Mediterranean_phage	29.7	1.6e-43
AXD66025.1|1208280_1209018_+|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase	tRNA	NA	NA	NA	NA
>prophage 2
CP030217	Salmonella enterica strain SA20075157 chromosome, complete genome	4716530	1657071	1727436	4716530	holin,head,terminase,capsid,tRNA,tail,integrase,portal	Cronobacter_phage(57.89%)	77	1697330:1697350	1725905:1725925
AXD66419.1|1657071_1658010_+|tRNA	tRNA dihydrouridine(16) synthase DusC	tRNA	NA	NA	NA	NA
AXD66420.1|1658067_1658151_-	hypothetical protein	NA	NA	NA	NA	NA
AXD66421.1|1658468_1659905_+	multidrug resistance outer membrane protein MdtQ	NA	NA	NA	NA	NA
AXD66422.1|1659970_1660732_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
AXD66423.1|1660779_1661376_-	DedA family protein	NA	NA	NA	NA	NA
AXD66424.1|1661507_1662095_+	YIP1 family protein	NA	NA	NA	NA	NA
AXD66425.1|1662094_1662370_+	hypothetical protein	NA	NA	NA	NA	NA
AXD66426.1|1662260_1663208_+	D-alanyl-D-alanine endopeptidase	NA	NA	NA	NA	NA
AXD66427.1|1663266_1664997_-	D-lactate dehydrogenase	NA	NA	NA	NA	NA
AXD66428.1|1665263_1667561_+	beta-glucosidase BglX	NA	NA	NA	NA	NA
AXD66429.1|1667741_1668659_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AXD66430.1|1668662_1669832_+	ABC transporter permease	NA	NA	NA	NA	NA
AXD66431.1|1669824_1670772_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	1.7e-23
AXD66432.1|1670755_1671487_+	ABC transporter permease	NA	NA	NA	NA	NA
AXD66433.1|1671467_1671575_-	hypothetical protein	NA	NA	NA	NA	NA
AXD66434.1|1671634_1672366_-	transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
AXD66435.1|1672588_1674274_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.3	4.8e-279
AXD66436.1|1674270_1674990_+	two-component system response regulator YehT	NA	NA	NA	NA	NA
AXD66437.1|1675036_1675504_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	1.8e-74
AXD66438.1|1675560_1676091_-	DUF1307 domain-containing protein	NA	NA	NA	NA	NA
AXD66439.1|1676262_1676721_-	DUF1307 domain-containing protein	NA	Q9EYF5	Enterobacteria_phage	72.5	1.7e-53
AXD66440.1|1676961_1678995_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	6.1e-55
AXD66441.1|1679159_1680269_+	ATP-binding protein	NA	NA	NA	NA	NA
AXD66442.1|1680546_1680828_+	DUF2574 family protein	NA	NA	NA	NA	NA
AXD66443.1|1681106_1681640_+	fimbrial chaperone protein	NA	NA	NA	NA	NA
AXD66444.1|1681701_1682382_+	fimbrial assembly protein	NA	NA	NA	NA	NA
AXD66445.1|1682410_1684897_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
AXD66446.1|1684912_1685935_+	fimbrial assembly protein	NA	NA	NA	NA	NA
AXD66447.1|1685978_1686293_-	heavy metal resistance protein	NA	NA	NA	NA	NA
AXD66448.1|1686702_1687500_+	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
AXD66449.1|1687486_1688287_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
AXD66450.1|1688322_1689069_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AXD66451.1|1689042_1690008_-	sugar kinase	NA	NA	NA	NA	NA
AXD66452.1|1690004_1691009_-	ADP-ribosylglycohydrolase family protein	NA	NA	NA	NA	NA
AXD66453.1|1691005_1692277_-	MFS transporter	NA	NA	NA	NA	NA
AXD66454.1|1692530_1693583_+	class I fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
AXD66455.1|1693635_1694535_-	lipid kinase YegS	NA	NA	NA	NA	NA
AXD66456.1|1695093_1695429_+	hypothetical protein	NA	NA	NA	NA	NA
AXD66457.1|1695550_1695967_+	CesT family type III secretion system chaperone	NA	NA	NA	NA	NA
AXD66458.1|1695996_1697049_-	type III secretion system effector arginine glycosyltransferase	NA	Q8HAB2	Salmonella_phage	75.8	7.1e-148
AXD66459.1|1697231_1697540_+	hypothetical protein	NA	NA	NA	NA	NA
1697330:1697350	attL	AAAAATAAGCCTGCGTAAGGG	NA	NA	NA	NA
AXD66460.1|1697434_1698448_-|integrase	site-specific integrase	integrase	Q83VS6	Escherichia_phage	90.4	2.2e-178
AXD66461.1|1698563_1698863_-	XRE family transcriptional regulator	NA	Q1JS63	Enterobacteria_phage	85.9	3.0e-43
AXD66462.1|1698980_1699256_+	hypothetical protein	NA	Q1JS60	Enterobacteria_phage	83.5	8.9e-42
AXD66463.1|1699252_1699585_+	hypothetical protein	NA	NA	NA	NA	NA
AXD66464.1|1699594_1700164_+	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	46.8	1.2e-43
AXD66465.1|1700166_1700385_+	hypothetical protein	NA	NA	NA	NA	NA
AXD66466.1|1700423_1703081_+	bifunctional DNA primase/helicase	NA	A0A077K8T2	Ralstonia_phage	47.4	6.0e-244
AXD66467.1|1703108_1703432_-	transcriptional regulator	NA	F1BUM8	Cronobacter_phage	73.1	1.3e-36
AXD66468.1|1703431_1704451_-|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	68.5	1.0e-135
AXD66469.1|1704447_1706232_-|terminase	terminase	terminase	F1BUM5	Cronobacter_phage	69.5	1.1e-246
AXD66470.1|1706289_1707279_+|capsid	phage capsid protein	capsid	F1BUM4	Cronobacter_phage	52.3	3.3e-46
AXD66471.1|1707312_1708341_+|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	73.1	3.2e-137
AXD66472.1|1708352_1709051_+|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	52.2	8.8e-62
AXD66473.1|1709069_1709261_+	hypothetical protein	NA	NA	NA	NA	NA
AXD66474.1|1709354_1709807_+|head	head completion protein	head	F1BUL8	Cronobacter_phage	64.7	1.2e-48
AXD66475.1|1709803_1710286_+|tail	phage tail protein	tail	F1BUL7	Cronobacter_phage	48.7	3.0e-37
AXD66476.1|1710282_1710987_+	hypothetical protein	NA	F1BUL6	Cronobacter_phage	57.3	6.4e-68
AXD66477.1|1710983_1712111_+	DUF2586 domain-containing protein	NA	F1BUL5	Cronobacter_phage	83.7	1.9e-175
AXD66478.1|1712107_1712563_+	DUF2597 domain-containing protein	NA	F1BUL4	Cronobacter_phage	72.2	5.0e-58
AXD66479.1|1712575_1712872_+|holin	holin	holin	C7BGD7	Burkholderia_phage	48.2	2.4e-16
AXD66480.1|1712868_1713210_+	M15 family peptidase	NA	F1BUL3	Cronobacter_phage	90.1	1.9e-49
AXD66481.1|1713209_1713542_+	hypothetical protein	NA	F1BUL2	Cronobacter_phage	70.0	4.4e-35
AXD66482.1|1713468_1713702_+	hypothetical protein	NA	F1BUL1	Cronobacter_phage	83.1	1.7e-30
AXD66483.1|1713679_1713946_+	hypothetical protein	NA	A5X9I7	Aeromonas_virus	61.0	3.2e-20
AXD66484.1|1714133_1716101_+|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	70.5	5.6e-271
AXD66485.1|1716097_1716427_+	DUF2590 family protein	NA	F1BUK8	Cronobacter_phage	72.4	3.8e-39
AXD66486.1|1716423_1717608_+	hypothetical protein	NA	F1BUK6	Cronobacter_phage	78.4	6.7e-179
AXD66487.1|1717594_1718188_+	hypothetical protein	NA	F1BUK5	Cronobacter_phage	82.1	6.5e-90
AXD66488.1|1718197_1720225_+|tail	phage tail protein	tail	F1BUK3	Cronobacter_phage	47.6	4.0e-155
AXD66489.1|1720242_1720770_+|tail	phage tail protein	tail	A0A0U2QV64	Escherichia_phage	52.6	4.0e-51
AXD66490.1|1720759_1721485_+	hypothetical protein	NA	F1BUK1	Cronobacter_phage	56.4	1.3e-68
AXD66491.1|1721456_1722002_+	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	72.5	2.4e-59
AXD66492.1|1722001_1723705_+	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	81.3	2.2e-223
AXD66493.1|1724809_1725421_+	iron-sulfur cluster assembly scaffold protein SufA	NA	NA	NA	NA	NA
AXD66494.1|1725432_1725813_+	type II toxin-antitoxin system YafO family toxin	NA	NA	NA	NA	NA
AXD69266.1|1726074_1727436_-	U32 family peptidase	NA	Q6DW11	Phage_TP	95.1	3.0e-207
1725905:1725925	attR	AAAAATAAGCCTGCGTAAGGG	NA	NA	NA	NA
>prophage 3
CP030217	Salmonella enterica strain SA20075157 chromosome, complete genome	4716530	2208062	2214807	4716530		Salmonella_phage(28.57%)	10	NA	NA
AXD66932.1|2208062_2208869_-	peptide ABC transporter ATP-binding protein SapF	NA	G3M9Y6	Bacillus_virus	27.4	4.6e-14
AXD66933.1|2208870_2209863_-	peptide ABC transporter ATP-binding protein SapD	NA	NA	NA	NA	NA
AXD66934.1|2209862_2210753_-	peptide ABC transporter permease SapC	NA	NA	NA	NA	NA
AXD69284.1|2210876_2211278_+	DUF4102 domain-containing protein	NA	K7PGY1	Enterobacteria_phage	58.4	1.1e-32
AXD66935.1|2211657_2212545_-	hypothetical protein	NA	A0A0P0ZCT1	Stx2-converting_phage	38.1	5.6e-37
AXD66936.1|2212851_2213034_+	hypothetical protein	NA	S4TSR3	Salmonella_phage	79.1	1.4e-22
AXD66937.1|2213283_2213424_+	pertussis toxin subunit	NA	A0A0U2KD26	Escherichia_phage	77.1	8.5e-09
AXD66938.1|2213462_2213762_+	pertussis toxin subunit	NA	A0A0U2KD26	Escherichia_phage	54.3	3.2e-13
AXD66939.1|2213688_2214114_+	subtilase cytotoxin subunit B-like protein	NA	NA	NA	NA	NA
AXD66940.1|2214492_2214807_+	recombinase family protein	NA	A0A1S6L009	Salmonella_phage	86.1	4.3e-40
>prophage 4
CP030217	Salmonella enterica strain SA20075157 chromosome, complete genome	4716530	2680065	2684477	4716530		Escherichia_phage(50.0%)	6	NA	NA
AXD67391.1|2680065_2680305_+	virulence protein MsgA	NA	K7P6H1	Enterobacteria_phage	88.6	8.5e-33
AXD69306.1|2681177_2681987_+	cytolethal distending toxin subunit B family protein	NA	A5LH53	Enterobacteria_phage	50.0	2.1e-62
AXD67392.1|2682059_2682437_+	DUF1353 domain-containing protein	NA	I1TQ41	Pseudomonas_phage	38.4	2.2e-14
AXD67393.1|2682584_2683127_-	hypothetical protein	NA	A0A0U2S643	Escherichia_phage	67.6	8.1e-71
AXD67394.1|2683318_2684047_-	pertussis toxin-like subunit ArtA	NA	A0A0U2KD26	Escherichia_phage	52.5	2.0e-61
AXD67395.1|2684063_2684477_-	subtilase cytotoxin subunit B	NA	A0A0U2KD34	Escherichia_phage	38.6	4.2e-19
>prophage 5
CP030217	Salmonella enterica strain SA20075157 chromosome, complete genome	4716530	2946118	2953886	4716530	transposase,protease	Enterobacteria_phage(16.67%)	6	NA	NA
AXD67636.1|2946118_2947373_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	34.5	2.2e-18
AXD67637.1|2947522_2949799_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
AXD67638.1|2949829_2950150_-|protease	ATP-dependent Clp protease adaptor ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
AXD67639.1|2950473_2950695_+	cold shock domain protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
AXD67640.1|2950824_2952771_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	42.3	9.1e-40
AXD67641.1|2952767_2953886_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.4e-08
>prophage 6
CP030217	Salmonella enterica strain SA20075157 chromosome, complete genome	4716530	3069647	3110295	4716530	protease,coat,lysis,tail,integrase,terminase,portal	Salmonella_phage(66.1%)	61	3067920:3067942	3110361:3110383
3067920:3067942	attL	CGTTCAACTTAGTATAAAAAAGC	NA	NA	NA	NA
AXD67753.1|3069647_3071072_+	hypothetical protein	NA	F1C5A9	Cronobacter_phage	29.2	4.3e-31
AXD67754.1|3073712_3074615_-	phage antirepressor Ant	NA	A0A192Y6V0	Salmonella_phage	98.7	6.1e-172
AXD67755.1|3074683_3074845_-	Arc family DNA-binding protein	NA	A8CG91	Salmonella_phage	98.1	2.7e-22
AXD67756.1|3074935_3075187_+	Arc family DNA-binding protein	NA	A0A192Y840	Salmonella_phage	98.8	3.8e-39
AXD67757.1|3075203_3075623_-	hypothetical protein	NA	B9UDL3	Salmonella_phage	97.1	1.6e-71
AXD67758.1|3075740_3076070_+	hypothetical protein	NA	NA	NA	NA	NA
AXD67759.1|3076087_3077914_-	DNA transfer protein	NA	A0A192Y934	Salmonella_phage	70.4	3.4e-238
AXD67760.1|3077913_3079329_-	DNA transfer protein	NA	A0A192Y834	Salmonella_phage	88.5	1.6e-227
AXD67761.1|3079338_3080028_-	DNA transfer protein	NA	A0A192Y6A3	Salmonella_phage	97.8	1.3e-113
AXD67762.1|3080030_3080486_-	hypothetical protein	NA	Q76H16	Enterobacteria_phage	99.3	3.9e-87
AXD67763.1|3080485_3081124_-|tail	phage tail protein	tail	A0A088CPT1	Enterobacteria_phage	98.6	2.7e-89
AXD67764.1|3081127_3082546_-	hypothetical protein	NA	I1TEJ1	Salmonella_phage	97.7	5.3e-271
AXD67765.1|3082505_3083006_-	hypothetical protein	NA	I1TEJ0	Salmonella_phage	98.8	5.5e-90
AXD67766.1|3082989_3083550_-	hypothetical protein	NA	C6ZR11	Salmonella_phage	99.5	3.7e-103
AXD67767.1|3083590_3084883_-|coat	coat protein	coat	Q76H21	Enterobacteria_phage	100.0	1.1e-243
AXD67768.1|3084882_3085794_-	scaffolding protein	NA	A0A192Y6T4	Salmonella_phage	99.3	3.1e-160
AXD67769.1|3085807_3087985_-|portal	portal protein	portal	I6R968	Salmonella_phage	98.8	0.0e+00
AXD67770.1|3087984_3089445_-|terminase	terminase	terminase	W6MW26	Pseudomonas_phage	76.7	1.1e-220
AXD67771.1|3089444_3089882_-|terminase	terminase	terminase	C7U0W1	Enterobacteria_phage	96.1	3.1e-65
AXD67772.1|3089884_3090127_-	DUF2560 family protein	NA	A5VW77	Enterobacteria_phage	100.0	1.3e-36
AXD67773.1|3090354_3090960_-	Rha family transcriptional regulator	NA	A0A1R3Y613	Salmonella_virus	99.5	8.9e-111
AXD67774.1|3091109_3091547_-|lysis	lysis protein	lysis	A0A1R3Y6Z8	Salmonella_virus	93.1	3.0e-68
AXD69318.1|3091635_3092133_-	lysozyme	NA	I6R0P2	Salmonella_phage	98.8	2.4e-90
AXD67775.1|3092110_3092314_-	hypothetical protein	NA	I6R0S9	Salmonella_phage	98.5	1.5e-33
AXD67776.1|3092368_3092629_-	hypothetical protein	NA	A0A220NRM8	Escherichia_phage	89.7	5.9e-11
AXD67777.1|3092684_3093173_-	DUF1133 family protein	NA	I6S672	Salmonella_phage	87.0	3.0e-77
AXD67778.1|3093169_3093352_-	hypothetical protein	NA	C6ZR61	Salmonella_phage	100.0	5.0e-25
AXD67779.1|3093339_3093810_-	hypothetical protein	NA	C6ZR60	Salmonella_phage	96.8	3.3e-89
AXD67780.1|3093790_3094027_-	hypothetical protein	NA	C6ZR59	Salmonella_phage	88.5	3.4e-34
AXD67781.1|3094019_3094190_-	NinF family protein	NA	I6R994	Salmonella_phage	85.2	1.3e-22
AXD67782.1|3094186_3094363_-	NinE family protein	NA	I6RSI9	Salmonella_phage	100.0	2.3e-27
AXD67783.1|3094329_3094503_-	protein ninD	NA	Q8HAF7	Salmonella_phage	96.5	1.7e-30
AXD67784.1|3094499_3094946_-	recombination protein NinB	NA	I6R0N7	Salmonella_phage	98.0	3.9e-79
AXD67785.1|3094902_3095160_-	restriction alleviation protein, Lar family	NA	Q8SC44	Stx2_converting_phage	47.1	1.1e-09
AXD69319.1|3095114_3095378_-	hypothetical protein	NA	I6R992	Salmonella_phage	95.4	1.7e-42
AXD67786.1|3095389_3095584_-	hypothetical protein	NA	NA	NA	NA	NA
AXD67787.1|3095666_3097547_-	bifunctional DNA primase/helicase	NA	Q5G8S8	Enterobacteria_phage	98.7	0.0e+00
AXD67788.1|3097654_3098287_-	helix-turn-helix domain-containing protein	NA	A0A0P0ZC04	Stx2-converting_phage	53.9	9.1e-58
AXD67789.1|3098449_3098740_-	hypothetical protein	NA	I6RSP4	Salmonella_phage	99.0	9.0e-45
AXD67790.1|3098876_3099104_-	DNA-binding protein	NA	G9L677	Escherichia_phage	89.3	2.1e-33
AXD67791.1|3099181_3099892_+	helix-turn-helix transcriptional regulator	NA	G9L676	Escherichia_phage	87.7	4.0e-118
AXD67792.1|3100052_3101132_+	hypothetical protein	NA	A0A192Y6S0	Salmonella_phage	100.0	1.5e-193
AXD67793.1|3101171_3101375_-	hypothetical protein	NA	A0A2H5BFH9	Salmonella_phage	98.5	1.0e-26
AXD67794.1|3101753_3102116_+	antitermination protein	NA	C6ZR44	Salmonella_phage	91.7	1.7e-56
AXD67795.1|3102193_3102748_+	pentapeptide repeat-containing protein	NA	A0A220NQW1	Salmonella_phage	71.7	7.5e-40
AXD67796.1|3103064_3103226_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	E7C9Q3	Salmonella_phage	100.0	4.9e-24
AXD67797.1|3103218_3103332_+	host cell division inhibitory peptide Kil	NA	C6ZR39	Salmonella_phage	100.0	7.8e-13
AXD67798.1|3103328_3103517_+	hypothetical protein	NA	C6ZR38	Salmonella_phage	100.0	1.3e-28
AXD67799.1|3103525_3104233_+	recombinase	NA	E7C9Q0	Salmonella_phage	93.6	2.4e-131
AXD67800.1|3104233_3104740_+	single-stranded DNA-binding protein	NA	C6ZR36	Salmonella_phage	99.4	6.5e-91
AXD67801.1|3104748_3105297_+	3'-5' exoribonuclease	NA	C6ZR35	Salmonella_phage	100.0	2.1e-106
AXD67802.1|3105312_3105606_+	DUF2856 family protein	NA	Q5G8U3	Enterobacteria_phage	90.7	3.5e-44
AXD67803.1|3105616_3105904_+	hypothetical protein	NA	Q5G8U4	Enterobacteria_phage	96.8	3.4e-44
AXD67804.1|3105900_3106071_+	DUF2737 domain-containing protein	NA	Q5G8U5	Enterobacteria_phage	91.1	1.6e-22
AXD67805.1|3106058_3106676_+	Eae-like protein	NA	Q5G8U6	Enterobacteria_phage	72.1	8.0e-75
AXD67806.1|3106784_3107144_+	Eaf protein	NA	T1SA95	Salmonella_phage	100.0	4.0e-66
AXD67807.1|3107140_3107617_+	ead/Ea22-like family protein	NA	A0A2H4FRZ0	Salmonella_phage	66.2	4.0e-58
AXD67808.1|3107618_3107864_+	hypothetical protein	NA	A0A0M3ULJ3	Salmonella_phage	96.3	2.7e-42
AXD67809.1|3107867_3108182_+	hypothetical protein	NA	Q5G8V1	Enterobacteria_phage	67.7	1.2e-34
AXD67810.1|3109028_3109247_+	excisionase	NA	A0A1V0E5M4	Salmonella_phage	100.0	5.7e-36
AXD67811.1|3109224_3110295_+|integrase	integrase	integrase	A0A1V0E5M7	Salmonella_phage	100.0	1.0e-154
3110361:3110383	attR	CGTTCAACTTAGTATAAAAAAGC	NA	NA	NA	NA
