The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP030211	Salmonella enterica strain SA20051528 chromosome, complete genome	4719399	89256	98639	4719399		Enterobacteria_phage(100.0%)	12	NA	NA
AXD55431.1|89256_91590_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	85.3	0.0e+00
AXD55432.1|91604_91925_-	hypothetical protein	NA	NA	NA	NA	NA
AXD55433.1|91921_92149_-	hypothetical protein	NA	NA	NA	NA	NA
AXD55434.1|92145_92694_-	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	64.0	3.5e-29
AXD59701.1|93028_93214_+	hypothetical protein	NA	NA	NA	NA	NA
AXD55435.1|93494_94232_+	glycoprotein 3	NA	Q7M2A2	Enterobacteria_phage	64.4	5.8e-80
AXD55436.1|94228_94474_+	hypothetical protein	NA	Q7M294	Enterobacteria_phage	76.5	6.3e-31
AXD55437.1|94490_95057_+	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	62.7	5.0e-55
AXD55438.1|95020_95206_-	hypothetical protein	NA	NA	NA	NA	NA
AXD55439.1|95438_96548_-	hypothetical protein	NA	NA	NA	NA	NA
AXD55440.1|96550_97459_-	hypothetical protein	NA	NA	NA	NA	NA
AXD55441.1|97463_98639_-	DUF4102 domain-containing protein	NA	Q7M297	Enterobacteria_phage	91.8	2.1e-209
>prophage 2
CP030211	Salmonella enterica strain SA20051528 chromosome, complete genome	4719399	653322	693141	4719399	integrase,head,terminase,tRNA,plate,capsid,portal,tail,lysis,holin	Salmonella_phage(52.27%)	50	647388:647408	695448:695468
647388:647408	attL	GATAAGCGCAGCGCCATCAGG	NA	NA	NA	NA
AXD55948.1|653322_654888_+	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	33.9	1.7e-12
AXD55949.1|654884_655532_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
AXD55950.1|655763_656531_+	siderophore-interacting protein	NA	NA	NA	NA	NA
AXD55951.1|656720_657764_-|integrase	integrase	integrase	A0A218M4I3	Erwinia_phage	97.4	1.1e-198
AXD59722.1|657763_658351_-	phage repressor protein CI	NA	A0A218M4J1	Erwinia_phage	60.3	4.6e-64
AXD55952.1|658485_658749_+	hypothetical protein	NA	A0A218M4I5	Erwinia_phage	72.4	7.4e-30
AXD55953.1|658779_659289_+	hypothetical protein	NA	Q6K1F8	Salmonella_virus	90.5	1.2e-81
AXD55954.1|659296_659497_+	DUF2724 domain-containing protein	NA	Q6K1F7	Salmonella_virus	98.5	1.8e-31
AXD55955.1|659460_659799_+	hypothetical protein	NA	A0A218M4I7	Erwinia_phage	94.6	7.3e-54
AXD55956.1|659863_660097_+	hypothetical protein	NA	Q6K1F6	Salmonella_virus	88.3	4.3e-29
AXD55957.1|660096_660321_+	TraR/DksA family transcriptional regulator	NA	Q6K1F5	Salmonella_virus	100.0	6.5e-35
AXD55958.1|660317_660839_+	hypothetical protein	NA	Q6K1F4	Salmonella_virus	100.0	1.2e-92
AXD55959.1|660961_663181_+	replication endonuclease	NA	A0A0M3ULG0	Salmonella_phage	95.4	0.0e+00
AXD59723.1|663325_663514_+	Tum protein	NA	A0A218M4I0	Erwinia_phage	91.5	2.8e-23
AXD55960.1|663746_663956_+	hypothetical protein	NA	Q6K1F0	Salmonella_virus	94.2	1.1e-31
AXD59724.1|664089_664281_+	hypothetical protein	NA	S4TRZ0	Salmonella_phage	93.7	1.8e-25
AXD55961.1|664486_664714_+	hypothetical protein	NA	NA	NA	NA	NA
AXD55962.1|664744_665962_+	ATP-binding protein	NA	NA	NA	NA	NA
AXD55963.1|666013_667060_-|portal	phage portal protein	portal	S4TNX7	Salmonella_phage	99.4	4.4e-190
AXD55964.1|667059_668829_-	oxidoreductase	NA	S4TT96	Salmonella_phage	98.1	0.0e+00
AXD55965.1|668994_669849_+|capsid	capsid scaffolding protein	capsid	A0A0M3UL81	Salmonella_phage	100.0	9.9e-148
AXD55966.1|669925_670993_+|capsid	phage major capsid protein, P2 family	capsid	A0A0M4R4W2	Salmonella_phage	99.7	1.2e-198
AXD55967.1|670996_671746_+|terminase	terminase	terminase	Q6K1I5	Salmonella_virus	98.0	2.6e-128
AXD55968.1|671839_672346_+|head	head completion/stabilization protein	head	S4TNY1	Salmonella_phage	100.0	1.3e-91
AXD55969.1|672345_672549_+|tail	phage tail protein	tail	S4TTA0	Salmonella_phage	95.5	4.4e-30
AXD55970.1|672552_672849_+|holin	holin	holin	S4TP56	Salmonella_phage	100.0	4.4e-47
AXD55971.1|672835_673333_+	lysozyme	NA	S4TUB1	Salmonella_phage	99.4	1.2e-92
AXD55972.1|673329_673743_+|lysis	LysB family phage lysis regulatory protein	lysis	S4TRW3	Salmonella_phage	99.3	9.9e-45
AXD55973.1|673714_673888_+|lysis	phage lysis protein	lysis	S4TNY4	Salmonella_phage	98.2	2.8e-25
AXD55974.1|673850_674318_+|tail	phage tail protein	tail	S4TTA5	Salmonella_phage	99.4	7.2e-84
AXD55975.1|674310_674760_+	phage virion morphogenesis protein	NA	A0A0M3UL83	Salmonella_phage	98.7	3.5e-72
AXD55976.1|674828_675470_+|plate	phage baseplate assembly protein V	plate	Q6K1H6	Salmonella_virus	99.1	2.0e-113
AXD55977.1|675466_675814_+|plate	baseplate assembly protein	plate	S4TRW8	Salmonella_phage	100.0	2.5e-57
AXD55978.1|675820_676729_+|plate	baseplate assembly protein	plate	S4TNY7	Salmonella_phage	100.0	2.6e-162
AXD55979.1|676721_677252_+|tail	phage tail protein I	tail	S4TTA8	Salmonella_phage	100.0	3.5e-103
AXD55980.1|677262_679377_+|tail	phage tail protein	tail	Q6K1H2	Salmonella_virus	76.1	2.9e-233
AXD55981.1|679389_679938_+|tail	tail fiber assembly protein	tail	S4TUB9	Salmonella_phage	100.0	9.9e-101
AXD55982.1|680072_681251_+|tail	phage tail protein	tail	S4TRX2	Salmonella_phage	99.2	1.4e-221
AXD55983.1|681266_681785_+|tail	phage major tail tube protein	tail	S4TNZ0	Salmonella_phage	100.0	6.5e-94
AXD55984.1|681847_682183_+|tail	phage tail assembly protein	tail	A0A0M4S5P8	Salmonella_phage	100.0	1.8e-52
AXD55985.1|682179_682335_+|tail	GpE family phage tail protein	tail	Q6K1G8	Salmonella_virus	98.0	8.8e-23
AXD55986.1|682327_684769_+|tail	phage tail tape measure protein	tail	S4TP64	Salmonella_phage	96.2	0.0e+00
AXD55987.1|684781_685267_+|tail	phage tail protein	tail	Q6K1G5	Salmonella_virus	98.8	1.5e-84
AXD55988.1|685263_686433_+	phage late control D family protein	NA	A0A0M5M5V5	Salmonella_phage	97.4	5.6e-210
AXD55989.1|686499_686718_+	DNA-binding transcriptional regulator	NA	A0A2I8TV89	Erwinia_phage	98.6	9.5e-39
AXD55990.1|687076_687583_+	mismatch-specific DNA-glycosylase	NA	NA	NA	NA	NA
AXD55991.1|687706_689689_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	9.0e-35
AXD55992.1|689703_691449_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.4	2.1e-72
AXD55993.1|691684_691900_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
AXD55994.1|692127_693141_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.5	2.8e-109
695448:695468	attR	GATAAGCGCAGCGCCATCAGG	NA	NA	NA	NA
>prophage 3
CP030211	Salmonella enterica strain SA20051528 chromosome, complete genome	4719399	1680224	1689395	4719399	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
AXD56891.1|1680224_1681172_+	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.8	2.8e-10
AXD56892.1|1681155_1681887_+	ABC transporter permease	NA	NA	NA	NA	NA
AXD56893.1|1681867_1681975_-	hypothetical protein	NA	NA	NA	NA	NA
AXD56894.1|1682034_1682766_-	transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
AXD56895.1|1682988_1684674_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.3	4.8e-279
AXD56896.1|1684670_1685390_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AXD56897.1|1685436_1685904_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
AXD56898.1|1685960_1686491_-	DUF1307 domain-containing protein	NA	NA	NA	NA	NA
AXD56899.1|1686662_1687121_-	DUF1307 domain-containing protein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
AXD56900.1|1687361_1689395_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
>prophage 4
CP030211	Salmonella enterica strain SA20051528 chromosome, complete genome	4719399	1757704	1768211	4719399		Enterobacteria_phage(37.5%)	10	NA	NA
AXD56955.1|1757704_1759108_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	3.1e-21
AXD56956.1|1759285_1760179_+	UTP--glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
AXD56957.1|1760555_1761641_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.2e-102
AXD56958.1|1761640_1762540_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.0	5.1e-30
AXD59762.1|1762587_1763466_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.8	5.1e-107
AXD56959.1|1763466_1764018_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	1.0e-52
AXD56960.1|1764023_1764998_+	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
AXD56961.1|1765013_1765787_+	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
AXD56962.1|1765791_1766871_+	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.5	1.3e-16
AXD56963.1|1766897_1768211_+	LPS biosynthesis protein	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	9.1e-52
>prophage 5
CP030211	Salmonella enterica strain SA20051528 chromosome, complete genome	4719399	1856227	1863652	4719399		Morganella_phage(33.33%)	9	NA	NA
AXD57045.1|1856227_1856752_-	peptidase	NA	G9L6C4	Escherichia_phage	77.7	1.3e-36
AXD57046.1|1857398_1857689_-	DUF4102 domain-containing protein	NA	B7SYF8	Stenotrophomonas_phage	50.9	1.0e-08
AXD57047.1|1858060_1858858_-	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
AXD57048.1|1859338_1859500_+	hypothetical protein	NA	NA	NA	NA	NA
AXD57049.1|1859626_1860046_+	DNA polymerase V subunit UmuD	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
AXD57050.1|1860048_1861317_+	translesion error-prone DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	92.2	4.2e-227
AXD57051.1|1861771_1861984_+	cold-shock protein CspJ	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
AXD59767.1|1861994_1862183_+	cold-shock protein	NA	NA	NA	NA	NA
AXD57052.1|1862440_1863652_-	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	56.5	1.5e-109
>prophage 6
CP030211	Salmonella enterica strain SA20051528 chromosome, complete genome	4719399	1971805	2027399	4719399	integrase,head,terminase,transposase,protease,tail,lysis,holin	Edwardsiella_phage(18.37%)	74	2004894:2004909	2026608:2026623
AXD57168.1|1971805_1972885_-|integrase	integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	52.5	3.9e-101
AXD57169.1|1972859_1973138_-	excisionase	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	37.5	1.4e-10
AXD59771.1|1973198_1973435_-	hypothetical protein	NA	NA	NA	NA	NA
AXD57170.1|1973725_1973911_-	DUF1187 family protein	NA	NA	NA	NA	NA
AXD57171.1|1973957_1974788_-	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.6	8.5e-104
AXD57172.1|1974780_1977471_-	exodeoxyribonuclease VIII	NA	Q9QF34	Lambdoid_phage	73.2	3.0e-118
AXD57173.1|1977611_1977947_-	hypothetical protein	NA	NA	NA	NA	NA
AXD57174.1|1978022_1978229_-	cell division inhibitor protein	NA	I6PBM9	Cronobacter_phage	45.6	3.0e-10
AXD57175.1|1978232_1978508_-	hypothetical protein	NA	NA	NA	NA	NA
AXD57176.1|1978856_1979123_-	hypothetical protein	NA	NA	NA	NA	NA
AXD57177.1|1979538_1979964_-	helix-turn-helix domain-containing protein	NA	K7PH71	Enterobacterial_phage	56.3	1.2e-13
AXD57178.1|1980060_1980315_+	XRE family transcriptional regulator	NA	K7PKH4	Enterobacteria_phage	59.4	1.2e-16
AXD57179.1|1980301_1980796_+	hypothetical protein	NA	NA	NA	NA	NA
AXD57180.1|1980839_1981841_+	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	68.1	4.4e-123
AXD57181.1|1981833_1982295_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	74.2	5.1e-66
AXD57182.1|1982309_1982705_+	DUF977 family protein	NA	A0A088CBK9	Shigella_phage	38.1	1.7e-17
AXD57183.1|1982701_1982974_+	hypothetical protein	NA	NA	NA	NA	NA
AXD57184.1|1983177_1983333_+	type I toxin-antitoxin system hok family toxin	NA	A0A0U2QV81	Escherichia_phage	84.3	1.2e-14
AXD57185.1|1983584_1983833_+	hypothetical protein	NA	NA	NA	NA	NA
AXD57186.1|1983896_1984496_+	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	82.9	3.6e-96
AXD57187.1|1984492_1984720_+	DNA breaking-rejoining protein	NA	A0A0M4RU10	Salmonella_phage	66.7	2.2e-14
AXD57188.1|1984849_1985539_+	antiterminator	NA	I6PDF8	Cronobacter_phage	54.9	2.1e-60
AXD59772.1|1985635_1986160_+	hypothetical protein	NA	NA	NA	NA	NA
AXD57189.1|1986533_1986983_-	lipoprotein	NA	NA	NA	NA	NA
AXD57190.1|1987343_1988030_-|protease	type III secretion system effector protease GtgA	protease	Q9MBM0	Phage_Gifsy-2	99.6	1.8e-131
AXD59773.1|1988305_1988635_+|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
AXD57191.1|1988618_1989071_+	lysozyme	NA	A0A0M4R365	Salmonella_phage	98.0	3.0e-79
AXD59774.1|1989088_1989553_+|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	82.9	2.7e-59
AXD57192.1|1989778_1989961_+	DUF826 domain-containing protein	NA	NA	NA	NA	NA
AXD57193.1|1990031_1990784_+	hypothetical protein	NA	G8C7P2	Escherichia_phage	73.3	5.3e-12
AXD57194.1|1990749_1992171_+|terminase	PBSX family phage terminase large subunit	terminase	A0A077KAW0	Edwardsiella_phage	67.8	8.9e-186
AXD57195.1|1992170_1993691_+	DUF1073 domain-containing protein	NA	A0A2R3UAL5	Myoviridae_environmental_samples	43.7	5.3e-104
AXD57196.1|1993731_1994421_+|head	phage head morphogenesis protein	head	H9C0V1	Aeromonas_phage	49.6	4.5e-58
AXD57197.1|1994417_1995764_+	DUF2213 domain-containing protein	NA	A0A219YCD3	Aeromonas_phage	37.0	2.7e-67
AXD57198.1|1995765_1996248_+	hypothetical protein	NA	A0A1X9SFC3	Acinetobacter_phage	48.8	1.1e-26
AXD57199.1|1996247_1997276_+	DUF2184 domain-containing protein	NA	A0A219YBB0	Aeromonas_phage	48.7	2.3e-82
AXD57200.1|1997279_1997627_+	hypothetical protein	NA	H9C0V9	Aeromonas_phage	40.2	3.0e-10
AXD57201.1|1997633_1998089_+	DUF4054 domain-containing protein	NA	A0A068CGG9	Acinetobacter_phage	40.8	2.4e-15
AXD57202.1|1998082_1998667_+	hypothetical protein	NA	H9C0W2	Aeromonas_phage	30.6	3.2e-17
AXD57203.1|1998663_1999029_+	hypothetical protein	NA	A0A077KAW7	Edwardsiella_phage	39.7	8.8e-21
AXD57204.1|1999013_1999559_+	hypothetical protein	NA	NA	NA	NA	NA
AXD57205.1|1999539_2001024_+	DUF3383 domain-containing protein	NA	A0A077KGV4	Edwardsiella_phage	41.0	4.0e-96
AXD57206.1|2001024_2001471_+	hypothetical protein	NA	Q2NPD1	Xanthomonas_phage	40.4	4.8e-21
AXD57207.1|2001470_2001875_+	hypothetical protein	NA	H9C0W7	Aeromonas_phage	44.8	1.8e-19
AXD57208.1|2001916_2002099_+	transcription elongation factor GreA	NA	NA	NA	NA	NA
AXD57209.1|2002082_2004254_+	lytic transglycosylase domain-containing protein	NA	A0A0M4REK7	Salmonella_phage	67.1	1.4e-49
AXD57210.1|2004250_2004961_+	hypothetical protein	NA	A0A077KGW3	Edwardsiella_phage	34.6	5.0e-28
2004894:2004909	attL	TTACGGCGTCGGTGAC	NA	NA	NA	NA
AXD57211.1|2004960_2005263_+	hypothetical protein	NA	A0A077K9U4	Edwardsiella_phage	50.5	2.4e-24
AXD57212.1|2005259_2006129_+	hypothetical protein	NA	A0A077KC17	Edwardsiella_phage	32.7	9.1e-32
AXD57213.1|2006109_2006820_+	oxidoreductase	NA	A0A077KAY0	Edwardsiella_phage	33.8	3.8e-28
AXD57214.1|2006832_2007189_+	hypothetical protein	NA	A0A077KCA1	Edwardsiella_phage	49.1	5.5e-20
AXD57215.1|2007185_2008427_+	hypothetical protein	NA	A0A077KGW9	Edwardsiella_phage	49.6	3.5e-101
AXD57216.1|2008428_2009031_+	DUF2612 domain-containing protein	NA	H9C0Y0	Aeromonas_phage	43.2	5.9e-30
AXD57217.1|2009020_2010475_+|tail	tail fiber protein	tail	E5G6P0	Salmonella_phage	68.2	1.5e-39
AXD57218.1|2010474_2011050_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	91.0	1.5e-96
AXD57219.1|2011245_2011968_-	guanine nucleotide exchange factor SopE	NA	NA	NA	NA	NA
AXD57220.1|2012447_2013248_-	hypothetical protein	NA	NA	NA	NA	NA
AXD59775.1|2014192_2015047_-|integrase	integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	51.9	1.5e-74
AXD59776.1|2015106_2015601_-	RecE	NA	A0A0U2I1R6	Escherichia_phage	70.3	4.8e-22
AXD57221.1|2015790_2016021_+	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	93.7	6.1e-28
AXD57222.1|2016074_2016608_+	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	43.0	5.4e-11
AXD57223.1|2016864_2017032_-	lytic enzyme	NA	NA	NA	NA	NA
AXD57224.1|2017096_2017285_-	hypothetical protein	NA	NA	NA	NA	NA
AXD57225.1|2017339_2017831_+	DUF1441 family protein	NA	Q9EYD0	Enterobacteria_phage	56.2	2.9e-43
AXD57226.1|2020532_2020733_-	phage virulence factor	NA	NA	NA	NA	NA
AXD57227.1|2020923_2021040_-|tail	phage tail protein	tail	NA	NA	NA	NA
AXD57228.1|2021301_2021427_+	arsenic transporter	NA	NA	NA	NA	NA
AXD57229.1|2021555_2021822_+	hypothetical protein	NA	NA	NA	NA	NA
AXD57230.1|2022574_2023189_-	disulfide bond formation protein B	NA	NA	NA	NA	NA
AXD57231.1|2023198_2023357_-	hypothetical protein	NA	NA	NA	NA	NA
AXD57232.1|2023489_2024404_-	protein PagO	NA	NA	NA	NA	NA
AXD59777.1|2025021_2025222_+	hypothetical protein	NA	NA	NA	NA	NA
AXD57233.1|2025698_2026067_-|integrase	integrase	integrase	K7PHK0	Enterobacteria_phage	38.9	7.0e-18
AXD57234.1|2026190_2027399_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	48.7	5.3e-46
2026608:2026623	attR	GTCACCGACGCCGTAA	NA	NA	NA	NA
>prophage 7
CP030211	Salmonella enterica strain SA20051528 chromosome, complete genome	4719399	2912010	2919323	4719399	integrase,protease	Ralstonia_phage(16.67%)	8	2906549:2906563	2918059:2918073
2906549:2906563	attL	GGAAAATCAACGCTG	NA	NA	NA	NA
AXD58087.1|2912010_2912388_+|integrase	integrase	integrase	A0A077KET4	Ralstonia_phage	41.0	1.2e-20
AXD58088.1|2912549_2912747_+	hypothetical protein	NA	NA	NA	NA	NA
AXD58089.1|2912959_2915236_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
AXD58090.1|2915266_2915587_-|protease	ATP-dependent Clp protease adaptor ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
AXD58091.1|2915910_2916132_+	cold shock domain protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
AXD58092.1|2916086_2916281_-	hypothetical protein	NA	NA	NA	NA	NA
AXD58093.1|2916261_2918208_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	42.3	9.1e-40
2918059:2918073	attR	CAGCGTTGATTTTCC	NA	NA	NA	NA
AXD58094.1|2918204_2919323_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.4e-08
>prophage 8
CP030211	Salmonella enterica strain SA20051528 chromosome, complete genome	4719399	4301708	4346485	4719399	tail,tRNA,plate	Burkholderia_phage(40.91%)	47	NA	NA
AXD59329.1|4301708_4302707_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
AXD59330.1|4302794_4304105_-	conjugal transfer protein	NA	NA	NA	NA	NA
AXD59331.1|4304351_4304867_+	transcriptional regulator Zur	NA	NA	NA	NA	NA
AXD59332.1|4304965_4305175_-	CsbD family protein	NA	NA	NA	NA	NA
AXD59870.1|4305196_4305310_-	hypothetical protein	NA	NA	NA	NA	NA
AXD59333.1|4305306_4306632_-	MATE family efflux transporter	NA	NA	NA	NA	NA
AXD59334.1|4306810_4307419_-	LexA repressor	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
AXD59335.1|4307527_4307896_-	diacylglycerol kinase	NA	NA	NA	NA	NA
AXD59336.1|4308066_4310487_+	glycerol-3-phosphate 1-O-acyltransferase	NA	NA	NA	NA	NA
AXD59337.1|4310585_4311458_-	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
AXD59338.1|4311471_4311969_-	chorismate--pyruvate lyase	NA	NA	NA	NA	NA
AXD59339.1|4312149_4313067_-	maltose operon protein MalM	NA	NA	NA	NA	NA
AXD59340.1|4313230_4314589_-	maltoporin	NA	NA	NA	NA	NA
AXD59341.1|4314677_4315787_-	maltose/maltodextrin import ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	47.2	6.2e-17
AXD59342.1|4316148_4317339_+	maltose/maltodextrin ABC transporter substrate-binding protein MalE	NA	NA	NA	NA	NA
AXD59343.1|4317470_4319015_+	maltose ABC transporter permease MalF	NA	NA	NA	NA	NA
AXD59344.1|4319029_4319920_+	maltose ABC transporter permease	NA	NA	NA	NA	NA
AXD59345.1|4320085_4320496_-	phosphate-starvation-inducible protein PsiE	NA	NA	NA	NA	NA
AXD59346.1|4320638_4322735_-	YjbH domain-containing protein	NA	NA	NA	NA	NA
AXD59347.1|4322734_4323472_-	hypothetical protein	NA	NA	NA	NA	NA
AXD59348.1|4323468_4324107_-	YjbF family lipoprotein	NA	NA	NA	NA	NA
AXD59349.1|4324170_4324413_-	outer membrane protein	NA	NA	NA	NA	NA
AXD59350.1|4324856_4326506_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
AXD59351.1|4326850_4328200_+	lysine-sensitive aspartokinase 3	NA	NA	NA	NA	NA
AXD59352.1|4328330_4328678_-	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.5	4.9e-21
AXD59353.1|4329253_4329541_+	hypothetical protein	NA	Q6QIC8	Burkholderia_phage	48.1	5.1e-16
AXD59354.1|4329543_4330149_+	lytic transglycosylase domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	60.4	6.5e-61
AXD59355.1|4330161_4330476_+	hypothetical protein	NA	Q6QIC4	Burkholderia_phage	49.1	6.4e-20
AXD59356.1|4330635_4331091_+	hypothetical protein	NA	NA	NA	NA	NA
AXD59357.1|4331087_4331285_+	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	52.9	8.6e-07
AXD59358.1|4331274_4332702_+|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	70.9	1.1e-194
AXD59359.1|4332701_4333226_+|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.5	2.8e-68
AXD59360.1|4333277_4333595_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
AXD59361.1|4333554_4333683_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
AXD59362.1|4333779_4336134_+|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	31.2	1.5e-68
AXD59363.1|4336133_4337087_+	methyl-accepting chemotaxis protein	NA	A4JWL1	Burkholderia_virus	50.8	2.3e-36
AXD59364.1|4337086_4337296_+	hypothetical protein	NA	A4JWL2	Burkholderia_virus	60.3	9.8e-17
AXD59365.1|4337283_4338327_+	phage protein D	NA	Q6QIA2	Burkholderia_phage	45.1	2.5e-76
AXD59366.1|4338336_4339059_+|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	42.0	3.9e-12
AXD59367.1|4339386_4339749_+	GtrA family protein	NA	I1TED9	Salmonella_phage	70.8	1.2e-43
AXD59368.1|4339745_4340675_+	glycosyltransferase	NA	S5FKN0	Shigella_phage	84.1	1.4e-150
AXD59369.1|4340674_4342222_+	hypothetical protein	NA	B9UDL6	Salmonella_phage	29.9	3.8e-49
AXD59370.1|4342385_4342745_+|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	64.2	2.8e-35
AXD59371.1|4342735_4343851_+|plate	baseplate protein	plate	Q6QI99	Burkholderia_phage	52.0	4.1e-101
AXD59372.1|4343843_4344476_+|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	55.6	1.9e-23
AXD59373.1|4344478_4345960_+|tail	phage tail protein	tail	A0A0M3ULF6	Salmonella_phage	51.7	1.3e-51
AXD59374.1|4345969_4346485_+|tail	tail fiber assembly protein	tail	A0A0U2QV64	Escherichia_phage	41.2	3.4e-34
