The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP030203	Salmonella enterica strain SA20083530 chromosome, complete genome	5062813	700084	752044	5062813	lysis,protease,head,tail,tRNA,portal,integrase	Vibrio_phage(25.0%)	48	709771:709786	740357:740372
AXD41469.1|700084_701032_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	35.9	8.4e-07
AXD41470.1|701047_701557_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	41.1	6.7e-19
AXD41471.1|701688_702813_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
AXD41472.1|702784_703258_+	hypothetical protein	NA	NA	NA	NA	NA
AXD41473.1|703284_703827_+	DNA topoisomerase	NA	NA	NA	NA	NA
AXD41474.1|703831_704404_+	L-threonylcarbamoyladenylate synthase type 1 TsaC	NA	S4VW33	Pandoravirus	27.2	2.9e-10
AXD45604.1|704408_705227_+	shikimate dehydrogenase	NA	NA	NA	NA	NA
AXD41475.1|705223_705481_+	DUF1488 domain-containing protein	NA	NA	NA	NA	NA
AXD41476.1|705456_706011_-	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
709771:709786	attL	GGTTAATATTCCCGTA	NA	NA	NA	NA
AXD41477.1|712833_713055_-	hypothetical protein	NA	NA	NA	NA	NA
AXD41478.1|713292_716406_-	multidrug efflux RND transporter permease subunit	NA	NA	NA	NA	NA
AXD41479.1|716417_717575_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AXD41480.1|717987_718650_+	acrEF/envCD operon transcriptional regulator	NA	NA	NA	NA	NA
AXD41481.1|718652_720752_-	bifunctional diguanylate cyclase/phosphodiesterase	NA	G3MA91	Bacillus_virus	33.9	8.4e-23
AXD41482.1|720902_721067_-	DUF2556 domain-containing protein	NA	NA	NA	NA	NA
AXD41483.1|721149_722034_-	adenine-specific DNA-methyltransferase	NA	M4QNN5	Ostreococcus_lucimarinus_virus	32.8	1.3e-25
AXD41484.1|722496_723726_+|integrase	integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	61.7	1.4e-155
AXD41485.1|723967_724261_+	hypothetical protein	NA	NA	NA	NA	NA
AXD41486.1|724637_724922_+	transcriptional regulator	NA	NA	NA	NA	NA
AXD41487.1|724942_725593_+	hypothetical protein	NA	A0A0P0J0J7	Acinetobacter_phage	47.6	4.9e-22
AXD41488.1|725583_726888_+	hypothetical protein	NA	NA	NA	NA	NA
AXD41489.1|726884_727577_+	hypothetical protein	NA	A0A1W6JPK3	Morganella_phage	51.7	2.1e-07
AXD41490.1|727723_728071_+	DNA primase	NA	B8Q5B5	Abalone_shriveling_syndrome-associated_virus	45.0	7.3e-09
AXD41491.1|728063_728417_+	hypothetical protein	NA	NA	NA	NA	NA
AXD41492.1|728409_728718_+	hypothetical protein	NA	Q1MVK6	Enterobacteria_phage	69.7	1.3e-25
AXD41493.1|728728_729523_+	ORF6N domain-containing protein	NA	F1C5A3	Cronobacter_phage	66.9	2.2e-45
AXD41494.1|729519_729825_+	hypothetical protein	NA	NA	NA	NA	NA
AXD41495.1|729913_730297_+	hypothetical protein	NA	NA	NA	NA	NA
AXD41496.1|730289_730937_+	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	39.0	6.1e-33
AXD41497.1|730947_733083_+	DNA primase	NA	A0A1W6JPG0	Morganella_phage	58.9	4.3e-192
AXD41498.1|733079_733475_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
AXD41499.1|733518_734442_+	hypothetical protein	NA	A0A1B5FPA6	Escherichia_phage	48.6	2.9e-60
AXD41500.1|734526_735342_+	antitermination protein	NA	A0A1B5FPA5	Escherichia_phage	72.7	1.3e-112
AXD41501.1|735496_735883_-	hypothetical protein	NA	NA	NA	NA	NA
AXD41502.1|736421_736694_+	hypothetical protein	NA	A0A2H4FNF0	Salmonella_phage	91.1	2.0e-38
AXD41503.1|736693_737179_+	lysozyme	NA	M9P0E5	Enterobacteria_phage	71.8	2.0e-60
AXD41504.1|737453_737636_+	hypothetical protein	NA	NA	NA	NA	NA
AXD41505.1|737646_738117_+|lysis	lysis protein	lysis	Q8HA85	Salmonella_phage	79.6	8.9e-58
AXD41506.1|738388_738886_-	non-heme ferritin	NA	NA	NA	NA	NA
AXD45605.1|739954_740671_+	hypothetical protein	NA	NA	NA	NA	NA
740357:740372	attR	TACGGGAATATTAACC	NA	NA	NA	NA
AXD41507.1|741180_741771_+	nuclease	NA	A0A067ZI74	Vibrio_phage	53.7	6.4e-37
AXD41508.1|741770_742316_+	hypothetical protein	NA	A0A067ZIZ9	Vibrio_phage	37.2	8.8e-17
AXD41509.1|744187_744427_+	hypothetical protein	NA	A0A067ZJ01	Vibrio_phage	54.8	6.8e-14
AXD41510.1|744423_745986_+|portal	phage portal protein	portal	A0A067ZJA4	Vibrio_phage	64.5	3.2e-189
AXD41511.1|745978_747133_+|protease	Clp protease ClpP	protease	A0A067ZG37	Vibrio_phage	51.4	4.8e-81
AXD41512.1|747051_747438_+|head	head decoration protein	head	NA	NA	NA	NA
AXD41513.1|749764_750064_+	hypothetical protein	NA	NA	NA	NA	NA
AXD41514.1|751522_752044_+|tail	phage tail protein	tail	A0A067ZJA9	Vibrio_phage	53.2	1.2e-47
>prophage 2
CP030203	Salmonella enterica strain SA20083530 chromosome, complete genome	5062813	939793	979205	5062813	head,tail,capsid,tRNA,terminase,holin,portal,integrase	Cronobacter_phage(69.44%)	47	939611:939670	969318:969414
939611:939670	attL	AAAAAAGCCACTCTTTAGAGTGGCTTAATTATATGATTTTAAAGCTAAAATTTGGTGGCC	NA	NA	NA	NA
AXD41685.1|939793_940831_-|integrase	site-specific integrase	integrase	F1BUS9	Erwinia_phage	65.3	1.2e-123
AXD41686.1|940817_941711_-	hypothetical protein	NA	NA	NA	NA	NA
AXD41687.1|941739_942318_-	phage repressor protein CI	NA	A0A218M4J1	Erwinia_phage	39.5	1.5e-27
AXD41688.1|942437_942659_+	regulator	NA	NA	NA	NA	NA
AXD41689.1|942689_943193_+	hypothetical protein	NA	F1BUN6	Cronobacter_phage	72.5	3.5e-60
AXD41690.1|943202_943430_+	hypothetical protein	NA	NA	NA	NA	NA
AXD41691.1|943419_943845_+	hypothetical protein	NA	F1BUN5	Cronobacter_phage	49.6	2.2e-23
AXD41692.1|943844_944246_+	hypothetical protein	NA	F1BUN2	Cronobacter_phage	66.9	1.4e-48
AXD41693.1|944313_944544_+	DUF2732 family protein	NA	NA	NA	NA	NA
AXD41694.1|944534_945395_+	DNA adenine methylase	NA	F1BUN1	Cronobacter_phage	83.5	1.3e-131
AXD41695.1|945391_947413_+	replication endonuclease	NA	F1BUM9	Cronobacter_phage	74.9	6.5e-299
AXD41696.1|947532_947739_+	hypothetical protein	NA	NA	NA	NA	NA
AXD41697.1|947712_948036_-	transcriptional regulator	NA	F1BUM8	Cronobacter_phage	92.3	8.0e-50
AXD41698.1|948032_949094_-|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	77.3	1.8e-162
AXD41699.1|949090_950866_-|terminase	terminase	terminase	F1BUM5	Cronobacter_phage	83.1	7.5e-291
AXD41700.1|951026_951827_+|capsid	phage capsid protein	capsid	F1BUM4	Cronobacter_phage	54.4	4.7e-75
AXD41701.1|951888_952911_+|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	81.2	1.1e-158
AXD41702.1|952914_953619_+|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	67.4	3.6e-87
AXD41703.1|953622_953817_+	hypothetical protein	NA	Q8W634	Enterobacteria_phage	58.6	3.3e-11
AXD41704.1|953862_954366_+|head	head completion protein	head	F1BUL8	Cronobacter_phage	81.3	1.5e-63
AXD41705.1|954362_954869_+|tail	phage tail protein	tail	F1BUL7	Cronobacter_phage	69.8	8.9e-64
AXD41706.1|954865_955573_+	hypothetical protein	NA	F1BUL6	Cronobacter_phage	76.5	1.2e-101
AXD41707.1|955569_956697_+	DUF2586 domain-containing protein	NA	F1BUL5	Cronobacter_phage	83.7	5.1e-176
AXD41708.1|956693_957149_+	DUF2597 family protein	NA	F1BUL4	Cronobacter_phage	72.2	1.5e-57
AXD41709.1|957158_957452_+|holin	holin	holin	C7BGD7	Burkholderia_phage	46.2	1.3e-14
AXD41710.1|957448_957790_+	M15 family peptidase	NA	F1BUL3	Cronobacter_phage	91.1	2.2e-50
AXD41711.1|957789_958122_+	hypothetical protein	NA	F1BUL2	Cronobacter_phage	70.9	6.7e-36
AXD41712.1|958093_958282_+	hypothetical protein	NA	F1BUL1	Cronobacter_phage	80.6	1.1e-22
AXD41713.1|958238_958526_+	hypothetical protein	NA	A5X9I7	Aeromonas_virus	62.2	1.2e-20
AXD41714.1|958713_960684_+|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	68.8	7.1e-266
AXD41715.1|960680_961010_+	DUF2590 family protein	NA	F1BUK8	Cronobacter_phage	72.4	3.8e-39
AXD41716.1|961006_962191_+	hypothetical protein	NA	F1BUK6	Cronobacter_phage	78.4	6.7e-179
AXD41717.1|962779_964936_+|tail	phage tail protein	tail	Q6K1H2	Salmonella_virus	72.1	3.3e-216
AXD45618.1|965013_965463_+|tail	tail fiber assembly protein	tail	S4TUB9	Salmonella_phage	87.0	1.6e-69
AXD41718.1|965452_966178_+	hypothetical protein	NA	F1BUK1	Cronobacter_phage	56.4	6.6e-68
AXD41719.1|966149_966695_+	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	71.4	3.5e-58
AXD41720.1|966694_968398_+	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	81.3	2.2e-223
AXD41721.1|968556_968778_+	hypothetical protein	NA	NA	NA	NA	NA
AXD41722.1|969570_970077_+	mismatch-specific DNA-glycosylase	NA	NA	NA	NA	NA
969318:969414	attR	AAAAAAGCCACTCTTTAGAGTGGCTTAATTATATGATTTTAAAGCTAAAATTTGGTGGCCCCTGCTGGACTTGAACCAGCGACCAAGCGATTATGAG	NA	NA	NA	NA
AXD41723.1|970200_972183_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	9.0e-35
AXD41724.1|972197_973943_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.4	2.1e-72
AXD41725.1|974178_974394_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
AXD41726.1|974621_975635_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.5	6.3e-109
AXD41727.1|975857_976475_-	acyl-phosphate--glycerol-3-phosphate O-acyltransferase	NA	NA	NA	NA	NA
AXD41728.1|976581_976941_+	bifunctional dihydroneopterin aldolase/7,8-dihydroneopterin epimerase	NA	NA	NA	NA	NA
AXD41729.1|977038_977860_+	undecaprenyl-diphosphatase	NA	NA	NA	NA	NA
AXD41730.1|977963_979205_-|tRNA	multifunctional CCA tRNA nucleotidyl transferase/2'3'-cyclic phosphodiesterase/2'nucleotidase/phosphatase	tRNA	A0A0F6YPT7	Sinorhizobium_phage	51.4	2.5e-91
>prophage 3
CP030203	Salmonella enterica strain SA20083530 chromosome, complete genome	5062813	1441626	1579601	5062813	lysis,plate,tail,head,transposase,capsid,tRNA,terminase,holin,portal,integrase	Salmonella_phage(22.58%)	146	1525081:1525099	1553600:1553618
AXD42174.1|1441626_1442737_+|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	26.2	9.9e-07
AXD42175.1|1442728_1442914_+	hypothetical protein	NA	NA	NA	NA	NA
AXD45631.1|1442992_1443421_-	nucleotide-binding protein	NA	NA	NA	NA	NA
AXD42176.1|1443572_1444604_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
AXD42177.1|1445035_1445995_-	RNA-directed DNA polymerase	NA	NA	NA	NA	NA
AXD42178.1|1446025_1446235_-	hypothetical protein	NA	NA	NA	NA	NA
AXD42179.1|1446602_1447771_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	89.5	1.9e-165
AXD42180.1|1448316_1450650_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	84.1	0.0e+00
AXD42181.1|1450664_1450985_-	hypothetical protein	NA	NA	NA	NA	NA
AXD42182.1|1450981_1451209_-	hypothetical protein	NA	NA	NA	NA	NA
AXD42183.1|1451205_1451757_-	Ash-like/host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	70.4	1.1e-30
AXD42184.1|1452560_1453298_+	glycoprotein 3	NA	Q7M2A2	Enterobacteria_phage	63.6	3.8e-79
AXD42185.1|1453294_1453540_+	hypothetical protein	NA	Q7M294	Enterobacteria_phage	74.1	6.9e-30
AXD42186.1|1453556_1454123_+	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	63.2	6.9e-57
AXD42187.1|1454530_1455442_+	DUF4747 domain-containing protein	NA	NA	NA	NA	NA
AXD42188.1|1455609_1456047_+	hypothetical protein	NA	NA	NA	NA	NA
AXD42189.1|1456077_1457271_-	DUF4102 domain-containing protein	NA	A0A1B5FPC6	Escherichia_phage	50.4	8.2e-108
AXD45632.1|1457889_1459053_-	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
AXD42190.1|1459060_1461241_-	type I secretion system permease/ATPase	NA	F2Y302	Organic_Lake_phycodnavirus	34.0	9.9e-19
AXD42191.1|1461237_1462647_-	type I secretion protein TolC	NA	NA	NA	NA	NA
AXD42192.1|1462711_1474186_-	biofilm-associated protein BapA	NA	NA	NA	NA	NA
AXD45633.1|1474795_1475278_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	5.2e-29
AXD42193.1|1475427_1475904_+	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
AXD42194.1|1475893_1476184_+	RnfH family protein	NA	NA	NA	NA	NA
AXD42195.1|1476344_1476683_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
AXD42196.1|1476831_1478493_-	DNA repair protein RecN	NA	NA	NA	NA	NA
AXD42197.1|1478578_1479457_-	NAD(+) kinase	NA	NA	NA	NA	NA
AXD45634.1|1479388_1479583_+	molecular chaperone GrpE	NA	NA	NA	NA	NA
AXD42198.1|1479579_1480170_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
AXD42199.1|1480204_1480810_-	cytoplasmic protein	NA	NA	NA	NA	NA
AXD42200.1|1480930_1482172_-	DUF21 domain-containing protein	NA	NA	NA	NA	NA
AXD42201.1|1482236_1483028_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
AXD42202.1|1482973_1483270_-	hypothetical protein	NA	NA	NA	NA	NA
AXD42203.1|1483193_1484555_+	signal recognition particle protein	NA	NA	NA	NA	NA
AXD42204.1|1484898_1485147_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
AXD42205.1|1485165_1485714_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
AXD42206.1|1485758_1486526_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
AXD42207.1|1486566_1486914_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
AXD42208.1|1487058_1487277_-	DNA-binding transcriptional regulator	NA	Q37973	Salmonella_virus	100.0	1.2e-38
AXD42209.1|1487352_1488522_-	phage late control D family protein	NA	Q6K1G4	Salmonella_virus	95.4	2.2e-206
AXD42210.1|1488518_1489004_-|tail	phage tail protein	tail	Q6K1G5	Salmonella_virus	99.4	1.8e-85
AXD42211.1|1489018_1491463_-|tail	phage tail tape measure protein	tail	S4TP64	Salmonella_phage	94.0	0.0e+00
AXD42212.1|1491455_1491611_-|tail	GpE family phage tail protein	tail	Q6K1G8	Salmonella_virus	98.0	8.8e-23
AXD42213.1|1491607_1491943_-|tail	phage tail assembly protein	tail	A0A0M4S5P8	Salmonella_phage	100.0	1.8e-52
AXD42214.1|1492005_1492524_-|tail	phage major tail tube protein	tail	S4TNZ0	Salmonella_phage	99.4	1.9e-93
AXD42215.1|1492539_1493727_-|tail	phage tail protein	tail	Q6K1H0	Salmonella_virus	100.0	2.0e-223
AXD42216.1|1493861_1494410_-|tail	tail fiber assembly protein	tail	S4TUB9	Salmonella_phage	92.9	4.0e-94
AXD42217.1|1494422_1496405_-|tail	phage tail protein	tail	Q6K1H2	Salmonella_virus	82.0	3.5e-257
AXD42218.1|1496415_1496946_-|tail	phage tail protein I	tail	A0A0M4R4W9	Salmonella_phage	98.3	2.3e-102
AXD42219.1|1496938_1497847_-|plate	baseplate assembly protein	plate	A0A1J0I2M3	Salmonella_phage	99.0	7.7e-159
AXD42220.1|1497853_1498201_-|plate	baseplate assembly protein	plate	A0A0M4RE59	Salmonella_phage	98.3	9.4e-57
AXD42221.1|1498197_1498839_-|plate	phage baseplate assembly protein V	plate	Q6K1H6	Salmonella_virus	99.5	1.8e-114
AXD42222.1|1498907_1499357_-	phage virion morphogenesis protein	NA	Q6K1H7	Salmonella_virus	99.3	1.2e-72
AXD42223.1|1499349_1499817_-|tail	phage tail protein	tail	S4TTA5	Salmonella_phage	99.4	4.2e-84
AXD42224.1|1499779_1499953_-|lysis	phage lysis protein	lysis	S4TNY4	Salmonella_phage	96.5	4.7e-25
AXD42225.1|1499924_1500338_-|lysis	LysB family phage lysis regulatory protein	lysis	Q6K1I0	Salmonella_virus	98.5	2.3e-49
AXD42226.1|1500334_1500832_-	lysozyme	NA	S4TUB1	Salmonella_phage	98.8	2.0e-92
AXD42227.1|1500818_1501115_-|holin	holin	holin	O80308	Escherichia_phage	98.0	3.7e-46
AXD42228.1|1501118_1501322_-|tail	phage tail protein	tail	S4TTA0	Salmonella_phage	98.5	1.8e-31
AXD42229.1|1501321_1501828_-|head	head completion/stabilization protein	head	S4TNY1	Salmonella_phage	100.0	1.3e-91
AXD42230.1|1501921_1502671_-|terminase	terminase	terminase	Q6K1I5	Salmonella_virus	95.2	6.7e-124
AXD42231.1|1502674_1503742_-|capsid	phage major capsid protein, P2 family	capsid	S4TUA6	Salmonella_phage	99.2	1.4e-196
AXD42232.1|1503818_1504673_-|capsid	capsid scaffolding protein	capsid	A0A0M3UL81	Salmonella_phage	100.0	9.9e-148
AXD42233.1|1504838_1506611_+	oxidoreductase	NA	S4TT96	Salmonella_phage	99.3	0.0e+00
AXD42234.1|1506607_1507354_+	hypothetical protein	NA	Q6K1I9	Salmonella_virus	97.2	3.9e-140
AXD42235.1|1507350_1508373_+|portal	phage portal protein	portal	Q6K1J0	Salmonella_virus	99.1	2.1e-197
AXD42236.1|1508508_1508691_-	hypothetical protein	NA	NA	NA	NA	NA
AXD42237.1|1508893_1509088_-	hypothetical protein	NA	S4TRZ0	Salmonella_phage	87.5	5.5e-22
AXD42238.1|1509221_1509431_-	hypothetical protein	NA	Q6K1F0	Salmonella_virus	91.3	9.1e-31
AXD42239.1|1509626_1509860_-	DinI family protein	NA	A0A0M4S6H1	Salmonella_phage	98.7	8.0e-36
AXD42240.1|1509863_1510046_-	hypothetical protein	NA	A0A0M5M1G5	Salmonella_phage	100.0	4.1e-27
AXD42241.1|1510159_1512388_-	replication endonuclease	NA	A0A218M4H2	Erwinia_phage	95.5	0.0e+00
AXD42242.1|1512378_1512660_-	DUF3850 domain-containing protein	NA	Q7Y4B7	Escherichia_virus	43.3	9.8e-12
AXD42243.1|1512656_1512929_-	hypothetical protein	NA	A0A218M4I8	Erwinia_phage	80.0	9.4e-36
AXD45635.1|1512925_1513519_-	3'-5' exonuclease	NA	A0A218M4G8	Erwinia_phage	99.5	1.2e-112
AXD42244.1|1513634_1513856_-	TraR/DksA family transcriptional regulator	NA	A0A218M4I6	Erwinia_phage	100.0	3.8e-35
AXD42245.1|1513855_1514083_-	DUF2732 domain-containing protein	NA	A0A0M3UL87	Salmonella_phage	100.0	6.8e-32
AXD42246.1|1514150_1514489_-	hypothetical protein	NA	A0A218M4I7	Erwinia_phage	92.0	5.8e-51
AXD42247.1|1514452_1514653_-	DUF2724 domain-containing protein	NA	Q6K1F7	Salmonella_virus	98.5	2.7e-32
AXD42248.1|1514660_1515170_-	hypothetical protein	NA	Q6K1F8	Salmonella_virus	98.8	6.2e-89
AXD42249.1|1515220_1515574_-	Cro/Cl family transcriptional regulator	NA	Q6K1F9	Salmonella_virus	99.1	1.1e-57
AXD42250.1|1515687_1516530_+	phage repressor protein CI	NA	Q6K1G0	Salmonella_virus	70.1	2.3e-112
AXD42251.1|1516529_1517093_+	WYL domain-containing protein	NA	NA	NA	NA	NA
AXD42252.1|1517114_1518164_+|integrase	integrase	integrase	A0A0M4S6G4	Salmonella_phage	92.0	3.0e-191
AXD42253.1|1518415_1519636_-	diguanylate cyclase	NA	A0A2K8I9Y5	Pseudomonas_phage	36.2	5.8e-08
AXD42254.1|1519628_1520147_-	YfiR family protein	NA	NA	NA	NA	NA
AXD42255.1|1520586_1521657_+	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.8	2.4e-90
AXD42256.1|1521666_1522788_+	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
AXD42257.1|1522845_1523754_+	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
AXD42258.1|1523714_1524875_-	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
AXD45636.1|1524974_1525022_-	hypothetical protein	NA	NA	NA	NA	NA
1525081:1525099	attL	AAAACGCGCCCGAAGGCGC	NA	NA	NA	NA
AXD42259.1|1525186_1526179_-|integrase	integrase	integrase	A0A0F7LBR0	Escherichia_phage	54.8	8.6e-103
AXD45637.1|1526278_1526581_-	XRE family transcriptional regulator	NA	Q1JS61	Enterobacteria_phage	52.0	3.8e-22
AXD42260.1|1526676_1527003_+	hypothetical protein	NA	NA	NA	NA	NA
AXD42261.1|1527033_1527366_+	hypothetical protein	NA	NA	NA	NA	NA
AXD42262.1|1527375_1527936_+	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	31.6	2.8e-18
AXD42263.1|1527938_1528157_+	hypothetical protein	NA	A0A286S1P6	Klebsiella_phage	45.0	3.6e-06
AXD42264.1|1528195_1530853_+	bifunctional DNA primase/helicase	NA	A0A077K8T2	Ralstonia_phage	47.5	5.4e-245
AXD42265.1|1530880_1531204_-	transcriptional regulator	NA	F1BUM8	Cronobacter_phage	73.1	1.3e-36
AXD42266.1|1531203_1532223_-|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	68.1	1.1e-134
AXD42267.1|1532219_1534004_-|terminase	terminase	terminase	F1BUM5	Cronobacter_phage	69.5	3.3e-246
AXD42268.1|1534214_1535051_+|capsid	phage capsid protein	capsid	F1BUM4	Cronobacter_phage	52.3	2.8e-46
AXD42269.1|1535085_1536114_+|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	71.6	1.7e-133
AXD42270.1|1536125_1536824_+|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	52.6	3.6e-63
AXD42271.1|1536922_1537375_+|head	head completion protein	head	F1BUL8	Cronobacter_phage	64.7	1.2e-48
AXD42272.1|1537371_1537854_+|tail	phage tail protein	tail	F1BUL7	Cronobacter_phage	48.7	3.0e-37
AXD42273.1|1537850_1538555_+	hypothetical protein	NA	F1BUL6	Cronobacter_phage	59.9	1.8e-70
AXD42274.1|1538551_1539679_+	DUF2586 domain-containing protein	NA	F1BUL5	Cronobacter_phage	83.5	2.1e-174
AXD42275.1|1539675_1540131_+	DUF2597 family protein	NA	F1BUL4	Cronobacter_phage	70.9	2.3e-58
AXD42276.1|1540143_1540440_+|holin	holin	holin	C7BGD7	Burkholderia_phage	48.2	2.4e-16
AXD42277.1|1540436_1540778_+	M15 family peptidase	NA	F1BUL3	Cronobacter_phage	92.1	1.7e-50
AXD42278.1|1540777_1541110_+	hypothetical protein	NA	F1BUL2	Cronobacter_phage	69.1	9.7e-35
AXD42279.1|1541036_1541270_+	hypothetical protein	NA	F1BUL1	Cronobacter_phage	83.1	1.7e-30
AXD42280.1|1541247_1541514_+	hypothetical protein	NA	A5X9I7	Aeromonas_virus	61.0	2.4e-20
AXD42281.1|1541701_1543669_+|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	70.4	4.7e-270
AXD42282.1|1543665_1543995_+	DUF2590 family protein	NA	F1BUK8	Cronobacter_phage	72.4	3.8e-39
AXD42283.1|1543991_1545176_+	hypothetical protein	NA	F1BUK6	Cronobacter_phage	78.1	1.3e-177
AXD42284.1|1545162_1545756_+	hypothetical protein	NA	F1BUK5	Cronobacter_phage	82.1	1.4e-89
AXD42285.1|1545765_1547934_+|tail	phage tail protein	tail	Q6K1H2	Salmonella_virus	64.0	7.7e-189
AXD45638.1|1548011_1548461_+|tail	tail fiber assembly protein	tail	S4TUB9	Salmonella_phage	86.3	1.4e-68
AXD42286.1|1548450_1549176_+	hypothetical protein	NA	F1BUK1	Cronobacter_phage	56.8	3.8e-68
AXD42287.1|1549147_1549693_+	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	71.4	4.6e-58
AXD42288.1|1549692_1551396_+	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	81.4	1.3e-223
AXD42289.1|1551385_1551649_-	hypothetical protein	NA	NA	NA	NA	NA
AXD42290.1|1552501_1553113_+	iron-sulfur cluster assembly scaffold protein SufA	NA	NA	NA	NA	NA
AXD42291.1|1553124_1553505_+	type II toxin-antitoxin system YafO family toxin	NA	NA	NA	NA	NA
AXD42292.1|1553644_1553983_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
1553600:1553618	attR	AAAACGCGCCCGAAGGCGC	NA	NA	NA	NA
AXD42293.1|1554254_1554992_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
AXD42294.1|1555123_1556104_+	ribosomal large subunit pseudouridine synthase D	NA	NA	NA	NA	NA
AXD42295.1|1556100_1556832_+	peptidoglycan editing factor PgeF	NA	NA	NA	NA	NA
AXD42296.1|1556961_1559535_+	chaperone protein ClpB	NA	H6X3M6	Enterobacteria_phage	35.5	2.6e-127
AXD42297.1|1565154_1565385_+	hypothetical protein	NA	NA	NA	NA	NA
AXD42298.1|1565401_1565857_+	DUF4385 domain-containing protein	NA	E3SMI8	Prochlorococcus_phage	50.0	3.0e-34
AXD42299.1|1565960_1567262_+	alpha-ketoglutarate transporter	NA	Q6JIH2	Burkholderia_virus	30.1	3.4e-43
AXD42300.1|1567258_1567582_-	YfiM family lipoprotein	NA	NA	NA	NA	NA
AXD42301.1|1567626_1568982_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
AXD42302.1|1569096_1571757_-	protein lysine acetyltransferase Pat	NA	NA	NA	NA	NA
AXD42303.1|1571810_1572491_-	DTW domain-containing protein	NA	NA	NA	NA	NA
AXD42304.1|1572563_1572983_-	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	40.6	1.2e-16
AXD42305.1|1573186_1574224_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
AXD42306.1|1574339_1575029_-	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	49.5	4.6e-55
AXD42307.1|1575347_1575731_+	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	74.0	6.1e-33
AXD42308.1|1575792_1576380_-	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
AXD45639.1|1576482_1577382_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AXD42309.1|1577399_1578734_-	ATP-dependent RNA helicase SrmB	NA	A0A1B1IS59	uncultured_Mediterranean_phage	29.7	1.6e-43
AXD42310.1|1578863_1579601_+|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase	tRNA	NA	NA	NA	NA
>prophage 4
CP030203	Salmonella enterica strain SA20083530 chromosome, complete genome	5062813	1703032	1796056	5062813	lysis,plate,protease,tail,transposase,capsid,tRNA,terminase,holin,integrase	Enterobacteria_phage(53.12%)	93	1723853:1723870	1798215:1798232
AXD42404.1|1703032_1704496_-|protease	beta-barrel assembly-enhancing protease	protease	NA	NA	NA	NA
AXD42405.1|1704703_1705771_+	AI-2E family transporter	NA	NA	NA	NA	NA
AXD42406.1|1706046_1707234_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AXD42407.1|1707301_1708570_+	GntP family permease	NA	NA	NA	NA	NA
AXD42408.1|1708575_1709715_+	glycerate kinase	NA	W6LM47	Streptococcus_phage	39.8	5.5e-45
AXD42409.1|1709761_1710232_-	thioredoxin-dependent thiol peroxidase	NA	NA	NA	NA	NA
AXD42410.1|1710231_1710870_-	glycine cleavage system transcriptional repressor	NA	NA	NA	NA	NA
AXD42411.1|1710949_1711828_+	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
AXD42412.1|1711844_1712879_+	outer membrane protein assembly factor BamC	NA	NA	NA	NA	NA
AXD42413.1|1713053_1713767_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	M4R1E8	Synechococcus_phage	37.5	9.1e-38
AXD42414.1|1713897_1714761_+	neutral zinc metallopeptidase	NA	NA	NA	NA	NA
AXD42415.1|1714776_1716795_+|tRNA	tRNA cytosine(34) acetyltransferase TmcA	tRNA	NA	NA	NA	NA
AXD42416.1|1716821_1717022_-	hypothetical protein	NA	NA	NA	NA	NA
AXD42417.1|1717049_1718177_-	succinyl-diaminopimelate desuccinylase	NA	NA	NA	NA	NA
AXD42418.1|1718180_1718537_-	ArsC family reductase	NA	NA	NA	NA	NA
AXD45643.1|1718949_1719009_+	hypothetical protein	NA	NA	NA	NA	NA
AXD42419.1|1719110_1722224_-	multidrug efflux RND transporter permease subunit	NA	NA	NA	NA	NA
AXD42420.1|1722408_1724109_-	nitrate/nitrite two-component system sensor histidine kinase NarQ	NA	NA	NA	NA	NA
1723853:1723870	attL	AGATTTTGCAGTACCGGC	NA	NA	NA	NA
AXD42421.1|1724294_1726256_+	oxidoreductase FeS-binding subunit	NA	NA	NA	NA	NA
AXD42422.1|1726704_1728003_-	penicillin binding protein PBP4B	NA	NA	NA	NA	NA
AXD42423.1|1728206_1728782_+	GDP-mannose pyrophosphatase NudK	NA	NA	NA	NA	NA
AXD42424.1|1728906_1729950_+	DUF1176 domain-containing protein	NA	NA	NA	NA	NA
AXD42425.1|1730077_1730308_+	hypothetical protein	NA	NA	NA	NA	NA
AXD42426.1|1730370_1732371_-	transketolase	NA	NA	NA	NA	NA
AXD42427.1|1732390_1733341_-	transaldolase A	NA	A0A127KNC6	Cyanophage	30.3	8.2e-10
AXD42428.1|1733410_1733611_-	hypothetical protein	NA	NA	NA	NA	NA
AXD42429.1|1733612_1735892_+	NADP-dependent malic enzyme	NA	NA	NA	NA	NA
AXD42430.1|1736308_1736644_+	ethanolamine utilization protein EutS	NA	NA	NA	NA	NA
AXD42431.1|1736656_1737136_+	ethanolamine utilization protein EutP	NA	NA	NA	NA	NA
AXD42432.1|1737113_1737803_+	ethanolamine utilization acetate kinase EutQ	NA	NA	NA	NA	NA
AXD42433.1|1737799_1738603_+	ethanolamine utilization cob(I)yrinic acid a,c-diamide adenosyltransferase EutT	NA	NA	NA	NA	NA
AXD42434.1|1738599_1739616_+	ethanolamine utilization protein EutD	NA	NA	NA	NA	NA
AXD42435.1|1739656_1739947_+	ethanolamine utilization protein EutM	NA	NA	NA	NA	NA
AXD42436.1|1740047_1740347_+	ethanolamine utilization microcompartment protein EutN	NA	NA	NA	NA	NA
AXD42437.1|1740358_1741762_+	ethanolamine utilization protein EutE	NA	NA	NA	NA	NA
AXD42438.1|1741772_1742612_+	ethanolamine utilization protein EutJ	NA	NA	NA	NA	NA
AXD42439.1|1742601_1743789_+	ethanolamine utilization ethanol dehydrogenase EutG	NA	NA	NA	NA	NA
AXD42440.1|1743908_1745135_+	ethanolamine utilization protein EutH	NA	NA	NA	NA	NA
AXD42441.1|1745131_1746535_+	ethanolamine ammonia-lyase reactivating factor EutA	NA	NA	NA	NA	NA
AXD42442.1|1746546_1747908_+	ethanolamine ammonia-lyase heavy chain	NA	NA	NA	NA	NA
AXD42443.1|1747926_1748823_+	ethanolamine ammonia-lyase light chain	NA	NA	NA	NA	NA
AXD42444.1|1748832_1749492_+	microcompartment protein EutL	NA	NA	NA	NA	NA
AXD42445.1|1749504_1749999_+	ethanolamine utilization protein EutK	NA	NA	NA	NA	NA
AXD42446.1|1750046_1751099_+	transcriptional regulator	NA	NA	NA	NA	NA
AXD42447.1|1751547_1751877_-	hypothetical protein	NA	NA	NA	NA	NA
AXD42448.1|1751897_1752797_-	oxygen-dependent coproporphyrinogen oxidase	NA	NA	NA	NA	NA
AXD42449.1|1752799_1753669_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A0N9SGH1	Paenibacillus_phage	31.9	2.8e-17
AXD42450.1|1753770_1754307_+	GNAT family acetyltransferase	NA	NA	NA	NA	NA
AXD42451.1|1754803_1755379_+	RpoE-regulated lipoprotein	NA	NA	NA	NA	NA
AXD42452.1|1755658_1755799_-	hok/gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	67.4	7.0e-11
AXD42453.1|1756011_1756293_-	hypothetical protein	NA	NA	NA	NA	NA
AXD42454.1|1757618_1758800_+|tail	phage tail protein	tail	A0A0A7NV69	Enterobacteria_phage	82.4	1.3e-185
AXD42455.1|1758800_1759313_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	67.5	1.3e-62
AXD42456.1|1759363_1759720_+|tail	phage tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	46.6	1.7e-16
AXD42457.1|1759725_1759884_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	77.6	5.3e-15
AXD42458.1|1759870_1762831_+|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	51.7	1.3e-255
AXD42459.1|1763350_1763725_-|tail	phage tail protein	tail	I1TQ41	Pseudomonas_phage	40.0	4.3e-15
AXD42460.1|1763855_1764947_-	hypothetical protein	NA	H6WZJ9	Escherichia_phage	71.1	3.5e-142
AXD42461.1|1765317_1765566_-	hypothetical protein	NA	S5MBX6	Escherichia_phage	53.5	3.2e-14
AXD42462.1|1767584_1768139_-|tail	phage tail protein I	tail	A0A0M4R4W9	Salmonella_phage	70.3	3.5e-69
AXD42463.1|1768135_1769023_-|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	68.2	2.1e-100
AXD42464.1|1769009_1769378_-|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	65.2	1.0e-37
AXD42465.1|1769950_1770586_-	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	57.9	1.0e-61
AXD42466.1|1770582_1771059_-|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	51.6	3.8e-40
AXD42467.1|1771045_1771555_-|lysis	lysis protein	lysis	Q8HA85	Salmonella_phage	75.4	4.2e-53
AXD42468.1|1771969_1772299_-|holin	phage holin, lambda family	holin	NA	NA	NA	NA
AXD42469.1|1772325_1772526_-|tail	phage tail protein	tail	A0A0A7NV57	Enterobacteria_phage	77.3	4.3e-22
AXD42470.1|1772525_1773020_-|capsid	capsid assembly protein	capsid	A0A0A7NPU2	Enterobacteria_phage	60.1	5.8e-52
AXD45644.1|1773121_1773910_-|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	77.1	1.2e-94
AXD42471.1|1775045_1775882_-|capsid	phage capsid protein	capsid	A0A0A7NRY7	Enterobacteria_phage	64.7	3.7e-99
AXD42472.1|1780241_1780541_+	hypothetical protein	NA	NA	NA	NA	NA
AXD42473.1|1780512_1780881_+	hypothetical protein	NA	NA	NA	NA	NA
AXD42474.1|1781603_1782056_+	N-acetyltransferase	NA	NA	NA	NA	NA
AXD42475.1|1782292_1782703_-	hypothetical protein	NA	NA	NA	NA	NA
AXD42476.1|1782695_1785203_-	replication endonuclease	NA	A0A0M4RTM8	Salmonella_phage	47.2	3.4e-172
AXD42477.1|1785199_1785829_-	hypothetical protein	NA	NA	NA	NA	NA
AXD42478.1|1785825_1786941_-	DNA cytosine methyltransferase	NA	A0A0M3ULA1	Salmonella_phage	64.4	1.1e-135
AXD42479.1|1786937_1787441_-	AsnC family protein	NA	NA	NA	NA	NA
AXD42480.1|1787434_1788370_-	DNA adenine methylase	NA	A0A0M4QWR0	Salmonella_phage	49.0	6.7e-65
AXD42481.1|1788366_1788606_-	hypothetical protein	NA	NA	NA	NA	NA
AXD42482.1|1788602_1789139_-	hypothetical protein	NA	NA	NA	NA	NA
AXD42483.1|1789380_1789821_-	hypothetical protein	NA	NA	NA	NA	NA
AXD42484.1|1790057_1790261_-	LapA family protein	NA	NA	NA	NA	NA
AXD42485.1|1790266_1790509_-	hypothetical protein	NA	NA	NA	NA	NA
AXD42486.1|1790580_1790967_-	hypothetical protein	NA	NA	NA	NA	NA
AXD42487.1|1790979_1791195_-	hypothetical protein	NA	NA	NA	NA	NA
AXD42488.1|1791406_1791814_-	hypothetical protein	NA	A0A0A7NPS5	Enterobacteria_phage	61.7	1.2e-39
AXD45645.1|1791919_1792222_+	XRE family transcriptional regulator	NA	Q1JS29	Enterobacteria_phage	67.7	4.4e-34
AXD42489.1|1792285_1793293_+|integrase	site-specific integrase	integrase	A0A0A7NQ69	Enterobacteria_phage	75.8	4.3e-150
AXD42490.1|1793406_1794306_+	Dyp-type peroxidase	NA	S4VVJ7	Pandoravirus	33.3	3.8e-25
AXD42491.1|1794405_1794630_+	hypothetical protein	NA	NA	NA	NA	NA
AXD42492.1|1794586_1795045_+|transposase	IS200/IS605-like element IS200F family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.3e-13
AXD42493.1|1795264_1796056_+	NAD(P)-dependent oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.6	1.5e-17
1798215:1798232	attR	GCCGGTACTGCAAAATCT	NA	NA	NA	NA
>prophage 5
CP030203	Salmonella enterica strain SA20083530 chromosome, complete genome	5062813	1845659	1890186	5062813	lysis,protease,tail,transposase,terminase,portal,integrase,coat	Salmonella_phage(69.7%)	71	1846755:1846769	1890350:1890364
AXD42536.1|1845659_1846598_+|protease	omptin family outer membrane protease PgtE	protease	NA	NA	NA	NA
AXD42537.1|1846619_1846850_-	hypothetical protein	NA	C6ZR23	Salmonella_phage	68.0	3.1e-08
1846755:1846769	attL	TGGTGTCCCCTGCAG	NA	NA	NA	NA
AXD42538.1|1846859_1847063_-	hypothetical protein	NA	C6ZR24	Salmonella_phage	97.0	2.7e-32
AXD42539.1|1847159_1847795_-	Eac protein	NA	A0A075B8I7	Enterobacteria_phage	86.7	4.2e-103
AXD42540.1|1847865_1848150_-	ASCH domain-containing protein	NA	A0A2D1GLL3	Escherichia_phage	97.9	5.9e-49
AXD42541.1|1848142_1848829_-	DUF551 domain-containing protein	NA	A0A192Y7X3	Salmonella_phage	56.5	1.8e-59
AXD42542.1|1848839_1849046_-	hypothetical protein	NA	A0A2D1GLS1	Escherichia_phage	92.5	1.5e-30
AXD42543.1|1849048_1849273_-	hypothetical protein	NA	A0A220NQV0	Salmonella_phage	89.5	9.4e-34
AXD45649.1|1849275_1849581_-	ead/Ea22-like family protein	NA	C6ZR30	Salmonella_phage	90.5	1.5e-42
AXD42544.1|1849649_1849922_-	antitoxin	NA	NA	NA	NA	NA
AXD42545.1|1849918_1850281_-	Eaf protein	NA	T1SA95	Salmonella_phage	92.2	1.2e-59
AXD42546.1|1850277_1850784_-	ead/Ea22-like family protein	NA	A0A0N6WGF1	Salmonella_phage	88.3	3.7e-62
AXD45650.1|1850780_1850951_-	DUF2737 domain-containing protein	NA	Q76H43	Enterobacteria_phage	96.4	1.8e-24
AXD42547.1|1850961_1851255_-	RecBCD nuclease inhibitor	NA	Q76H42	Enterobacteria_phage	90.7	1.7e-43
AXD42548.1|1851271_1851820_-	3'-5' exoribonuclease	NA	C6ZR35	Salmonella_phage	100.0	2.1e-106
AXD42549.1|1851828_1852335_-	single-stranded DNA-binding protein	NA	C6ZR36	Salmonella_phage	90.5	7.3e-82
AXD42550.1|1852335_1853043_-	recombinase	NA	A0A192Y5Z5	Salmonella_phage	86.4	4.4e-117
AXD42551.1|1853051_1853240_-	hypothetical protein	NA	C6ZR38	Salmonella_phage	96.8	1.1e-27
AXD42552.1|1853324_1853594_-	hypothetical protein	NA	K7PGS9	Enterobacteria_phage	88.8	2.6e-38
AXD42553.1|1853734_1854358_-	hypothetical protein	NA	K7PKU5	Enterobacteria_phage	96.1	1.0e-106
AXD42554.1|1854394_1854595_-	restriction endonuclease	NA	A0A1R3Y5S4	Salmonella_virus	100.0	1.0e-31
AXD45651.1|1854526_1854739_+	hypothetical protein	NA	NA	NA	NA	NA
AXD42555.1|1854934_1855273_-	hypothetical protein	NA	E7C9Q7	Salmonella_phage	95.5	2.5e-54
AXD45652.1|1855627_1856290_-	LexA family transcriptional regulator	NA	A0A0M4QWY1	Salmonella_phage	100.0	1.7e-126
AXD42556.1|1856408_1856624_+	XRE family transcriptional regulator	NA	A0A0M4RTV8	Salmonella_phage	100.0	4.1e-34
AXD42557.1|1856732_1857023_+	hypothetical protein	NA	I6RSP4	Salmonella_phage	99.0	5.3e-45
AXD42558.1|1857191_1858040_+	replication protein	NA	C6ZR51	Salmonella_phage	96.5	2.0e-153
AXD42559.1|1858150_1860031_+	bifunctional DNA primase/helicase	NA	I6S1U6	Salmonella_phage	98.7	0.0e+00
AXD42560.1|1860031_1860310_+	hypothetical protein	NA	C6ZR54	Salmonella_phage	93.5	2.3e-45
AXD42561.1|1860438_1860897_-|transposase	IS200/IS605-like element IS200F family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.3e-13
AXD45653.1|1861091_1861352_+	hypothetical protein	NA	K7PKU8	Enterobacteria_phage	57.7	1.1e-22
AXD42562.1|1861498_1861945_+	recombination protein NinB	NA	I6R0N7	Salmonella_phage	95.9	1.5e-78
AXD42563.1|1861941_1862124_+	NinE family protein	NA	C6ZR57	Salmonella_phage	93.3	9.1e-27
AXD42564.1|1862120_1862291_+	NinF family protein	NA	I6R994	Salmonella_phage	83.3	1.8e-21
AXD42565.1|1862283_1862520_+	hypothetical protein	NA	C6ZR59	Salmonella_phage	88.5	3.4e-34
AXD42566.1|1862500_1862962_+	hypothetical protein	NA	C6ZR60	Salmonella_phage	96.1	1.7e-85
AXD42567.1|1862958_1863363_+	antitermination protein	NA	A0A088CD47	Shigella_phage	66.4	1.4e-43
AXD42568.1|1863626_1864382_+	hypothetical protein	NA	B6SD57	Bacteriophage	54.8	8.3e-66
AXD42569.1|1865075_1865348_+	hypothetical protein	NA	A0A2H4FNF0	Salmonella_phage	91.1	2.0e-38
AXD42570.1|1865415_1865835_+	lysozyme	NA	M9P0E5	Enterobacteria_phage	74.8	4.8e-55
AXD42571.1|1865831_1866299_+|lysis	lysis protein	lysis	H6WRZ5	Salmonella_phage	88.4	3.8e-69
AXD45654.1|1866510_1867032_+	DNA-binding protein	NA	H6WRZ8	Salmonella_phage	98.3	4.7e-100
AXD42572.1|1867364_1867607_+	DUF2560 family protein	NA	A0A192Y6S9	Salmonella_phage	100.0	1.0e-33
AXD42573.1|1867609_1868014_+	Decoration protein	NA	A0A192Y6U9	Salmonella_phage	99.3	1.5e-66
AXD42574.1|1868026_1868485_+|terminase	terminase	terminase	A0A2P1MXF5	Escherichia_phage	65.5	1.2e-48
AXD42575.1|1868484_1869945_+|terminase	terminase	terminase	W6MW26	Pseudomonas_phage	76.5	4.3e-220
AXD42576.1|1869944_1872122_+|portal	portal protein	portal	Q5C835	Enterobacteria_phage	98.8	0.0e+00
AXD42577.1|1872135_1873047_+	scaffolding protein	NA	A0A192Y6T4	Salmonella_phage	99.7	1.8e-160
AXD42578.1|1873050_1873599_-	HNH endonuclease	NA	A0A291AXK3	Shigella_phage	46.8	1.2e-26
AXD42579.1|1873641_1874940_+|coat	coat protein	coat	A0A0M5M1J5	Salmonella_phage	99.8	1.0e-241
AXD42580.1|1874978_1875188_+	hypothetical protein	NA	I1TEI9	Salmonella_phage	98.6	4.1e-31
AXD42581.1|1875171_1875672_+	hypothetical protein	NA	I1TEJ0	Salmonella_phage	98.8	5.5e-90
AXD42582.1|1875631_1877050_+	hypothetical protein	NA	I1TEJ1	Salmonella_phage	98.1	1.1e-271
AXD42583.1|1877053_1877755_+|tail	phage tail protein	tail	I1TEJ2	Salmonella_phage	98.7	1.4e-70
AXD42584.1|1877754_1878210_+	DUF2824 family protein	NA	E7C9U3	Salmonella_phage	99.3	5.2e-87
AXD42585.1|1878212_1878902_+	DNA transfer protein	NA	A0A1R3Y5P8	Salmonella_virus	98.3	8.4e-89
AXD45655.1|1878944_1880171_+	acyltransferase	NA	E7C9U5	Salmonella_phage	73.0	2.7e-130
AXD42586.1|1880170_1882036_+	DNA transfer protein	NA	A0A2H4FNB8	Salmonella_phage	90.0	8.1e-296
AXD42587.1|1882053_1882452_-	hypothetical protein	NA	NA	NA	NA	NA
AXD42588.1|1882532_1883099_+	hypothetical protein	NA	G8C7Q8	Escherichia_phage	37.4	6.5e-23
AXD42589.1|1883107_1883557_+	hypothetical protein	NA	G8C7Q9	Escherichia_phage	62.2	1.3e-45
AXD42590.1|1883592_1883856_+	hypothetical protein	NA	NA	NA	NA	NA
AXD45656.1|1884244_1884580_+	hypothetical protein	NA	A0A0M4R2Z9	Salmonella_phage	98.2	2.4e-57
AXD42591.1|1884583_1884781_+	type II toxin-antitoxin system HicA family toxin	NA	A0A0M4RCZ9	Salmonella_phage	98.5	8.6e-31
AXD42592.1|1884816_1885002_+	hypothetical protein	NA	I6RSG3	Salmonella_phage	100.0	1.1e-08
AXD42593.1|1884976_1885186_-	hypothetical protein	NA	I6R975	Salmonella_phage	98.6	5.9e-30
AXD42594.1|1885182_1885416_-	hypothetical protein	NA	I6S5X8	Salmonella_phage	98.7	8.6e-38
AXD45657.1|1885418_1885628_-	Arc family DNA-binding protein	NA	I6R0M0	Salmonella_phage	100.0	1.2e-30
AXD45658.1|1885754_1885916_+	Arc family DNA-binding protein	NA	A8CG91	Salmonella_phage	92.5	1.5e-20
AXD42595.1|1885984_1886875_+	phage antirepressor Ant	NA	I6R977	Salmonella_phage	98.0	2.9e-166
AXD42596.1|1889016_1890186_-|integrase	integrase	integrase	I6R0M2	Salmonella_phage	95.6	3.7e-222
1890350:1890364	attR	TGGTGTCCCCTGCAG	NA	NA	NA	NA
>prophage 6
CP030203	Salmonella enterica strain SA20083530 chromosome, complete genome	5062813	2116056	2125227	5062813	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
AXD42813.1|2116056_2117004_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	1.7e-23
AXD42814.1|2116987_2117719_+	ABC transporter permease	NA	NA	NA	NA	NA
AXD42815.1|2117699_2117807_-	hypothetical protein	NA	NA	NA	NA	NA
AXD42816.1|2117866_2118598_-	transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
AXD42817.1|2118820_2120506_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.3	4.8e-279
AXD42818.1|2120502_2121222_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AXD42819.1|2121268_2121736_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
AXD42820.1|2121792_2122323_-	hypothetical protein	NA	NA	NA	NA	NA
AXD42821.1|2122494_2122953_-	DUF1307 domain-containing protein	NA	Q9EYF5	Enterobacteria_phage	73.2	7.6e-54
AXD42822.1|2123193_2125227_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
>prophage 7
CP030203	Salmonella enterica strain SA20083530 chromosome, complete genome	5062813	2193596	2199902	5062813		Enterobacteria_phage(50.0%)	6	NA	NA
AXD42876.1|2193596_2195000_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	32.3	1.5e-20
AXD42877.1|2195177_2196071_+	UTP--glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
AXD42878.1|2196447_2197533_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.2	5.5e-103
AXD42879.1|2197532_2198432_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	1.4e-30
AXD45666.1|2198479_2199358_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.1	3.0e-107
AXD42880.1|2199362_2199902_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.5	2.9e-52
>prophage 8
CP030203	Salmonella enterica strain SA20083530 chromosome, complete genome	5062813	2280956	2333787	5062813	lysis,plate,head,tail,holin,integrase	Salmonella_phage(45.65%)	62	2275268:2275282	2325513:2325527
2275268:2275282	attL	GATGTGGGGCTGTCG	NA	NA	NA	NA
AXD42955.1|2280956_2281946_-|integrase	integrase	integrase	A0A192Y7M7	Salmonella_phage	100.0	8.6e-196
AXD42956.1|2281947_2282190_-	DUF4224 domain-containing protein	NA	Q8HAA9	Salmonella_phage	100.0	9.5e-40
AXD42957.1|2282214_2282784_-	3'-5' exoribonuclease	NA	A0A192Y6E0	Salmonella_phage	88.9	5.6e-99
AXD42958.1|2282829_2283066_-	hypothetical protein	NA	G8C7S3	Escherichia_phage	55.6	3.9e-14
AXD42959.1|2283052_2284021_-	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	73.5	4.2e-78
AXD42960.1|2284031_2285351_-	phosphoadenosine phosphosulfate reductase	NA	Q8W6P3	Burkholderia_virus	32.9	7.8e-43
AXD42961.1|2285352_2285877_-	ead/Ea22-like family protein	NA	C6ZR30	Salmonella_phage	83.5	6.9e-43
AXD42962.1|2285947_2286487_-	HD family hydrolase	NA	A0A192Y8M4	Salmonella_phage	99.4	7.7e-98
AXD42963.1|2286623_2287451_-	hypothetical protein	NA	Q8HAA2	Salmonella_phage	98.9	1.9e-151
AXD42964.1|2287508_2287880_-	hypothetical protein	NA	Q8HAA1	Salmonella_phage	100.0	1.1e-63
AXD42965.1|2287977_2288163_+	hypothetical protein	NA	NA	NA	NA	NA
AXD42966.1|2288452_2288704_+	bssS family protein	NA	NA	NA	NA	NA
AXD42967.1|2288603_2288852_-	hypothetical protein	NA	NA	NA	NA	NA
AXD42968.1|2288779_2288965_-	hypothetical protein	NA	A0A1C9II97	Salmonella_phage	73.3	1.2e-13
AXD42969.1|2289199_2289865_-	LexA family transcriptional regulator	NA	H9C160	Pectobacterium_phage	30.1	2.6e-23
AXD42970.1|2289931_2290147_+	hypothetical protein	NA	NA	NA	NA	NA
AXD42971.1|2290247_2290823_+	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	63.7	6.6e-63
AXD42972.1|2290968_2291175_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	67.9	4.8e-16
AXD42973.1|2291175_2291523_-	glycosyl transferase family 1	NA	NA	NA	NA	NA
AXD42974.1|2291527_2291809_-	hypothetical protein	NA	NA	NA	NA	NA
AXD42975.1|2291937_2292156_+	hypothetical protein	NA	A5LH70	Enterobacteria_phage	52.1	2.0e-12
AXD42976.1|2292152_2293127_+	hypothetical protein	NA	A0A1C9IHW0	Salmonella_phage	94.8	9.8e-160
AXD42977.1|2293123_2293609_+	hypothetical protein	NA	A0A1C9IHW0	Salmonella_phage	69.0	1.4e-34
AXD42978.1|2293605_2295942_+	DNA (cytosine-5-)-methyltransferase	NA	A0A1B0V7P0	Salmonella_phage	48.6	5.3e-212
AXD42979.1|2295951_2296275_+	LexA family transcriptional regulator	NA	A5LH73	Enterobacteria_phage	59.0	8.0e-26
AXD42980.1|2296271_2296664_+	hypothetical protein	NA	A0A1C9IIA0	Salmonella_phage	89.1	9.3e-61
AXD42981.1|2296675_2297476_+	KilA-N domain-containing protein	NA	S5FM84	Shigella_phage	66.9	6.1e-99
AXD42982.1|2297483_2298542_+	hypothetical protein	NA	A0A291AWV9	Escherichia_phage	61.4	1.7e-120
AXD42983.1|2298552_2299176_+	hypothetical protein	NA	Q8HA89	Salmonella_phage	99.0	2.3e-117
AXD45671.1|2299308_2299566_+	hypothetical protein	NA	Q8HA88	Salmonella_phage	83.5	3.4e-35
AXD42984.1|2299483_2299930_-	hypothetical protein	NA	NA	NA	NA	NA
AXD42985.1|2300091_2300436_+|holin	phage holin, lambda family	holin	Q8HA87	Salmonella_phage	100.0	5.3e-44
AXD42986.1|2300438_2301053_+	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	92.2	6.1e-107
AXD45672.1|2301085_2301535_+|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	85.7	1.9e-57
AXD45673.1|2302180_2302897_+	hypothetical protein	NA	NA	NA	NA	NA
AXD42987.1|2303420_2304011_+	nuclease	NA	A0A067ZI74	Vibrio_phage	53.1	2.0e-35
AXD42988.1|2304010_2304556_+	hypothetical protein	NA	A0A067ZIZ9	Vibrio_phage	37.2	6.7e-17
AXD42989.1|2306421_2306661_+	hypothetical protein	NA	A0A067ZJ01	Vibrio_phage	53.4	2.0e-13
AXD42990.1|2309280_2309667_+|head	head decoration protein	head	NA	NA	NA	NA
AXD42991.1|2310720_2311176_+	hypothetical protein	NA	NA	NA	NA	NA
AXD42992.1|2311182_2311527_+	sugar transporter	NA	A0A067ZJA6	Vibrio_phage	44.9	4.1e-20
AXD42993.1|2311523_2312009_+	hypothetical protein	NA	A0A067ZIL8	Vibrio_phage	40.9	6.4e-19
AXD42994.1|2312008_2312308_+	hypothetical protein	NA	NA	NA	NA	NA
AXD42995.1|2313776_2314298_+|tail	phage tail protein	tail	A0A067ZJA9	Vibrio_phage	53.2	1.2e-47
AXD42996.1|2314307_2314589_+	hypothetical protein	NA	NA	NA	NA	NA
AXD42997.1|2317178_2317397_+|tail	phage tail protein	tail	A0A0C5AEF4	Bacteriophage	50.0	1.4e-10
AXD42998.1|2317386_2318388_+	late control D family protein	NA	A0A0C5AJ59	Bacteriophage	36.9	3.0e-55
AXD42999.1|2318388_2319009_+|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	55.9	1.3e-32
AXD43000.1|2319005_2319473_+	hypothetical protein	NA	NA	NA	NA	NA
AXD43001.1|2319786_2320911_+|plate	baseplate J protein	plate	A0A0C5AEG2	Bacteriophage	44.4	2.7e-89
AXD43002.1|2320903_2321485_+|tail	phage tail protein I	tail	V9IQK7	Stenotrophomonas_phage	34.1	1.0e-18
AXD43003.1|2323584_2324115_+|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	80.7	1.8e-78
AXD43004.1|2324168_2325299_-	acyltransferase	NA	A0A2H4JA46	uncultured_Caudovirales_phage	35.1	4.6e-36
AXD43005.1|2326232_2326394_+	hypothetical protein	NA	NA	NA	NA	NA
2325513:2325527	attR	GATGTGGGGCTGTCG	NA	NA	NA	NA
AXD43006.1|2326520_2326940_+	DNA polymerase V subunit UmuD	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
AXD43007.1|2326942_2328211_+	translesion error-prone DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	92.2	1.1e-227
AXD43008.1|2328665_2328878_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	68.6	1.1e-20
AXD45674.1|2328888_2329077_+	cold-shock protein	NA	NA	NA	NA	NA
AXD43009.1|2329336_2330548_-	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	56.5	2.0e-109
AXD43010.1|2331196_2331508_+	hypothetical protein	NA	NA	NA	NA	NA
AXD43011.1|2331587_2332283_+	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.7	2.1e-07
AXD43012.1|2332356_2333787_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.5	3.5e-105
>prophage 9
CP030203	Salmonella enterica strain SA20083530 chromosome, complete genome	5062813	2372145	2408593	5062813	lysis,head,tail,capsid,holin,integrase	Salmonella_phage(41.46%)	52	2366397:2366411	2390476:2390490
2366397:2366411	attL	CGACGGCGCTGGCGC	NA	NA	NA	NA
AXD43058.1|2372145_2373156_-|integrase	integrase	integrase	K7PLZ2	Enterobacterial_phage	63.7	3.3e-126
AXD43059.1|2373155_2373383_-	hypothetical protein	NA	K7PHA0	Enterobacterial_phage	43.3	9.6e-10
AXD43060.1|2373535_2373751_-	hypothetical protein	NA	NA	NA	NA	NA
AXD43061.1|2373750_2374215_-	ATPase	NA	A0A1B5FPC7	Escherichia_phage	49.8	2.0e-38
AXD43062.1|2374211_2374436_-	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	66.7	8.6e-19
AXD43063.1|2374432_2374558_-	sodium:solute symporter	NA	NA	NA	NA	NA
AXD43064.1|2374557_2375355_-	ORF6N domain-containing protein	NA	F1C5A3	Cronobacter_phage	64.8	6.3e-48
AXD43065.1|2375677_2377924_-	DNA (cytosine-5-)-methyltransferase	NA	A0A1B0V7P0	Salmonella_phage	50.1	6.1e-205
AXD43066.1|2377920_2378544_-	YqaJ-like viral recombinase	NA	S0A2A9	Cellulophaga_phage	48.1	8.7e-45
AXD43067.1|2378540_2379044_-	hypothetical protein	NA	A0A0F7L7F5	uncultured_marine_virus	31.5	1.9e-13
AXD43068.1|2379049_2379346_-	host-nuclease inhibitor protein Gam	NA	A0A0M5M5Z9	Salmonella_phage	92.9	6.0e-44
AXD43069.1|2379436_2379637_-	cell division protein FtsZ	NA	A0A0M4S6W3	Salmonella_phage	50.0	4.3e-06
AXD45675.1|2379927_2380137_+	fumarate hydratase FumD	NA	I6R0R9	Salmonella_phage	88.4	1.8e-26
AXD43070.1|2380184_2380991_-	DUF3037 domain-containing protein	NA	NA	NA	NA	NA
AXD43071.1|2380987_2381836_-	hypothetical protein	NA	NA	NA	NA	NA
AXD43072.1|2382007_2382403_-	helix-turn-helix domain-containing protein	NA	K7PM35	Enterobacteria_phage	72.5	5.9e-47
AXD43073.1|2382507_2382744_+	Rha family transcriptional regulator	NA	A0A0M4QX15	Salmonella_phage	73.1	9.0e-27
AXD43074.1|2382763_2383087_+	transcriptional regulator	NA	H6WRX6	Salmonella_phage	58.9	1.2e-26
AXD43075.1|2383178_2384084_+	Replication protein O	NA	A0A0M5M7Y1	Salmonella_phage	99.3	4.5e-175
AXD43076.1|2384080_2384767_+	phage replication protein	NA	G8C7U6	Escherichia_phage	61.6	9.2e-80
AXD43077.1|2384780_2385038_+	DUF4752 domain-containing protein	NA	T1S9K2	Salmonella_phage	89.4	5.2e-36
AXD45676.1|2385055_2385265_+	hypothetical protein	NA	A0A0F6TK62	Escherichia_coli_O157_typing_phage	85.5	1.7e-29
AXD43078.1|2385261_2385450_+	hypothetical protein	NA	NA	NA	NA	NA
AXD43079.1|2385446_2386274_+	hypothetical protein	NA	K7P881	Enterobacteria_phage	44.7	1.2e-46
AXD43080.1|2386424_2387057_+	hypothetical protein	NA	H6WRY3	Salmonella_phage	90.0	3.7e-99
AXD43081.1|2387123_2387390_+	hypothetical protein	NA	S4TNF2	Salmonella_phage	98.9	9.8e-46
AXD43082.1|2387528_2387996_+	PH domain-containing protein	NA	A0A1J0MFS8	Serratia_phage	34.4	1.1e-10
AXD43083.1|2388236_2388776_+	hypothetical protein	NA	Q8HA44	Vibrio_phage	62.4	9.0e-30
AXD43084.1|2388937_2389171_+	DinI family protein	NA	K7PM44	Enterobacteria_phage	75.3	9.5e-29
AXD43085.1|2389287_2389536_+	hypothetical protein	NA	A0A0U2C0C8	Salmonella_phage	100.0	1.6e-42
AXD43086.1|2389570_2390173_+	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	99.5	7.5e-110
AXD43087.1|2390172_2390379_+	hypothetical protein	NA	S4TNP0	Salmonella_phage	100.0	3.5e-35
AXD43088.1|2390381_2390993_+	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	98.5	2.7e-91
2390476:2390490	attR	GCGCCAGCGCCGTCG	NA	NA	NA	NA
AXD43089.1|2390989_2391130_+	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	78.9	3.2e-08
AXD43090.1|2391126_2391807_+	antiterminator	NA	I6PDF8	Cronobacter_phage	53.6	8.0e-60
AXD43091.1|2392048_2392372_-	addiction module antidote protein, HigA family	NA	A0A0M3LPV0	Mannheimia_phage	34.1	6.4e-07
AXD43092.1|2392337_2392619_-	peptidase	NA	A0A2L1IV28	Escherichia_phage	48.4	1.7e-19
AXD43093.1|2393578_2393932_+|holin	phage holin, lambda family	holin	NA	NA	NA	NA
AXD43094.1|2393948_2394149_-	hypothetical protein	NA	NA	NA	NA	NA
AXD43095.1|2394201_2394651_+	lysozyme	NA	A0A0M4R365	Salmonella_phage	73.2	2.7e-56
AXD43096.1|2395190_2395658_+|lysis	lysis protein	lysis	H6WRZ5	Salmonella_phage	90.3	3.4e-70
AXD43097.1|2396775_2396934_+	hypothetical protein	NA	I6PDJ6	Cronobacter_phage	64.7	1.0e-10
AXD45677.1|2396987_2397704_+	hypothetical protein	NA	NA	NA	NA	NA
AXD43098.1|2398227_2398818_+	nuclease	NA	A0A067ZI74	Vibrio_phage	53.7	6.4e-37
AXD43099.1|2401232_2401472_+	hypothetical protein	NA	A0A067ZJ01	Vibrio_phage	54.8	6.8e-14
AXD43100.1|2404090_2404477_+|head	head decoration protein	head	NA	NA	NA	NA
AXD43101.1|2404492_2405536_+|capsid	major capsid protein	capsid	A0A059WRQ2	Vibrio_phage	44.6	5.3e-71
AXD43102.1|2405536_2405992_+	hypothetical protein	NA	NA	NA	NA	NA
AXD43103.1|2405998_2406343_+	sugar transporter	NA	A0A067ZJA6	Vibrio_phage	44.9	1.2e-19
AXD43104.1|2406339_2406825_+	hypothetical protein	NA	A0A067ZIL8	Vibrio_phage	40.9	6.4e-19
AXD43105.1|2406824_2407124_+	hypothetical protein	NA	NA	NA	NA	NA
AXD43106.1|2407123_2408593_+|tail	phage tail sheath family protein	tail	A0A059WKP9	Vibrio_phage	54.7	1.5e-148
>prophage 10
CP030203	Salmonella enterica strain SA20083530 chromosome, complete genome	5062813	2485304	2528140	5062813	integrase,head,lysis,tail	Salmonella_phage(18.18%)	63	2487511:2487540	2531381:2531410
AXD43179.1|2485304_2485535_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	60.3	2.9e-14
AXD43180.1|2485672_2486047_+	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
AXD43181.1|2486047_2486923_+	hypothetical protein	NA	NA	NA	NA	NA
AXD43182.1|2486939_2487293_+	hypothetical protein	NA	NA	NA	NA	NA
AXD43183.1|2487350_2487470_+	hypothetical protein	NA	NA	NA	NA	NA
2487511:2487540	attL	ACAGGAATCGTATTCGGTCTCTTTTTATTT	NA	NA	NA	NA
AXD43184.1|2487666_2488746_-|integrase	integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	54.9	4.5e-105
AXD43185.1|2488726_2488999_-	excisionase	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	39.7	4.0e-10
AXD45680.1|2489071_2489296_-	hypothetical protein	NA	NA	NA	NA	NA
AXD43186.1|2489586_2489766_-	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	62.1	4.3e-13
AXD43187.1|2490386_2490650_-	hypothetical protein	NA	NA	NA	NA	NA
AXD43188.1|2490655_2491417_-	protein Ead	NA	A0A075B8K3	Enterobacteria_phage	53.0	4.2e-57
AXD43189.1|2491413_2491728_-	hypothetical protein	NA	A0A222YY67	Escherichia_phage	56.3	2.8e-31
AXD43190.1|2491763_2492594_-	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.6	8.5e-104
AXD43191.1|2492586_2495292_-	exodeoxyribonuclease VIII	NA	V5UQJ3	Shigella_phage	57.1	7.9e-159
AXD43192.1|2495432_2495768_-	hypothetical protein	NA	NA	NA	NA	NA
AXD43193.1|2495843_2496050_-	cell division inhibitor protein	NA	I6PBM9	Cronobacter_phage	45.6	3.0e-10
AXD43194.1|2496053_2496329_-	hypothetical protein	NA	NA	NA	NA	NA
AXD43195.1|2496499_2496691_+	hypothetical protein	NA	NA	NA	NA	NA
AXD43196.1|2496755_2496986_-	hypothetical protein	NA	NA	NA	NA	NA
AXD43197.1|2497371_2497773_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	48.1	4.5e-26
AXD43198.1|2497851_2498070_+	transcriptional regulator	NA	NA	NA	NA	NA
AXD43199.1|2498066_2498561_+	hypothetical protein	NA	NA	NA	NA	NA
AXD43200.1|2498605_2499481_+	DNA-binding protein	NA	A0A088CD36	Shigella_phage	58.5	2.4e-32
AXD43201.1|2499487_2500240_+	DNA replication protein DnaC	NA	A0A088CBP4	Shigella_phage	77.0	7.7e-104
AXD43202.1|2500647_2500920_+	hypothetical protein	NA	NA	NA	NA	NA
AXD43203.1|2501123_2501279_+	type I toxin-antitoxin system hok family toxin	NA	A0A0U2QV81	Escherichia_phage	84.3	1.2e-14
AXD43204.1|2501542_2501737_+	hypothetical protein	NA	NA	NA	NA	NA
AXD43205.1|2501902_2502340_+	recombination protein NinB	NA	G8C7V3	Escherichia_phage	68.1	8.8e-52
AXD43206.1|2502336_2502531_+	hypothetical protein	NA	S4TNP0	Salmonella_phage	59.6	1.0e-12
AXD43207.1|2502527_2502809_+	DUF1364 family protein	NA	K7P7Q1	Enterobacteria_phage	79.1	1.7e-35
AXD43208.1|2502805_2503342_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	67.4	2.7e-66
AXD43209.1|2503509_2504046_+	hypothetical protein	NA	NA	NA	NA	NA
AXD45682.1|2504178_2504481_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
AXD43210.1|2504458_2504998_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	71.2	9.8e-77
AXD45681.1|2505315_2505771_+|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	79.5	4.3e-57
AXD45683.1|2505987_2506170_+	DUF826 domain-containing protein	NA	NA	NA	NA	NA
AXD43211.1|2506239_2506869_+	hypothetical protein	NA	A0A0M3ULJ9	Salmonella_phage	98.6	1.1e-108
AXD43212.1|2506871_2508491_+	TerL protein	NA	A0A0M5M1R6	Salmonella_phage	80.6	1.5e-261
AXD43213.1|2508490_2510011_+	DUF1073 domain-containing protein	NA	A0A2R3UAL5	Myoviridae_environmental_samples	43.9	2.4e-104
AXD43214.1|2510051_2510741_+|head	phage head morphogenesis protein	head	H9C0V1	Aeromonas_phage	49.6	4.5e-58
AXD43215.1|2510737_2512084_+	DUF2213 domain-containing protein	NA	A0A219YCD3	Aeromonas_phage	36.5	5.5e-68
AXD43216.1|2512085_2512568_+	hypothetical protein	NA	K4HYQ5	Acinetobacter_phage	41.2	1.5e-20
AXD43217.1|2512567_2513596_+	DUF2184 domain-containing protein	NA	A0A219YBB0	Aeromonas_phage	48.7	2.3e-82
AXD43218.1|2513599_2513947_+	hypothetical protein	NA	H9C0V9	Aeromonas_phage	40.2	3.9e-10
AXD43219.1|2513953_2514409_+	DUF4054 domain-containing protein	NA	A0A068CGG9	Acinetobacter_phage	40.8	2.4e-15
AXD43220.1|2514402_2514987_+	hypothetical protein	NA	H9C0W2	Aeromonas_phage	30.6	4.2e-17
AXD43221.1|2514983_2515349_+	hypothetical protein	NA	A0A077KAW7	Edwardsiella_phage	40.5	1.0e-21
AXD43222.1|2515333_2515879_+	hypothetical protein	NA	NA	NA	NA	NA
AXD43223.1|2515859_2517344_+	DUF3383 domain-containing protein	NA	A0A1X9SFB3	Acinetobacter_phage	33.8	5.3e-64
AXD43224.1|2517344_2517791_+	hypothetical protein	NA	Q2NPD1	Xanthomonas_phage	40.4	2.2e-21
AXD43225.1|2517790_2518195_+	hypothetical protein	NA	H9C0W7	Aeromonas_phage	44.8	2.4e-19
AXD43226.1|2518236_2518419_+	transcription elongation factor GreA	NA	NA	NA	NA	NA
AXD43227.1|2518402_2520574_+	lytic transglycosylase domain-containing protein	NA	A0A0M4REK7	Salmonella_phage	67.1	3.7e-50
AXD43228.1|2520570_2521281_+	hypothetical protein	NA	A0A077KGW3	Edwardsiella_phage	35.2	3.8e-28
AXD43229.1|2521280_2521583_+	hypothetical protein	NA	A0A077K9U4	Edwardsiella_phage	49.5	7.0e-24
AXD43230.1|2521579_2522449_+	hypothetical protein	NA	A0A077KC17	Edwardsiella_phage	32.4	2.6e-31
AXD43231.1|2522429_2523107_+	oxidoreductase	NA	A0A077KAY0	Edwardsiella_phage	36.0	1.2e-31
AXD43232.1|2523119_2523476_+	hypothetical protein	NA	A0A077KCA1	Edwardsiella_phage	47.2	8.0e-19
AXD43233.1|2523472_2524714_+	hypothetical protein	NA	A0A077KGW9	Edwardsiella_phage	49.6	3.5e-101
AXD43234.1|2524715_2525318_+	DUF2612 domain-containing protein	NA	A0A2R3UAM9	Myoviridae_environmental_samples	38.9	3.3e-33
AXD43235.1|2525307_2526759_+|tail	tail fiber protein	tail	E5G6P0	Salmonella_phage	70.7	6.6e-43
AXD43236.1|2526755_2527574_+|tail	phage tail protein	tail	A0A0M4QWS3	Salmonella_phage	95.9	6.3e-152
AXD43237.1|2527570_2528140_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	89.9	4.5e-96
2531381:2531410	attR	ACAGGAATCGTATTCGGTCTCTTTTTATTT	NA	NA	NA	NA
>prophage 11
CP030203	Salmonella enterica strain SA20083530 chromosome, complete genome	5062813	2531545	2538550	5062813	integrase,tail	Salmonella_phage(50.0%)	9	2530530:2530543	2535022:2535035
2530530:2530543	attL	ATTGAAAATGATAA	NA	NA	NA	NA
AXD43240.1|2531545_2532625_-|integrase	integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	52.2	3.3e-100
AXD43241.1|2532621_2533728_-	exodeoxyribonuclease 8	NA	Q9QF34	Lambdoid_phage	66.7	3.3e-55
AXD43242.1|2533758_2534046_+	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	95.1	1.9e-39
AXD43243.1|2534042_2534576_+	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	42.4	1.6e-10
AXD43244.1|2534832_2535000_-	lytic enzyme	NA	NA	NA	NA	NA
AXD43245.1|2535302_2535794_+	DUF1441 family protein	NA	Q9EYD0	Enterobacteria_phage	56.2	7.6e-44
2535022:2535035	attR	ATTGAAAATGATAA	NA	NA	NA	NA
AXD43246.1|2536346_2537684_+	shikimate transporter	NA	E5G6P0	Salmonella_phage	52.6	1.3e-77
AXD43247.1|2537655_2537976_+	hypothetical protein	NA	A0A0M4QWS3	Salmonella_phage	79.2	2.9e-44
AXD43248.1|2537965_2538550_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	80.1	2.2e-82
>prophage 12
CP030203	Salmonella enterica strain SA20083530 chromosome, complete genome	5062813	2713823	2720485	5062813		Salmonella_phage(33.33%)	9	NA	NA
AXD43420.1|2713823_2714630_-	peptide ABC transporter ATP-binding protein SapF	NA	G3M9Y6	Bacillus_virus	27.4	4.6e-14
AXD43421.1|2714631_2715624_-	peptide ABC transporter ATP-binding protein SapD	NA	NA	NA	NA	NA
AXD43422.1|2715623_2716514_-	peptide ABC transporter permease SapC	NA	NA	NA	NA	NA
AXD43423.1|2717336_2718059_-	hypothetical protein	NA	A0A0P0ZCT1	Stx2-converting_phage	38.9	4.3e-35
AXD43424.1|2718529_2718712_+	hypothetical protein	NA	S4TSR3	Salmonella_phage	77.6	1.0e-22
AXD43425.1|2718961_2719102_+	pertussis toxin subunit	NA	A0A0U2KD26	Escherichia_phage	77.1	5.0e-09
AXD43426.1|2719140_2719440_+	pertussis toxin subunit	NA	A0A0U2KD26	Escherichia_phage	55.7	8.5e-14
AXD43427.1|2719366_2719792_+	subtilase cytotoxin subunit B-like protein	NA	NA	NA	NA	NA
AXD43428.1|2720170_2720485_+	hypothetical protein	NA	A0A1S6L009	Salmonella_phage	85.1	6.1e-39
>prophage 13
CP030203	Salmonella enterica strain SA20083530 chromosome, complete genome	5062813	3190920	3195331	5062813		Escherichia_phage(50.0%)	6	NA	NA
AXD43883.1|3190920_3191160_+	virulence protein MsgA	NA	K7P6H1	Enterobacteria_phage	88.6	8.5e-33
AXD45713.1|3192030_3192840_+	cytolethal distending toxin subunit B family protein	NA	A5LH53	Enterobacteria_phage	50.0	2.1e-62
AXD43884.1|3192912_3193290_+	DUF1353 domain-containing protein	NA	I1TQ41	Pseudomonas_phage	38.4	2.2e-14
AXD43885.1|3193437_3193980_-	hypothetical protein	NA	A0A0U2S643	Escherichia_phage	67.0	6.2e-71
AXD43886.1|3194172_3194901_-	pertussis toxin-like subunit ArtA	NA	A0A0U2KD26	Escherichia_phage	52.0	4.6e-61
AXD43887.1|3194917_3195331_-	subtilase cytotoxin subunit B	NA	A0A0U2KD34	Escherichia_phage	38.6	5.5e-19
>prophage 14
CP030203	Salmonella enterica strain SA20083530 chromosome, complete genome	5062813	3349996	3393891	5062813	lysis,tail,transposase,terminase,integrase	Escherichia_phage(35.14%)	60	3389648:3389662	3396129:3396143
AXD44041.1|3349996_3350518_+	PipA/GogA/GtgA family type III secretion system effector	NA	Q9MBM0	Phage_Gifsy-2	72.7	8.6e-62
AXD44042.1|3350902_3351169_+	hypothetical protein	NA	A0A0M3ULK3	Salmonella_phage	87.5	4.4e-38
AXD44043.1|3351241_3352273_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
AXD44044.1|3352368_3352530_-	DUF2767 domain-containing protein	NA	A0A0M4R5C3	Salmonella_phage	94.1	4.0e-10
AXD45721.1|3352638_3353073_-	hypothetical protein	NA	NA	NA	NA	NA
AXD44045.1|3353428_3354022_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	86.9	3.1e-92
AXD44046.1|3354011_3354836_-|tail	phage tail protein	tail	A0A0M4QWS3	Salmonella_phage	94.9	9.8e-153
AXD44047.1|3354832_3356542_-|tail	tail fiber protein	tail	A0A0U2SAV1	Escherichia_phage	65.6	7.6e-91
AXD44048.1|3356538_3357165_-	hypothetical protein	NA	A0A0U2RK03	Escherichia_phage	71.6	3.3e-92
AXD44049.1|3357148_3358375_-	hypothetical protein	NA	A0A0U2RJZ0	Escherichia_phage	63.4	1.1e-147
AXD44050.1|3358371_3358704_-	hypothetical protein	NA	NA	NA	NA	NA
AXD44051.1|3358700_3359417_-	hypothetical protein	NA	NA	NA	NA	NA
AXD44052.1|3359413_3360457_-	hypothetical protein	NA	NA	NA	NA	NA
AXD44053.1|3360456_3360732_-	hypothetical protein	NA	NA	NA	NA	NA
AXD44054.1|3360728_3361445_-	hypothetical protein	NA	A0A0U2JGI7	Escherichia_phage	36.5	7.7e-29
AXD44055.1|3361444_3363487_-	hypothetical protein	NA	I6ZXX9	Escherichia_phage	35.8	1.5e-08
AXD44056.1|3363610_3364198_-	hypothetical protein	NA	NA	NA	NA	NA
AXD44057.1|3364197_3364635_-	hypothetical protein	NA	NA	NA	NA	NA
AXD44058.1|3364638_3366033_-	hypothetical protein	NA	A0A0U2KD19	Escherichia_phage	37.2	2.5e-71
AXD44059.1|3366037_3366976_-	hypothetical protein	NA	A0A0U2SH76	Escherichia_phage	39.9	2.9e-52
AXD45722.1|3366959_3367370_-	hypothetical protein	NA	NA	NA	NA	NA
AXD44060.1|3367387_3367813_-	hypothetical protein	NA	NA	NA	NA	NA
AXD44061.1|3367825_3368311_-	hypothetical protein	NA	NA	NA	NA	NA
AXD44062.1|3368375_3369407_-	DUF2184 domain-containing protein	NA	A0A0U2QQI2	Escherichia_phage	45.5	1.9e-73
AXD44063.1|3369424_3370297_-	hypothetical protein	NA	NA	NA	NA	NA
AXD44064.1|3370317_3371892_-	NUDIX hydrolase	NA	Q6UJ14	Burkholderia_virus	48.6	1.3e-20
AXD44065.1|3371892_3372768_-	hypothetical protein	NA	A0A0U2I1R8	Escherichia_phage	45.8	1.5e-55
AXD44066.1|3372739_3374170_-	hypothetical protein	NA	A0A0U2S5X9	Escherichia_phage	37.7	3.7e-91
AXD44067.1|3374169_3375441_-	hypothetical protein	NA	A0A0U2JTW9	Escherichia_phage	38.3	5.1e-84
AXD44068.1|3375430_3376405_-|terminase	terminase small subunit	terminase	C5IHM0	Burkholderia_virus	37.7	4.3e-30
AXD44069.1|3376500_3376716_-	hypothetical protein	NA	NA	NA	NA	NA
AXD44070.1|3376830_3377334_-	hypothetical protein	NA	NA	NA	NA	NA
AXD45723.1|3377661_3378105_-|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	78.7	4.7e-53
AXD44071.1|3378125_3378614_-	lysozyme	NA	M9P0E5	Enterobacteria_phage	67.5	2.3e-56
AXD45724.1|3378591_3378894_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
AXD44072.1|3379096_3379285_-	hypothetical protein	NA	NA	NA	NA	NA
AXD44073.1|3379715_3380174_-|transposase	IS200/IS605 family transposase IS200F	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.0e-13
AXD44074.1|3380130_3380313_-	hypothetical protein	NA	NA	NA	NA	NA
AXD44075.1|3380388_3380967_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	52.0	2.4e-44
AXD44076.1|3380963_3381257_-	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	65.3	2.1e-33
AXD44077.1|3381253_3381850_-	DUF1367 family protein	NA	H9C173	Pectobacterium_phage	73.7	1.5e-81
AXD44078.1|3381918_3382110_-	hypothetical protein	NA	NA	NA	NA	NA
AXD44079.1|3382293_3382632_-	hypothetical protein	NA	A0A193GYX4	Enterobacter_phage	86.6	3.7e-50
AXD45725.1|3382631_3382802_-	methyltransferase	NA	I6S1S6	Salmonella_phage	87.5	6.3e-06
AXD44080.1|3383393_3383642_-	hypothetical protein	NA	NA	NA	NA	NA
AXD44081.1|3383645_3384326_-	hypothetical protein	NA	NA	NA	NA	NA
AXD44082.1|3384363_3385752_-	replicative DNA helicase	NA	Q76H51	Enterobacteria_phage	47.1	2.6e-105
AXD44083.1|3385748_3386729_-	helix-turn-helix domain-containing protein	NA	H9C164	Pectobacterium_phage	79.6	4.0e-44
AXD44084.1|3386731_3386956_-	hypothetical protein	NA	H9C163	Pectobacterium_phage	44.7	1.0e-08
AXD45726.1|3386978_3387425_-	hypothetical protein	NA	H9C162	Pectobacterium_phage	50.4	5.5e-25
AXD44085.1|3387489_3387693_-	hypothetical protein	NA	K7PHK4	Enterobacteria_phage	46.6	4.0e-07
AXD44086.1|3387771_3388173_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	55.6	2.5e-37
AXD44087.1|3388827_3389151_+	hypothetical protein	NA	NA	NA	NA	NA
AXD44088.1|3389158_3389404_+	hypothetical protein	NA	A0A1B1W282	Salmonella_phage	52.5	7.7e-13
AXD44089.1|3389433_3391707_+	hypothetical protein	NA	H9C157	Pectobacterium_phage	34.5	7.0e-108
3389648:3389662	attL	AATTTGATGAACAAT	NA	NA	NA	NA
AXD44090.1|3391703_3392258_+	hypothetical protein	NA	H9C156	Pectobacterium_phage	59.3	9.8e-48
AXD44091.1|3392260_3392443_+	hypothetical protein	NA	NA	NA	NA	NA
AXD44092.1|3392492_3392690_+	hypothetical protein	NA	H9C154	Pectobacterium_phage	58.5	8.3e-10
AXD44093.1|3392655_3392880_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
AXD44094.1|3392880_3393891_+|integrase	integrase	integrase	A0A192Y7M7	Salmonella_phage	53.3	2.6e-91
3396129:3396143	attR	AATTTGATGAACAAT	NA	NA	NA	NA
>prophage 15
CP030203	Salmonella enterica strain SA20083530 chromosome, complete genome	5062813	3457372	3545574	5062813	lysis,plate,protease,tail,head,transposase,tRNA,holin	Vibrio_phage(20.59%)	71	NA	NA
AXD44148.1|3457372_3458134_-|protease	metalloprotease	protease	NA	NA	NA	NA
AXD44149.1|3458277_3459561_-	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
AXD44150.1|3459631_3460720_-	3-phosphoserine/phosphohydroxythreonine aminotransferase	NA	M1Q1P2	Streptococcus_phage	46.5	2.8e-78
AXD44151.1|3460905_3461598_-	DUF421 domain-containing protein	NA	NA	NA	NA	NA
AXD45727.1|3461734_3463495_+	30S ribosomal protein S12 methylthiotransferase accessory protein YcaO	NA	NA	NA	NA	NA
AXD44152.1|3463898_3464756_+	formate transporter FocA	NA	NA	NA	NA	NA
AXD44153.1|3464815_3467098_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	42.0	1.1e-161
AXD44154.1|3467169_3468129_-	type III secretion system effector SopD2	NA	NA	NA	NA	NA
AXD44155.1|3468677_3469502_+	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.5	2.8e-22
AXD44156.1|3469793_3471215_-	amino acid permease	NA	NA	NA	NA	NA
AXD44157.1|3471432_3472581_-	MFS transporter	NA	NA	NA	NA	NA
AXD44158.1|3472930_3473794_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
AXD44159.1|3473795_3474413_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	4.3e-76
AXD44160.1|3474423_3476868_-	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	50.5	5.4e-223
AXD44161.1|3477104_3478397_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	44.9	7.3e-94
AXD44162.1|3478655_3479999_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.9	1.6e-80
AXD44163.1|3480008_3480620_-	outer membrane lipoprotein carrier protein LolA	NA	NA	NA	NA	NA
AXD45728.1|3480762_3484800_-	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	49.5	2.9e-88
AXD44164.1|3484934_3485429_-	leucine-responsive regulatory protein	NA	NA	NA	NA	NA
AXD44165.1|3485357_3485633_+	hypothetical protein	NA	NA	NA	NA	NA
AXD44166.1|3485975_3486944_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	45.5	6.5e-63
AXD44167.1|3487057_3488824_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	25.1	6.0e-22
AXD44168.1|3488824_3490546_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	23.3	1.9e-12
AXD44169.1|3490590_3491295_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
AXD44170.1|3491295_3491679_+	hypothetical protein	NA	NA	NA	NA	NA
AXD44171.1|3491606_3491825_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
AXD44172.1|3491915_3492827_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AXD44173.1|3492935_3493796_+	pirin family protein	NA	NA	NA	NA	NA
AXD44174.1|3493815_3494493_+	hydrolase	NA	NA	NA	NA	NA
AXD44175.1|3495099_3497376_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.2	2.4e-164
AXD44176.1|3497406_3497727_-|protease	ATP-dependent Clp protease adaptor ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
AXD44177.1|3498050_3498272_+	cold shock domain protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
AXD44178.1|3498401_3500348_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	42.3	9.1e-40
AXD44179.1|3500344_3501454_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	34.5	2.4e-05
AXD44180.1|3501581_3502550_+	DUF535 domain-containing protein	NA	NA	NA	NA	NA
AXD44181.1|3502546_3504205_-	DUF2813 domain-containing protein	NA	NA	NA	NA	NA
AXD44182.1|3504405_3505305_+	lysine exporter LysO family protein	NA	NA	NA	NA	NA
AXD44183.1|3505448_3507101_+	hydroxylamine reductase	NA	NA	NA	NA	NA
AXD44184.1|3507112_3508081_+	NADH oxidoreductase	NA	NA	NA	NA	NA
AXD44185.1|3508238_3509957_+	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.3	2.9e-29
AXD44186.1|3509995_3510997_+	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
AXD44187.1|3511007_3512441_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
AXD44188.1|3512536_3513550_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
AXD44189.1|3513546_3514377_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	30.7	2.3e-08
AXD44190.1|3514373_3514697_-	hypothetical protein	NA	NA	NA	NA	NA
AXD44191.1|3515177_3516209_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
AXD44192.1|3516752_3517058_-	Dabb family protein	NA	NA	NA	NA	NA
AXD44193.1|3518026_3518245_-	recombinase family protein	NA	S4TTF2	Salmonella_phage	88.2	1.6e-25
AXD44194.1|3518458_3519181_+	SPI-1 type III secretion system guanine nucleotide exchange factor SopE	NA	NA	NA	NA	NA
AXD44195.1|3520707_3520941_+	hypothetical protein	NA	A0A192Y6D5	Salmonella_phage	98.7	4.7e-36
AXD45729.1|3521053_3521503_-|tail	tail fiber assembly protein	tail	S4TUB9	Salmonella_phage	87.7	9.6e-70
AXD44196.1|3523754_3524336_-|tail	phage tail protein I	tail	V9IQK7	Stenotrophomonas_phage	34.1	1.0e-18
AXD44197.1|3525446_3525767_-	hypothetical protein	NA	A0A067ZJ13	Vibrio_phage	42.6	1.7e-12
AXD44198.1|3525763_3526231_-	hypothetical protein	NA	NA	NA	NA	NA
AXD44199.1|3526227_3526848_-|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	55.9	1.3e-32
AXD44200.1|3526848_3527850_-	late control D family protein	NA	A0A0C5AJ59	Bacteriophage	36.9	3.0e-55
AXD44201.1|3527839_3528058_-|tail	phage tail protein	tail	A0A0C5AEF4	Bacteriophage	50.0	1.4e-10
AXD44202.1|3530150_3530504_-	hypothetical protein	NA	NA	NA	NA	NA
AXD44203.1|3530656_3530938_-	hypothetical protein	NA	NA	NA	NA	NA
AXD44204.1|3530947_3531469_-|tail	phage tail protein	tail	A0A067ZJA9	Vibrio_phage	53.2	1.2e-47
AXD44205.1|3531481_3532951_-|tail	phage tail sheath family protein	tail	A0A059WKP9	Vibrio_phage	54.7	1.5e-148
AXD44206.1|3532950_3533238_-	hypothetical protein	NA	NA	NA	NA	NA
AXD44207.1|3533244_3533730_-	hypothetical protein	NA	A0A067ZIL8	Vibrio_phage	40.9	6.4e-19
AXD44208.1|3534075_3534531_-	hypothetical protein	NA	NA	NA	NA	NA
AXD44209.1|3535589_3535976_-|head	head decoration protein	head	NA	NA	NA	NA
AXD44210.1|3535986_3537051_-|protease	Clp protease ClpP	protease	A0A067ZG37	Vibrio_phage	51.4	2.6e-81
AXD44211.1|3541228_3541819_-	nuclease	NA	A0A067ZI74	Vibrio_phage	53.7	6.4e-37
AXD45730.1|3542366_3543086_-	hypothetical protein	NA	NA	NA	NA	NA
AXD44212.1|3544190_3544670_-|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	72.8	1.5e-49
AXD44213.1|3544666_3545293_-	glycoside hydrolase family 19 protein	NA	Q858F0	Salmonella_phage	80.7	4.6e-94
AXD44214.1|3545292_3545574_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	80.6	2.6e-36
>prophage 16
CP030203	Salmonella enterica strain SA20083530 chromosome, complete genome	5062813	3549798	3563027	5062813		Escherichia_phage(28.57%)	22	NA	NA
AXD44221.1|3549798_3550614_-	antitermination protein	NA	A0A1B5FPA5	Escherichia_phage	72.0	6.4e-112
AXD44222.1|3550610_3550946_-	hypothetical protein	NA	NA	NA	NA	NA
AXD44223.1|3552921_3553854_-	hypothetical protein	NA	C5IHL2	Burkholderia_virus	36.9	2.9e-36
AXD44224.1|3553850_3554048_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
AXD44225.1|3554049_3554292_-	Cro/Cl family transcriptional regulator	NA	H6WRX5	Salmonella_phage	45.2	1.1e-14
AXD44226.1|3554375_3554834_+	hypothetical protein	NA	K7PHG0	Enterobacteria_phage	30.9	1.1e-09
AXD44227.1|3554965_3555382_+	helix-turn-helix domain-containing protein	NA	Q8W649	Enterobacteria_phage	47.7	3.0e-09
AXD44228.1|3555378_3555570_+	hypothetical protein	NA	NA	NA	NA	NA
AXD44229.1|3555642_3555837_+	hypothetical protein	NA	NA	NA	NA	NA
AXD44230.1|3555833_3556019_+	hypothetical protein	NA	NA	NA	NA	NA
AXD44231.1|3556206_3556416_+	hypothetical protein	NA	NA	NA	NA	NA
AXD44232.1|3556339_3556756_+	hypothetical protein	NA	A0A1B5FPB3	Escherichia_phage	54.8	3.2e-27
AXD44233.1|3556755_3556992_+	hypothetical protein	NA	A0A286SGR4	Klebsiella_phage	75.3	5.8e-26
AXD44234.1|3556981_3557377_+	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	74.6	4.4e-50
AXD44235.1|3557608_3558406_+	ORF6N domain-containing protein	NA	F1C5A3	Cronobacter_phage	67.3	1.7e-48
AXD44236.1|3558968_3559193_+	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	69.4	1.7e-19
AXD44237.1|3559189_3559498_+	hypothetical protein	NA	A0A1B5FPC7	Escherichia_phage	80.8	2.1e-15
AXD44238.1|3559497_3559713_+	hypothetical protein	NA	NA	NA	NA	NA
AXD44239.1|3559865_3560108_+	excisionase	NA	A0A286S2A4	Klebsiella_phage	67.1	2.4e-22
AXD44240.1|3560133_3561465_+	DUF3596 domain-containing protein	NA	Q20GI2	Phage_258-320	63.8	1.3e-165
AXD44241.1|3561554_3562070_+	lipoprotein	NA	NA	NA	NA	NA
AXD44242.1|3562298_3563027_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	35.8	3.9e-28
>prophage 17
CP030203	Salmonella enterica strain SA20083530 chromosome, complete genome	5062813	4833165	4865531	5062813	lysis,tail,head,tRNA,terminase,holin,integrase	Aeromonas_phage(25.0%)	39	4832960:4832974	4850106:4850120
4832960:4832974	attL	CATCAGAAAAAAGCC	NA	NA	NA	NA
AXD45358.1|4833165_4834203_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
AXD45359.1|4834293_4835391_+|integrase	site-specific integrase	integrase	A0A1W6JP34	Morganella_phage	70.8	1.2e-150
AXD45360.1|4835679_4835922_+	hypothetical protein	NA	NA	NA	NA	NA
AXD45361.1|4836461_4837163_-|tail	phage tail protein	tail	S5MBX6	Escherichia_phage	53.7	4.1e-67
AXD45784.1|4837174_4838035_-	hypothetical protein	NA	Q6K1H2	Salmonella_virus	55.0	2.2e-54
AXD45362.1|4838927_4839530_-	DUF2612 domain-containing protein	NA	H9C0Y0	Aeromonas_phage	42.2	3.8e-29
AXD45363.1|4839531_4840773_-	hypothetical protein	NA	A0A077KGW9	Edwardsiella_phage	49.4	7.2e-99
AXD45364.1|4840769_4841126_-	hypothetical protein	NA	A0A077KCA1	Edwardsiella_phage	47.2	6.1e-19
AXD45365.1|4841139_4841352_-	hypothetical protein	NA	NA	NA	NA	NA
AXD45366.1|4841440_4841824_-	hypothetical protein	NA	NA	NA	NA	NA
AXD45367.1|4841871_4842426_-	hypothetical protein	NA	NA	NA	NA	NA
AXD45368.1|4842494_4843172_-	oxidoreductase	NA	A0A077KAY0	Edwardsiella_phage	35.5	1.7e-30
AXD45369.1|4843152_4844022_-	hypothetical protein	NA	NA	NA	NA	NA
AXD45370.1|4844018_4844321_-	hypothetical protein	NA	A0A077K9U4	Edwardsiella_phage	49.5	4.1e-24
AXD45371.1|4844320_4845031_-	hypothetical protein	NA	A0A077KGW3	Edwardsiella_phage	35.8	1.7e-28
AXD45372.1|4847104_4847287_-	transcription elongation factor GreA	NA	NA	NA	NA	NA
AXD45373.1|4847328_4847733_-	hypothetical protein	NA	H9C0W7	Aeromonas_phage	47.2	2.8e-20
AXD45374.1|4847732_4848179_-	hypothetical protein	NA	Q2NPD1	Xanthomonas_phage	40.4	4.8e-21
AXD45375.1|4848179_4849664_-	hypothetical protein	NA	A0A1X9SFB3	Acinetobacter_phage	29.1	1.9e-50
AXD45376.1|4849644_4850190_-	hypothetical protein	NA	NA	NA	NA	NA
4850106:4850120	attR	CATCAGAAAAAAGCC	NA	NA	NA	NA
AXD45377.1|4850174_4850540_-	hypothetical protein	NA	A0A077KAW7	Edwardsiella_phage	40.5	3.0e-21
AXD45378.1|4850536_4851004_-	hypothetical protein	NA	H9C0W2	Aeromonas_phage	35.2	1.3e-16
AXD45379.1|4850997_4851453_-	DUF4054 domain-containing protein	NA	A0A068CGG9	Acinetobacter_phage	43.5	6.6e-18
AXD45380.1|4851458_4851806_-	hypothetical protein	NA	H9C0V9	Aeromonas_phage	41.2	3.0e-10
AXD45381.1|4851809_4852838_-	DUF2184 domain-containing protein	NA	Q8HAP7	Burkholderia_phage	49.8	1.8e-79
AXD45382.1|4852837_4853320_-	hypothetical protein	NA	A0A1X9SFC3	Acinetobacter_phage	48.8	1.4e-26
AXD45383.1|4853321_4854668_-	hypothetical protein	NA	A0A219YCD3	Aeromonas_phage	36.5	3.2e-68
AXD45384.1|4854664_4855354_-|head	phage head morphogenesis protein	head	H9C0V1	Aeromonas_phage	49.6	5.8e-58
AXD45385.1|4855394_4856915_-	DUF1073 domain-containing protein	NA	A0A2R3UAL5	Myoviridae_environmental_samples	44.3	1.2e-106
AXD45386.1|4856914_4858534_-	TerL protein	NA	A0A0M5M1R6	Salmonella_phage	78.2	2.4e-256
AXD45387.1|4858536_4859109_-|terminase	terminase small subunit	terminase	A0A2H4J480	uncultured_Caudovirales_phage	63.7	3.5e-56
AXD45388.1|4859129_4859603_-|lysis	lysis protein	lysis	Q8HA85	Salmonella_phage	89.0	1.4e-63
AXD45389.1|4859900_4860350_-	lysozyme	NA	A0A0M4R365	Salmonella_phage	73.8	9.4e-57
AXD45390.1|4860402_4860603_+	hypothetical protein	NA	NA	NA	NA	NA
AXD45391.1|4860619_4860973_-|holin	phage holin, lambda family	holin	NA	NA	NA	NA
AXD45392.1|4861578_4862013_-	antitermination protein Q	NA	B6SD39	Bacteriophage	59.6	9.1e-41
AXD45393.1|4862295_4864566_-	ATPase	NA	B6SCU2	Bacteriophage	57.9	1.1e-251
AXD45394.1|4864569_4864791_-	transcriptional regulator	NA	NA	NA	NA	NA
AXD45395.1|4864901_4865531_+	DNA-binding protein	NA	A0A1I9KG86	Aeromonas_phage	41.5	6.3e-35
>prophage 18
CP030203	Salmonella enterica strain SA20083530 chromosome, complete genome	5062813	4869820	4882269	5062813		Escherichia_phage(30.0%)	16	NA	NA
AXD45401.1|4869820_4870459_+	hypothetical protein	NA	H6WRY3	Salmonella_phage	83.3	1.6e-89
AXD45402.1|4870448_4870670_+	hypothetical protein	NA	NA	NA	NA	NA
AXD45403.1|4870797_4871409_-	hypothetical protein	NA	NA	NA	NA	NA
AXD45404.1|4872162_4872936_+	phage antirepressor Ant	NA	A0A0N6WET9	Escherichia_phage	77.2	1.2e-43
AXD45785.1|4873088_4875980_+	hypothetical protein	NA	B6SCX5	Bacteriophage	62.8	0.0e+00
AXD45405.1|4876051_4876132_-	small toxic protein shoB	NA	NA	NA	NA	NA
AXD45406.1|4876825_4877587_+	phage antirepressor Ant	NA	A0A0N6WET9	Escherichia_phage	71.4	3.4e-43
AXD45407.1|4877636_4877855_+	hypothetical protein	NA	NA	NA	NA	NA
AXD45408.1|4877851_4878121_+	VRR-NUC domain-containing protein	NA	B6SD64	Bacteriophage	67.4	1.2e-27
AXD45409.1|4878117_4878348_+	hypothetical protein	NA	A0A2H4JCC5	uncultured_Caudovirales_phage	40.0	2.7e-07
AXD45410.1|4878344_4878962_+	hypothetical protein	NA	A0A2H4JIA5	uncultured_Caudovirales_phage	30.6	2.2e-08
AXD45411.1|4878964_4880359_+	ATP-dependent helicase	NA	Q3LZN8	Bacteriophage	74.8	1.5e-214
AXD45412.1|4880360_4880516_+	DNA-binding protein	NA	NA	NA	NA	NA
AXD45786.1|4880507_4880840_-	hypothetical protein	NA	NA	NA	NA	NA
AXD45413.1|4881242_4881962_+	DNA-binding protein	NA	A0A222YXY0	Escherichia_phage	40.4	6.8e-33
AXD45787.1|4882017_4882269_+	pyocin activator protein PrtN	NA	K7PGU0	Enterobacteria_phage	56.4	3.3e-19
>prophage 19
CP030203	Salmonella enterica strain SA20083530 chromosome, complete genome	5062813	4981488	5038314	5062813	lysis,plate,tail,capsid,tRNA,terminase,holin,portal	Enterobacteria_phage(72.0%)	52	NA	NA
AXD45487.1|4981488_4982589_+|tRNA	tRNA (uridine(54)-C5)-methyltransferase TrmA	tRNA	NA	NA	NA	NA
AXD45488.1|4982635_4982995_-	YijD family membrane protein	NA	NA	NA	NA	NA
AXD45489.1|4983010_4983646_-	HTH-type transcriptional repressor FabR	NA	NA	NA	NA	NA
AXD45490.1|4983647_4983836_+	hypothetical protein	NA	NA	NA	NA	NA
AXD45491.1|4983844_4985245_+	Si-specific NAD(P)(+) transhydrogenase	NA	NA	NA	NA	NA
AXD45492.1|4985227_4986145_-	DNA-binding transcriptional regulator OxyR	NA	NA	NA	NA	NA
AXD45493.1|4986428_4987805_-	argininosuccinate lyase	NA	NA	NA	NA	NA
AXD45494.1|4987922_4988699_-	acetylglutamate kinase	NA	NA	NA	NA	NA
AXD45495.1|4988706_4989711_-	N-acetyl-gamma-glutamyl-phosphate reductase	NA	NA	NA	NA	NA
AXD45496.1|4989799_4990951_+	acetylornithine deacetylase	NA	NA	NA	NA	NA
AXD45793.1|4991342_4993994_+	phosphoenolpyruvate carboxylase	NA	NA	NA	NA	NA
AXD45497.1|4994204_4995938_+	phosphoethanolamine transferase CptA	NA	NA	NA	NA	NA
AXD45498.1|4996098_4996935_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AXD45499.1|4997189_4997852_+	fructose-6-phosphate aldolase	NA	A0A0E3F0E2	Synechococcus_phage	34.1	2.5e-29
AXD45500.1|4997863_4998967_+	glycerol dehydrogenase	NA	NA	NA	NA	NA
AXD45501.1|4999073_5001254_-	catalase/peroxidase HPI	NA	NA	NA	NA	NA
AXD45502.1|5001418_5002309_-	5,10-methylenetetrahydrofolate reductase	NA	NA	NA	NA	NA
AXD45503.1|5002503_5004060_-	bifunctional metallophosphatase/5'-nucleotidase	NA	NA	NA	NA	NA
AXD45504.1|5004195_5005320_+	cytoplasmic protein	NA	NA	NA	NA	NA
AXD45505.1|5005554_5006553_+	hypothetical protein	NA	NA	NA	NA	NA
AXD45506.1|5006555_5007413_+	mechanosensitive ion channel protein MscS	NA	NA	NA	NA	NA
AXD45507.1|5007538_5009971_-	bifunctional aspartate kinase/homoserine dehydrogenase II	NA	NA	NA	NA	NA
AXD45508.1|5009973_5011134_-	cystathionine gamma-synthase	NA	NA	NA	NA	NA
AXD45509.1|5011398_5011716_+	met repressor	NA	NA	NA	NA	NA
AXD45510.1|5012172_5013963_+	aryl-sulfate sulfotransferase	NA	NA	NA	NA	NA
AXD45511.1|5014163_5014826_+	TIGR02117 family protein	NA	NA	NA	NA	NA
AXD45512.1|5015066_5015207_-	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	71.7	3.1e-11
AXD45513.1|5015419_5015701_-	hypothetical protein	NA	NA	NA	NA	NA
AXD45514.1|5015748_5016876_-	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	77.2	2.8e-158
AXD45515.1|5017034_5018222_+|tail	phage tail protein	tail	A0A0A7NV69	Enterobacteria_phage	82.7	8.8e-187
AXD45516.1|5018222_5018735_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	67.5	1.3e-62
AXD45517.1|5019150_5019309_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	77.6	5.3e-15
AXD45518.1|5019295_5022256_+|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	51.7	1.3e-255
AXD45519.1|5022269_5022758_+	oxidoreductase	NA	A0A0A7NV65	Enterobacteria_phage	79.5	1.1e-71
AXD45520.1|5022777_5023152_-|tail	phage tail protein	tail	I1TQ41	Pseudomonas_phage	40.0	4.3e-15
AXD45521.1|5023294_5024386_-	hypothetical protein	NA	H6WZJ9	Escherichia_phage	71.1	3.5e-142
AXD45522.1|5024440_5025139_-|tail	phage tail protein	tail	S5MBX6	Escherichia_phage	53.8	1.6e-66
AXD45523.1|5025150_5027064_-|tail	phage tail protein	tail	Q6K1H2	Salmonella_virus	60.2	3.5e-193
AXD45524.1|5027047_5027602_-|tail	phage tail protein I	tail	A0A0M4R4W9	Salmonella_phage	70.3	3.5e-69
AXD45525.1|5028476_5028845_-|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	65.2	1.0e-37
AXD45526.1|5028841_5029423_-|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	68.1	1.6e-69
AXD45527.1|5029419_5030055_-	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	58.4	6.1e-62
AXD45528.1|5030051_5030528_-|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	51.6	3.8e-40
AXD45529.1|5030514_5031024_-|lysis	lysis protein	lysis	Q8HA85	Salmonella_phage	75.4	4.2e-53
AXD45530.1|5031026_5031440_-	structural protein	NA	A0A0E3GMJ2	Enterobacteria_phage	57.9	3.9e-41
AXD45531.1|5031443_5031773_-|holin	phage holin, lambda family	holin	NA	NA	NA	NA
AXD45532.1|5031799_5032000_-|tail	phage tail protein	tail	A0A0A7NV57	Enterobacteria_phage	77.3	4.3e-22
AXD45533.1|5031999_5032494_-|capsid	capsid assembly protein	capsid	A0A0A7NPU2	Enterobacteria_phage	60.1	5.8e-52
AXD45534.1|5032593_5033382_-|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	77.1	1.2e-94
AXD45535.1|5033428_5034514_-|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	67.7	1.8e-133
AXD45536.1|5034537_5035374_-|capsid	phage capsid protein	capsid	A0A0A7NRY7	Enterobacteria_phage	64.7	3.7e-99
AXD45537.1|5037264_5038314_+|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	73.1	9.6e-153
>prophage 1
CP030204	Salmonella enterica strain SA20083530 plasmid pSA20083530.1, complete sequence	138648	6435	69295	138648	integrase,transposase	Enterobacteria_phage(20.0%)	56	4094:4108	28341:28355
4094:4108	attL	GGACATTGCTGTCCA	NA	NA	NA	NA
AXD45796.1|6435_6894_+|transposase	IS200/IS605-like element IS200F family transposase	transposase	D9CGB6	Hyperthermophilic_Archaeal_Virus_2	35.3	5.9e-14
AXD45797.1|7218_7422_-	hypothetical protein	NA	NA	NA	NA	NA
AXD45798.1|8407_8935_-	hypothetical protein	NA	H6WZM8	Escherichia_phage	31.0	5.5e-16
AXD45799.1|8953_9142_-	hypothetical protein	NA	NA	NA	NA	NA
AXD45800.1|9878_10784_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AXD45911.1|10881_11097_-	hypothetical protein	NA	NA	NA	NA	NA
AXD45801.1|11388_12216_-	hypothetical protein	NA	NA	NA	NA	NA
AXD45802.1|12279_17730_-	hypothetical protein	NA	NA	NA	NA	NA
AXD45803.1|18097_18322_+|transposase	transposase	transposase	NA	NA	NA	NA
AXD45804.1|20390_20858_-	DNA-binding protein	NA	NA	NA	NA	NA
AXD45805.1|21881_22526_-	hypothetical protein	NA	NA	NA	NA	NA
AXD45806.1|22522_22783_-	hypothetical protein	NA	NA	NA	NA	NA
AXD45807.1|23495_23714_+	plasmid maintenance protein CcdA	NA	NA	NA	NA	NA
AXD45808.1|23715_24021_+	plasmid maintenance protein CcdB	NA	NA	NA	NA	NA
AXD45809.1|24022_24349_+	cytoplasmic protein	NA	NA	NA	NA	NA
AXD45810.1|24338_25130_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	93.0	2.0e-54
AXD45811.1|25363_26227_-	protein RepA	NA	J9Q7H0	Salmonella_phage	46.3	1.6e-65
AXD45812.1|26754_27396_+	ParA family protein	NA	NA	NA	NA	NA
AXD45912.1|27464_27803_+	molecular chaperone GroEL	NA	NA	NA	NA	NA
AXD45813.1|29478_30045_+	hypothetical protein	NA	NA	NA	NA	NA
28341:28355	attR	TGGACAGCAATGTCC	NA	NA	NA	NA
AXD45814.1|31039_31306_-	glutamate decarboxylase	NA	NA	NA	NA	NA
AXD45815.1|31201_31895_+|transposase	IS1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	87.4	3.2e-120
AXD45816.1|32435_33530_+	quinol oxidase	NA	NA	NA	NA	NA
AXD45817.1|33765_34095_+	nucleoside transporter	NA	NA	NA	NA	NA
AXD45913.1|34358_35084_+	hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	93.9	2.8e-58
AXD45818.1|37708_37924_+	hypothetical protein	NA	NA	NA	NA	NA
AXD45819.1|37916_38369_+	hypothetical protein	NA	NA	NA	NA	NA
AXD45820.1|38365_39157_+	hypothetical protein	NA	NA	NA	NA	NA
AXD45821.1|40495_41434_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	54.0	1.1e-75
AXD45822.1|41559_41799_-	hypothetical protein	NA	NA	NA	NA	NA
AXD45823.1|41959_42634_-	hypothetical protein	NA	NA	NA	NA	NA
AXD45824.1|42633_43161_-	CaiF/GrlA family transcriptional regulator	NA	NA	NA	NA	NA
AXD45825.1|43321_43810_-	CaiF/GrlA family transcriptional regulator	NA	NA	NA	NA	NA
AXD45826.1|43867_44314_-	hypothetical protein	NA	NA	NA	NA	NA
AXD45827.1|44814_45396_+	fimbrial protein	NA	NA	NA	NA	NA
AXD45828.1|45433_47908_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
AXD45829.1|47920_48652_+	fimbrial assembly protein	NA	NA	NA	NA	NA
AXD45830.1|48815_49769_+	fimbrial protein	NA	NA	NA	NA	NA
AXD45831.1|52477_53683_+	ParA family protein	NA	Q1MVJ3	Enterobacteria_phage	90.2	8.6e-206
AXD45832.1|53679_54651_+	chromosome partitioning protein ParB	NA	Q1MVJ4	Enterobacteria_phage	67.0	5.8e-112
AXD45833.1|56062_56485_-	peptidase	NA	A0A1W6JNS2	Morganella_phage	49.2	9.5e-27
AXD45914.1|56709_56913_-	hypothetical protein	NA	NA	NA	NA	NA
AXD45834.1|57768_58182_+	hypothetical protein	NA	NA	NA	NA	NA
AXD45835.1|58257_59031_+	hypothetical protein	NA	NA	NA	NA	NA
AXD45836.1|59497_59932_+	antirestriction protein	NA	NA	NA	NA	NA
AXD45837.1|61367_61925_+	single-stranded DNA-binding protein	NA	A0A0A0P1Q9	Enterobacteria_phage	74.8	7.3e-51
AXD45915.1|61977_62220_+	DUF905 domain-containing protein	NA	NA	NA	NA	NA
AXD45838.1|62290_64315_+	chromosome partitioning protein ParB	NA	NA	NA	NA	NA
AXD45839.1|64355_64790_+	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
AXD45840.1|64786_65527_+	hypothetical protein	NA	NA	NA	NA	NA
AXD45841.1|65523_65841_+	theronine dehydrogenase	NA	I3UM57	Rhodobacter_phage	34.5	7.9e-10
AXD45842.1|66316_66817_+	antirestriction protein ArdA	NA	G9FHQ1	Rhodococcus_virus	27.5	1.1e-05
AXD45843.1|67301_67496_-	hypothetical protein	NA	NA	NA	NA	NA
AXD45844.1|67479_67914_+	post-segregation killing protein PndC	NA	A0A1B0XUG6	Freshwater_phage	30.6	1.1e-06
AXD45845.1|68007_68274_+	hypothetical protein	NA	NA	NA	NA	NA
AXD45846.1|68338_69295_+|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	53.4	7.8e-69
