The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP030185	Salmonella enterica strain SA20094620 chromosome, complete genome	4854398	1437554	1478916	4854398	holin,protease,terminase,portal,tail,coat,lysis	Salmonella_phage(55.93%)	63	NA	NA
AXD18413.1|1437554_1438493_+|protease	omptin family outer membrane protease PgtE	protease	NA	NA	NA	NA
AXD18414.1|1438514_1438745_-	hypothetical protein	NA	C6ZR23	Salmonella_phage	74.0	6.8e-11
AXD18415.1|1438754_1438958_-	hypothetical protein	NA	C6ZR24	Salmonella_phage	95.5	1.0e-31
AXD18416.1|1439263_1439596_-	ASCH domain-containing protein	NA	Q9XJG9	Enterobacteria_phage	93.5	2.1e-53
AXD18417.1|1440562_1441111_-	hypothetical protein	NA	H6WRY2	Salmonella_phage	42.3	4.5e-37
AXD18418.1|1441114_1441333_-	DUF4014 domain-containing protein	NA	B9UDM3	Salmonella_phage	100.0	2.4e-34
AXD18419.1|1441334_1441991_-	ead/Ea22-like family protein	NA	C6ZR30	Salmonella_phage	85.2	2.3e-43
AXD18420.1|1441987_1442398_-	hypothetical protein	NA	A0A1R3Y5S0	Salmonella_virus	95.6	1.5e-69
AXD18421.1|1442394_1442565_-	DUF2737 family protein	NA	E7C9P7	Salmonella_phage	92.9	3.7e-22
AXD18422.1|1442575_1442869_-	DUF2856 family protein	NA	E7C9P8	Salmonella_phage	99.0	3.6e-49
AXD18423.1|1442892_1443276_-	hypothetical protein	NA	I6S1T0	Salmonella_phage	100.0	8.5e-67
AXD18424.1|1443275_1443893_-	recombinase	NA	I6RSN3	Salmonella_phage	100.0	1.4e-108
AXD18425.1|1444022_1444211_-	protein kil	NA	A0A1R3Y5S5	Salmonella_virus	98.4	4.8e-31
AXD18426.1|1444191_1444365_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q76H38	Enterobacteria_phage	100.0	2.6e-23
AXD18427.1|1444580_1445270_-	pentapeptide repeat-containing protein	NA	Q8HAH0	Salmonella_phage	77.3	2.5e-45
AXD18428.1|1445353_1445548_-	restriction endonuclease	NA	E7C9Q6	Salmonella_phage	96.9	4.6e-29
AXD18429.1|1445580_1445982_-	antitermination protein	NA	J3JZZ6	Escherichia_phage	62.0	3.3e-29
AXD18430.1|1446472_1447105_-	helix-turn-helix domain-containing protein	NA	A0A1I9KG86	Aeromonas_phage	37.4	2.1e-30
AXD18431.1|1447205_1447421_+	XRE family transcriptional regulator	NA	Q716D6	Shigella_phage	69.0	2.0e-20
AXD18432.1|1447542_1447821_+	hypothetical protein	NA	A5VW96	Enterobacteria_phage	80.2	2.6e-33
AXD18433.1|1447859_1448003_+	hypothetical protein	NA	A0A075B8K7	Enterobacteria_phage	95.7	2.5e-16
AXD18434.1|1447995_1448829_+	DNA replication protein	NA	A0A1R3Y5R9	Salmonella_virus	98.9	4.6e-150
AXD18435.1|1448825_1450202_+	replicative DNA helicase	NA	A0A192Y673	Salmonella_phage	99.8	4.3e-254
AXD18436.1|1450274_1450481_+	hypothetical protein	NA	A0A192Y802	Salmonella_phage	94.1	4.5e-30
AXD18437.1|1450659_1450980_+	hypothetical protein	NA	I6R992	Salmonella_phage	58.5	1.1e-22
AXD21697.1|1450934_1451207_+	restriction alleviation protein, Lar family	NA	NA	NA	NA	NA
AXD18438.1|1451163_1451610_+	recombination protein NinB	NA	I6R0N7	Salmonella_phage	96.6	6.6e-79
AXD18439.1|1451606_1451780_+	protein ninD	NA	C6ZR56	Salmonella_phage	100.0	5.2e-32
AXD18440.1|1451746_1451923_+	NinE family protein	NA	I6RSI9	Salmonella_phage	94.8	4.8e-25
AXD18441.1|1451919_1452096_+	NinF family protein	NA	A0A0M4S6T3	Salmonella_phage	98.3	7.9e-28
AXD18442.1|1452058_1452355_+	hypothetical protein	NA	A0A0M3ULJ7	Salmonella_phage	100.0	2.0e-47
AXD18443.1|1452351_1452849_+	hypothetical protein	NA	A0A1U9HWQ1	Salmonella_phage	47.7	5.7e-31
AXD18444.1|1452841_1453237_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A220NQY4	Salmonella_phage	93.1	6.7e-67
AXD18445.1|1453233_1453890_+	HNH endonuclease	NA	A0A2I7QND8	Vibrio_phage	45.4	3.4e-39
AXD18446.1|1453886_1454111_+	protein ninY	NA	I6R0N9	Salmonella_phage	97.3	2.0e-36
AXD18447.1|1454107_1454311_+	protein ninH	NA	I6RSQ6	Salmonella_phage	100.0	7.2e-33
AXD18448.1|1454291_1454471_+	hypothetical protein	NA	A0A0M4QWY9	Salmonella_phage	94.9	5.1e-22
AXD18449.1|1454467_1455241_+	antitermination protein	NA	Q76H66	Enterobacteria_phage	99.2	2.6e-131
AXD18450.1|1455665_1455992_+|holin	phage holin, lambda family	holin	Q5G8R5	Enterobacteria_phage	95.4	3.1e-49
AXD18451.1|1455975_1456452_+	lysozyme	NA	K7PKV2	Enterobacteria_phage	99.4	8.3e-88
AXD18452.1|1456448_1456886_+|lysis	lysis protein	lysis	K7P710	Enterobacteria_phage	97.9	5.0e-71
AXD18453.1|1457091_1457580_+	GIY-YIG nuclease family protein	NA	K7P7S3	Enterobacteria_phage	98.8	2.7e-86
AXD18454.1|1458070_1458313_+	DUF2560 family protein	NA	A5VW77	Enterobacteria_phage	100.0	1.3e-36
AXD21698.1|1458348_1458837_+	DNA-packaging protein	NA	A0A0M3ULC0	Salmonella_phage	99.4	5.0e-88
AXD18455.1|1458814_1460317_+|terminase	terminase	terminase	G5DA96	Enterobacteria_phage	99.4	3.5e-305
AXD18456.1|1460326_1460860_-	HNH endonuclease	NA	A0A0M4R2Z1	Salmonella_phage	69.8	2.9e-65
AXD18457.1|1460877_1463046_+|portal	portal protein	portal	A0A2D1GLJ6	Escherichia_phage	98.5	0.0e+00
AXD18458.1|1463059_1463971_+	scaffolding protein	NA	A0A2D1GLN7	Escherichia_phage	99.7	2.8e-161
AXD18459.1|1463970_1465266_+|coat	coat protein	coat	A0A2D1GLV2	Escherichia_phage	98.8	1.0e-241
AXD18460.1|1465310_1465547_+	hypothetical protein	NA	A0A2D1GLK1	Escherichia_phage	78.4	1.1e-24
AXD18461.1|1465524_1466025_+	recombinase RmuC	NA	G8EYJ2	Enterobacteria_phage	98.2	5.5e-90
AXD18462.1|1466025_1467444_+	hypothetical protein	NA	A0A075B8I2	Enterobacteria_phage	96.6	9.0e-271
AXD18463.1|1467447_1468149_+|tail	phage tail protein	tail	Q76H17	Enterobacteria_phage	100.0	1.7e-76
AXD18464.1|1468148_1468604_+	DUF2824 family protein	NA	Q76H16	Enterobacteria_phage	98.7	2.8e-85
AXD18465.1|1468606_1469296_+	DNA transfer protein	NA	B9UDK9	Salmonella_phage	92.1	2.5e-93
AXD21699.1|1469338_1470676_+	DNA transfer protein	NA	I1TEJ5	Salmonella_phage	98.7	5.3e-241
AXD18466.1|1470672_1472493_+	DNA transfer protein	NA	A0A2H4FNB8	Salmonella_phage	93.2	7.0e-276
AXD21700.1|1472510_1472840_-	hypothetical protein	NA	NA	NA	NA	NA
AXD18467.1|1473079_1474846_+	hypothetical protein	NA	I6S5Y0	Salmonella_phage	86.7	1.5e-57
AXD18468.1|1474881_1476336_-	hypothetical protein	NA	NA	NA	NA	NA
AXD18469.1|1476325_1477252_-	glycosyltransferase	NA	I1TED8	Salmonella_phage	91.8	7.1e-160
AXD21701.1|1477248_1477611_-	GtrA family protein	NA	I1TED9	Salmonella_phage	83.3	1.6e-51
AXD18470.1|1477746_1478916_-	DUF4102 domain-containing protein	NA	I6R0M2	Salmonella_phage	99.2	5.9e-228
>prophage 2
CP030185	Salmonella enterica strain SA20094620 chromosome, complete genome	4854398	1701033	1771616	4854398	holin,tRNA,integrase,portal,terminase,tail,head,capsid	Cronobacter_phage(53.85%)	76	1741482:1741502	1770085:1770105
AXD18680.1|1701033_1701972_+|tRNA	tRNA dihydrouridine(16) synthase DusC	tRNA	NA	NA	NA	NA
AXD18681.1|1702029_1702113_-	hypothetical protein	NA	NA	NA	NA	NA
AXD18682.1|1702430_1703867_+	multidrug resistance outer membrane protein MdtQ	NA	NA	NA	NA	NA
AXD18683.1|1703932_1704694_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
AXD18684.1|1704742_1705339_-	DedA family protein	NA	NA	NA	NA	NA
AXD18685.1|1705470_1706058_+	YIP1 family protein	NA	NA	NA	NA	NA
AXD18686.1|1706057_1706333_+	hypothetical protein	NA	NA	NA	NA	NA
AXD18687.1|1706223_1707171_+	D-alanyl-D-alanine endopeptidase	NA	NA	NA	NA	NA
AXD18688.1|1707228_1708959_-	D-lactate dehydrogenase	NA	NA	NA	NA	NA
AXD18689.1|1709225_1711523_+	beta-glucosidase BglX	NA	NA	NA	NA	NA
AXD18690.1|1711703_1712621_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AXD18691.1|1712624_1713794_+	ABC transporter permease	NA	NA	NA	NA	NA
AXD18692.1|1713786_1714734_+	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.8	3.7e-10
AXD18693.1|1714717_1715449_+	ABC transporter permease	NA	NA	NA	NA	NA
AXD18694.1|1715429_1715537_-	hypothetical protein	NA	NA	NA	NA	NA
AXD18695.1|1715596_1716328_-	transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
AXD21709.1|1716550_1718236_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.3	4.8e-279
AXD18696.1|1718232_1718952_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AXD18697.1|1718998_1719466_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
AXD18698.1|1719522_1720053_-	DUF1307 domain-containing protein	NA	NA	NA	NA	NA
AXD18699.1|1720224_1720683_-	DUF1307 domain-containing protein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
AXD18700.1|1720923_1722957_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
AXD18701.1|1723121_1724231_+	ATP-binding protein	NA	NA	NA	NA	NA
AXD18702.1|1724508_1724790_+	DUF2574 family protein	NA	NA	NA	NA	NA
AXD18703.1|1725068_1725599_+	fimbrial chaperone protein	NA	NA	NA	NA	NA
AXD18704.1|1725585_1726338_+	fimbrial assembly protein	NA	NA	NA	NA	NA
AXD18705.1|1726351_1728841_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
AXD18706.1|1728856_1729864_+	putative fimbrial-like adhesin protein	NA	NA	NA	NA	NA
AXD18707.1|1730126_1730441_-	heavy metal resistance protein	NA	NA	NA	NA	NA
AXD18708.1|1730850_1731648_+	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
AXD18709.1|1731634_1732435_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
AXD18710.1|1732470_1733217_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AXD18711.1|1733190_1734156_-	sugar kinase	NA	NA	NA	NA	NA
AXD18712.1|1734152_1735157_-	ADP-ribosylglycohydrolase family protein	NA	A0A172WZB4	Catopsilia_pomona_nucleopolyhedrovirus	22.1	8.4e-05
AXD18713.1|1735153_1736425_-	MFS transporter	NA	NA	NA	NA	NA
AXD18714.1|1736678_1737731_+	class I fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
AXD18715.1|1737783_1738683_-	lipid kinase YegS	NA	NA	NA	NA	NA
AXD18716.1|1739244_1739580_+	hypothetical protein	NA	NA	NA	NA	NA
AXD18717.1|1739701_1740118_+	CesT family type III secretion system chaperone	NA	NA	NA	NA	NA
AXD18718.1|1740153_1741200_-	type III secretion system effector arginine glycosyltransferase	NA	Q8HAB2	Salmonella_phage	76.4	2.4e-148
AXD18719.1|1741425_1741692_+	hypothetical protein	NA	NA	NA	NA	NA
1741482:1741502	attL	AAAAATAAGCCTGCGTAAGGG	NA	NA	NA	NA
AXD18720.1|1741586_1742600_-|integrase	site-specific integrase	integrase	Q83VS6	Escherichia_phage	90.1	4.9e-178
AXD18721.1|1742715_1743015_-	XRE family transcriptional regulator	NA	Q1JS63	Enterobacteria_phage	85.9	3.0e-43
AXD18722.1|1743132_1743408_+	hypothetical protein	NA	Q1JS60	Enterobacteria_phage	83.5	8.9e-42
AXD18723.1|1743404_1743737_+	hypothetical protein	NA	NA	NA	NA	NA
AXD18724.1|1743746_1744316_+	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	46.8	1.5e-43
AXD18725.1|1744318_1744537_+	hypothetical protein	NA	NA	NA	NA	NA
AXD18726.1|1744575_1747233_+	bifunctional DNA primase/helicase	NA	A0A077K8T2	Ralstonia_phage	47.4	4.6e-244
AXD18727.1|1747260_1747584_-	transcriptional regulator	NA	F1BUM8	Cronobacter_phage	73.1	1.3e-36
AXD18728.1|1747583_1748603_-|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	68.5	1.0e-135
AXD18729.1|1748599_1750384_-|terminase	terminase	terminase	F1BUM5	Cronobacter_phage	69.7	2.1e-245
AXD18730.1|1750441_1751431_+|capsid	phage capsid protein	capsid	F1BUM4	Cronobacter_phage	49.2	4.3e-46
AXD18731.1|1751465_1752494_+|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	71.6	1.7e-133
AXD18732.1|1752505_1753204_+|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	52.6	2.7e-63
AXD18733.1|1753302_1753755_+|head	head completion protein	head	F1BUL8	Cronobacter_phage	64.7	1.2e-48
AXD18734.1|1753751_1754234_+|tail	phage tail protein	tail	F1BUL7	Cronobacter_phage	48.7	2.3e-37
AXD18735.1|1754230_1754935_+	hypothetical protein	NA	F1BUL6	Cronobacter_phage	59.5	4.0e-70
AXD18736.1|1754931_1756059_+	DUF2586 domain-containing protein	NA	F1BUL5	Cronobacter_phage	82.9	8.1e-174
AXD18737.1|1756055_1756511_+	DUF2597 family protein	NA	F1BUL4	Cronobacter_phage	71.5	1.7e-58
AXD18738.1|1756523_1756820_+|holin	holin	holin	C7BGD7	Burkholderia_phage	48.2	2.4e-16
AXD18739.1|1756816_1757158_+	M15 family peptidase	NA	F1BUL3	Cronobacter_phage	91.1	2.2e-50
AXD18740.1|1757157_1757490_+	hypothetical protein	NA	F1BUL2	Cronobacter_phage	68.2	2.8e-34
AXD18741.1|1757416_1757650_+	hypothetical protein	NA	F1BUL1	Cronobacter_phage	83.1	1.7e-30
AXD18742.1|1757627_1757894_+	hypothetical protein	NA	A5X9I7	Aeromonas_virus	61.0	2.4e-20
AXD18743.1|1758081_1760049_+|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	70.7	1.9e-271
AXD18744.1|1760045_1760375_+	DUF2590 family protein	NA	F1BUK8	Cronobacter_phage	72.4	3.8e-39
AXD18745.1|1760371_1761556_+	hypothetical protein	NA	F1BUK6	Cronobacter_phage	78.4	6.7e-179
AXD18746.1|1761542_1762136_+	hypothetical protein	NA	F1BUK5	Cronobacter_phage	82.1	1.1e-89
AXD18747.1|1762145_1764392_+|tail	phage tail protein	tail	Q8HAB4	Salmonella_phage	70.4	3.1e-169
AXD18748.1|1764404_1764950_+|tail	tail fiber assembly protein	tail	S4TUB9	Salmonella_phage	89.0	9.5e-88
AXD18749.1|1764939_1765665_+	hypothetical protein	NA	F1BUK1	Cronobacter_phage	56.4	5.0e-68
AXD18750.1|1765636_1766182_+	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	71.4	3.5e-58
AXD18751.1|1766181_1767885_+	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	79.7	1.7e-223
AXD18752.1|1768989_1769601_+	iron-sulfur cluster assembly scaffold protein SufA	NA	NA	NA	NA	NA
AXD18753.1|1769612_1769993_+	type II toxin-antitoxin system YafO family toxin	NA	NA	NA	NA	NA
AXD21710.1|1770254_1771616_-	U32 family peptidase	NA	Q6DW11	Phage_TP	95.4	2.3e-207
1770085:1770105	attR	AAAAATAAGCCTGCGTAAGGG	NA	NA	NA	NA
>prophage 3
CP030185	Salmonella enterica strain SA20094620 chromosome, complete genome	4854398	1928623	1939223	4854398		Morganella_phage(25.0%)	13	NA	NA
AXD18884.1|1928623_1929097_-	peptidase	NA	A0A0F6TJ61	Escherichia_coli_O157_typing_phage	77.6	7.1e-39
AXD18885.1|1929744_1930035_-	DUF4102 domain-containing protein	NA	B7SYF8	Stenotrophomonas_phage	49.1	3.0e-08
AXD18886.1|1930406_1931204_-	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
AXD18887.1|1931464_1931707_+	hypothetical protein	NA	NA	NA	NA	NA
AXD18888.1|1931684_1931846_+	hypothetical protein	NA	NA	NA	NA	NA
AXD18889.1|1931972_1932392_+	protein UmuD	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
AXD18890.1|1932394_1933663_+	translesion error-prone DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	92.4	1.1e-227
AXD18891.1|1934117_1934330_+	cold-shock protein CspJ	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
AXD21721.1|1934340_1934529_+	cold-shock protein	NA	NA	NA	NA	NA
AXD18892.1|1934786_1935983_-	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	56.3	6.1e-111
AXD18893.1|1936632_1936944_+	hypothetical protein	NA	NA	NA	NA	NA
AXD18894.1|1937023_1937719_+	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.1	2.8e-07
AXD18895.1|1937792_1939223_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
>prophage 4
CP030185	Salmonella enterica strain SA20094620 chromosome, complete genome	4854398	2044139	2115550	4854398	holin,integrase,protease,terminase,tail,transposase,head,lysis	Edwardsiella_phage(17.65%)	90	2077228:2077243	2097525:2097540
AXD19008.1|2044139_2045219_-|integrase	integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	52.5	3.0e-101
AXD19009.1|2045193_2045472_-	excisionase	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	37.5	1.4e-10
AXD21726.1|2045532_2045769_-	hypothetical protein	NA	NA	NA	NA	NA
AXD19010.1|2046059_2046245_-	DUF1187 family protein	NA	NA	NA	NA	NA
AXD19011.1|2046291_2047122_-	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	72.0	1.3e-104
AXD19012.1|2047114_2049805_-	exodeoxyribonuclease VIII	NA	Q9QF34	Lambdoid_phage	73.2	3.0e-118
AXD19013.1|2049945_2050281_-	hypothetical protein	NA	NA	NA	NA	NA
AXD19014.1|2050356_2050563_-	cell division inhibitor protein	NA	I6PBM9	Cronobacter_phage	45.6	3.0e-10
AXD19015.1|2050566_2050842_-	hypothetical protein	NA	NA	NA	NA	NA
AXD19016.1|2051190_2051457_-	hypothetical protein	NA	NA	NA	NA	NA
AXD19017.1|2051872_2052298_-	helix-turn-helix domain-containing protein	NA	K7PH71	Enterobacterial_phage	56.3	1.2e-13
AXD19018.1|2052394_2052649_+	XRE family transcriptional regulator	NA	K7PKH4	Enterobacteria_phage	59.4	1.2e-16
AXD19019.1|2052635_2053130_+	hypothetical protein	NA	NA	NA	NA	NA
AXD19020.1|2053173_2054175_+	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	68.1	4.4e-123
AXD19021.1|2054167_2054629_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	74.8	7.8e-67
AXD19022.1|2054643_2055039_+	DUF977 family protein	NA	A0A088CBK9	Shigella_phage	38.1	1.7e-17
AXD19023.1|2055035_2055308_+	hypothetical protein	NA	NA	NA	NA	NA
AXD19024.1|2055511_2055667_+	type I toxin-antitoxin system hok family toxin	NA	A0A0U2QV81	Escherichia_phage	84.3	1.2e-14
AXD19025.1|2055918_2056167_+	hypothetical protein	NA	NA	NA	NA	NA
AXD19026.1|2056230_2056830_+	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	82.9	3.6e-96
AXD19027.1|2056826_2057054_+	DNA breaking-rejoining protein	NA	A0A0M4RU10	Salmonella_phage	66.7	2.2e-14
AXD19028.1|2057183_2057873_+	antiterminator	NA	I6PDF8	Cronobacter_phage	54.9	2.1e-60
AXD21727.1|2057969_2058494_+	hypothetical protein	NA	NA	NA	NA	NA
AXD19029.1|2058867_2059317_-	lipoprotein	NA	NA	NA	NA	NA
AXD19030.1|2059677_2060364_-|protease	type III secretion system effector protease GtgA	protease	Q9MBM0	Phage_Gifsy-2	99.6	1.8e-131
AXD21728.1|2060639_2060969_+|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
AXD19031.1|2060952_2061405_+	lysozyme	NA	A0A0M4R365	Salmonella_phage	98.0	3.0e-79
AXD21729.1|2061422_2061887_+|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	82.9	2.7e-59
AXD19032.1|2062112_2062295_+	DUF826 domain-containing protein	NA	NA	NA	NA	NA
AXD19033.1|2062365_2063118_+	hypothetical protein	NA	G8C7P2	Escherichia_phage	73.3	5.3e-12
AXD19034.1|2063083_2064505_+|terminase	PBSX family phage terminase large subunit	terminase	A0A077KAW0	Edwardsiella_phage	68.0	1.4e-186
AXD19035.1|2064504_2066025_+	DUF1073 domain-containing protein	NA	A0A2R3UAL5	Myoviridae_environmental_samples	43.7	2.4e-104
AXD19036.1|2066065_2066755_+|head	phage head morphogenesis protein	head	H9C0V1	Aeromonas_phage	49.6	4.5e-58
AXD19037.1|2066751_2068098_+	DUF2213 domain-containing protein	NA	A0A219YCD3	Aeromonas_phage	37.9	1.0e-69
AXD19038.1|2068099_2068582_+	hypothetical protein	NA	A0A1X9SFC3	Acinetobacter_phage	48.8	2.4e-26
AXD19039.1|2068581_2069610_+	DUF2184 domain-containing protein	NA	A0A219YBB0	Aeromonas_phage	48.7	2.3e-82
AXD19040.1|2069613_2069961_+	hypothetical protein	NA	H9C0V9	Aeromonas_phage	40.2	3.9e-10
AXD19041.1|2069967_2070423_+	DUF4054 domain-containing protein	NA	A0A068CGG9	Acinetobacter_phage	40.8	2.4e-15
AXD19042.1|2070416_2071001_+	hypothetical protein	NA	H9C0W2	Aeromonas_phage	30.1	2.1e-16
AXD19043.1|2070997_2071363_+	hypothetical protein	NA	A0A077KAW7	Edwardsiella_phage	40.5	2.3e-21
AXD19044.1|2071347_2071893_+	hypothetical protein	NA	NA	NA	NA	NA
AXD19045.1|2071873_2073358_+	DUF3383 domain-containing protein	NA	A0A077KGV4	Edwardsiella_phage	40.4	7.6e-95
AXD19046.1|2073358_2073805_+	hypothetical protein	NA	Q2NPD1	Xanthomonas_phage	40.4	4.8e-21
AXD19047.1|2073804_2074209_+	hypothetical protein	NA	H9C0W7	Aeromonas_phage	44.8	1.8e-19
AXD19048.1|2074250_2074433_+	transcription elongation factor GreA	NA	NA	NA	NA	NA
AXD19049.1|2074416_2076588_+	lytic transglycosylase domain-containing protein	NA	A0A0M4REK7	Salmonella_phage	67.1	1.4e-49
AXD19050.1|2076584_2077295_+	hypothetical protein	NA	A0A077KGW3	Edwardsiella_phage	34.6	8.5e-28
2077228:2077243	attL	TTACGGCGTCGGTGAC	NA	NA	NA	NA
AXD19051.1|2077294_2077597_+	hypothetical protein	NA	A0A077K9U4	Edwardsiella_phage	49.5	7.0e-24
AXD19052.1|2077593_2078463_+	hypothetical protein	NA	A0A077KC17	Edwardsiella_phage	32.7	9.1e-32
AXD19053.1|2078443_2079121_+	oxidoreductase	NA	A0A077KAY0	Edwardsiella_phage	36.0	1.6e-31
AXD19054.1|2079133_2079490_+	hypothetical protein	NA	A0A077KCA1	Edwardsiella_phage	49.1	1.6e-19
AXD19055.1|2079486_2080728_+	hypothetical protein	NA	A0A077KGW9	Edwardsiella_phage	49.9	5.3e-102
AXD19056.1|2080729_2081332_+	DUF2612 domain-containing protein	NA	A0A2R3UAM9	Myoviridae_environmental_samples	38.9	3.3e-33
AXD19057.1|2081321_2082776_+|tail	tail fiber protein	tail	E5G6P0	Salmonella_phage	68.2	1.5e-39
AXD19058.1|2082775_2083351_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	91.0	1.5e-96
AXD19059.1|2083546_2084269_-	guanine nucleotide exchange factor SopE	NA	NA	NA	NA	NA
AXD19060.1|2084748_2085549_-	hypothetical protein	NA	NA	NA	NA	NA
AXD19061.1|2086502_2087582_-|integrase	integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	52.0	8.2e-99
AXD19062.1|2088715_2089003_+	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	92.7	1.4e-37
AXD19063.1|2088999_2089533_+	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	43.0	3.2e-11
AXD19064.1|2089789_2089957_-	lytic enzyme	NA	NA	NA	NA	NA
AXD19065.1|2090021_2090210_-	hypothetical protein	NA	NA	NA	NA	NA
AXD19066.1|2091659_2091860_-	phage virulence factor	NA	NA	NA	NA	NA
AXD19067.1|2092050_2092167_-|tail	phage tail protein	tail	NA	NA	NA	NA
AXD19068.1|2092429_2092555_+	arsenic transporter	NA	NA	NA	NA	NA
AXD19069.1|2092683_2092950_+	hypothetical protein	NA	NA	NA	NA	NA
AXD19070.1|2093702_2094317_-	disulfide bond formation protein B	NA	NA	NA	NA	NA
AXD19071.1|2094326_2094485_-	hypothetical protein	NA	NA	NA	NA	NA
AXD19072.1|2094617_2095532_-	protein PagO	NA	NA	NA	NA	NA
AXD21730.1|2096149_2096350_+	hypothetical protein	NA	NA	NA	NA	NA
AXD19073.1|2096615_2096984_-|integrase	integrase	integrase	K7PHK0	Enterobacteria_phage	39.8	1.2e-17
AXD19074.1|2097107_2098316_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	47.6	1.0e-44
2097525:2097540	attR	GTCACCGACGCCGTAA	NA	NA	NA	NA
AXD19075.1|2098461_2098602_-	hypothetical protein	NA	NA	NA	NA	NA
AXD19076.1|2098767_2099037_-	hypothetical protein	NA	Q6UAV5	Klebsiella_phage	44.4	6.9e-07
AXD19077.1|2099083_2099278_+	hypothetical protein	NA	NA	NA	NA	NA
AXD19078.1|2099407_2099827_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AXD19079.1|2100214_2100691_-	hypothetical protein	NA	NA	NA	NA	NA
AXD19080.1|2101019_2101358_-	cytoplasmic protein	NA	C6ZCX4	Enterobacteria_phage	33.3	6.2e-13
AXD19081.1|2102875_2103598_+	SPI-1 type III secretion system guanine nucleotide exchange factor SopE2	NA	NA	NA	NA	NA
AXD19082.1|2103882_2104047_+	hypothetical protein	NA	NA	NA	NA	NA
AXD19083.1|2104270_2104921_+	serine/threonine-protein phosphatase 1	NA	A0A222YWF0	Escherichia_phage	51.4	1.1e-58
AXD19084.1|2104939_2105131_-	DUF1482 family protein	NA	NA	NA	NA	NA
AXD19085.1|2105241_2105481_-	DUF1480 family protein	NA	NA	NA	NA	NA
AXD21731.1|2105595_2107035_-	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
AXD19086.1|2107112_2109752_-	MCE family protein	NA	NA	NA	NA	NA
AXD19087.1|2109714_2110998_-	paraquat-inducible protein A	NA	NA	NA	NA	NA
AXD19088.1|2111039_2111624_+	GAF domain-containing protein	NA	NA	NA	NA	NA
AXD19089.1|2111721_2112408_+	RNA chaperone ProQ	NA	NA	NA	NA	NA
AXD19090.1|2112427_2114476_+|tail,protease	tail-specific protease	tail,protease	A0A0R6PIZ1	Moraxella_phage	33.5	8.0e-87
AXD19091.1|2114668_2115550_+|protease	protease HtpX	protease	NA	NA	NA	NA
>prophage 5
CP030185	Salmonella enterica strain SA20094620 chromosome, complete genome	4854398	2427854	2433933	4854398	transposase,capsid	Enterobacteria_phage(100.0%)	8	NA	NA
AXD19382.1|2427854_2428778_+|transposase	IS5-like element IS903B family transposase	transposase	Q1MVF0	Enterobacteria_phage	98.7	4.6e-175
AXD19383.1|2428955_2429189_-	hypothetical protein	NA	NA	NA	NA	NA
AXD19384.1|2429306_2429615_-	hypothetical protein	NA	NA	NA	NA	NA
AXD19385.1|2429684_2430950_-	general secretion pathway protein GspD	NA	A7BJY1	Enterobacteria_phage	51.2	2.3e-108
AXD19386.1|2430957_2432052_-	hypothetical protein	NA	A7BJY0	Enterobacteria_phage	54.4	6.1e-110
AXD19387.1|2432052_2432394_-	Head virion protein G6P	NA	D0U162	Enterobacteria_phage	36.1	2.3e-07
AXD19388.1|2432393_2433644_-	attachment protein	NA	D0U161	Enterobacteria_phage	50.9	4.2e-06
AXD19389.1|2433690_2433933_-|capsid	capsid protein	capsid	Q9T0Q8	Enterobacteria_phage	63.0	2.1e-07
>prophage 6
CP030185	Salmonella enterica strain SA20094620 chromosome, complete genome	4854398	2653815	2740553	4854398	holin,tRNA,integrase,protease,plate,portal,terminase,tail,lysis,head,capsid	Enterobacteria_phage(48.54%)	119	2656244:2656262	2693377:2693395
AXD19615.1|2653815_2654565_-	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	28.2	3.5e-08
AXD19616.1|2654564_2655116_-	glutathione peroxidase	NA	NA	NA	NA	NA
AXD19617.1|2655207_2656188_-	vitamin B12 import system permease BtuC	NA	NA	NA	NA	NA
2656244:2656262	attL	TGAAAGAAAAAAGGCCGCA	NA	NA	NA	NA
AXD19618.1|2656395_2656833_-	hypothetical protein	NA	NA	NA	NA	NA
AXD19619.1|2656832_2657195_-	hypothetical protein	NA	NA	NA	NA	NA
AXD19620.1|2657197_2658136_-|integrase	integrase	integrase	A0A0M4RTQ0	Salmonella_phage	51.5	5.1e-81
AXD19621.1|2658224_2658533_-	helix-turn-helix domain-containing protein	NA	A0A0M5M1I9	Salmonella_phage	53.1	1.3e-22
AXD19622.1|2658629_2658908_+	DNA-binding protein	NA	NA	NA	NA	NA
AXD19623.1|2658922_2659261_+	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	86.2	8.9e-52
AXD19624.1|2659271_2659559_+	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	76.8	7.8e-33
AXD19625.1|2659570_2659813_+	DUF4754 domain-containing protein	NA	A0A0A7NQ71	Enterobacteria_phage	100.0	2.3e-38
AXD19626.1|2660009_2660213_+	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	88.1	1.0e-26
AXD19627.1|2660209_2660455_+	MarR family transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	90.1	1.7e-36
AXD19628.1|2660596_2660962_+	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	97.5	1.7e-61
AXD19629.1|2660968_2663791_+	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	96.7	0.0e+00
AXD19630.1|2663867_2664827_+	recombinase	NA	A0A0A7NPX4	Enterobacteria_phage	99.7	2.0e-181
AXD19631.1|2664831_2665143_+	chromosome partitioning protein	NA	A0A0A7NPT5	Enterobacteria_phage	95.1	1.2e-47
AXD19632.1|2665206_2665797_+	ead/Ea22-like family protein	NA	Q8HAA6	Salmonella_phage	51.3	3.6e-32
AXD19633.1|2666287_2667334_-|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	99.7	2.6e-206
AXD19634.1|2667333_2669085_-	oxidoreductase	NA	A0A0A7NV54	Enterobacteria_phage	97.9	0.0e+00
AXD19635.1|2669239_2670076_+|capsid	phage capsid protein	capsid	A0A0A7NRY7	Enterobacteria_phage	80.6	1.5e-119
AXD19636.1|2670099_2671152_+|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	96.9	2.5e-193
AXD19637.1|2671197_2671998_+|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	92.1	6.0e-131
AXD19638.1|2672099_2672594_+|capsid	capsid assembly protein	capsid	A0A0A7NPU2	Enterobacteria_phage	98.2	1.0e-88
AXD19639.1|2672593_2672794_+|tail	phage tail protein	tail	A0A0A7NV57	Enterobacteria_phage	98.5	8.7e-31
AXD19640.1|2672796_2673120_+|holin	holin	holin	A0A0A7NRY9	Enterobacteria_phage	99.1	1.6e-50
AXD19641.1|2673116_2673509_+	M15 family peptidase	NA	A0A0A7NQ86	Enterobacteria_phage	100.0	5.8e-71
AXD19642.1|2673505_2673913_+	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	98.5	3.4e-66
AXD21757.1|2673884_2674064_+	hypothetical protein	NA	NA	NA	NA	NA
AXD19643.1|2674050_2674518_+|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	99.4	2.2e-85
AXD19644.1|2674510_2675146_+	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	99.5	2.4e-114
AXD19645.1|2675142_2675724_+|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	97.4	1.0e-100
AXD19646.1|2675720_2676071_+|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	98.3	6.6e-58
AXD19647.1|2676074_2676971_+|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	99.7	1.9e-157
AXD19648.1|2676963_2677494_+|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	100.0	1.3e-94
AXD19649.1|2677496_2679482_+|tail	phage tail protein	tail	A0A0A7NV63	Enterobacteria_phage	85.9	8.4e-174
AXD19650.1|2679484_2680018_+|tail	tail fiber assembly protein	tail	C9DGR0	Escherichia_phage	99.4	8.4e-97
AXD19651.1|2680046_2680574_-|tail	tail fiber assembly protein	tail	A0A222YWC2	Escherichia_phage	97.7	5.6e-93
AXD21758.1|2680577_2681282_-|tail	phage tail protein	tail	Q7Y4D4	Escherichia_virus	95.3	3.9e-126
AXD19652.1|2681518_2682118_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	98.9	3.8e-98
AXD19653.1|2682146_2682641_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	99.4	2.1e-86
AXD19654.1|2682647_2685455_-|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	95.9	0.0e+00
AXD19655.1|2685441_2685678_-|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	94.1	4.3e-21
AXD19656.1|2685605_2685980_-|tail	phage tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	73.2	9.0e-37
AXD19657.1|2686035_2686548_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	97.1	1.5e-90
AXD19658.1|2686547_2687732_-|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	98.5	3.4e-223
AXD19659.1|2687889_2688999_+	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	94.6	2.2e-195
AXD19660.1|2689209_2692002_-	hypothetical protein	NA	NA	NA	NA	NA
AXD19661.1|2692007_2692328_-	hypothetical protein	NA	NA	NA	NA	NA
AXD19662.1|2692523_2692784_+	hypothetical protein	NA	NA	NA	NA	NA
AXD19663.1|2692974_2693115_+	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	97.8	1.5e-18
AXD19664.1|2693523_2693823_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
2693377:2693395	attR	TGAAAGAAAAAAGGCCGCA	NA	NA	NA	NA
AXD19665.1|2693827_2696215_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
AXD19666.1|2696230_2697214_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.1e-33
AXD21759.1|2697350_2697395_-|tRNA	phenylalanyl--tRNA ligase operon leader peptide	tRNA	NA	NA	NA	NA
AXD19667.1|2697515_2697872_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
AXD19668.1|2697922_2698120_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
AXD19669.1|2698215_2698758_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.7	4.8e-15
AXD19670.1|2698761_2700690_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.7	7.2e-130
AXD19671.1|2701021_2702290_-	translesion error-prone DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	96.9	2.1e-239
AXD19672.1|2702292_2702712_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	59.8	3.8e-36
AXD19673.1|2702948_2704247_-|tail	phage tail protein	tail	I6R0Q9	Salmonella_phage	99.3	5.9e-245
AXD19674.1|2704257_2705217_-	hypothetical protein	NA	H6WRW5	Salmonella_phage	99.1	9.0e-182
AXD19675.1|2705225_2707937_-	DUF1983 domain-containing protein	NA	S4TTF5	Salmonella_phage	95.9	0.0e+00
AXD19676.1|2707936_2708335_-	hypothetical protein	NA	S4TR39	Salmonella_phage	94.7	2.9e-70
AXD19677.1|2708341_2708926_-	hypothetical protein	NA	S4TND4	Salmonella_phage	97.9	1.1e-105
AXD19678.1|2708925_2709519_-	hypothetical protein	NA	S4TSP7	Salmonella_phage	99.5	1.9e-110
AXD19679.1|2709681_2709936_+	hypothetical protein	NA	NA	NA	NA	NA
AXD19680.1|2710306_2713621_-|tail	phage tail tape measure protein	tail	S4TTF9	Salmonella_phage	95.2	0.0e+00
AXD19681.1|2713667_2714003_-	zinc ribbon domain-containing protein	NA	S4TR42	Salmonella_phage	100.0	7.0e-57
AXD21760.1|2714059_2714338_-	DUF4035 domain-containing protein	NA	S4TND7	Salmonella_phage	100.0	1.9e-44
AXD19682.1|2714361_2714733_-|tail	phage tail protein	tail	S4TSQ0	Salmonella_phage	94.2	3.0e-61
AXD19683.1|2714760_2715465_-|tail	phage tail protein	tail	K7PHL2	Enterobacterial_phage	74.4	4.4e-93
AXD19684.1|2715521_2715869_-	DUF3168 domain-containing protein	NA	S4TTG3	Salmonella_phage	96.5	5.5e-57
AXD19685.1|2715865_2716315_-	hypothetical protein	NA	S4TR46	Salmonella_phage	96.6	2.5e-73
AXD19686.1|2716311_2716650_-|head,tail	head-tail adaptor protein	head,tail	A0A2H4JHK5	uncultured_Caudovirales_phage	70.5	6.6e-39
AXD19687.1|2716659_2716986_-|head,tail	phage gp6-like head-tail connector protein	head,tail	K7PKT4	Enterobacteria_phage	85.2	5.2e-49
AXD19688.1|2716985_2717174_-	hypothetical protein	NA	K7PHI6	Enterobacteria_phage	60.6	2.6e-13
AXD19689.1|2717217_2718435_-|capsid	phage major capsid protein	capsid	K7PM57	Enterobacteria_phage	88.9	6.0e-199
AXD19690.1|2718444_2719293_-|protease	Clp protease ClpP	protease	K7PH05	Enterobacteria_phage	88.2	3.4e-132
AXD19691.1|2719306_2720614_-|portal	phage portal protein	portal	K7PJU5	Enterobacteria_phage	85.5	6.4e-215
AXD19692.1|2720613_2722356_-|terminase	terminase large subunit	terminase	A0A0U2C138	Paracoccus_phage	46.2	5.7e-142
AXD19693.1|2722309_2722774_-|terminase	phage terminase small subunit P27 family	terminase	Q9B019	Phage_GMSE-1	62.1	1.3e-48
AXD19694.1|2722906_2723251_-	HNH endonuclease	NA	K7P7P6	Enterobacteria_phage	75.7	1.0e-47
AXD19695.1|2723369_2723840_-|lysis	lysis protein	lysis	Q76H63	Enterobacteria_phage	84.1	1.5e-60
AXD19696.1|2723836_2724274_-	lysozyme	NA	Q5G8R3	Enterobacteria_phage	97.2	4.1e-73
AXD19697.1|2724257_2724584_-|holin	phage holin, lambda family	holin	Q5G8R5	Enterobacteria_phage	99.1	1.9e-51
AXD19698.1|2725008_2725782_-	antitermination protein	NA	Q76H66	Enterobacteria_phage	99.2	2.6e-131
AXD19699.1|2725778_2725958_-	hypothetical protein	NA	A0A0M4QWY9	Salmonella_phage	94.9	5.1e-22
AXD19700.1|2725938_2726142_-	protein ninH	NA	I6RSQ6	Salmonella_phage	100.0	7.2e-33
AXD19701.1|2726138_2726363_-	protein ninY	NA	I6R0N9	Salmonella_phage	97.3	2.0e-36
AXD19702.1|2726359_2727016_-	HNH endonuclease	NA	A0A2I7QND8	Vibrio_phage	45.4	3.4e-39
AXD19703.1|2727012_2727408_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0M4REJ2	Salmonella_phage	97.7	2.2e-70
AXD19704.1|2727404_2727701_-	hypothetical protein	NA	A0A0M3ULJ7	Salmonella_phage	100.0	2.0e-47
AXD19705.1|2727663_2727840_-	NinF family protein	NA	A0A0M4S6T3	Salmonella_phage	93.1	2.5e-26
AXD19706.1|2727836_2728019_-	NinE family protein	NA	Q716C5	Shigella_phage	96.7	1.8e-27
AXD19707.1|2727985_2728159_-	protein ninD	NA	C6ZR56	Salmonella_phage	91.2	7.8e-28
AXD19708.1|2728155_2729028_-	hypothetical protein	NA	I6R0S6	Salmonella_phage	93.4	6.1e-169
AXD19709.1|2729024_2729483_-	recombination protein NinB	NA	K7PGZ3	Enterobacteria_phage	95.9	2.9e-77
AXD19710.1|2729541_2730993_-	helicase DnaB	NA	Q7Y2K5	Escherichia_phage	98.6	1.8e-274
AXD19711.1|2730967_2731867_-	DNA replication protein	NA	A0A220NQX5	Salmonella_phage	99.3	1.5e-154
AXD19712.1|2731859_2732006_-	DUF2740 domain-containing protein	NA	A0A075B8K7	Enterobacteria_phage	100.0	1.5e-19
AXD19713.1|2732040_2732319_-	hypothetical protein	NA	A0A220NRS4	Escherichia_phage	91.3	6.4e-40
AXD19714.1|2732425_2732611_-	hypothetical protein	NA	Q5G8T3	Enterobacteria_phage	100.0	5.4e-27
AXD19715.1|2732691_2733342_+	LexA family transcriptional regulator	NA	B1B6L9	Salmonella_phage	99.5	2.1e-121
AXD19716.1|2733680_2734016_+	hypothetical protein	NA	Q5G8T5	Enterobacteria_phage	87.9	1.7e-47
AXD21761.1|2734238_2734424_-	hypothetical protein	NA	NA	NA	NA	NA
AXD19717.1|2734355_2734550_+	restriction endonuclease	NA	E7C9Q6	Salmonella_phage	100.0	2.5e-30
AXD19718.1|2734633_2735368_+	pentapeptide repeat-containing protein	NA	I6S1T3	Salmonella_phage	91.5	2.6e-32
AXD19719.1|2735367_2735598_+	hypothetical protein	NA	A0A1B0VMC0	Pseudomonas_phage	48.1	1.7e-09
AXD21762.1|2735788_2735962_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q76H38	Enterobacteria_phage	100.0	2.6e-23
AXD19720.1|2735942_2736131_+	protein kil	NA	A0A1R3Y5S5	Salmonella_virus	98.4	4.8e-31
AXD19721.1|2736260_2736878_+	recombinase	NA	I6RSN3	Salmonella_phage	94.6	1.2e-102
AXD19722.1|2736877_2737261_+	hypothetical protein	NA	I6S1T0	Salmonella_phage	94.5	1.4e-64
AXD19723.1|2737284_2737578_+	DUF2856 family protein	NA	A0A192Y654	Salmonella_phage	95.9	5.2e-48
AXD19724.1|2737588_2737759_+	DUF2737 family protein	NA	I6S642	Salmonella_phage	100.0	6.1e-25
AXD19725.1|2737975_2738326_+	hypothetical protein	NA	NA	NA	NA	NA
AXD19726.1|2739150_2739396_+	helix-turn-helix domain-containing protein	NA	A0A1P8DTG1	Proteus_phage	56.7	9.1e-14
AXD19727.1|2739341_2740553_-	DUF4102 domain-containing protein	NA	I6R9B6	Salmonella_phage	99.5	1.6e-236
>prophage 7
CP030185	Salmonella enterica strain SA20094620 chromosome, complete genome	4854398	3011507	3087700	4854398	transposase,protease,tRNA,integrase	Bacillus_phage(16.67%)	63	3022174:3022190	3088867:3088883
AXD20010.1|3011507_3012908_+|tRNA	asparagine--tRNA ligase	tRNA	A0A167RLM0	Powai_lake_megavirus	35.1	4.5e-81
AXD20011.1|3013513_3014605_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	51.7	1.7e-99
AXD20012.1|3014789_3015980_+	aspartate aminotransferase	NA	NA	NA	NA	NA
AXD20013.1|3016041_3016689_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
AXD20014.1|3016716_3017265_-	DUF882 domain-containing protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	1.2e-05
AXD20015.1|3017524_3019372_-	L,D-transpeptidase	NA	NA	NA	NA	NA
AXD20016.1|3019716_3024183_-	chromosome partition protein MukB	NA	NA	NA	NA	NA
3022174:3022190	attL	TTCCGCGCCGCCCGGCT	NA	NA	NA	NA
AXD20017.1|3024182_3024887_-	chromosome partition protein MukE	NA	NA	NA	NA	NA
AXD20018.1|3024867_3026190_-	chromosome partition protein MukF	NA	NA	NA	NA	NA
AXD20019.1|3026182_3026986_-|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
AXD20020.1|3027121_3027898_+	envelope biogenesis factor ElyC	NA	NA	NA	NA	NA
AXD20021.1|3027877_3028771_-	hypothetical protein	NA	NA	NA	NA	NA
AXD20022.1|3028981_3029728_-	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
AXD20023.1|3029724_3029907_-	hypothetical protein	NA	NA	NA	NA	NA
AXD20024.1|3029958_3031191_-	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AXD20025.1|3031234_3032212_-	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
AXD20026.1|3032208_3033957_-	lipid A export ATP-binding/permease MsbA	NA	W8CYL7	Bacillus_phage	30.5	3.2e-60
AXD20027.1|3033993_3036258_-	ComEC family protein	NA	Q332C0	Clostridium_botulinum_C_phage	22.5	5.1e-10
AXD20028.1|3036434_3037690_-|transposase	IS3-like element ISSen1 family transposase	transposase	Q6H9S3	Enterobacteria_phage	33.9	5.4e-17
AXD20029.1|3037802_3038087_-	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	4.1e-10
AXD20030.1|3038242_3039916_-	30S ribosomal protein S1	NA	NA	NA	NA	NA
AXD20031.1|3040029_3040713_-	cytidylate kinase	NA	NA	NA	NA	NA
AXD20032.1|3040885_3041647_-|protease	metalloprotease	protease	NA	NA	NA	NA
AXD20033.1|3041789_3043073_-	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
AXD20034.1|3043143_3044232_-	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	45.0	4.7e-78
AXD20035.1|3044417_3045110_-	DUF421 domain-containing protein	NA	NA	NA	NA	NA
AXD21772.1|3045246_3047007_+	30S ribosomal protein S12 methylthiotransferase accessory protein YcaO	NA	NA	NA	NA	NA
AXD20036.1|3047411_3048269_+	formate transporter FocA	NA	NA	NA	NA	NA
AXD20037.1|3048328_3050611_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	42.0	1.1e-161
AXD20038.1|3050686_3051646_-	SPI-2 type III secretion system effector SopD2	NA	NA	NA	NA	NA
AXD20039.1|3051776_3052103_+	cytoplasmic protein	NA	NA	NA	NA	NA
AXD20040.1|3052194_3053019_+	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.5	2.8e-22
AXD20041.1|3053311_3054733_-	amino acid permease	NA	NA	NA	NA	NA
AXD20042.1|3054950_3056099_-	MFS transporter	NA	NA	NA	NA	NA
AXD20043.1|3056448_3057312_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
AXD20044.1|3057313_3057931_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	4.3e-76
AXD20045.1|3057941_3060386_-	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	50.5	7.0e-223
AXD20046.1|3060622_3061915_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	44.5	8.6e-95
AXD20047.1|3062173_3063517_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.9	1.6e-80
AXD21773.1|3063526_3064138_-	outer membrane lipoprotein carrier protein LolA	NA	NA	NA	NA	NA
AXD21774.1|3064280_3068339_-	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	49.5	2.9e-88
AXD20048.1|3068473_3068968_-	leucine-responsive regulatory protein	NA	NA	NA	NA	NA
AXD20049.1|3068896_3069172_+	hypothetical protein	NA	NA	NA	NA	NA
AXD20050.1|3069514_3070483_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	45.5	6.5e-63
AXD20051.1|3070596_3072363_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	25.3	4.1e-23
AXD20052.1|3072363_3074085_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	23.5	6.4e-13
AXD20053.1|3074129_3074834_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
AXD20054.1|3074834_3075218_+	hypothetical protein	NA	NA	NA	NA	NA
AXD20055.1|3075145_3075364_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
AXD20056.1|3075454_3076366_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AXD20057.1|3076474_3077335_+	pirin family protein	NA	NA	NA	NA	NA
AXD20058.1|3077354_3078032_+	hydrolase	NA	NA	NA	NA	NA
AXD20059.1|3078313_3078520_+	hypothetical protein	NA	NA	NA	NA	NA
AXD20060.1|3078556_3079811_+|transposase	IS3-like element ISSen1 family transposase	transposase	Q6H9S3	Enterobacteria_phage	33.9	5.4e-17
AXD21775.1|3080071_3080281_+	hypothetical protein	NA	NA	NA	NA	NA
AXD20061.1|3080387_3080765_+|integrase	integrase	integrase	NA	NA	NA	NA
AXD20062.1|3080926_3081124_+	hypothetical protein	NA	NA	NA	NA	NA
AXD20063.1|3081336_3083613_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
AXD20064.1|3083643_3083964_-|protease	ATP-dependent Clp protease adaptor ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
AXD20065.1|3084287_3084509_+	cold shock domain protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
AXD20066.1|3084463_3084658_-	hypothetical protein	NA	NA	NA	NA	NA
AXD20067.1|3084638_3086585_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	42.3	9.1e-40
AXD20068.1|3086581_3087700_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.4e-08
3088867:3088883	attR	TTCCGCGCCGCCCGGCT	NA	NA	NA	NA
>prophage 8
CP030185	Salmonella enterica strain SA20094620 chromosome, complete genome	4854398	4439488	4483998	4854398	plate,tRNA,tail	Burkholderia_phage(42.86%)	47	NA	NA
AXD21279.1|4439488_4440487_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
AXD21280.1|4440574_4441885_-	conjugal transfer protein	NA	NA	NA	NA	NA
AXD21281.1|4442131_4442647_+	transcriptional regulator Zur	NA	NA	NA	NA	NA
AXD21282.1|4442746_4442956_-	CsbD family protein	NA	NA	NA	NA	NA
AXD21829.1|4442977_4443091_-	hypothetical protein	NA	NA	NA	NA	NA
AXD21283.1|4443087_4444413_-	MATE family efflux transporter	NA	NA	NA	NA	NA
AXD21284.1|4444591_4445200_-	LexA repressor	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
AXD21285.1|4445308_4445677_-	diacylglycerol kinase	NA	NA	NA	NA	NA
AXD21286.1|4445847_4448268_+	glycerol-3-phosphate 1-O-acyltransferase	NA	NA	NA	NA	NA
AXD21287.1|4448366_4449239_-	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
AXD21288.1|4449252_4449750_-	chorismate--pyruvate lyase	NA	NA	NA	NA	NA
AXD21289.1|4449930_4450848_-	maltose operon protein MalM	NA	NA	NA	NA	NA
AXD21290.1|4451011_4452370_-	maltoporin	NA	NA	NA	NA	NA
AXD21291.1|4452458_4453568_-	maltose/maltodextrin import ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	47.2	6.2e-17
AXD21292.1|4453928_4455119_+	maltose/maltodextrin ABC transporter substrate-binding protein MalE	NA	NA	NA	NA	NA
AXD21293.1|4455250_4456795_+	maltose ABC transporter permease MalF	NA	NA	NA	NA	NA
AXD21294.1|4456809_4457700_+	maltose ABC transporter permease	NA	NA	NA	NA	NA
AXD21295.1|4457865_4458276_-	phosphate-starvation-inducible protein PsiE	NA	NA	NA	NA	NA
AXD21296.1|4458418_4460515_-	YjbH domain-containing protein	NA	NA	NA	NA	NA
AXD21297.1|4460514_4461252_-	hypothetical protein	NA	NA	NA	NA	NA
AXD21298.1|4461248_4461887_-	YjbF family lipoprotein	NA	NA	NA	NA	NA
AXD21299.1|4461950_4462193_-	hypothetical protein	NA	NA	NA	NA	NA
AXD21300.1|4462636_4464286_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
AXD21301.1|4464630_4465980_+	lysine-sensitive aspartokinase 3	NA	NA	NA	NA	NA
AXD21302.1|4466110_4466458_-	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.5	4.9e-21
AXD21303.1|4467034_4467322_+	hypothetical protein	NA	Q6QIC8	Burkholderia_phage	48.1	5.1e-16
AXD21304.1|4467324_4467930_+	lytic transglycosylase domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	60.4	6.5e-61
AXD21305.1|4467942_4468257_+	hypothetical protein	NA	Q6QIC4	Burkholderia_phage	49.1	6.4e-20
AXD21306.1|4468416_4468872_+	hypothetical protein	NA	NA	NA	NA	NA
AXD21307.1|4468868_4469066_+	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	52.9	8.6e-07
AXD21308.1|4469055_4470483_+|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	70.7	4.0e-194
AXD21309.1|4470482_4471007_+|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.5	2.8e-68
AXD21310.1|4471058_4471376_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
AXD21311.1|4471335_4471464_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
AXD21312.1|4471560_4473912_+|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	30.7	2.4e-66
AXD21313.1|4473911_4474865_+	chemotaxis protein	NA	A4JWL1	Burkholderia_virus	51.5	7.9e-37
AXD21314.1|4474864_4475074_+	hypothetical protein	NA	A4JWL2	Burkholderia_virus	60.3	9.8e-17
AXD21315.1|4475061_4476105_+	phage protein D	NA	Q6QIA2	Burkholderia_phage	45.1	3.2e-76
AXD21316.1|4476114_4476837_+|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	41.0	5.1e-12
AXD21317.1|4476845_4477085_+	hypothetical protein	NA	NA	NA	NA	NA
AXD21318.1|4477160_4477523_+	GtrA family protein	NA	U5P0S6	Shigella_phage	70.8	9.6e-44
AXD21319.1|4477519_4478449_+	glycosyltransferase	NA	S5FKN0	Shigella_phage	83.8	6.7e-150
AXD21320.1|4478448_4479996_+	hypothetical protein	NA	B9UDL6	Salmonella_phage	29.9	1.5e-48
AXD21321.1|4480159_4480519_+|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	64.2	2.8e-35
AXD21322.1|4480509_4481625_+|plate	baseplate protein	plate	Q6QI99	Burkholderia_phage	52.2	1.8e-101
AXD21323.1|4481617_4482250_+|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	56.4	6.6e-24
AXD21324.1|4482252_4483998_+|tail	phage tail protein	tail	A0A0M3ULF6	Salmonella_phage	52.2	5.5e-52
>prophage 1
CP030186	Salmonella enterica strain SA20094620 plasmid pSA20094620.1, complete sequence	298919	150518	215564	298919	transposase,integrase	Escherichia_phage(40.91%)	60	159683:159742	214807:215627
AXD21981.1|150518_151523_-|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
AXD21982.1|151601_152036_-	mercuric resistance operon regulatory protein	NA	NA	NA	NA	NA
AXD21983.1|152255_152531_+	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
AXD22119.1|152566_152989_+	mercury transport protein MerC	NA	NA	NA	NA	NA
AXD21984.1|153040_154735_+	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.6	8.8e-39
AXD21985.1|154752_155115_+	mercuric resistance transcriptional repressor protein MerD	NA	NA	NA	NA	NA
AXD21986.1|155111_155348_+	mercury resistance protein	NA	NA	NA	NA	NA
AXD21987.1|155344_156052_+	EAL domain-containing protein	NA	NA	NA	NA	NA
AXD21988.1|156090_157806_+|transposase	transposase	transposase	NA	NA	NA	NA
AXD21989.1|157808_158669_+|transposase	transposase	transposase	NA	NA	NA	NA
159683:159742	attL	CGGCACTGTTGCAAAGTTAGCGATGAGGCAGCCTTTTGTCTTATTCAAAGGCCTTACATT	NA	NA	NA	NA
AXD21990.1|159735_160440_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AXD21991.1|161238_162114_+	class A extended-spectrum beta-lactamase CTX-M-15	NA	A0A1B0VBP7	Salmonella_phage	82.4	1.1e-125
AXD21992.1|162160_162493_-	cupin fold metalloprotein, WbuC family	NA	NA	NA	NA	NA
AXD21993.1|170937_171642_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AXD21994.1|172957_174298_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
AXD21995.1|174472_175842_-|transposase	IS3-like element ISKpn8 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	95.5	9.4e-108
AXD21996.1|176174_176780_-	hypothetical protein	NA	NA	NA	NA	NA
AXD21997.1|176996_177278_-	hypothetical protein	NA	NA	NA	NA	NA
AXD21998.1|177653_177965_-	hypothetical protein	NA	NA	NA	NA	NA
AXD21999.1|178187_178388_-	hypothetical protein	NA	NA	NA	NA	NA
AXD22000.1|178427_178652_-	hypothetical protein	NA	NA	NA	NA	NA
AXD22001.1|178706_178910_-	hypothetical protein	NA	NA	NA	NA	NA
AXD22002.1|179089_179383_-	hypothetical protein	NA	I7B2L9	Escherichia_phage	38.6	4.1e-05
AXD22003.1|179462_179954_-	DUF3085 domain-containing protein	NA	NA	NA	NA	NA
AXD22004.1|179958_180270_-	DUF957 domain-containing protein	NA	NA	NA	NA	NA
AXD22005.1|180471_180690_-	hypothetical protein	NA	NA	NA	NA	NA
AXD22006.1|180786_181107_-	hypothetical protein	NA	NA	NA	NA	NA
AXD22007.1|181285_181516_-	hypothetical protein	NA	NA	NA	NA	NA
AXD22008.1|181687_182581_-	hypothetical protein	NA	NA	NA	NA	NA
AXD22009.1|182890_183595_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AXD22010.1|184084_185194_-	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	30.2	2.8e-33
AXD22011.1|185288_186473_-	tetracycline efflux MFS transporter Tet(D)	NA	NA	NA	NA	NA
AXD22012.1|186568_187225_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AXD22013.1|187236_187941_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AXD22014.1|188215_188785_-	trimethoprim-resistant dihydrofolate reductase DfrA19	NA	A0A1V0SD48	Indivirus	27.2	3.5e-08
AXD22015.1|188784_189285_-	hypothetical protein	NA	A0A1V0SB21	Catovirus	31.7	3.3e-10
AXD22016.1|189550_191092_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
AXD22017.1|191496_192336_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
AXD22018.1|192329_192677_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
AXD22019.1|193986_194418_-	DUF4440 domain-containing protein	NA	NA	NA	NA	NA
AXD22020.1|194780_195194_-	NAD(+)--rifampin ADP-ribosyltransferase	NA	NA	NA	NA	NA
AXD22120.1|195321_196131_-	AAC(3)-II family aminoglycoside N-acetyltransferase	NA	O64018	Bacillus_phage	29.3	1.2e-17
AXD22021.1|196372_197728_-|transposase	IS1380-like element IS1247 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	29.7	2.2e-45
AXD22022.1|198215_198797_-	aminoglycoside N-acetyltransferase AAC(6')-IIc	NA	NA	NA	NA	NA
AXD22023.1|198959_199973_+|integrase	integron integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
AXD22024.1|201718_201967_+	type II toxin-antitoxin system YafQ family toxin	NA	NA	NA	NA	NA
AXD22025.1|202409_203066_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	99.1	6.2e-126
AXD22026.1|203251_203893_-	type A-2 chloramphenicol O-acetyltransferase CatII	NA	G3CFL0	Escherichia_phage	45.9	7.3e-55
AXD22121.1|204042_204543_-	hypothetical protein	NA	NA	NA	NA	NA
AXD22027.1|204622_205327_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AXD22028.1|205447_208414_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	72.9	0.0e+00
AXD22029.1|208492_209497_+|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
AXD22030.1|209678_209855_-	DUF4102 domain-containing protein	NA	T1S9J3	Salmonella_phage	68.6	1.0e-06
AXD22031.1|210184_211000_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	5.9e-09
AXD22032.1|211086_211389_+	phosphoglucosamine mutase	NA	NA	NA	NA	NA
AXD22033.1|211282_211534_-	hypothetical protein	NA	NA	NA	NA	NA
AXD22034.1|211564_213058_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
AXD22035.1|213268_213493_-	hypothetical protein	NA	NA	NA	NA	NA
AXD22036.1|214334_214826_+	hypothetical protein	NA	NA	NA	NA	NA
AXD22037.1|214859_215564_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
214807:215627	attR	CGGCACTGTTGCAAAGTTAGCGATGAGGCAGCCTTTTGTCTTATTCAAAGGCCTTACATTTCAAAAACTCTGCTTACCAGGCGCATTTCGCCCAGGGGATCACCATAATAAAATGCTGAGGCCTGGCCTTTGCGTAGTGCACGCATCACCTCAATACCTTTGATGGTGGCGTAAGCCGTCTTCATGGATTTAAATCCCAGCGTGGCGCCGATTATCCGTTTCAGTTTGCCATGATCGCATTCAATCACGTTGTTCCGGTACTTAATCTGTCGGTGTTCAACGTCAGACGGGCACCGGCCTTCGCGTTTGAGCAGAGCAAGCGCGCGACCATAGGCGGGCGCTTTATCCGTGTTGATGAATCGCGGGATCTGCCACTTCTTCACGTTGTTGAGGATTTTACCCAGAAACCGGTATGCAGCTTTGCTGTTACGACGGGAGGAGAGATAAAAATCGACAGTGCGGCCCCGGCTGTCGACGGCCCGGTACAGATACGCCCAGCGGCCATTGACCTTCACGTAGGTTTCATCCATGTGCCACGGGCAAAGATCGGAAGGGTTACGCCAGTACCAGCGCAGCCGTTTTTCCATTTCAGGCGCATAACGCTGAACCCAGCGGTAAATCGTGGAGTGATCGACATTCACTCCGCGTTCAGCCAGCATCTCCTGCAGCTCACGGTAACTGATGCCGTATTTGCAGTACCAGCGTACGGCCCACAGAATGATGTCACGCTGAAAATGCCGGCCTTTGAATGGGTTCATGTGCAGCTCCATCAGCAAAAGGGGATGATAAGTTTATCACCACCGACTATTTGCAACAGTGCC	NA	NA	NA	NA
>prophage 2
CP030186	Salmonella enterica strain SA20094620 plasmid pSA20094620.1, complete sequence	298919	233223	284303	298919	transposase,protease	uncultured_Caudovirales_phage(40.0%)	46	NA	NA
AXD22061.1|233223_233928_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AXD22062.1|234543_235281_+	resolvase	NA	NA	NA	NA	NA
AXD22063.1|235277_235502_+	hypothetical protein	NA	NA	NA	NA	NA
AXD22064.1|237191_237443_+	hypothetical protein	NA	NA	NA	NA	NA
AXD22065.1|238821_238998_+	DUF4102 domain-containing protein	NA	T1S9J3	Salmonella_phage	68.6	1.0e-06
AXD22124.1|244095_244596_+	hypothetical protein	NA	NA	NA	NA	NA
AXD22066.1|245517_246222_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AXD22067.1|246387_246864_-	cupin fold metalloprotein, WbuC family	NA	NA	NA	NA	NA
AXD22068.1|246940_248560_-	phosphoethanolamine--lipid A transferase	NA	NA	NA	NA	NA
AXD22069.1|248748_249672_-|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	99.3	2.4e-176
AXD22070.1|249755_251102_+	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	26.6	8.8e-18
AXD22071.1|251319_251754_+	copper-binding protein	NA	NA	NA	NA	NA
AXD22072.1|252011_253127_-	nickel/cobalt efflux protein RcnA	NA	NA	NA	NA	NA
AXD22073.1|253249_253522_+	transcriptional repressor RcnR	NA	NA	NA	NA	NA
AXD22074.1|253987_254806_+	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
AXD22075.1|254802_256008_+	ATP/GTP-binding protein	NA	NA	NA	NA	NA
AXD22076.1|256071_256275_-	hypothetical protein	NA	NA	NA	NA	NA
AXD22077.1|256287_257607_-	DUF1173 family protein	NA	NA	NA	NA	NA
AXD22078.1|257857_259285_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	52.3	3.4e-100
AXD22079.1|259499_260015_+	nuclease	NA	A0A1X6WF84	Pacmanvirus	38.6	2.1e-07
AXD22080.1|260017_260914_+	hypothetical protein	NA	NA	NA	NA	NA
AXD22081.1|260961_261276_+	hypothetical protein	NA	NA	NA	NA	NA
AXD22082.1|261349_261607_+	hypothetical protein	NA	NA	NA	NA	NA
AXD22083.1|261665_261899_+	hypothetical protein	NA	NA	NA	NA	NA
AXD22084.1|261944_262199_+	hypothetical protein	NA	NA	NA	NA	NA
AXD22085.1|262236_262524_+	hypothetical protein	NA	NA	NA	NA	NA
AXD22125.1|262593_262791_+	hypothetical protein	NA	NA	NA	NA	NA
AXD22086.1|262931_263207_+	hypothetical protein	NA	NA	NA	NA	NA
AXD22087.1|263698_265177_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	74.4	7.3e-199
AXD22088.1|265195_266023_+	universal stress protein	NA	A0A2H4J154	uncultured_Caudovirales_phage	37.2	4.9e-43
AXD22089.1|266082_266508_-	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.7	1.6e-50
AXD22090.1|266520_267810_-	arsenical efflux pump membrane protein ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	71.4	9.9e-168
AXD22126.1|267855_268176_-	transcriptional regulator	NA	A0A2H4J145	uncultured_Caudovirales_phage	43.3	2.0e-21
AXD22091.1|268262_268967_+	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	72.9	8.8e-86
AXD22092.1|268999_270403_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
AXD22127.1|275002_275635_+	hypothetical protein	NA	NA	NA	NA	NA
AXD22093.1|275663_277067_-|transposase	ISNCY-like element ISKpn21 family transposase	transposase	NA	NA	NA	NA
AXD22094.1|277308_278259_-|transposase	IS5-like element IS903B family transposase	transposase	Q1MVF0	Enterobacteria_phage	98.4	7.5e-173
AXD22128.1|278352_278985_+	hypothetical protein	NA	NA	NA	NA	NA
AXD22095.1|280628_280946_+	hypothetical protein	NA	NA	NA	NA	NA
AXD22096.1|280968_281274_+	hypothetical protein	NA	NA	NA	NA	NA
AXD22097.1|281318_281990_+|protease	serine protease	protease	NA	NA	NA	NA
AXD22098.1|282447_282855_+	hypothetical protein	NA	NA	NA	NA	NA
AXD22099.1|282905_283223_-	hypothetical protein	NA	NA	NA	NA	NA
AXD22100.1|283221_283350_+	ABC transporter	NA	NA	NA	NA	NA
AXD22101.1|283388_284303_-|transposase	IS5 family transposase	transposase	A0A077SK28	Escherichia_phage	98.4	3.6e-172
>prophage 1
CP030187	Salmonella enterica strain SA20094620 plasmid pSA20094620.2, complete sequence	106569	0	105827	106569	tail,integrase,capsid,terminase	Salmonella_phage(91.87%)	133	2659:2679	85576:85596
AXD22130.1|0_1056_+	replication protein RepA	NA	J9Q7H0	Salmonella_phage	90.1	5.6e-169
AXD22131.1|1621_1834_-	hypothetical protein	NA	J9Q7S8	Salmonella_phage	91.4	1.1e-31
AXD22251.1|1833_2148_-	hypothetical protein	NA	J9Q7Z5	Salmonella_phage	77.9	2.1e-39
AXD22132.1|2165_2345_-	hypothetical protein	NA	J9Q6J1	Salmonella_phage	81.4	1.9e-16
AXD22133.1|2385_2661_-	hypothetical protein	NA	J9Q738	Salmonella_phage	76.9	7.8e-38
2659:2679	attL	CATGTGTTTTTCCTTATTGGT	NA	NA	NA	NA
AXD22134.1|2728_3139_-	hypothetical protein	NA	J9Q7G9	Salmonella_phage	91.9	3.2e-72
AXD22135.1|3256_3490_-	hypothetical protein	NA	NA	NA	NA	NA
AXD22136.1|3573_4404_-	SPFH/Band 7/PHB domain protein	NA	J9Q7Z4	Salmonella_phage	95.7	7.4e-124
AXD22137.1|4403_4607_-	hypothetical protein	NA	J9Q6J0	Salmonella_phage	67.7	2.9e-13
AXD22138.1|4699_5773_-	recombinase	NA	J9Q736	Salmonella_phage	96.9	9.0e-199
AXD22139.1|5775_6042_-	hypothetical protein	NA	J9Q7G8	Salmonella_phage	88.6	1.8e-36
AXD22140.1|6041_6986_-	exonuclease	NA	J9Q7S6	Salmonella_phage	95.5	1.8e-174
AXD22141.1|7046_8069_-	regulator	NA	J9Q7Z3	Salmonella_phage	95.3	1.6e-157
AXD22142.1|8188_8620_-	hypothetical protein	NA	J9Q6I8	Salmonella_phage	91.6	2.5e-67
AXD22143.1|8721_9165_-	hypothetical protein	NA	J9Q7S4	Salmonella_phage	94.3	4.4e-67
AXD22144.1|9161_12680_-	DNA polymerase III subunit alpha	NA	J9Q7Z2	Salmonella_phage	96.2	0.0e+00
AXD22145.1|12654_12858_-	hypothetical protein	NA	J9Q6I7	Salmonella_phage	89.6	1.1e-28
AXD22146.1|12860_14096_-	porphyrin biosynthesis protein	NA	J9Q733	Salmonella_phage	94.4	5.7e-229
AXD22147.1|14192_16517_-	porphyrin biosynthesis protein	NA	J9Q7G6	Salmonella_phage	83.3	2.8e-293
AXD22252.1|16631_16844_-	hypothetical protein	NA	NA	NA	NA	NA
AXD22148.1|17106_17487_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AXD22149.1|17478_18585_-|integrase	integrase	integrase	A0A1P8DTG6	Proteus_phage	32.1	4.3e-26
AXD22253.1|18848_19229_-	hypothetical protein	NA	NA	NA	NA	NA
AXD22150.1|19674_19920_-	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	46.8	3.5e-13
AXD22151.1|19919_20285_-	hypothetical protein	NA	K7PH35	Enterobacteria_phage	66.4	5.1e-37
AXD22152.1|20300_20531_-	hypothetical protein	NA	A0A2P1CDD4	Klebsiella_phage	51.6	1.8e-08
AXD22153.1|20514_21348_-	phosphate starvation-inducible protein PhoH	NA	W8D063	Erwinia_phage	63.6	2.9e-88
AXD22154.1|21494_22727_+	hypothetical protein	NA	NA	NA	NA	NA
AXD22155.1|22927_23539_-	hypothetical protein	NA	S4TP42	Salmonella_phage	48.0	6.8e-42
AXD22156.1|24822_25128_-	C-type natriuretic protein	NA	J9Q7S1	Salmonella_phage	64.4	1.1e-29
AXD22157.1|25273_25489_-	hypothetical protein	NA	J9Q6I3	Salmonella_phage	75.7	1.4e-23
AXD22254.1|25475_25649_-	hypothetical protein	NA	J9Q729	Salmonella_phage	71.4	2.3e-16
AXD22158.1|25648_26971_-	DNA ligase	NA	J9Q7G5	Salmonella_phage	92.3	2.4e-241
AXD22255.1|27005_27254_-	hypothetical protein	NA	J9Q7R9	Salmonella_phage	75.3	4.4e-24
AXD22256.1|27149_27503_+	hypothetical protein	NA	NA	NA	NA	NA
AXD22159.1|27554_28349_-	hypothetical protein	NA	J9Q7Z0	Salmonella_phage	73.9	6.4e-109
AXD22160.1|28427_29543_-	DNA primase	NA	J9Q720	Salmonella_phage	93.0	1.0e-208
AXD22161.1|29693_31034_-	DNA helicase	NA	J9Q7G4	Salmonella_phage	98.7	9.4e-246
AXD22162.1|31094_31820_-	hypothetical protein	NA	J9Q7R8	Salmonella_phage	93.4	2.8e-135
AXD22163.1|32009_32420_-	hypothetical protein	NA	J9Q6F2	Salmonella_phage	67.6	4.0e-46
AXD22164.1|32406_33054_-	hypothetical protein	NA	J9Q719	Salmonella_phage	68.2	1.4e-69
AXD22165.1|33055_33415_-	hypothetical protein	NA	J9Q7G3	Salmonella_phage	97.9	8.6e-45
AXD22166.1|33414_34080_-	plasmid stability protein	NA	J9Q7R7	Salmonella_phage	93.7	4.0e-112
AXD22167.1|34275_35025_-	hypothetical protein	NA	J9Q7Y8	Salmonella_phage	31.6	4.2e-17
AXD22168.1|35009_35393_-	hypothetical protein	NA	A0A077SLR3	Escherichia_phage	43.3	1.0e-11
AXD22169.1|35783_36035_-	hypothetical protein	NA	J9Q7R6	Salmonella_phage	81.9	1.5e-27
AXD22170.1|36036_36729_-	hypothetical protein	NA	J9Q7Y7	Salmonella_phage	93.0	5.6e-125
AXD22171.1|36740_37064_-	hypothetical protein	NA	J9Q6E7	Salmonella_phage	92.5	3.7e-47
AXD22172.1|37154_37979_-	receptor-recognizing protein	NA	A0A2K9VBP2	Citrobacter_phage	53.9	2.2e-27
AXD22173.1|37983_38169_-	hypothetical protein	NA	J9Q6E3	Salmonella_phage	58.3	1.6e-07
AXD22257.1|38264_38495_-	hypothetical protein	NA	J9Q714	Salmonella_phage	78.9	1.1e-29
AXD22258.1|38506_39073_-	hypothetical protein	NA	J9Q7G0	Salmonella_phage	91.5	4.4e-96
AXD22174.1|39114_39369_-	hypothetical protein	NA	J9Q7R5	Salmonella_phage	79.8	1.5e-35
AXD22175.1|39412_39970_-	hypothetical protein	NA	A0A088CD67	Shigella_phage	57.3	5.1e-52
AXD22259.1|39969_42654_-	hypothetical protein	NA	J9Q6E3	Salmonella_phage	48.2	3.6e-212
AXD22176.1|44256_48534_-	host specificity protein J	NA	J9Q713	Salmonella_phage	93.3	0.0e+00
AXD22177.1|48550_49141_-|tail	tail assembly protein	tail	J9Q7F8	Salmonella_phage	96.4	3.8e-106
AXD22178.1|49128_49926_-|tail	phage tail protein	tail	J9Q7R4	Salmonella_phage	92.1	1.8e-151
AXD22179.1|49918_50650_-|tail	phage minor tail protein L	tail	J9Q7Y5	Salmonella_phage	98.3	7.4e-136
AXD22180.1|50706_51042_-|tail	phage tail protein	tail	J9Q6E1	Salmonella_phage	87.4	2.5e-54
AXD22181.1|51082_55663_-|tail	phage tail tape measure protein	tail	J9Q712	Salmonella_phage	83.8	0.0e+00
AXD22182.1|55670_55940_-	hypothetical protein	NA	J9Q7F7	Salmonella_phage	100.0	8.4e-37
AXD22183.1|56020_56338_-	hypothetical protein	NA	J9Q7R3	Salmonella_phage	98.1	6.0e-50
AXD22184.1|56398_57145_-	hypothetical protein	NA	J9Q7Y4	Salmonella_phage	88.7	3.9e-116
AXD22185.1|57218_57602_-	hypothetical protein	NA	J9Q6D8	Salmonella_phage	82.7	1.4e-56
AXD22186.1|57603_58077_-	hypothetical protein	NA	J9Q711	Salmonella_phage	91.7	2.1e-75
AXD22187.1|58067_58412_-	hypothetical protein	NA	J9Q7F6	Salmonella_phage	91.2	7.4e-54
AXD22188.1|58509_59343_-	hypothetical protein	NA	J9Q7R2	Salmonella_phage	88.8	1.2e-137
AXD22189.1|59342_59774_-	hypothetical protein	NA	J9Q7Y3	Salmonella_phage	86.8	1.5e-64
AXD22190.1|59813_60476_-	hypothetical protein	NA	J9Q6D6	Salmonella_phage	71.3	4.0e-80
AXD22191.1|60550_61432_-|capsid	phage major capsid protein	capsid	J9Q710	Salmonella_phage	91.5	1.9e-149
AXD22192.1|61457_62354_-	hypothetical protein	NA	J9Q7F4	Salmonella_phage	90.9	1.2e-140
AXD22193.1|62375_63950_-	hypothetical protein	NA	J9Q7R1	Salmonella_phage	95.0	5.2e-288
AXD22194.1|63982_65239_-|terminase	terminase	terminase	J9Q7Y2	Salmonella_phage	97.1	1.4e-246
AXD22195.1|65241_65883_-	DNA-binding protein	NA	J9Q6D4	Salmonella_phage	96.2	3.5e-105
AXD22196.1|66077_66344_-	hypothetical protein	NA	J9Q757	Salmonella_phage	97.7	4.3e-41
AXD22197.1|66353_67253_-	hypothetical protein	NA	J9Q7I6	Salmonella_phage	97.6	3.2e-165
AXD22198.1|67249_67504_-	hypothetical protein	NA	J9Q7U0	Salmonella_phage	98.8	4.1e-41
AXD22199.1|67496_68135_-	ATP-binding cassette domain-containing protein	NA	J9Q807	Salmonella_phage	100.0	3.8e-112
AXD22200.1|68131_68800_-	chromosome partitioning protein ParB	NA	J9Q6L1	Salmonella_phage	96.4	2.0e-111
AXD22201.1|68799_69498_-	chromosome partitioning protein ParB	NA	J9Q756	Salmonella_phage	95.3	3.2e-120
AXD22202.1|69562_71122_+	ATP-dependent helicase	NA	J9Q7I4	Salmonella_phage	95.8	9.2e-285
AXD22203.1|71124_71403_+	hypothetical protein	NA	J9Q7T9	Salmonella_phage	95.7	3.8e-40
AXD22204.1|71465_71888_+	hypothetical protein	NA	J9Q806	Salmonella_phage	87.9	2.6e-64
AXD22205.1|71892_72420_+	transcriptional regulator	NA	J9Q6L0	Salmonella_phage	87.8	9.9e-74
AXD22206.1|72741_73389_+	hypothetical protein	NA	J9Q754	Salmonella_phage	89.8	8.4e-99
AXD22207.1|73439_73643_+	hypothetical protein	NA	J9Q7I3	Salmonella_phage	97.0	8.3e-29
AXD22208.1|74287_74770_-	hypothetical protein	NA	J9Q805	Salmonella_phage	76.7	3.0e-69
AXD22209.1|74993_75182_+	hypothetical protein	NA	E5FFJ6	Burkholderia_phage	63.0	5.0e-12
AXD22210.1|75209_75491_-	ABC transporter	NA	J9Q753	Salmonella_phage	86.0	5.3e-42
AXD22211.1|75618_76011_-	hypothetical protein	NA	J9Q7I1	Salmonella_phage	77.7	1.6e-49
AXD22212.1|76141_76453_-	hypothetical protein	NA	J9Q7T7	Salmonella_phage	73.8	6.3e-36
AXD22213.1|76593_76815_-	hypothetical protein	NA	J9Q804	Salmonella_phage	88.9	1.5e-31
AXD22214.1|76825_77044_-	hypothetical protein	NA	J9Q6K7	Salmonella_phage	87.5	2.6e-28
AXD22215.1|77186_77432_+	hypothetical protein	NA	J9Q751	Salmonella_phage	86.2	7.9e-34
AXD22216.1|78852_79038_-	hypothetical protein	NA	NA	NA	NA	NA
AXD22217.1|79082_79400_-	hypothetical protein	NA	J9Q750	Salmonella_phage	78.1	8.4e-44
AXD22218.1|79393_79636_-	DUF1380 domain-containing protein	NA	J9Q7H8	Salmonella_phage	88.5	6.4e-36
AXD22219.1|79720_79987_-	hypothetical protein	NA	A0A1V0E5L9	Salmonella_phage	73.6	1.8e-31
AXD22220.1|80117_80303_-	hypothetical protein	NA	A0A1V0E5M0	Salmonella_phage	86.0	4.0e-22
AXD22221.1|80302_80521_-	hypothetical protein	NA	NA	NA	NA	NA
AXD22260.1|80517_81054_-	hypothetical protein	NA	J9Q748	Salmonella_phage	79.5	2.3e-78
AXD22222.1|81050_81692_-	HD domain-containing protein	NA	J9Q7H7	Salmonella_phage	92.0	6.3e-107
AXD22223.1|81784_82156_-	hypothetical protein	NA	J9Q7T4	Salmonella_phage	62.6	3.1e-37
AXD22224.1|82158_82440_-	hypothetical protein	NA	J9Q801	Salmonella_phage	75.3	1.3e-35
AXD22225.1|82436_83126_-	hypothetical protein	NA	J9Q6K2	Salmonella_phage	79.5	1.4e-96
AXD22226.1|83183_84887_-	DNA modification methylase	NA	J9Q747	Salmonella_phage	93.6	0.0e+00
AXD22227.1|85008_85578_-	hypothetical protein	NA	J9Q7H6	Salmonella_phage	62.1	2.0e-59
AXD22261.1|85685_86444_-	hypothetical protein	NA	J9Q7T3	Salmonella_phage	88.5	1.9e-118
85576:85596	attR	CATGTGTTTTTCCTTATTGGT	NA	NA	NA	NA
AXD22228.1|86524_86698_-	DUF3927 domain-containing protein	NA	NA	NA	NA	NA
AXD22229.1|86697_87123_-	tellurite/colicin resistance protein	NA	Q71TK7	Escherichia_phage	69.5	2.6e-48
AXD22230.1|87188_87377_-	hypothetical protein	NA	J9Q800	Salmonella_phage	71.0	1.4e-17
AXD22231.1|87373_87628_-	hypothetical protein	NA	NA	NA	NA	NA
AXD22232.1|88026_88635_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	95.0	6.8e-111
AXD22233.1|89223_89454_-	hypothetical protein	NA	J9Q7H5	Salmonella_phage	81.3	2.9e-30
AXD22234.1|89653_90247_-	phage N-6-adenine-methyltransferase	NA	J9Q7T2	Salmonella_phage	91.9	1.4e-105
AXD22235.1|90431_91274_-	hypothetical protein	NA	J9Q7Z9	Salmonella_phage	65.4	5.3e-77
AXD22236.1|91398_91956_-	3'-5' exonuclease	NA	J9Q6J8	Salmonella_phage	87.4	9.4e-91
AXD22237.1|91965_92385_-	hypothetical protein	NA	J9Q743	Salmonella_phage	81.3	2.3e-57
AXD22238.1|92448_93093_-	hypothetical protein	NA	J9Q7H4	Salmonella_phage	83.6	4.4e-100
AXD22239.1|93092_93569_-	dihydrofolate reductase	NA	J9Q7T1	Salmonella_phage	84.8	1.0e-77
AXD22240.1|93565_93979_-	hypothetical protein	NA	J9Q7Z8	Salmonella_phage	92.0	1.1e-67
AXD22241.1|93980_95096_-	thymidylate synthase	NA	J9Q6J6	Salmonella_phage	91.0	9.7e-204
AXD22242.1|95268_96144_-	phosphoribosyl-ATP pyrophosphohydrolase	NA	J9Q742	Salmonella_phage	88.2	1.4e-144
AXD22243.1|96225_97368_-	ribonucleotide-diphosphate reductase subunit beta	NA	J9Q7H3	Salmonella_phage	95.8	4.4e-212
AXD22244.1|97497_99813_-	ribonucleoside-diphosphate reductase subunit alpha	NA	J9Q7T0	Salmonella_phage	93.0	0.0e+00
AXD22245.1|99890_100460_-	hypothetical protein	NA	J9Q7Z7	Salmonella_phage	96.8	5.1e-100
AXD22262.1|100470_101184_-	hypothetical protein	NA	J9Q6J5	Salmonella_phage	63.7	1.1e-78
AXD22246.1|101209_103126_-	exonuclease	NA	J9Q741	Salmonella_phage	82.4	3.1e-282
AXD22247.1|103122_103359_-	hypothetical protein	NA	J9Q7H1	Salmonella_phage	77.8	2.1e-23
AXD22248.1|103355_104441_-	exonuclease SbcCD subunit D	NA	J9Q7S9	Salmonella_phage	93.6	3.5e-198
AXD22249.1|104612_105107_-	N-acetyltransferase	NA	J9Q6J3	Salmonella_phage	91.4	5.4e-82
AXD22250.1|105182_105827_-	hypothetical protein	NA	J9Q739	Salmonella_phage	94.9	2.1e-118
>prophage 1
CP030188	Salmonella enterica strain SA20094620 plasmid pSA20094620.3, complete sequence	93719	0	93393	93719	tail,holin,head,portal,plate,lysis,terminase	Escherichia_phage(61.26%)	114	NA	NA
AXD22263.1|0_861_+	replication protein RepA	NA	Q71TL8	Escherichia_phage	100.0	4.7e-158
AXD22264.1|1418_2615_+	ParA family protein	NA	A0A077SL49	Escherichia_phage	100.0	1.6e-225
AXD22265.1|2631_3633_+	ParB/RepB/Spo0J family partition protein	NA	Q38420	Escherichia_phage	100.0	1.7e-178
AXD22266.1|3858_5565_+	hypothetical protein	NA	Q71TM1	Escherichia_phage	100.0	0.0e+00
AXD22267.1|5625_7215_+	hypothetical protein	NA	A0A1B0V7E4	Salmonella_phage	99.4	6.2e-305
AXD22268.1|7224_8040_+	hypothetical protein	NA	A0A1B0V835	Salmonella_phage	99.6	1.2e-113
AXD22269.1|8075_8657_+	hypothetical protein	NA	Q71TM4	Escherichia_phage	99.0	6.6e-103
AXD22270.1|8668_9178_+|plate	baseplate protein	plate	Q1MVJ9	Enterobacteria_phage	100.0	1.3e-91
AXD22271.1|9294_9450_-	type I toxin-antitoxin system hok family toxin	NA	A0A1I9LJU7	Stx_converting_phage	92.2	1.0e-15
AXD22369.1|9631_9877_-	hypothetical protein	NA	A0A1B0VDM5	Salmonella_phage	45.0	4.5e-13
AXD22272.1|9927_10773_-	Replication protein repL	NA	Q1MVK3	Enterobacteria_phage	100.0	5.9e-153
AXD22273.1|10802_11603_-	DNA-binding protein	NA	Q1MVK4	Enterobacteria_phage	100.0	1.9e-148
AXD22274.1|11767_12811_-	phage antirepressor Ant	NA	Q71TN2	Escherichia_phage	98.0	1.7e-186
AXD22370.1|12807_13029_-	host cell division inhibitor Icd-like protein	NA	Q38414	Enterobacteria_phage	98.6	4.8e-38
AXD22275.1|13609_13927_+	hypothetical protein	NA	Q71TC5	Escherichia_phage	100.0	2.9e-28
AXD22276.1|13934_14714_+	hypothetical protein	NA	Q71TC6	Escherichia_phage	96.5	5.4e-145
AXD22277.1|14924_15491_+	hypothetical protein	NA	Q1MVL0	Enterobacteria_phage	100.0	6.6e-100
AXD22278.1|15501_16113_+|tail	phage tail protein	tail	Q71TN8	Escherichia_phage	99.5	2.9e-109
AXD22279.1|16127_17009_+	morphogenetic protein	NA	Q71TC9	Escherichia_phage	99.7	2.8e-174
AXD22280.1|17090_20513_+	lytic transglycosylase domain-containing protein	NA	A0A077SK38	Escherichia_phage	98.6	0.0e+00
AXD22281.1|20512_20869_+	hypothetical protein	NA	Q71TP1	Escherichia_phage	100.0	1.0e-61
AXD22282.1|20865_22299_+	bleomycin hydrolase	NA	Q71TP2	Escherichia_phage	100.0	6.3e-272
AXD22283.1|22298_23135_+|tail	phage tail protein	tail	A0A077SLH5	Escherichia_phage	99.3	5.8e-153
AXD22284.1|23213_23648_+|tail	phage tail protein	tail	A0A077SLL3	Escherichia_phage	99.3	9.6e-75
AXD22285.1|23659_26644_+|tail	phage tail protein	tail	Q71TP5	Escherichia_phage	87.9	0.0e+00
AXD22371.1|26647_27175_+|tail	tail fiber assembly protein	tail	A0A077SK10	Escherichia_phage	100.0	1.3e-94
AXD22286.1|27203_27737_-|tail	tail fiber assembly protein	tail	A0A077SL44	Escherichia_phage	100.0	1.4e-96
AXD22287.1|27739_29041_-|tail	phage tail protein	tail	Q1MVL8	Enterobacteria_phage	100.0	8.5e-260
AXD22288.1|29310_29871_-	DNA-invertase	NA	Q1MVM2	Enterobacteria_phage	100.0	5.5e-99
AXD22289.1|29992_30277_+	hypothetical protein	NA	A0A077SK36	Escherichia_phage	100.0	2.0e-49
AXD22290.1|30337_30667_+|holin	holin	holin	Q37876	Escherichia_phage	100.0	1.3e-52
AXD22291.1|30663_31107_+|lysis	lysis protein	lysis	A0A077SK09	Escherichia_phage	100.0	1.3e-82
AXD22292.1|31093_31696_+	odaE	NA	Q1MVM6	Enterobacteria_phage	99.5	1.6e-99
AXD22293.1|31697_33617_+	hypothetical protein	NA	A0A1B0V7H1	Salmonella_phage	99.4	0.0e+00
AXD22294.1|33613_33979_+	ddrA	NA	A0A1B0V846	Salmonella_phage	97.5	2.1e-46
AXD22295.1|33991_36979_+	hypothetical protein	NA	A0A1B0VFX4	Salmonella_phage	99.1	0.0e+00
AXD22296.1|36968_37286_+	hypothetical protein	NA	Q1MVN0	Enterobacteria_phage	88.6	5.8e-45
AXD22297.1|37315_38104_-	hypothetical protein	NA	Q71TF1	Escherichia_phage	96.2	5.7e-142
AXD22372.1|38110_38788_-	DUF2829 domain-containing protein	NA	A0A1B0VBT1	Salmonella_phage	96.0	1.5e-122
AXD22298.1|38985_39474_-	single-stranded DNA-binding protein	NA	A0A1B0VAF5	Salmonella_phage	100.0	5.0e-88
AXD22373.1|39643_40201_+	lysozyme	NA	Q71TF3	Escherichia_phage	100.0	4.2e-107
AXD22299.1|40193_40385_+|holin	holin	holin	Q71TF4	Escherichia_phage	100.0	3.6e-26
AXD22300.1|40336_40513_+|holin	antiholin	holin	Q71TR5	Escherichia_phage	93.1	1.9e-26
AXD22301.1|40492_41512_-|head	head processing protein	head	Q71TR6	Escherichia_phage	99.7	9.2e-185
AXD22302.1|41504_43214_-|portal	phage portal protein	portal	A0A1B0V850	Salmonella_phage	99.1	0.0e+00
AXD22303.1|43289_50057_+	helicase	NA	Q1MVN7	Enterobacteria_phage	98.0	0.0e+00
AXD22304.1|50090_50531_+	peptide-binding protein	NA	A0A077SLF0	Escherichia_phage	100.0	1.7e-79
AXD22305.1|50527_50776_+	modulator protein	NA	Q71TG0	Escherichia_phage	100.0	1.8e-41
AXD22306.1|50815_51457_-	maturation control protein	NA	A0A077SK30	Escherichia_phage	99.5	2.2e-115
AXD22307.1|51645_52206_-	recombinase	NA	Q5QBN4	Enterobacteria_phage	98.4	2.5e-99
AXD22308.1|52452_52764_-	lysogeny establishment protein	NA	A0A077SK03	Escherichia_phage	99.0	2.3e-46
AXD22309.1|52814_53846_-	recombinase	NA	Q71TG5	Escherichia_phage	100.0	9.9e-195
AXD22310.1|53853_54075_-	creatininase	NA	A0A077SLI9	Escherichia_phage	100.0	3.4e-36
AXD22311.1|54486_54600_+	peptidase	NA	Q5XLQ7	Enterobacteria_phage	100.0	3.2e-14
AXD22312.1|54618_54714_+	peptidase	NA	Q38402	Escherichia_phage	100.0	2.8e-11
AXD22313.1|54679_54889_+	c1 repressor inactivator	NA	Q5XLQ8	Enterobacteria_phage	100.0	4.8e-32
AXD22314.1|54999_55851_+	hypothetical protein	NA	A0A077SLM8	Escherichia_phage	99.6	6.1e-158
AXD22315.1|55875_57360_-|terminase	terminase	terminase	Q71T61	Escherichia_phage	100.0	1.5e-292
AXD22316.1|57359_58553_-|terminase	terminase	terminase	Q71T62	Escherichia_phage	100.0	5.2e-179
AXD22317.1|58639_59092_-	Late promoter-activating protein	NA	Q71T63	Escherichia_phage	99.3	6.7e-79
AXD22318.1|59180_60224_-	DUF968 domain-containing protein	NA	A0A077SLM1	Escherichia_phage	99.1	4.3e-206
AXD22319.1|60251_60431_-	PdcA protein	NA	Q71TH5	Escherichia_phage	100.0	7.1e-24
AXD22320.1|60435_60816_-	type II toxin-antitoxin system death-on-curing family toxin	NA	Q71T66	Escherichia_phage	99.2	5.7e-63
AXD22321.1|60815_61037_-	type II toxin-antitoxin system prevent-host-death family antitoxin	NA	A0A222YXU1	Escherichia_phage	100.0	6.7e-32
AXD22322.1|61109_61499_-	DNA repair protein	NA	Q1MVE7	Enterobacteria_phage	100.0	8.3e-70
AXD22323.1|61673_62258_+	DNA-binding protein	NA	A0A1B0V861	Salmonella_phage	100.0	1.7e-111
AXD22324.1|62258_62615_+	hypothetical protein	NA	A0A1B0VCG1	Salmonella_phage	100.0	2.4e-63
AXD22325.1|63690_64053_-	hypothetical protein	NA	A0A1B0VBR1	Salmonella_phage	100.0	9.8e-57
AXD22326.1|64049_64982_-	hypothetical protein	NA	A0A1B0VDS6	Salmonella_phage	100.0	1.3e-182
AXD22327.1|64963_65338_-	hypothetical protein	NA	A0A1B0VBU7	Salmonella_phage	100.0	4.4e-68
AXD22328.1|65344_65638_-	hypothetical protein	NA	A0A077SK23	Escherichia_phage	92.8	3.1e-45
AXD22329.1|65816_66050_-	hypothetical protein	NA	A0A1B0V7L5	Salmonella_phage	94.8	3.1e-35
AXD22330.1|66135_66396_-	eaa protein	NA	A0A077SLR0	Escherichia_phage	97.7	3.2e-41
AXD22331.1|66392_67091_-	DUF551 domain-containing protein	NA	A0A2D1GLX9	Escherichia_phage	68.4	2.3e-78
AXD22332.1|67101_67338_-	hypothetical protein	NA	A0A2D1GLS1	Escherichia_phage	96.2	5.6e-37
AXD22333.1|67339_67558_-	DUF4014 domain-containing protein	NA	A0A1I9LJM2	Stx_converting_phage	90.3	5.2e-29
AXD22374.1|67559_67781_-	hypothetical protein	NA	K7P6F8	Enterobacteria_phage	74.6	4.5e-20
AXD22375.1|68143_68464_-	hypothetical protein	NA	NA	NA	NA	NA
AXD22334.1|68820_69408_-	ead/Ea22-like family protein	NA	E7C9P6	Salmonella_phage	70.4	8.0e-40
AXD22335.1|69404_70049_-	hypothetical protein	NA	Q1MVG0	Enterobacteria_phage	100.0	5.2e-133
AXD22336.1|70041_70257_-	hypothetical protein	NA	NA	NA	NA	NA
AXD22376.1|70253_70445_-	DUF1382 family protein	NA	A0A0P0ZC60	Stx2-converting_phage	79.7	1.4e-17
AXD22337.1|70484_71090_-	hypothetical protein	NA	A0A077SLQ8	Escherichia_phage	84.7	2.4e-95
AXD22338.1|71284_71791_-	3'-phosphatase	NA	A0A1B0VAK0	Salmonella_phage	98.8	4.1e-93
AXD22339.1|71863_73126_-	hypothetical protein	NA	Q1MVG4	Enterobacteria_phage	99.8	4.6e-234
AXD22340.1|73127_73346_-	hypothetical protein	NA	Q71TI9	Escherichia_phage	100.0	3.4e-36
AXD22341.1|73427_74129_-	hypothetical protein	NA	A0A077SLK3	Escherichia_phage	97.9	1.1e-141
AXD22342.1|74125_74803_-	serine/threonine protein phosphatase	NA	Q71TJ1	Escherichia_phage	98.7	9.3e-133
AXD22343.1|74799_75426_-	norphogenetic protein	NA	Q71T82	Escherichia_phage	100.0	6.1e-123
AXD22344.1|75323_75986_-	norphogenetic protein	NA	Q71T83	Escherichia_phage	100.0	4.5e-124
AXD22345.1|75927_76083_-	norphogenetic protein	NA	Q71TJ4	Escherichia_phage	100.0	7.0e-20
AXD22346.1|76149_76728_-	VRR-NUC domain-containing protein	NA	Q71T85	Escherichia_phage	99.5	5.7e-107
AXD22347.1|76730_76976_-	hypothetical protein	NA	Q71T86	Escherichia_phage	100.0	5.7e-40
AXD22348.1|77122_77500_+	hypothetical protein	NA	Q38620	Escherichia_phage	100.0	2.2e-67
AXD22349.1|77509_78727_+|tail	phage tail protein	tail	A0A077SL53	Escherichia_phage	100.0	1.1e-224
AXD22350.1|78730_79459_+|tail	phage tail protein	tail	Q71TJ9	Escherichia_phage	100.0	4.2e-139
AXD22351.1|79445_80231_+|plate	baseplate	plate	Q71T90	Escherichia_phage	98.9	2.3e-143
AXD22352.1|80232_81249_+|tail	phage tail tape measure protein	tail	A0A077SLQ1	Escherichia_phage	99.7	5.9e-192
AXD22353.1|81241_81874_+|plate	baseplate protein	plate	Q1MVH8	Enterobacteria_phage	100.0	9.0e-90
AXD22354.1|81920_82919_-	hypothetical protein	NA	Q71TK3	Escherichia_phage	98.8	1.8e-193
AXD22355.1|82918_84283_-	replicative DNA helicase	NA	O80281	Escherichia_phage	99.6	3.6e-253
AXD22356.1|84273_84489_+	hypothetical protein	NA	NA	NA	NA	NA
AXD22357.1|84672_85500_-	SPFH/Band 7/PHB domain protein	NA	A0A077SLJ6	Escherichia_phage	100.0	1.6e-131
AXD22358.1|85480_85717_-	hypothetical protein	NA	A0A0A7NQ74	Enterobacteria_phage	50.0	2.1e-07
AXD22359.1|85909_86101_+	hypothetical protein	NA	Q71T98	Escherichia_phage	98.4	3.9e-28
AXD22360.1|86489_86675_+	hypothetical protein	NA	Q71T99	Escherichia_phage	100.0	1.5e-16
AXD22361.1|87474_89493_-	DNA adenine methylase	NA	Q1MVI4	Enterobacteria_phage	96.6	0.0e+00
AXD22362.1|89489_90395_-	recombination-associated protein RdgC	NA	A0A077SK17	Escherichia_phage	99.7	1.6e-159
AXD22363.1|90387_90672_-	hypothetical protein	NA	Q71TA2	Escherichia_phage	97.9	2.5e-47
AXD22364.1|90945_91125_+	hypothetical protein	NA	A0A1B0V758	Salmonella_phage	98.3	6.8e-27
AXD22365.1|91133_91922_+	hypothetical protein	NA	A0A1B0V830	Salmonella_phage	97.7	2.6e-118
AXD22366.1|91961_92384_+	ppfA	NA	Q71TL5	Escherichia_phage	97.9	2.1e-58
AXD22367.1|92561_92921_+	hypothetical protein	NA	A0A0F6TJP2	Escherichia_coli_O157_typing_phage	69.1	4.6e-38
AXD22368.1|92991_93393_+	hypothetical protein	NA	Q71TL7	Escherichia_phage	54.0	4.2e-32
