The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP030180	Salmonella enterica strain SA20100201 chromosome, complete genome	5195044	2022629	2071914	5195044	plate,transposase,integrase	Shigella_phage(25.0%)	34	2035090:2035149	2054071:2054150
AXD09258.1|2022629_2023484_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	55.0	1.4e-80
AXD09259.1|2023480_2023765_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
AXD09260.1|2025674_2026616_+	3-hydroxy-3-methylglutaryl-CoA lyase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	29.6	1.9e-19
AXD09261.1|2026612_2027329_+	hypothetical protein	NA	NA	NA	NA	NA
AXD09262.1|2027325_2029488_+	isocitrate/isopropylmalate dehydrogenase family protein	NA	NA	NA	NA	NA
AXD12058.1|2029495_2030164_+	RraA family protein	NA	NA	NA	NA	NA
AXD09263.1|2030160_2031054_+	hypothetical protein	NA	NA	NA	NA	NA
AXD09264.1|2031019_2031913_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AXD09265.1|2033470_2034934_-	MATE family efflux transporter	NA	NA	NA	NA	NA
2035090:2035149	attL	CGATTCCTCTGTAGTTCAGTCGGTAGAACGGCGGACTGTTAATCCGTATGTCACTGGTTC	NA	NA	NA	NA
AXD09266.1|2035330_2036599_+|integrase	integrase	integrase	B7SYF8	Stenotrophomonas_phage	40.8	1.1e-73
AXD09267.1|2037418_2037631_+	hypothetical protein	NA	NA	NA	NA	NA
AXD09268.1|2037999_2038884_+|integrase	integrase	integrase	NA	NA	NA	NA
AXD12059.1|2039114_2039234_-	hypothetical protein	NA	NA	NA	NA	NA
AXD09269.1|2039626_2039746_-	hypothetical protein	NA	NA	NA	NA	NA
AXD12060.1|2041291_2041459_+	hypothetical protein	NA	NA	NA	NA	NA
AXD09270.1|2041550_2041898_+	hypothetical protein	NA	NA	NA	NA	NA
AXD12061.1|2042404_2042569_+	hypothetical protein	NA	NA	NA	NA	NA
AXD09271.1|2042517_2042775_+	hypothetical protein	NA	NA	NA	NA	NA
AXD09272.1|2044221_2046819_+	hypothetical protein	NA	NA	NA	NA	NA
AXD09273.1|2046996_2048451_+	AMP nucleosidase	NA	NA	NA	NA	NA
AXD09274.1|2048562_2048925_-	hypothetical protein	NA	NA	NA	NA	NA
AXD09275.1|2049957_2052099_+	hypothetical protein	NA	NA	NA	NA	NA
AXD09276.1|2052085_2052676_+	hypothetical protein	NA	NA	NA	NA	NA
AXD09277.1|2054249_2054453_+	hypothetical protein	NA	NA	NA	NA	NA
2054071:2054150	attR	GAACCAGTGACATACGGATTAACAGTCCGCCGTTCTACCGACTGAACTACAGAGGAATCGTGTGAACGAGGCGCATAGTA	NA	NA	NA	NA
AXD12062.1|2056226_2056841_+	hypothetical protein	NA	NA	NA	NA	NA
AXD09278.1|2056878_2059275_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	27.1	4.0e-05
AXD09279.1|2059255_2060296_+	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
AXD09280.1|2060292_2062959_+	hypothetical protein	NA	NA	NA	NA	NA
AXD09281.1|2063055_2063943_+	hypothetical protein	NA	NA	NA	NA	NA
AXD09282.1|2063955_2064225_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
AXD09283.1|2064230_2065391_+	hypothetical protein	NA	NA	NA	NA	NA
AXD09284.1|2068781_2069093_+	hypothetical protein	NA	NA	NA	NA	NA
AXD09285.1|2069092_2070853_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
AXD09286.1|2070816_2071914_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
>prophage 2
CP030180	Salmonella enterica strain SA20100201 chromosome, complete genome	5195044	2864024	2949798	5195044	capsid,tail,lysis,holin,tRNA,head,portal,protease,terminase,integrase	Enterobacteria_phage(24.32%)	101	2858793:2858807	2947076:2947090
2858793:2858807	attL	TCAACAGAAGCCAAA	NA	NA	NA	NA
AXD09979.1|2864024_2864621_+|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
AXD09980.1|2864610_2865015_+	hydrogenase-1 operon protein HyaE	NA	NA	NA	NA	NA
AXD09981.1|2865011_2865860_+	hydrogenase expression/formation protein	NA	NA	NA	NA	NA
AXD09982.1|2865934_2867479_+	cytochrome bd-II oxidase subunit 1	NA	NA	NA	NA	NA
AXD09983.1|2867490_2868627_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
AXD09984.1|2868639_2868729_+	cytochrome bd-II oxidase subunit CbdX	NA	NA	NA	NA	NA
AXD09985.1|2869123_2870398_+	Glu/Leu/Phe/Val dehydrogenase	NA	NA	NA	NA	NA
AXD09986.1|2870611_2872324_+	alpha,alpha-trehalase	NA	NA	NA	NA	NA
AXD09987.1|2872386_2872641_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
AXD09988.1|2872809_2873544_+	flagellar brake protein YcgR	NA	NA	NA	NA	NA
AXD09989.1|2873557_2874169_-	membrane-bound lytic murein transglycosylase EmtA	NA	NA	NA	NA	NA
AXD09990.1|2874407_2875322_+	muramoyltetrapeptide carboxypeptidase	NA	NA	NA	NA	NA
AXD09991.1|2875417_2877151_+	potassium/proton antiporter	NA	NA	NA	NA	NA
AXD09992.1|2877214_2878285_-	alanine racemase	NA	NA	NA	NA	NA
AXD09993.1|2878298_2879597_-	D-amino acid dehydrogenase small subunit	NA	NA	NA	NA	NA
AXD09994.1|2879919_2881452_+	SpoVR family protein	NA	NA	NA	NA	NA
AXD09995.1|2881498_2882218_-	fatty acid metabolism transcriptional regulator FadR	NA	NA	NA	NA	NA
AXD09996.1|2882436_2883981_+	sodium/proton antiporter	NA	NA	NA	NA	NA
AXD09997.1|2884122_2884653_+	disulfide bond formation protein DsbB	NA	NA	NA	NA	NA
AXD09998.1|2885447_2885987_-	phase 1 flagellin transcriptional repressor	NA	NA	NA	NA	NA
AXD09999.1|2886046_2887699_-	FliC/FljB family flagellin	NA	NA	NA	NA	NA
AXD10000.1|2887956_2888520_+	recombinase family protein	NA	A0A1S6L009	Salmonella_phage	67.2	4.5e-64
AXD10001.1|2888900_2889380_+	heme-binding protein	NA	NA	NA	NA	NA
AXD10002.1|2889717_2889915_+	hypothetical protein	NA	NA	NA	NA	NA
AXD10003.1|2891001_2891355_-	DUF1353 domain-containing protein	NA	I1TQ41	Pseudomonas_phage	39.8	1.2e-14
AXD10004.1|2891478_2892057_-	DUF4376 domain-containing protein	NA	Q9LA61	Enterobacterial_phage	52.8	9.9e-43
AXD10005.1|2892479_2892713_-	hypothetical protein	NA	NA	NA	NA	NA
AXD10006.1|2892772_2893294_-	hypothetical protein	NA	J9Q7Y6	Salmonella_phage	34.6	2.5e-13
AXD10007.1|2893293_2895192_-	hypothetical protein	NA	J9Q6E3	Salmonella_phage	61.1	1.9e-21
AXD10008.1|2895316_2895469_-	type I toxin-antitoxin system hok family toxin	NA	NA	NA	NA	NA
AXD10009.1|2895662_2896415_-	hypothetical protein	NA	NA	NA	NA	NA
AXD10010.1|2896414_2896771_-	hypothetical protein	NA	NA	NA	NA	NA
AXD10011.1|2896780_2899999_-	DUF1983 domain-containing protein	NA	A5LH43	Enterobacteria_phage	51.5	2.5e-300
AXD10012.1|2900104_2900854_-|tail	tail assembly protein	tail	S5MDP1	Escherichia_phage	63.5	1.2e-61
AXD10013.1|2900751_2901489_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	76.4	1.8e-113
AXD10014.1|2901494_2902046_-|tail	phage minor tail protein L	tail	Q687F1	Enterobacteria_phage	68.8	1.7e-63
AXD10015.1|2902187_2903324_-	porin	NA	Q1MVN1	Enterobacteria_phage	60.1	2.3e-112
AXD10016.1|2903482_2903812_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	43.5	6.5e-23
AXD10017.1|2903817_2904618_-	hypothetical protein	NA	A0A2P1CKJ3	Pantoea_phage	33.5	6.4e-24
AXD10018.1|2904657_2906298_-	hypothetical protein	NA	NA	NA	NA	NA
AXD10019.1|2906512_2906869_-	hypothetical protein	NA	NA	NA	NA	NA
AXD10020.1|2906877_2907606_-	hypothetical protein	NA	NA	NA	NA	NA
AXD10021.1|2907598_2907964_-	hypothetical protein	NA	NA	NA	NA	NA
AXD10022.1|2907956_2908487_-	hypothetical protein	NA	NA	NA	NA	NA
AXD10023.1|2908476_2908806_-	hypothetical protein	NA	A0A1B5FP90	Escherichia_phage	37.8	1.1e-09
AXD10024.1|2908822_2909158_-|head,tail	phage gp6-like head-tail connector protein	head,tail	G3ENA1	Psychrobacter_phage	31.8	1.7e-07
AXD10025.1|2909165_2909528_-	hypothetical protein	NA	NA	NA	NA	NA
AXD10026.1|2909592_2910819_-|capsid	phage major capsid protein	capsid	Q6JIM7	Burkholderia_virus	62.7	1.2e-130
AXD10027.1|2910828_2911533_-|head,protease	HK97 family phage prohead protease	head,protease	Q6JIM8	Burkholderia_virus	63.5	8.0e-71
AXD12092.1|2911508_2912834_-|portal	phage portal protein	portal	Q6JIM9	Burkholderia_virus	50.5	8.2e-117
AXD10028.1|2912839_2914579_-|terminase	terminase large subunit	terminase	A0A0U2C138	Paracoccus_phage	45.8	1.0e-138
AXD10029.1|2914532_2914997_-|terminase	phage terminase small subunit P27 family	terminase	Q9B019	Phage_GMSE-1	59.5	2.6e-46
AXD10030.1|2915199_2915553_-	HNH endonuclease	NA	F1C587	Cronobacter_phage	70.3	2.9e-45
AXD10031.1|2915555_2915894_-	hypothetical protein	NA	S4TTH3	Salmonella_phage	56.0	5.1e-23
AXD10032.1|2915890_2916184_-	hypothetical protein	NA	Q8W634	Enterobacteria_phage	63.7	7.8e-28
AXD10033.1|2916453_2916918_-|lysis	lysis protein	lysis	S4TNN7	Salmonella_phage	73.4	1.4e-55
AXD10034.1|2917147_2917564_-	structural protein	NA	A0A0E3GMJ2	Enterobacteria_phage	52.8	1.5e-40
AXD10035.1|2917560_2917899_-|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	37.5	3.8e-10
AXD10036.1|2917982_2918225_-	hypothetical protein	NA	NA	NA	NA	NA
AXD10037.1|2918397_2918595_+	hypothetical protein	NA	NA	NA	NA	NA
AXD10038.1|2918575_2919166_-	hypothetical protein	NA	NA	NA	NA	NA
AXD10039.1|2919245_2919527_-	DUF4406 domain-containing protein	NA	A0A1I9KFD3	Aeromonas_phage	63.1	1.5e-23
AXD10040.1|2919936_2920356_+	hypothetical protein	NA	NA	NA	NA	NA
AXD10041.1|2923081_2923564_-	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
AXD12093.1|2923596_2923710_+	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
AXD10042.1|2923706_2924048_+	type II toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
AXD10043.1|2924190_2924940_-	hypothetical protein	NA	NA	NA	NA	NA
AXD10044.1|2924840_2925968_-	DUF968 domain-containing protein	NA	A0A1W6JP62	Morganella_phage	34.8	5.2e-56
AXD10045.1|2925988_2926288_-	hypothetical protein	NA	Q8W639	Enterobacteria_phage	32.9	2.0e-07
AXD10046.1|2926412_2928344_-	replication endonuclease	NA	F1BUS0	Erwinia_phage	36.5	9.8e-95
AXD10047.1|2928340_2928970_-	hypothetical protein	NA	NA	NA	NA	NA
AXD10048.1|2928976_2929765_-	hypothetical protein	NA	A0A286S260	Klebsiella_phage	37.1	3.1e-31
AXD12094.1|2929912_2930956_-	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	62.1	7.0e-47
AXD10049.1|2931313_2931787_-	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	81.6	4.6e-70
AXD10050.1|2931786_2932002_-	hypothetical protein	NA	NA	NA	NA	NA
AXD10051.1|2932462_2932705_-	hypothetical protein	NA	NA	NA	NA	NA
AXD10052.1|2932701_2933097_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	39.3	4.1e-16
AXD10053.1|2933093_2935223_-	hypothetical protein	NA	V5UQJ3	Shigella_phage	26.3	3.0e-36
AXD10054.1|2935223_2935454_-	hypothetical protein	NA	NA	NA	NA	NA
AXD10055.1|2935758_2936343_-	hypothetical protein	NA	NA	NA	NA	NA
AXD10056.1|2936347_2936539_-	hypothetical protein	NA	NA	NA	NA	NA
AXD10057.1|2936535_2936730_-	hypothetical protein	NA	NA	NA	NA	NA
AXD10058.1|2936814_2937288_+	hypothetical protein	NA	NA	NA	NA	NA
AXD10059.1|2937698_2938133_+	hypothetical protein	NA	NA	NA	NA	NA
AXD10060.1|2938244_2938763_-	transcriptional regulator	NA	NA	NA	NA	NA
AXD10061.1|2938875_2939217_+	XRE family transcriptional regulator	NA	Q1JS45	Enterobacteria_phage	44.6	7.4e-14
AXD10062.1|2939289_2940279_+|integrase	integrase	integrase	Q83VS6	Escherichia_phage	54.8	1.6e-101
AXD10063.1|2940469_2940811_+	DUF1971 domain-containing protein	NA	NA	NA	NA	NA
AXD10064.1|2940882_2941056_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
AXD10065.1|2941269_2941407_-	hypothetical protein	NA	NA	NA	NA	NA
AXD10066.1|2941757_2942219_-	YcgN family cysteine cluster protein	NA	NA	NA	NA	NA
AXD12095.1|2942296_2942956_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
AXD10067.1|2943005_2943338_-	hypothetical protein	NA	NA	NA	NA	NA
AXD10068.1|2943424_2944132_+	septum site-determining protein MinC	NA	NA	NA	NA	NA
AXD10069.1|2944155_2944968_+	septum site-determining protein MinD	NA	NA	NA	NA	NA
AXD10070.1|2944971_2945238_+	cell division topological specificity factor	NA	NA	NA	NA	NA
AXD10071.1|2945359_2946487_-	ribonuclease D	NA	NA	NA	NA	NA
AXD10072.1|2946559_2948245_-	long-chain-fatty-acid--CoA ligase FadD	NA	A0A2H4PQM9	Staphylococcus_phage	25.8	5.0e-34
2947076:2947090	attR	TTTGGCTTCTGTTGA	NA	NA	NA	NA
AXD10073.1|2948264_2948471_+	hypothetical protein	NA	NA	NA	NA	NA
AXD10074.1|2948449_2949031_-	hypothetical protein	NA	NA	NA	NA	NA
AXD10075.1|2949102_2949798_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
>prophage 3
CP030180	Salmonella enterica strain SA20100201 chromosome, complete genome	5195044	3005425	3011036	5195044	lysis	Enterobacteria_phage(33.33%)	9	NA	NA
AXD12098.1|3005425_3006238_+	cytolethal distending toxin subunit B family protein	NA	A5LH53	Enterobacteria_phage	48.4	4.6e-62
AXD12099.1|3006396_3006774_+	DUF1353 domain-containing protein	NA	I1TQ41	Pseudomonas_phage	38.2	7.4e-15
AXD10120.1|3006951_3007494_-	hypothetical protein	NA	A0A0U2S643	Escherichia_phage	65.4	6.8e-70
AXD10121.1|3007690_3008422_-	pertussis toxin-like subunit ArtA	NA	A0A0U2KD26	Escherichia_phage	52.0	2.3e-60
AXD10122.1|3008418_3008877_-	subtilase cytotoxin subunit B	NA	NA	NA	NA	NA
AXD10123.1|3008994_3009414_-	subtilase cytotoxin subunit B	NA	NA	NA	NA	NA
AXD12100.1|3010276_3010351_-	hypothetical protein	NA	NA	NA	NA	NA
AXD10124.1|3010492_3010849_-	lysozyme	NA	M9P0E5	Enterobacteria_phage	60.7	4.5e-30
AXD12101.1|3010829_3011036_-|lysis	lysis protein	lysis	H9C183	Pectobacterium_phage	46.4	3.1e-07
