The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP030202	Salmonella enterica strain SA20052327 chromosome, complete genome	4763586	658101	698759	4763586	integrase,capsid,terminase,lysis,tRNA,portal,tail,holin,plate,head	Salmonella_phage(53.49%)	50	655809:655868	688848:688948
655809:655868	attL	AACAAAAAAGCCACTCTTTAGAGTGGCTTAATTATATGATTTTAAAGCTAAAATTTGGTG	NA	NA	NA	NA
AXD36867.1|658101_659130_-|integrase	integrase	integrase	A0A218M4I3	Erwinia_phage	99.1	5.4e-193
AXD36868.1|659129_659711_-	phage repressor protein CI	NA	A0A218M4J1	Erwinia_phage	94.2	6.8e-100
AXD36869.1|659832_660096_+	hypothetical protein	NA	A0A218M4I5	Erwinia_phage	100.0	3.1e-44
AXD36870.1|660126_660636_+	hypothetical protein	NA	A0A0M4QWN1	Salmonella_phage	98.8	1.2e-89
AXD40684.1|660643_660871_+	DUF2724 domain-containing protein	NA	A0A0M4RTI3	Salmonella_phage	97.3	9.2e-37
AXD36871.1|660857_661058_+	hypothetical protein	NA	A0A0M5M7U3	Salmonella_phage	98.5	2.3e-31
AXD36872.1|661127_661355_+	DUF2732 domain-containing protein	NA	A0A218M4I9	Erwinia_phage	96.0	3.8e-30
AXD36873.1|661354_661579_+	TraR/DksA family transcriptional regulator	NA	Q6K1F5	Salmonella_virus	97.3	4.2e-34
AXD36874.1|661575_662097_+	hypothetical protein	NA	Q6K1F4	Salmonella_virus	99.4	1.0e-91
AXD40685.1|662192_664439_+	replication endonuclease	NA	A0A218M4H2	Erwinia_phage	94.5	0.0e+00
AXD36875.1|664556_664997_+	DinI family protein	NA	A0A218M4I0	Erwinia_phage	92.0	8.3e-66
AXD36876.1|665079_665811_+	hypothetical protein	NA	Q37850	Escherichia_phage	92.6	2.0e-125
AXD36877.1|666940_667945_-	hypothetical protein	NA	NA	NA	NA	NA
AXD36878.1|668022_669069_-|portal	phage portal protein	portal	S4TNX7	Salmonella_phage	99.4	4.4e-190
AXD36879.1|669068_670838_-	oxidoreductase	NA	S4TT96	Salmonella_phage	100.0	0.0e+00
AXD36880.1|671003_671858_+|capsid	capsid scaffolding protein	capsid	S4TP53	Salmonella_phage	98.6	8.9e-157
AXD36881.1|671933_673001_+|capsid	phage major capsid protein, P2 family	capsid	O80304	Escherichia_phage	89.5	2.3e-178
AXD36882.1|673004_673754_+|terminase	terminase	terminase	Q6K1I5	Salmonella_virus	88.0	1.8e-113
AXD36883.1|673847_674354_+|head	head completion/stabilization protein	head	S4TNY1	Salmonella_phage	98.8	8.6e-91
AXD36884.1|674353_674557_+|tail	phage tail protein	tail	A0A0M3ULF4	Salmonella_phage	100.0	3.6e-32
AXD36885.1|674560_674857_+|holin	holin	holin	Q6K1I2	Salmonella_virus	100.0	5.8e-47
AXD36886.1|674843_675341_+	lysozyme	NA	S4TUB1	Salmonella_phage	98.8	5.8e-92
AXD36887.1|675337_675751_+|lysis	LysB family phage lysis regulatory protein	lysis	S4TRW3	Salmonella_phage	100.0	2.6e-45
AXD36888.1|675722_675896_+|lysis	phage lysis protein	lysis	S4TNY4	Salmonella_phage	96.5	1.1e-24
AXD36889.1|675858_676326_+|tail	phage tail protein	tail	S4TTA5	Salmonella_phage	100.0	1.1e-84
AXD36890.1|676318_676768_+	phage virion morphogenesis protein	NA	S4TP59	Salmonella_phage	99.3	4.2e-73
AXD36891.1|676836_677478_+|plate	phage baseplate assembly protein V	plate	A0A0M4S6F6	Salmonella_phage	99.5	8.2e-115
AXD36892.1|677474_677822_+|plate	baseplate assembly protein	plate	S4TRW8	Salmonella_phage	100.0	2.5e-57
AXD36893.1|677828_678737_+|plate	baseplate assembly protein	plate	S4TNY7	Salmonella_phage	99.3	8.3e-161
AXD36894.1|678729_679260_+|tail	phage tail protein I	tail	S4TTA8	Salmonella_phage	98.9	1.3e-102
AXD36895.1|679270_681382_+|tail	phage tail protein	tail	A0A192Y7M1	Salmonella_phage	84.0	3.8e-209
AXD36896.1|681351_681951_+|tail	tail fiber assembly protein	tail	Q8HAB3	Salmonella_phage	97.9	8.5e-106
AXD36897.1|682085_683273_+|tail	phage tail protein	tail	Q6K1H0	Salmonella_virus	99.7	4.5e-223
AXD36898.1|683288_683807_+|tail	phage major tail tube protein	tail	S4TNZ0	Salmonella_phage	98.8	1.4e-93
AXD36899.1|683869_684205_+|tail	phage tail assembly protein	tail	S4TTB2	Salmonella_phage	100.0	1.4e-52
AXD36900.1|684201_684357_+|tail	GpE family phage tail protein	tail	Q6K1G8	Salmonella_virus	96.1	2.6e-22
AXD36901.1|684349_686794_+|tail	phage tail tape measure protein	tail	A0A0M3UL85	Salmonella_phage	91.9	0.0e+00
AXD36902.1|686808_687294_+|tail	phage tail protein	tail	Q6K1G5	Salmonella_virus	100.0	3.6e-86
AXD36903.1|687290_688460_+	phage late control D family protein	NA	A0A0M5M5V5	Salmonella_phage	98.2	5.9e-212
AXD36904.1|688526_688745_+	DNA-binding transcriptional regulator	NA	A0A2I8TV89	Erwinia_phage	98.6	9.5e-39
AXD36905.1|689103_689610_+	mismatch-specific DNA-glycosylase	NA	NA	NA	NA	NA
688848:688948	attR	AACAAAAAAGCCACTCTTTAGAGTGGCTTAATTATATGATTTTAAAGCTAAAATTTGGTGGCCCCTGCTGGACTTGAACCAGCGACCAAGCGATTATGAGT	NA	NA	NA	NA
AXD36906.1|689732_691715_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	9.0e-35
AXD36907.1|691729_693475_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.4	2.1e-72
AXD36908.1|693710_693926_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
AXD36909.1|694153_695167_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.5	2.8e-109
AXD36910.1|695070_695409_-	hypothetical protein	NA	NA	NA	NA	NA
AXD36911.1|695416_696028_-	acyl-phosphate--glycerol-3-phosphate O-acyltransferase	NA	NA	NA	NA	NA
AXD36912.1|696134_696494_+	dihydroneopterin aldolase	NA	NA	NA	NA	NA
AXD36913.1|696591_697413_+	undecaprenyl-diphosphatase	NA	NA	NA	NA	NA
AXD36914.1|697517_698759_-|tRNA	multifunctional tRNA nucleotidyltransferase/2',3'-cyclic phosphodiesterase/2' nucleotidase/2'phosphatase	tRNA	A0A0F6YPT7	Sinorhizobium_phage	47.7	1.5e-91
>prophage 2
CP030202	Salmonella enterica strain SA20052327 chromosome, complete genome	4763586	1163316	1173071	4763586		Enterobacteria_phage(83.33%)	11	NA	NA
AXD37363.1|1163316_1165650_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	84.3	0.0e+00
AXD37364.1|1165664_1165985_-	hypothetical protein	NA	NA	NA	NA	NA
AXD37365.1|1165981_1166209_-	hypothetical protein	NA	NA	NA	NA	NA
AXD37366.1|1166205_1166754_-	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	69.4	9.7e-32
AXD37367.1|1167554_1168292_+	glycoprotein 3	NA	Q7M2A2	Enterobacteria_phage	66.1	1.4e-81
AXD37368.1|1168288_1168534_+	hypothetical protein	NA	Q7M294	Enterobacteria_phage	77.8	3.7e-31
AXD37369.1|1168550_1169117_+	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	63.8	2.0e-56
AXD37370.1|1169158_1169266_-	acetyl xylan esterase	NA	NA	NA	NA	NA
AXD37371.1|1169394_1171008_+	calcineurin phosphoesterase	NA	NA	NA	NA	NA
AXD37372.1|1171010_1171850_+	HAD family hydrolase	NA	NA	NA	NA	NA
AXD37373.1|1171877_1173071_-	DUF4102 domain-containing protein	NA	A0A1B5FPC6	Escherichia_phage	49.6	5.3e-107
>prophage 3
CP030202	Salmonella enterica strain SA20052327 chromosome, complete genome	4763586	1712694	1721865	4763586	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
AXD37850.1|1712694_1713642_+	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.8	3.7e-10
AXD37851.1|1713625_1714357_+	ABC transporter permease	NA	NA	NA	NA	NA
AXD37852.1|1714337_1714445_-	hypothetical protein	NA	NA	NA	NA	NA
AXD37853.1|1714504_1715236_-	transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
AXD37854.1|1715458_1717144_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.3	4.8e-279
AXD37855.1|1717140_1717860_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AXD37856.1|1717906_1718374_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
AXD37857.1|1718430_1718961_-	DUF1307 domain-containing protein	NA	NA	NA	NA	NA
AXD37858.1|1719132_1719591_-	DUF1307 domain-containing protein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
AXD37859.1|1719831_1721865_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
>prophage 4
CP030202	Salmonella enterica strain SA20052327 chromosome, complete genome	4763586	1789956	1800463	4763586		Enterobacteria_phage(37.5%)	10	NA	NA
AXD37912.1|1789956_1791360_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	3.1e-21
AXD37913.1|1791537_1792431_+	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
AXD37914.1|1792807_1793893_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.2e-102
AXD37915.1|1793892_1794792_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.0	5.1e-30
AXD40722.1|1794839_1795718_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.8	5.1e-107
AXD37916.1|1795718_1796270_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	1.0e-52
AXD37917.1|1796275_1797250_+	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
AXD37918.1|1797265_1798039_+	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
AXD37919.1|1798043_1799123_+	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.5	1.3e-16
AXD37920.1|1799149_1800463_+	LPS biosynthesis protein	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	9.1e-52
>prophage 5
CP030202	Salmonella enterica strain SA20052327 chromosome, complete genome	4763586	1893602	1904199	4763586		Morganella_phage(25.0%)	12	NA	NA
AXD38005.1|1893602_1894076_-	peptidase	NA	A0A0F6TJ61	Escherichia_coli_O157_typing_phage	77.6	7.1e-39
AXD38006.1|1894723_1895014_-	DUF4102 domain-containing protein	NA	B7SYF8	Stenotrophomonas_phage	49.1	3.0e-08
AXD38007.1|1895385_1896183_-	protein MtfA	NA	NA	NA	NA	NA
AXD38008.1|1896663_1896825_+	hypothetical protein	NA	NA	NA	NA	NA
AXD38009.1|1896951_1897371_+	DNA polymerase V subunit UmuD	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
AXD38010.1|1897373_1898642_+	translesion error-prone DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	92.4	1.1e-227
AXD38011.1|1899095_1899308_+	cold-shock protein CspJ	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
AXD40728.1|1899318_1899507_+	cold-shock protein	NA	NA	NA	NA	NA
AXD38012.1|1899767_1900961_-	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	56.5	1.0e-110
AXD38013.1|1901608_1901920_+	hypothetical protein	NA	NA	NA	NA	NA
AXD38014.1|1901999_1902695_+	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.1	2.8e-07
AXD38015.1|1902768_1904199_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
>prophage 6
CP030202	Salmonella enterica strain SA20052327 chromosome, complete genome	4763586	2623035	2707488	4763586	integrase,transposase,protease,terminase,tRNA,tail,holin	Enterobacteria_phage(31.82%)	97	2643683:2643699	2707007:2707023
AXD38716.1|2623035_2623563_+|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
AXD38717.1|2623559_2623667_-	hypothetical protein	NA	NA	NA	NA	NA
AXD38718.1|2623872_2624319_+	DUF441 domain-containing protein	NA	NA	NA	NA	NA
AXD38719.1|2624298_2625093_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AXD38720.1|2625193_2626378_+	cyanate MFS transporter	NA	NA	NA	NA	NA
AXD38721.1|2626496_2626844_+	DUF488 domain-containing protein	NA	NA	NA	NA	NA
AXD38722.1|2626829_2627141_-	hypothetical protein	NA	NA	NA	NA	NA
AXD38723.1|2627209_2627461_-	DUF333 domain-containing protein	NA	NA	NA	NA	NA
AXD38724.1|2627656_2627755_+	hypothetical protein	NA	NA	NA	NA	NA
AXD38725.1|2627893_2628142_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
AXD38726.1|2628149_2628335_-	hypothetical protein	NA	NA	NA	NA	NA
AXD38727.1|2628456_2629098_-	hypothetical protein	NA	NA	NA	NA	NA
AXD38728.1|2629327_2629510_-	DUF1869 domain-containing protein	NA	NA	NA	NA	NA
AXD38729.1|2629512_2629875_-	DUF1971 domain-containing protein	NA	NA	NA	NA	NA
AXD38730.1|2629845_2630031_+	hypothetical protein	NA	NA	NA	NA	NA
AXD38731.1|2630047_2630686_-	leucine efflux protein	NA	NA	NA	NA	NA
AXD38732.1|2630881_2631427_-	chorismate mutase	NA	NA	NA	NA	NA
AXD38733.1|2631509_2631665_+	hypothetical protein	NA	NA	NA	NA	NA
AXD38734.1|2631743_2631992_+	histidine kinase	NA	NA	NA	NA	NA
AXD38735.1|2632246_2633095_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
AXD40761.1|2633163_2633757_-	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
AXD38736.1|2633901_2634690_-	cryptic aminoglycoside nucleotidyltransferase ANT(3'')/ANT(9)	NA	NA	NA	NA	NA
AXD38737.1|2634797_2635448_-	metal-binding protein ZinT	NA	NA	NA	NA	NA
AXD38738.1|2635641_2635968_-	four-helix bundle copper-binding protein	NA	NA	NA	NA	NA
AXD38739.1|2636161_2637295_+	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
AXD38740.1|2637376_2637967_-	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
AXD38741.1|2637960_2638758_-	ATP-binding cassette domain-containing protein	NA	A0A2R8FG22	Brazilian_cedratvirus	31.7	9.6e-12
AXD38742.1|2638751_2639564_-	ABC transporter permease	NA	NA	NA	NA	NA
AXD38743.1|2639553_2640528_-	ABC transporter permease	NA	NA	NA	NA	NA
AXD38744.1|2640527_2642162_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AXD38745.1|2642843_2643158_+	hypothetical protein	NA	NA	NA	NA	NA
AXD38746.1|2643306_2643837_+	cytochrome b	NA	A0A0U2QLA7	Escherichia_phage	70.5	2.8e-36
2643683:2643699	attL	CAGATAGCGCCCTAAAA	NA	NA	NA	NA
AXD38747.1|2643918_2644962_-	hypothetical protein	NA	NA	NA	NA	NA
AXD38748.1|2645300_2645771_-	heat-shock protein	NA	NA	NA	NA	NA
AXD38749.1|2645920_2646193_-	hypothetical protein	NA	NA	NA	NA	NA
AXD38750.1|2646392_2646518_-	hypothetical protein	NA	NA	NA	NA	NA
AXD38751.1|2646895_2647240_+	lysozyme inhibitor	NA	NA	NA	NA	NA
AXD38752.1|2648461_2649019_-	virulence membrane protein PagC	NA	Q9LA63	Enterobacterial_phage	33.0	1.0e-15
AXD38753.1|2649830_2650094_+	virulence protein PagD	NA	NA	NA	NA	NA
AXD38754.1|2650225_2650438_+	cold-shock protein CspH	NA	NA	NA	NA	NA
AXD38755.1|2650852_2651374_+	lipoprotein	NA	NA	NA	NA	NA
AXD38756.1|2651564_2651804_+	virulence protein MsgA	NA	K7P6H1	Enterobacteria_phage	87.3	1.9e-32
AXD38757.1|2652293_2653082_+	lipoprotein EnvF	NA	NA	NA	NA	NA
AXD38758.1|2655696_2656155_-|transposase	IS200/IS605 family transposase IS200F	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.0e-13
AXD38759.1|2656350_2656518_-	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	90.7	2.6e-20
AXD38760.1|2656657_2657011_+	hypothetical protein	NA	NA	NA	NA	NA
AXD40762.1|2659016_2660633_+	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AXD38761.1|2661689_2661998_-	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	56.1	3.8e-25
AXD38762.1|2663139_2663655_-|tail	phage tail protein	tail	A0A0U2QV64	Escherichia_phage	53.5	2.2e-46
AXD38763.1|2666296_2666539_-	hypothetical protein	NA	NA	NA	NA	NA
AXD38764.1|2666577_2669940_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	79.6	0.0e+00
AXD38765.1|2670001_2670649_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	78.1	9.3e-90
AXD38766.1|2671287_2671986_-|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	75.9	1.2e-103
AXD38767.1|2671995_2672325_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	71.3	1.3e-42
AXD38768.1|2675338_2675677_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	62.4	1.3e-31
AXD38769.1|2675673_2676069_-|tail	phage minor tail protein G	tail	A5LH36	Enterobacteria_phage	56.5	2.3e-30
AXD38770.1|2676119_2676866_-|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	76.9	1.9e-99
AXD38771.1|2676873_2677275_-|tail	phage tail protein	tail	A0A291AWY2	Escherichia_phage	66.2	4.2e-48
AXD38772.1|2677271_2677856_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	77.1	3.4e-75
AXD38773.1|2677859_2678135_-	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	42.9	6.0e-14
AXD38774.1|2678127_2678451_-	DUF2190 family protein	NA	K7PLV6	Enterobacteria_phage	63.2	1.0e-28
AXD38775.1|2678539_2680720_-|protease	Clp protease ClpP	protease	K7PGT6	Enterobacteria_phage	72.3	3.9e-273
AXD38776.1|2682103_2682310_-	primosomal replication protein PriB/PriC domain protein	NA	A5LH28	Enterobacteria_phage	48.6	1.1e-07
AXD38777.1|2682306_2684415_-|terminase	phage terminase large subunit family protein	terminase	Q9EYD1	Enterobacteria_phage	70.4	2.1e-292
AXD38778.1|2684401_2684893_-	DUF1441 family protein	NA	Q9EYD0	Enterobacteria_phage	57.5	4.5e-44
AXD40763.1|2684948_2685170_+	hypothetical protein	NA	NA	NA	NA	NA
AXD38779.1|2685245_2685437_+	hypothetical protein	NA	NA	NA	NA	NA
AXD38780.1|2685491_2685995_-	hypothetical protein	NA	NA	NA	NA	NA
AXD38781.1|2686097_2686640_-	DUF2514 family protein	NA	NA	NA	NA	NA
AXD38782.1|2686636_2687251_-	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	91.7	6.1e-107
AXD38783.1|2687250_2687532_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	47.3	2.2e-19
AXD38784.1|2687518_2687905_-	hypothetical protein	NA	A0A192Y8P2	Salmonella_phage	91.4	3.1e-56
AXD38785.1|2687998_2689390_-	ATP-binding protein	NA	NA	NA	NA	NA
AXD38786.1|2689532_2690111_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	56.7	2.4e-49
AXD40764.1|2690125_2691115_-	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	98.2	1.3e-191
AXD38787.1|2691122_2691923_-	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	72.2	1.1e-105
AXD38788.1|2691939_2692329_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A192Y8N5	Salmonella_phage	99.2	2.4e-69
AXD38789.1|2692325_2694146_-	DNA cytosine methyltransferase	NA	H9C171	Pectobacterium_phage	54.1	1.3e-192
AXD38790.1|2694138_2695017_-	phage N-6-adenine-methyltransferase	NA	Q8HA94	Salmonella_phage	87.4	4.5e-148
AXD38791.1|2695016_2695541_-	PerC family transcriptional regulator	NA	Q8HA95	Salmonella_phage	98.3	4.5e-95
AXD38792.1|2695500_2696460_-	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	85.0	7.0e-126
AXD38793.1|2696456_2696681_-	hypothetical protein	NA	A0A1C9II64	Salmonella_phage	100.0	3.3e-39
AXD38794.1|2696677_2697820_-	peptidase	NA	Q8HA97	Salmonella_phage	85.5	1.1e-178
AXD38795.1|2697816_2698371_-	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	100.0	6.9e-102
AXD38796.1|2698399_2698624_-	XRE family transcriptional regulator	NA	A0A1C9IHV8	Salmonella_phage	100.0	1.9e-34
AXD38797.1|2698721_2699417_+	helix-turn-helix transcriptional regulator	NA	Q8HAA0	Salmonella_phage	99.6	4.6e-127
AXD38798.1|2699829_2700060_-	hypothetical protein	NA	NA	NA	NA	NA
AXD38799.1|2700115_2700373_-	hypothetical protein	NA	A5LH65	Enterobacteria_phage	75.7	2.1e-08
AXD38800.1|2700356_2700728_+	hypothetical protein	NA	Q8HAA1	Salmonella_phage	100.0	1.1e-63
AXD38801.1|2700785_2701613_+	DUF2303 family protein	NA	Q8HAA2	Salmonella_phage	98.9	1.1e-151
AXD38802.1|2701976_2702222_+	excisionase	NA	NA	NA	NA	NA
AXD38803.1|2702202_2703330_+|integrase	integrase	integrase	Q77Z04	Phage_21	59.5	2.1e-121
AXD38804.1|2703441_2704692_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	1.1e-19
AXD38805.1|2704863_2705529_+	23S rRNA pseudouridine synthase E	NA	NA	NA	NA	NA
AXD38806.1|2705525_2705855_+	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
AXD38807.1|2705866_2706328_+	NUDIX hydrolase	NA	NA	NA	NA	NA
AXD38808.1|2706381_2707488_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
2707007:2707023	attR	TTTTAGGGCGCTATCTG	NA	NA	NA	NA
>prophage 7
CP030202	Salmonella enterica strain SA20052327 chromosome, complete genome	4763586	2852292	2941350	4763586	transposase,protease,capsid,terminase,lysis,tRNA,portal,tail,holin,head	Salmonella_phage(46.55%)	98	NA	NA
AXD38958.1|2852292_2852973_+|protease	type III secretion system effector protease PipA	protease	Q9MBM0	Phage_Gifsy-2	71.0	9.8e-82
AXD38959.1|2853591_2854251_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	52.4	2.7e-44
AXD38960.1|2854337_2854667_+	sulfurtransferase TusE	NA	NA	NA	NA	NA
AXD38961.1|2854663_2854945_-	acylphosphatase	NA	NA	NA	NA	NA
AXD38962.1|2854993_2855773_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AXD38963.1|2855798_2856347_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
AXD38964.1|2856561_2857773_+	ribosomal RNA large subunit methyltransferase I	NA	NA	NA	NA	NA
AXD38965.1|2857830_2858148_+	heat-shock protein HspQ	NA	NA	NA	NA	NA
AXD38966.1|2858192_2858609_-	CoA-binding protein	NA	NA	NA	NA	NA
AXD38967.1|2858779_2859442_+	DUF2057 family protein	NA	NA	NA	NA	NA
AXD38968.1|2859536_2859995_+	methylglyoxal synthase	NA	NA	NA	NA	NA
AXD38969.1|2860030_2862085_-	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.6	8.5e-20
AXD38970.1|2862208_2862655_+	YccF domain-containing protein	NA	NA	NA	NA	NA
AXD38971.1|2862673_2864827_+	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
AXD38972.1|2864813_2865419_-	DNA transformation protein	NA	NA	NA	NA	NA
AXD38973.1|2865635_2866145_+	cell division inhibitor SulA	NA	NA	NA	NA	NA
AXD38974.1|2866501_2867554_+	porin OmpA	NA	NA	NA	NA	NA
AXD38975.1|2867625_2868078_-	macrodomain Ter protein	NA	NA	NA	NA	NA
AXD38976.1|2868263_2870024_+|protease	Lon protease family protein	protease	NA	NA	NA	NA
AXD38977.1|2870092_2870611_+	beta-hydroxydecanoyl-ACP dehydratase	NA	NA	NA	NA	NA
AXD38978.1|2870710_2870878_-	ribosome modulation factor	NA	NA	NA	NA	NA
AXD38979.1|2871133_2871697_-	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
AXD38980.1|2871693_2873334_-	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
AXD38981.1|2873338_2874592_-	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
AXD38982.1|2874606_2876514_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
AXD38983.1|2876526_2878635_-	ribosomal RNA large subunit methyltransferase K/L	NA	NA	NA	NA	NA
AXD38984.1|2878733_2879843_+	MOSC domain-containing protein	NA	NA	NA	NA	NA
AXD38985.1|2879839_2880382_-	cell division protein ZapC	NA	NA	NA	NA	NA
AXD38986.1|2880547_2881558_-	dihydroorotate dehydrogenase (quinone)	NA	NA	NA	NA	NA
AXD38987.1|2881765_2884378_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.8	4.8e-20
AXD38988.1|2884804_2884996_+	DinI family protein	NA	S4TNM0	Salmonella_phage	93.7	2.3e-25
AXD38989.1|2885266_2885953_+	virulence protein	NA	NA	NA	NA	NA
AXD38990.1|2886031_2886151_-	hypothetical protein	NA	A0A0M4RTP2	Salmonella_phage	71.9	2.6e-06
AXD38991.1|2886888_2887155_-	hypothetical protein	NA	NA	NA	NA	NA
AXD38992.1|2887282_2887408_-	arsenic transporter	NA	NA	NA	NA	NA
AXD38993.1|2887977_2888178_+	phage virulence factor	NA	NA	NA	NA	NA
AXD38994.1|2889608_2889842_+	hypothetical protein	NA	A0A192Y6D5	Salmonella_phage	94.8	2.0e-34
AXD38995.1|2890116_2890758_+	glutathione S-transferase family protein	NA	NA	NA	NA	NA
AXD38996.1|2890928_2891447_-|tail	phage tail protein	tail	A0A0U2QV64	Escherichia_phage	53.8	5.9e-47
AXD38997.1|2891461_2894143_-	shikimate transporter	NA	A0A1B0VFW4	Salmonella_phage	64.2	2.4e-147
AXD38998.1|2894198_2894441_-	hypothetical protein	NA	NA	NA	NA	NA
AXD38999.1|2894479_2895355_-|tail	phage tail protein	tail	C6ZCZ5	Enterobacteria_phage	80.5	1.5e-50
AXD39000.1|2895470_2896049_-	hypothetical protein	NA	A5LH43	Enterobacteria_phage	72.0	1.7e-74
AXD39001.1|2897904_2898552_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	78.1	9.3e-90
AXD39002.1|2898449_2899187_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	85.0	4.0e-129
AXD39003.1|2899193_2899892_-|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	75.9	1.2e-103
AXD39004.1|2899901_2900231_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	71.3	1.3e-42
AXD39005.1|2900236_2903275_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	64.3	1.3e-290
AXD39006.1|2903246_2903585_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	62.4	1.3e-31
AXD39007.1|2903581_2903977_-|tail	phage minor tail protein G	tail	A5LH36	Enterobacteria_phage	56.5	2.3e-30
AXD39008.1|2904027_2904774_-|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	77.3	6.0e-101
AXD39009.1|2904781_2905183_-|tail	phage tail protein	tail	Q9G0F3	Phage_Gifsy-1	100.0	8.1e-52
AXD39010.1|2905179_2905758_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	80.2	3.7e-82
AXD39011.1|2905866_2906997_+|transposase	transposase	transposase	Q9G0F2	Phage_Gifsy-1	97.9	1.2e-212
AXD39012.1|2907029_2907413_-|tail	phage tail protein	tail	A0A0K2FJB7	Enterobacteria_phage	55.6	1.2e-28
AXD39013.1|2907423_2907789_-	DNA packaging protein	NA	NA	NA	NA	NA
AXD39014.1|2907846_2908875_-|capsid	minor capsid protein E	capsid	C6ZCY2	Enterobacteria_phage	61.1	1.7e-114
AXD39015.1|2908929_2909277_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	52.7	1.2e-19
AXD39016.1|2909289_2910786_-	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	52.7	4.3e-98
AXD39017.1|2910775_2912356_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	62.7	4.3e-189
AXD39018.1|2912352_2912556_-|tail	phage tail protein	tail	K7PM10	Enterobacteria_phage	73.8	1.9e-17
AXD39019.1|2912539_2914471_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.9	2.2e-259
AXD39020.1|2914442_2914988_-|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	79.9	1.9e-56
AXD39021.1|2915273_2915675_+	inhibitor of g-type lysozyme	NA	NA	NA	NA	NA
AXD40771.1|2915900_2916344_-|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	81.1	7.3e-54
AXD39022.1|2916376_2917003_-	glycoside hydrolase family 19 protein	NA	Q858F0	Salmonella_phage	80.2	2.7e-94
AXD39023.1|2917005_2917353_-|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	80.4	9.8e-46
AXD39024.1|2918218_2918404_-	hypothetical protein	NA	NA	NA	NA	NA
AXD39025.1|2918400_2919078_-	antiterminator	NA	I6PDF8	Cronobacter_phage	53.6	8.6e-62
AXD39026.1|2919074_2919602_-	HNH endonuclease	NA	Q5DMP6	Escherichia_phage	41.4	3.6e-23
AXD39027.1|2919598_2919739_-	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	70.7	6.1e-07
AXD39028.1|2919735_2920347_-	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	99.0	1.2e-91
AXD39029.1|2920349_2920556_-	hypothetical protein	NA	S4TNP0	Salmonella_phage	100.0	3.5e-35
AXD39030.1|2920555_2921158_-	DUF1367 family protein	NA	A0A0M4QX23	Salmonella_phage	98.0	1.4e-108
AXD39031.1|2921192_2921441_-	hypothetical protein	NA	A0A0U2C0C8	Salmonella_phage	98.8	8.0e-42
AXD39032.1|2921560_2921794_-	DinI family protein	NA	H6WRY5	Salmonella_phage	100.0	5.6e-37
AXD39033.1|2922063_2923056_+	peptidase M85	NA	NA	NA	NA	NA
AXD39034.1|2923082_2923616_-	ead/Ea22-like family protein	NA	Q8HAA6	Salmonella_phage	67.9	3.8e-41
AXD39035.1|2923612_2923960_-	DUF977 family protein	NA	H6WRX9	Salmonella_phage	99.1	1.3e-58
AXD39036.1|2923970_2924720_-	DNA replication protein DnaC	NA	S4TNF5	Salmonella_phage	100.0	4.3e-139
AXD39037.1|2924722_2925706_-	hypothetical protein	NA	H6WRX7	Salmonella_phage	99.0	2.0e-160
AXD39038.1|2925790_2926114_-	transcriptional regulator	NA	H6WRX6	Salmonella_phage	59.1	7.2e-27
AXD39039.1|2926133_2926370_-	Rha family transcriptional regulator	NA	A0A0M4QX15	Salmonella_phage	100.0	2.3e-38
AXD40772.1|2926473_2926857_+	helix-turn-helix domain-containing protein	NA	A0A0M4R5D1	Salmonella_phage	99.2	6.3e-62
AXD39040.1|2926884_2927286_+	helix-turn-helix domain-containing protein	NA	A0A0M4REM4	Salmonella_phage	99.2	6.8e-67
AXD39041.1|2927702_2927873_+	hypothetical protein	NA	H6WRX3	Salmonella_phage	78.8	3.3e-15
AXD39042.1|2927894_2928245_+	DNA breaking-rejoining protein	NA	S4TSN6	Salmonella_phage	97.4	1.1e-60
AXD39043.1|2928371_2931572_+	DNA breaking-rejoining protein	NA	S4TNL0	Salmonella_phage	78.7	0.0e+00
AXD39044.1|2931534_2932692_+	enterohemolysin	NA	S4TTE8	Salmonella_phage	100.0	1.6e-217
AXD39045.1|2932734_2932974_+	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
AXD39046.1|2933014_2933263_+	excisionase	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
AXD39047.1|2933307_2934600_+	DUF3596 domain-containing protein	NA	S4TSP2	Salmonella_phage	100.0	3.4e-253
AXD39048.1|2934794_2935997_+	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
AXD39049.1|2936077_2937511_-	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
AXD39050.1|2937756_2938971_-	PLP-dependent lyase/thiolase	NA	NA	NA	NA	NA
AXD39051.1|2939057_2939291_+	hypothetical protein	NA	NA	NA	NA	NA
AXD39052.1|2939287_2939749_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
AXD39053.1|2939949_2941350_+|tRNA	asparagine--tRNA ligase	tRNA	A0A167RLM0	Powai_lake_megavirus	35.1	4.5e-81
>prophage 8
CP030202	Salmonella enterica strain SA20052327 chromosome, complete genome	4763586	4098495	4109169	4763586		Enterobacteria_phage(55.56%)	13	NA	NA
AXD40072.1|4098495_4100829_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	84.7	0.0e+00
AXD40073.1|4100843_4101164_-	hypothetical protein	NA	NA	NA	NA	NA
AXD40074.1|4101160_4101388_-	hypothetical protein	NA	NA	NA	NA	NA
AXD40075.1|4101384_4101936_-	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	60.9	2.0e-24
AXD40076.1|4102736_4103474_+	glycoprotein 3	NA	Q7M2A2	Enterobacteria_phage	64.0	2.2e-79
AXD40077.1|4103470_4103716_+	hypothetical protein	NA	Q7M294	Enterobacteria_phage	76.5	6.3e-31
AXD40078.1|4103732_4104299_+	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	62.7	7.7e-56
AXD40079.1|4104262_4104448_-	hypothetical protein	NA	NA	NA	NA	NA
AXD40080.1|4104518_4105082_-	restriction endonuclease	NA	A0A1B0UXL9	Roseobacter_phage	42.9	5.5e-30
AXD40081.1|4105078_4105315_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AXD40082.1|4105370_4106366_+	site-specific DNA-methyltransferase	NA	S0A236	Cellulophaga_phage	24.2	3.5e-19
AXD40083.1|4106419_4107679_-	DUF4102 domain-containing protein	NA	B7SYF8	Stenotrophomonas_phage	41.2	3.7e-74
AXD40084.1|4108149_4109169_+	NAD(P)-dependent alcohol dehydrogenase	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	30.1	7.9e-43
>prophage 9
CP030202	Salmonella enterica strain SA20052327 chromosome, complete genome	4763586	4353614	4398389	4763586	tail,plate,tRNA	Burkholderia_phage(36.36%)	48	NA	NA
AXD40298.1|4353614_4354613_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
AXD40299.1|4354700_4356011_-	conjugal transfer protein	NA	NA	NA	NA	NA
AXD40300.1|4356257_4356773_+	transcriptional regulator Zur	NA	NA	NA	NA	NA
AXD40301.1|4356871_4357081_-	CsbD family protein	NA	NA	NA	NA	NA
AXD40830.1|4357102_4357216_-	hypothetical protein	NA	NA	NA	NA	NA
AXD40302.1|4357212_4358538_-	MATE family efflux transporter	NA	NA	NA	NA	NA
AXD40303.1|4358716_4359325_-	LexA repressor	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
AXD40304.1|4359433_4359802_-	diacylglycerol kinase	NA	NA	NA	NA	NA
AXD40305.1|4359972_4362393_+	glycerol-3-phosphate 1-O-acyltransferase	NA	NA	NA	NA	NA
AXD40306.1|4362491_4363364_-	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
AXD40307.1|4363377_4363875_-	chorismate--pyruvate lyase	NA	NA	NA	NA	NA
AXD40308.1|4364055_4364973_-	maltose operon protein MalM	NA	NA	NA	NA	NA
AXD40309.1|4365136_4366492_-	maltoporin LamB	NA	NA	NA	NA	NA
AXD40310.1|4366580_4367690_-	maltose/maltodextrin import ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	47.2	6.2e-17
AXD40311.1|4368051_4369242_+	maltose/maltodextrin ABC transporter substrate-binding protein MalE	NA	NA	NA	NA	NA
AXD40312.1|4369373_4370918_+	maltose ABC transporter permease MalF	NA	NA	NA	NA	NA
AXD40313.1|4370932_4371823_+	maltose ABC transporter permease	NA	NA	NA	NA	NA
AXD40314.1|4371988_4372399_-	phosphate-starvation-inducible protein PsiE	NA	NA	NA	NA	NA
AXD40315.1|4372541_4374638_-	YjbH domain-containing protein	NA	NA	NA	NA	NA
AXD40316.1|4374637_4375375_-	hypothetical protein	NA	NA	NA	NA	NA
AXD40317.1|4375371_4376010_-	YjbF family lipoprotein	NA	NA	NA	NA	NA
AXD40318.1|4376073_4376316_-	outer membrane protein	NA	NA	NA	NA	NA
AXD40319.1|4376759_4378409_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
AXD40320.1|4378753_4380103_+	lysine-sensitive aspartokinase 3	NA	NA	NA	NA	NA
AXD40321.1|4380233_4380581_-	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.5	4.9e-21
AXD40322.1|4381157_4381445_+	hypothetical protein	NA	Q6QIC8	Burkholderia_phage	48.1	3.0e-16
AXD40323.1|4381447_4382053_+	lytic transglycosylase domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	59.4	7.2e-60
AXD40324.1|4382065_4382380_+	hypothetical protein	NA	Q6QIC4	Burkholderia_phage	48.2	3.2e-19
AXD40325.1|4382539_4382995_+	hypothetical protein	NA	NA	NA	NA	NA
AXD40326.1|4382991_4383189_+	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	52.9	8.6e-07
AXD40327.1|4383178_4384606_+|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	70.9	1.8e-194
AXD40328.1|4384605_4385130_+|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.5	3.6e-68
AXD40329.1|4385181_4385499_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
AXD40330.1|4385458_4385587_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
AXD40331.1|4385683_4388038_+|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	30.8	2.8e-67
AXD40332.1|4388037_4388991_+	chemotaxis protein	NA	A4JWL1	Burkholderia_virus	51.5	1.0e-36
AXD40333.1|4388990_4389200_+	hypothetical protein	NA	A4JWL2	Burkholderia_virus	60.3	9.8e-17
AXD40334.1|4389187_4390231_+	phage protein D	NA	A4JWL3	Burkholderia_virus	45.9	5.0e-77
AXD40335.1|4390240_4390963_+|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	42.0	3.9e-12
AXD40336.1|4390971_4391214_+	hypothetical protein	NA	NA	NA	NA	NA
AXD40337.1|4391289_4391652_+	GtrA family protein	NA	U5P0S6	Shigella_phage	70.8	1.2e-43
AXD40338.1|4391648_4392578_+	glycosyltransferase	NA	S5FKN0	Shigella_phage	83.4	1.5e-149
AXD40339.1|4392577_4394125_+	hypothetical protein	NA	B9UDL6	Salmonella_phage	29.9	1.1e-48
AXD40340.1|4394288_4394648_+|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	64.2	2.8e-35
AXD40341.1|4394638_4395754_+|plate	baseplate protein	plate	Q6QI99	Burkholderia_phage	52.2	1.8e-101
AXD40342.1|4395746_4396379_+|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	56.4	6.6e-24
AXD40343.1|4396381_4397863_+|tail	phage tail protein	tail	A0A0M3ULF6	Salmonella_phage	51.7	1.3e-51
AXD40344.1|4397873_4398389_+|tail	tail fiber assembly protein	tail	A0A0U2QV64	Escherichia_phage	40.7	1.3e-33
