The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP030002	Salmonella enterica subsp. enterica strain SA20064858 chromosome, complete genome	4677648	608490	680274	4677648	capsid,tRNA,plate,holin,portal,terminase,head,integrase,transposase,tail,lysis	Escherichia_phage(23.08%)	83	599889:599948	646705:648033
599889:599948	attL	CTGATGAATCCCCTAATGATTTTGGTAAAAATCATTAAGTTAAGGTGGATACACATCTTG	NA	NA	NA	NA
AXC93911.1|608490_609699_-|transposase	IS4-like element ISVsa5 family transposase	transposase	Q9E8P4	Bluetongue_virus	99.5	4.4e-234
AXC93912.1|609638_610124_-	hypothetical protein	NA	A0A218M4H2	Erwinia_phage	97.1	4.9e-51
AXC93913.1|610137_610446_-	DUF3850 domain-containing protein	NA	C9E2N9	Enterococcus_phage	45.9	2.1e-07
AXC93914.1|610442_610670_-	TraR/DksA family transcriptional regulator	NA	A0A1S6L007	Salmonella_phage	70.7	3.1e-24
AXC93915.1|610669_610903_-	DUF2732 domain-containing protein	NA	Q6K1F6	Salmonella_virus	77.9	1.1e-24
AXC93916.1|610969_611170_-	hypothetical protein	NA	A0A0M5M7U3	Salmonella_phage	92.4	3.7e-29
AXC93917.1|611156_611384_-	DUF2724 domain-containing protein	NA	A0A0M4RTI3	Salmonella_phage	90.7	7.3e-34
AXC93918.1|611391_611901_-	hypothetical protein	NA	A0A0M4QWN1	Salmonella_phage	99.4	4.3e-90
AXC93919.1|611931_612195_-	hypothetical protein	NA	A0A218M4I5	Erwinia_phage	100.0	3.1e-44
AXC93920.1|612327_612903_+	phage repressor protein CI	NA	A0A218M4J1	Erwinia_phage	66.0	8.9e-68
AXC93921.1|612902_613940_+|integrase	integrase	integrase	A0A218M4I3	Erwinia_phage	87.1	8.8e-175
AXC97680.1|613941_615267_+	hypothetical protein	NA	NA	NA	NA	NA
AXC93922.1|615570_616338_-	siderophore-interacting protein	NA	NA	NA	NA	NA
AXC93923.1|616569_617217_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
AXC93924.1|617213_618782_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	33.5	2.2e-12
AXC93925.1|619169_620690_-	PAS domain S-box protein	NA	A0A1B0V854	Salmonella_phage	47.8	8.4e-33
AXC93926.1|620977_621160_+	hypothetical protein	NA	NA	NA	NA	NA
AXC93927.1|621119_622499_+	putrescine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	29.0	2.9e-32
AXC93928.1|622669_624688_+	NADPH-dependent 2,4-dienoyl-CoA reductase	NA	NA	NA	NA	NA
AXC93929.1|624768_625905_-	23S rRNA (guanine(1835)-N(2))-methyltransferase RlmG	NA	NA	NA	NA	NA
AXC93930.1|625990_626488_+	M48 family peptidase	NA	NA	NA	NA	NA
AXC93931.1|626639_627332_+	vancomycin high temperature exclusion protein	NA	NA	NA	NA	NA
AXC93932.1|627420_628419_+	gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
AXC93933.1|628688_629657_+	hypothetical protein	NA	I7HPH5	Enterobacteria_phage	34.9	5.0e-39
AXC93934.1|629911_631156_+	serine/threonine transporter SstT	NA	NA	NA	NA	NA
AXC93935.1|631152_631353_-	hypothetical protein	NA	NA	NA	NA	NA
AXC93936.1|631605_632268_+	DedA family protein	NA	NA	NA	NA	NA
AXC93937.1|632271_632655_+	EnvZ/OmpR regulon moderator MzrA	NA	NA	NA	NA	NA
AXC93938.1|632799_633168_+	DUF1090 domain-containing protein	NA	NA	NA	NA	NA
AXC93939.1|633209_633515_+	DUF883 domain-containing protein	NA	NA	NA	NA	NA
AXC93940.1|633517_633916_+	hypothetical protein	NA	NA	NA	NA	NA
AXC93941.1|633912_634212_+	hypothetical protein	NA	NA	NA	NA	NA
AXC93942.1|634366_634852_+	DoxX family protein	NA	NA	NA	NA	NA
AXC93943.1|634919_635906_+	glutathione S-transferase family protein	NA	NA	NA	NA	NA
AXC93944.1|636029_636395_+	DUF805 domain-containing protein	NA	NA	NA	NA	NA
AXC93945.1|636433_637330_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AXC93946.1|637434_638136_+	pirin family protein	NA	NA	NA	NA	NA
AXC93947.1|638159_638324_+	hypothetical protein	NA	NA	NA	NA	NA
AXC93948.1|638436_639747_-	serine dehydratase subunit alpha family protein	NA	NA	NA	NA	NA
AXC97681.1|639772_641104_-	hypothetical protein	NA	NA	NA	NA	NA
AXC93949.1|641419_642784_-	L-serine ammonia-lyase	NA	NA	NA	NA	NA
AXC93950.1|642853_645148_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.2	5.7e-158
AXC93951.1|645181_646390_-	propionate kinase	NA	NA	NA	NA	NA
AXC93952.1|646811_648020_+|transposase	IS4-like element ISVsa5 family transposase	transposase	Q9E8P4	Bluetongue_virus	99.8	8.8e-235
AXC93953.1|650081_650522_+	DinI family protein	NA	A0A218M4I0	Erwinia_phage	92.0	5.4e-65
646705:648033	attR	CTGATGAATCCCCTAATGATTTTGGTAAAAATCATTAAGTTAAGGTGGATACACATCTTGTCATATGATCAAATGGTTTCGCGAAAAATCAATAATCAGACAACAAGATGTGCGAACTCGATATTTTACACGACTCTCTTTACCAATTCTGCCCCGAATTACACTTAAAACGACTCAACAGCTTAACGTTGGCTTGCCACGCATTACTTGACTGTAAAACTCTCACTCTTACCGAACTTGGCCGTAACCTGCCAACCAAAGCGAGAACAAAACATAACATCAAACGAATCGACCGATTGTTAGGTAATCGTCACCTCCACAAAGAGCGACTCGCTGTATACCGTTGGCATGCTAGCTTTATCTGTTCGGGCAATACGATGCCCATTGTACTTGTTGACTGGTCTGATATTCGTGAGCAAAAACGACTTATGGTATTGCGAGCTTCAGTCGCACTACACGGTCGTTCTGTTACTCTTTATGAGAAAGCGTTCCCGCTTTCAGAGCAATGTTCAAAGAAAGCTCATGACCAATTTCTAGCCGACCTTGCGAGCATTCTACCGAGTAACACCACACCGCTCATTGTCAGTGATGCTGGCTTTAAAGTGCCATGGTATAAATCCGTTGAGAAGCTGGGTTGGTACTGGTTAAGTCGAGTAAGAGGAAAAGTACAATATGCAGACCTAGGAGCGAAAAACTGGAAACCTATCAGCAACTTACATGATATGTCATCTAGTCACTCAAAGACTTTAGGCTATAAGAGGCTGACTAAAAGCAATCCAATCTCATGCCAAATTCTATTGTATAAATCTCGCTCTAAAGGCCGAAAAAATCAGCGCTCGACACGGACTCATTGTCACCACCCGTCACCTAAAATCTACTCAGCGTCGGCAAAGGAGCCATGGGTTCTAGCAACTAACTTACCTGTTGAAATTCGAACACCCAAACAACTTGTTAATATCTATTCGAAGCGAATGCAGATTGAAGAAACCTTCCGAGACTTGAAAAGTCCTGCCTACGGACTAGGCCTACGCCATAGCCGAACGAGCAGCTCAGAGCGTTTTGATATCATGCTGCTAATCGCCCTGATGCTTCAACTAACATGTTGGCTTGCGGGCGTTCATGCTCAGAAACAAGGTTGGGACAAGCACTTCCAGGCTAACACAGTCAGAAATCGAAACGTACTCTCAACAGTTCGCTTAGGCATGGAAGTTTTGCGGCATTCTGGCTACACAATAACAAGGGAAGACTTACTCGTGGCTGCAACCCTACTAGCTCAAAATTTATTCACACATGGTTACGCTTTGGGGAAATTATGAGGGGATCTCTCAG	NA	NA	NA	NA
AXC93954.1|650804_651104_+	hypothetical protein	NA	NA	NA	NA	NA
AXC93955.1|651140_651449_+	XRE family transcriptional regulator	NA	E5E3S9	Burkholderia_phage	39.2	2.2e-12
AXC93956.1|651426_652377_+	RNA-directed DNA polymerase	NA	E5E3S8	Burkholderia_phage	37.7	2.3e-36
AXC93957.1|652516_652948_-	hypothetical protein	NA	S4TUD6	Salmonella_phage	95.1	1.4e-70
AXC93958.1|652946_653141_+	hypothetical protein	NA	S4TRZ0	Salmonella_phage	92.2	3.4e-24
AXC93959.1|653171_653441_-	hypothetical protein	NA	Q2P9X2	Enterobacteria_phage	82.6	1.1e-25
AXC93960.1|653660_654698_-|portal	phage portal protein	portal	Q6K1J0	Salmonella_virus	79.3	2.0e-163
AXC93961.1|654697_656467_-	oxidoreductase	NA	Q9T0R3	Escherichia_phage	81.2	1.5e-286
AXC93962.1|656631_657495_+|capsid	GPO family capsid scaffolding protein	capsid	A0A218M4L9	Erwinia_phage	76.3	2.2e-118
AXC93963.1|657526_658687_+|capsid	phage major capsid protein, P2 family	capsid	A0A0M4R4W2	Salmonella_phage	62.8	9.6e-130
AXC93964.1|658690_659449_+|terminase	terminase	terminase	Q94MJ2	Enterobacteria_phage	66.3	2.3e-79
AXC93965.1|659546_660047_+|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	68.5	3.8e-59
AXC93966.1|660046_660250_+|tail	phage tail protein	tail	U5N3E7	Enterobacteria_phage	76.1	8.9e-23
AXC93967.1|660240_660462_+	primosomal protein	NA	A0A218M4L5	Erwinia_phage	71.2	5.1e-24
AXC93968.1|660445_660955_+	lysozyme	NA	A0A218M4K3	Erwinia_phage	82.6	4.6e-76
AXC93969.1|660951_661365_+|lysis	LysB family phage lysis regulatory protein	lysis	O80310	Escherichia_phage	60.6	1.3e-36
AXC93970.1|661264_661510_+|holin	holin	holin	S4TNY4	Salmonella_phage	73.1	2.5e-27
AXC93971.1|661472_661940_+|tail	phage tail protein	tail	U5N0S7	Enterobacteria_phage	69.7	1.1e-55
AXC93972.1|661932_662382_+	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	69.4	1.0e-50
AXC93973.1|662450_663092_+|plate	phage baseplate assembly protein V	plate	Q6K1H6	Salmonella_virus	82.2	3.8e-96
AXC93974.1|663088_663436_+|plate	baseplate assembly protein	plate	A0A0F7LDQ1	Escherichia_phage	70.4	2.8e-40
AXC93975.1|663440_664349_+|plate	baseplate assembly protein	plate	Q37840	Escherichia_phage	83.8	2.6e-138
AXC93976.1|664341_664875_+|tail	phage tail protein I	tail	Q37841	Escherichia_phage	88.6	5.6e-93
AXC93977.1|664882_666628_+|tail	phage tail protein	tail	Q37842	Escherichia_phage	75.5	9.2e-92
AXC93978.1|666630_667155_+|tail	tail fiber assembly protein	tail	NA	NA	NA	NA
AXC93979.1|667284_668472_+|tail	phage tail protein	tail	A0A0F7LBW9	Escherichia_phage	82.8	1.1e-189
AXC93980.1|668484_669003_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	75.6	2.0e-71
AXC93981.1|669065_669347_+|tail	phage tail assembly protein	tail	A0A0F7LBN9	Escherichia_phage	79.1	4.7e-30
AXC93982.1|669379_669499_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	84.6	3.7e-13
AXC93983.1|669491_671921_+|tail	phage tail tape measure protein	tail	Q858U7	Yersinia_virus	70.6	2.3e-266
AXC93984.1|671932_672397_+|tail	phage tail protein	tail	A0A0F7LBX3	Escherichia_phage	75.5	5.9e-62
AXC93985.1|672399_673593_+	phage late control D family protein	NA	Q6K1G4	Salmonella_virus	78.4	2.3e-166
AXC93986.1|673632_673851_+	DNA-binding transcriptional regulator	NA	A0A2I8TV89	Erwinia_phage	86.1	4.6e-33
AXC93987.1|674209_674716_+	mismatch-specific DNA-glycosylase	NA	NA	NA	NA	NA
AXC93988.1|674839_676822_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	9.0e-35
AXC93989.1|676836_678582_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.4	2.1e-72
AXC93990.1|678817_679033_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
AXC93991.1|679260_680274_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.5	2.2e-109
>prophage 2
CP030002	Salmonella enterica subsp. enterica strain SA20064858 chromosome, complete genome	4677648	1184176	1247492	4677648	capsid,tRNA,holin,portal,terminase,head,integrase,tail	Cronobacter_phage(57.89%)	63	1192154:1192169	1221531:1221546
AXC94454.1|1184176_1184944_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
AXC94455.1|1184984_1185332_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
AXC94456.1|1185488_1186709_-	diguanylate cyclase	NA	A0A2K8I9Y5	Pseudomonas_phage	37.0	1.7e-07
AXC94457.1|1186701_1187220_-	YfiR family protein	NA	NA	NA	NA	NA
AXC94458.1|1187659_1188730_+	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.8	2.4e-90
AXC94459.1|1188739_1189861_+	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
AXC94460.1|1189918_1190827_+	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
AXC94461.1|1190787_1191948_-	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
AXC97701.1|1192047_1192095_-	hypothetical protein	NA	NA	NA	NA	NA
1192154:1192169	attL	AAAACGCGCCCGAAGG	NA	NA	NA	NA
AXC94462.1|1192258_1193278_-|integrase	integrase	integrase	A0A0F7LBR0	Escherichia_phage	58.2	1.4e-108
AXC94463.1|1193317_1193623_-	XRE family transcriptional regulator	NA	A0A0M5M1I9	Salmonella_phage	47.5	1.6e-15
AXC94464.1|1193720_1194059_+	hypothetical protein	NA	NA	NA	NA	NA
AXC94465.1|1194084_1194417_+	hypothetical protein	NA	NA	NA	NA	NA
AXC94466.1|1194426_1194996_+	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	46.3	2.6e-43
AXC94467.1|1194998_1195217_+	hypothetical protein	NA	NA	NA	NA	NA
AXC94468.1|1195255_1197913_+	bifunctional DNA primase/helicase	NA	A0A077K8T2	Ralstonia_phage	47.5	1.2e-244
AXC94469.1|1197940_1198264_-	transcriptional regulator	NA	F1BUM8	Cronobacter_phage	73.1	1.3e-36
AXC94470.1|1198263_1199283_-|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	68.5	1.3e-135
AXC94471.1|1199279_1201064_-|terminase	terminase	terminase	F1BUM5	Cronobacter_phage	69.7	1.8e-247
AXC94472.1|1201121_1202111_+|capsid	phage capsid protein	capsid	F1BUM4	Cronobacter_phage	52.3	2.5e-46
AXC94473.1|1202145_1203174_+|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	71.6	3.7e-133
AXC94474.1|1203185_1203884_+|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	52.6	3.6e-63
AXC94475.1|1203982_1204435_+|head	head completion protein	head	F1BUL8	Cronobacter_phage	64.7	1.2e-48
AXC94476.1|1204431_1204914_+|tail	phage tail protein	tail	F1BUL7	Cronobacter_phage	48.7	2.3e-37
AXC94477.1|1204910_1205615_+	hypothetical protein	NA	F1BUL6	Cronobacter_phage	59.5	4.0e-70
AXC94478.1|1205611_1206739_+	DUF2586 domain-containing protein	NA	F1BUL5	Cronobacter_phage	82.9	8.1e-174
AXC94479.1|1206735_1207191_+	DUF2597 family protein	NA	F1BUL4	Cronobacter_phage	71.5	1.7e-58
AXC94480.1|1207203_1207500_+|holin	holin	holin	C7BGD7	Burkholderia_phage	48.2	2.4e-16
AXC94481.1|1207496_1207838_+	M15 family peptidase	NA	F1BUL3	Cronobacter_phage	91.1	2.2e-50
AXC94482.1|1207837_1208170_+	hypothetical protein	NA	F1BUL2	Cronobacter_phage	70.0	2.6e-35
AXC94483.1|1208096_1208330_+	hypothetical protein	NA	F1BUL1	Cronobacter_phage	83.1	1.7e-30
AXC94484.1|1208307_1208574_+	hypothetical protein	NA	A5X9I7	Aeromonas_virus	61.0	2.4e-20
AXC94485.1|1208761_1210729_+|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	70.7	1.9e-271
AXC94486.1|1210725_1211055_+	DUF2590 family protein	NA	F1BUK8	Cronobacter_phage	72.4	3.8e-39
AXC94487.1|1211051_1212236_+	hypothetical protein	NA	F1BUK6	Cronobacter_phage	78.6	5.1e-179
AXC94488.1|1212222_1212816_+	hypothetical protein	NA	F1BUK5	Cronobacter_phage	82.1	1.4e-89
AXC94489.1|1212825_1214838_+|tail	phage tail protein	tail	F1BUK3	Cronobacter_phage	81.2	2.1e-148
AXC94490.1|1214840_1215371_+|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	32.4	4.4e-13
AXC94491.1|1215360_1216086_+	hypothetical protein	NA	F1BUK1	Cronobacter_phage	56.4	3.8e-68
AXC94492.1|1216057_1216603_+	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	71.4	3.5e-58
AXC94493.1|1216602_1218306_+	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	81.3	1.7e-223
AXC94494.1|1219423_1220896_+	hypothetical protein	NA	NA	NA	NA	NA
AXC94495.1|1221031_1221418_-	hypothetical protein	NA	NA	NA	NA	NA
AXC94496.1|1221575_1221914_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
1221531:1221546	attR	AAAACGCGCCCGAAGG	NA	NA	NA	NA
AXC94497.1|1222185_1222923_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
AXC94498.1|1223054_1224035_+	ribosomal large subunit pseudouridine synthase D	NA	NA	NA	NA	NA
AXC94499.1|1224031_1224763_+	peptidoglycan editing factor PgeF	NA	NA	NA	NA	NA
AXC94500.1|1224892_1227466_+	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.5	3.4e-127
AXC94501.1|1227661_1227862_-	hypothetical protein	NA	NA	NA	NA	NA
AXC94502.1|1233292_1233748_+	DUF4385 domain-containing protein	NA	E3SMI8	Prochlorococcus_phage	49.3	8.6e-34
AXC94503.1|1233851_1235153_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	30.4	1.2e-43
AXC94504.1|1235149_1235473_-	YfiM family lipoprotein	NA	NA	NA	NA	NA
AXC94505.1|1235517_1236873_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
AXC94506.1|1236987_1239648_-	protein lysine acetyltransferase Pat	NA	NA	NA	NA	NA
AXC94507.1|1239701_1240382_-	DTW domain-containing protein	NA	NA	NA	NA	NA
AXC94508.1|1240454_1240874_-	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	40.6	1.2e-16
AXC94509.1|1241077_1242115_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
AXC94510.1|1242230_1242920_-	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	49.5	4.6e-55
AXC94511.1|1243238_1243622_+	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	74.0	6.1e-33
AXC94512.1|1243683_1244271_-	cysteine/O-acetylserine efflux protein	NA	NA	NA	NA	NA
AXC97702.1|1244373_1245273_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AXC94513.1|1245290_1246625_-	ATP-dependent RNA helicase SrmB	NA	A0A1B1IS59	uncultured_Mediterranean_phage	29.7	1.6e-43
AXC94514.1|1246754_1247492_+|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase	tRNA	NA	NA	NA	NA
>prophage 3
CP030002	Salmonella enterica subsp. enterica strain SA20064858 chromosome, complete genome	4677648	1700331	1709502	4677648	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
AXC94918.1|1700331_1701279_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	1.7e-23
AXC94919.1|1701262_1701994_+	ABC transporter permease	NA	NA	NA	NA	NA
AXC94920.1|1701974_1702082_-	hypothetical protein	NA	NA	NA	NA	NA
AXC94921.1|1702141_1702873_-	transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
AXC94922.1|1703095_1704781_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.3	4.8e-279
AXC94923.1|1704777_1705497_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AXC94924.1|1705543_1706011_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
AXC94925.1|1706067_1706598_-	DUF1307 domain-containing protein	NA	NA	NA	NA	NA
AXC94926.1|1706769_1707228_-	DUF1307 domain-containing protein	NA	Q9EYF5	Enterobacteria_phage	73.2	7.6e-54
AXC94927.1|1707468_1709502_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	6.1e-55
>prophage 4
CP030002	Salmonella enterica subsp. enterica strain SA20064858 chromosome, complete genome	4677648	1776694	1787201	4677648		Enterobacteria_phage(37.5%)	10	NA	NA
AXC94982.1|1776694_1778098_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	2.3e-21
AXC94983.1|1778275_1779169_+	UTP--glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
AXC94984.1|1779545_1780631_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.6e-102
AXC94985.1|1780630_1781530_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.0	6.7e-30
AXC97717.1|1781577_1782456_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	65.5	2.7e-108
AXC94986.1|1782456_1783008_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	1.3e-52
AXC94987.1|1783013_1783988_+	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
AXC94988.1|1784003_1784777_+	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
AXC94989.1|1784781_1785861_+	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.5	2.3e-16
AXC94990.1|1785887_1787201_+	lipopolysaccharide biosynthesis protein RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
>prophage 5
CP030002	Salmonella enterica subsp. enterica strain SA20064858 chromosome, complete genome	4677648	1869743	1876979	4677648		Morganella_phage(33.33%)	8	NA	NA
AXC95072.1|1869743_1870163_+	DNA polymerase V subunit UmuD	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
AXC95073.1|1870165_1871434_+	translesion error-prone DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	92.4	1.4e-227
AXC95074.1|1871888_1872101_+	cold-shock protein CspJ	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
AXC97721.1|1872111_1872300_+	cold-shock protein	NA	NA	NA	NA	NA
AXC95075.1|1872560_1873739_-	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	57.0	2.5e-109
AXC95076.1|1874388_1874688_+	hypothetical protein	NA	NA	NA	NA	NA
AXC95077.1|1874779_1875475_+	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.1	2.8e-07
AXC95078.1|1875548_1876979_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
>prophage 6
CP030002	Salmonella enterica subsp. enterica strain SA20064858 chromosome, complete genome	4677648	2163027	2169684	4677648		Salmonella_phage(33.33%)	9	NA	NA
AXC95363.1|2163027_2163834_-	peptide ABC transporter ATP-binding protein SapF	NA	G3M9Y6	Bacillus_virus	27.4	4.6e-14
AXC95364.1|2163835_2164828_-	peptide ABC transporter ATP-binding protein SapD	NA	NA	NA	NA	NA
AXC95365.1|2164827_2165718_-	peptide ABC transporter permease SapC	NA	NA	NA	NA	NA
AXC95366.1|2166540_2167263_-	hypothetical protein	NA	A0A0P0ZCT1	Stx2-converting_phage	38.9	4.3e-35
AXC95367.1|2167733_2167916_+	hypothetical protein	NA	S4TSR3	Salmonella_phage	77.6	1.0e-22
AXC95368.1|2168165_2168306_+	pertussis toxin subunit	NA	A0A0U2KD26	Escherichia_phage	77.1	6.5e-09
AXC95369.1|2168344_2168644_+	pertussis toxin subunit	NA	A0A0U2KD26	Escherichia_phage	54.3	3.2e-13
AXC95370.1|2168570_2168996_+	subtilase cytotoxin subunit B-like protein	NA	NA	NA	NA	NA
AXC95371.1|2169369_2169684_+	recombinase family protein	NA	A0A1S6L009	Salmonella_phage	86.1	4.3e-40
>prophage 7
CP030002	Salmonella enterica subsp. enterica strain SA20064858 chromosome, complete genome	4677648	2645418	2652656	4677648		Escherichia_phage(42.86%)	8	NA	NA
AXC95835.1|2645418_2645658_+	virulence protein MsgA	NA	K7P6H1	Enterobacteria_phage	88.6	8.5e-33
AXC97753.1|2646537_2647347_+	cytolethal distending toxin subunit B family protein	NA	A5LH53	Enterobacteria_phage	50.0	2.1e-62
AXC95836.1|2647419_2647797_+	DUF1353 domain-containing protein	NA	I1TQ41	Pseudomonas_phage	38.4	2.2e-14
AXC95837.1|2647944_2648487_-	hypothetical protein	NA	A0A0U2S643	Escherichia_phage	67.0	6.2e-71
AXC95838.1|2648670_2649399_-	pertussis toxin-like subunit ArtA	NA	A0A0U2KD26	Escherichia_phage	52.5	1.2e-61
AXC95839.1|2649415_2649829_-	subtilase cytotoxin subunit B	NA	A0A0U2KD34	Escherichia_phage	37.7	5.5e-19
AXC95840.1|2650873_2651998_-	DUF3626 domain-containing protein	NA	NA	NA	NA	NA
AXC95841.1|2652443_2652656_-	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	90.7	2.5e-20
>prophage 8
CP030002	Salmonella enterica subsp. enterica strain SA20064858 chromosome, complete genome	4677648	2657934	2705752	4677648	capsid,tRNA,portal,head,terminase,integrase,transposase,tail,lysis	Enterobacteria_phage(38.1%)	63	2652392:2652407	2701653:2701668
2652392:2652407	attL	TAATAAAAACGGGAAC	NA	NA	NA	NA
AXC95845.1|2657934_2658051_+|tail	phage tail protein	tail	NA	NA	NA	NA
AXC95846.1|2658241_2658442_+	phage virulence factor	NA	NA	NA	NA	NA
AXC95847.1|2658539_2659124_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	84.8	1.7e-87
AXC95848.1|2659123_2661565_-|tail	phage tail protein	tail	A0A0K2FIZ6	Escherichia_phage	62.0	7.3e-87
AXC95849.1|2661618_2661861_-	hypothetical protein	NA	NA	NA	NA	NA
AXC95850.1|2661899_2665262_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	79.9	0.0e+00
AXC95851.1|2665323_2665971_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	78.1	9.3e-90
AXC95852.1|2665868_2666606_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	84.6	1.2e-128
AXC95853.1|2666612_2667311_-|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	75.4	7.9e-103
AXC95854.1|2667320_2667650_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	71.3	7.3e-43
AXC95855.1|2667652_2670748_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	61.6	6.3e-277
AXC95856.1|2670719_2671058_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	62.4	1.3e-31
AXC95857.1|2671054_2671450_-|tail	phage minor tail protein G	tail	A5LH36	Enterobacteria_phage	56.5	2.3e-30
AXC95858.1|2671500_2672247_-|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	76.9	1.9e-99
AXC95859.1|2672254_2672656_-|tail	phage tail protein	tail	Q9G0F3	Phage_Gifsy-1	100.0	8.1e-52
AXC95860.1|2672764_2673895_+|transposase	transposase	transposase	Q9G0F2	Phage_Gifsy-1	99.2	1.9e-215
AXC95861.1|2673943_2674522_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	80.7	1.7e-82
AXC95862.1|2674549_2674933_-|tail	phage tail protein	tail	A0A0K2FJB7	Enterobacteria_phage	55.6	9.2e-29
AXC95863.1|2674943_2675309_-	DNA packaging protein	NA	NA	NA	NA	NA
AXC95864.1|2675366_2676395_-|capsid	minor capsid protein E	capsid	C6ZCY2	Enterobacteria_phage	61.1	1.7e-114
AXC95865.1|2676449_2676797_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	52.7	9.2e-20
AXC95866.1|2676809_2678306_-	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	52.7	4.3e-98
AXC95867.1|2678295_2679876_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	62.8	9.6e-189
AXC95868.1|2679872_2680076_-|tail	phage tail protein	tail	K7PM10	Enterobacteria_phage	72.3	9.5e-17
AXC95869.1|2680059_2681991_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.7	1.8e-258
AXC95870.1|2681962_2682508_-|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	80.6	1.5e-56
AXC95871.1|2682552_2682759_-	hypothetical protein	NA	NA	NA	NA	NA
AXC95872.1|2682793_2683195_+	inhibitor of g-type lysozyme	NA	NA	NA	NA	NA
AXC95873.1|2683421_2683886_-|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	84.7	1.8e-58
AXC95874.1|2683986_2684526_-	lysozyme	NA	S5MQK2	Escherichia_phage	74.1	4.4e-77
AXC97754.1|2684503_2684806_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
AXC97755.1|2685055_2685511_+	DUF2441 domain-containing protein	NA	NA	NA	NA	NA
AXC95875.1|2685522_2685741_-	hypothetical protein	NA	NA	NA	NA	NA
AXC95876.1|2685894_2686083_-	hypothetical protein	NA	NA	NA	NA	NA
AXC95877.1|2686217_2686406_+	hypothetical protein	NA	NA	NA	NA	NA
AXC95878.1|2686325_2686883_-	ORF6N domain-containing protein	NA	A0A0N7C203	Escherichia_phage	78.5	9.5e-51
AXC95879.1|2686932_2687157_-	hypothetical protein	NA	NA	NA	NA	NA
AXC95880.1|2687153_2687708_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	65.3	3.4e-64
AXC95881.1|2687704_2688001_-	DUF1364 family protein	NA	K7P7Q1	Enterobacteria_phage	79.1	3.9e-35
AXC95882.1|2687982_2688177_-	hypothetical protein	NA	S4TNP0	Salmonella_phage	61.5	1.4e-12
AXC95883.1|2688173_2688773_-	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	82.9	3.3e-97
AXC95884.1|2688836_2689085_-	hypothetical protein	NA	NA	NA	NA	NA
AXC95885.1|2689618_2690125_-	hypothetical protein	NA	NA	NA	NA	NA
AXC95886.1|2690427_2690805_-	DUF977 family protein	NA	A0A088CBK9	Shigella_phage	36.1	2.2e-14
AXC95887.1|2690822_2691575_-	DNA replication protein DnaC	NA	A0A088CBP4	Shigella_phage	76.1	8.5e-103
AXC95888.1|2691581_2692451_-	DNA-binding protein	NA	A0A088CD36	Shigella_phage	58.5	6.9e-32
AXC95889.1|2692495_2692990_-	hypothetical protein	NA	NA	NA	NA	NA
AXC95890.1|2692976_2693231_-	XRE family transcriptional regulator	NA	K7PKH4	Enterobacteria_phage	60.9	5.3e-17
AXC95891.1|2693327_2693753_+	helix-turn-helix domain-containing protein	NA	K7PH71	Enterobacterial_phage	56.3	9.3e-14
AXC95892.1|2694063_2694219_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	55.3	4.7e-08
AXC95893.1|2694597_2694882_+	hypothetical protein	NA	K7PGY4	Enterobacteria_phage	53.2	1.7e-08
AXC95894.1|2694956_2695292_+	hypothetical protein	NA	NA	NA	NA	NA
AXC95895.1|2695432_2698123_+	exodeoxyribonuclease VIII	NA	Q9QF34	Lambdoid_phage	83.5	6.8e-118
AXC95896.1|2698980_2699301_+	hypothetical protein	NA	A0A222YY67	Escherichia_phage	59.2	1.8e-33
AXC95897.1|2699293_2699626_+	hypothetical protein	NA	S4TNP2	Salmonella_phage	81.8	8.8e-20
AXC95898.1|2699622_2700174_+	Eaa protein	NA	A0A192Y7X3	Salmonella_phage	34.5	2.8e-10
AXC95899.1|2700223_2700460_+	excisionase	NA	NA	NA	NA	NA
AXC95900.1|2700449_2701592_+|integrase	integrase	integrase	O21929	Phage_21	80.0	1.8e-173
AXC95901.1|2701705_2702956_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	90.7	1.1e-19
2701653:2701668	attR	TAATAAAAACGGGAAC	NA	NA	NA	NA
AXC95902.1|2703127_2703793_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
AXC95903.1|2703789_2704119_+	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
AXC95904.1|2704130_2704592_+	NUDIX hydrolase	NA	NA	NA	NA	NA
AXC95905.1|2704645_2705752_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
>prophage 9
CP030002	Salmonella enterica subsp. enterica strain SA20064858 chromosome, complete genome	4677648	4432746	4467472	4677648	capsid,holin,head,terminase,portal,integrase,tail	Cronobacter_phage(63.33%)	41	4432038:4432082	4462847:4462891
4432038:4432082	attL	GATAAAAAAAACCCCCACATCATGTGGGGGAAGACAGGGATGGTG	NA	NA	NA	NA
AXC97433.1|4432746_4434471_-	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	63.0	1.3e-175
AXC97434.1|4434478_4435021_-	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	56.0	7.1e-43
AXC97435.1|4434992_4435715_-	hypothetical protein	NA	F1BUK1	Cronobacter_phage	40.3	1.2e-40
AXC97436.1|4435704_4436292_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	55.5	1.0e-58
AXC97437.1|4436291_4438238_-|tail	phage tail protein	tail	F1BUK3	Cronobacter_phage	68.1	1.7e-123
AXC97438.1|4438249_4438843_-	hypothetical protein	NA	F1BUK5	Cronobacter_phage	63.8	4.7e-72
AXC97439.1|4438835_4440020_-	hypothetical protein	NA	F1BUK6	Cronobacter_phage	69.2	1.2e-154
AXC97440.1|4440012_4440348_-	DUF2590 family protein	NA	F1BUK8	Cronobacter_phage	58.7	1.2e-29
AXC97441.1|4440344_4442459_-|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	41.3	2.6e-141
AXC97442.1|4442460_4442640_-	hypothetical protein	NA	A5X9I8	Aeromonas_virus	63.0	6.4e-09
AXC97443.1|4442648_4442918_-	hypothetical protein	NA	NA	NA	NA	NA
AXC97444.1|4442914_4443112_-	hypothetical protein	NA	NA	NA	NA	NA
AXC97445.1|4443020_4443404_-	hypothetical protein	NA	F1BUL2	Cronobacter_phage	38.5	1.2e-12
AXC97446.1|4443403_4443742_-	M15 family peptidase	NA	F1BUL3	Cronobacter_phage	84.2	8.9e-44
AXC97447.1|4443728_4444040_-|holin	holin	holin	NA	NA	NA	NA
AXC97448.1|4444044_4444500_-	DUF2597 family protein	NA	A5X9I1	Aeromonas_virus	52.3	1.5e-38
AXC97449.1|4444503_4445646_-	DUF2586 domain-containing protein	NA	F1BUL5	Cronobacter_phage	61.3	5.6e-130
AXC97450.1|4445648_4446344_-	hypothetical protein	NA	F1BUL6	Cronobacter_phage	58.4	6.7e-70
AXC97451.1|4446340_4446817_-|tail	phage tail protein	tail	NA	NA	NA	NA
AXC97452.1|4446813_4447287_-|head	head completion protein	head	F1BUL8	Cronobacter_phage	54.3	1.2e-30
AXC97453.1|4447389_4448091_-|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	57.1	2.0e-69
AXC97454.1|4448093_4449116_-|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	55.7	6.6e-98
AXC97455.1|4449144_4450206_-|capsid	phage capsid protein	capsid	F1BUM4	Cronobacter_phage	44.3	2.2e-32
AXC97456.1|4450382_4452194_+	hypothetical protein	NA	F1BUM5	Cronobacter_phage	54.4	7.4e-185
AXC97457.1|4452190_4453252_+|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	60.5	5.2e-122
AXC97458.1|4453299_4453575_+	transcriptional regulator	NA	F1BUM8	Cronobacter_phage	60.7	3.1e-26
AXC97459.1|4453627_4455463_+	hypothetical protein	NA	NA	NA	NA	NA
AXC97460.1|4455554_4458191_-	replication endonuclease	NA	E5G6L9	Salmonella_phage	37.9	3.5e-127
AXC97461.1|4459280_4459670_-	hypothetical protein	NA	NA	NA	NA	NA
AXC97462.1|4459685_4459907_-	hypothetical protein	NA	A0A0M4S6M9	Salmonella_phage	50.0	2.2e-11
AXC97463.1|4460044_4460320_+	hypothetical protein	NA	NA	NA	NA	NA
AXC97464.1|4460294_4460915_-	hypothetical protein	NA	NA	NA	NA	NA
AXC97465.1|4460915_4461188_-	hypothetical protein	NA	Q1JS20	Enterobacteria_phage	85.6	1.3e-40
AXC97466.1|4461382_4461676_+	XRE family transcriptional regulator	NA	Q1JS21	Enterobacteria_phage	77.3	2.0e-36
AXC97467.1|4461745_4462726_+|integrase	integrase	integrase	Q7Y4C5	Escherichia_virus	85.0	1.2e-160
AXC97468.1|4462915_4463416_-	stress adaptor protein CpxP	NA	NA	NA	NA	NA
4462847:4462891	attR	GATAAAAAAAACCCCCACATCATGTGGGGGAAGACAGGGATGGTG	NA	NA	NA	NA
AXC97469.1|4463566_4464265_+	DNA-binding transcriptional regulator CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
AXC97470.1|4464261_4465635_+	two-component system sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.6	7.2e-15
AXC97471.1|4465685_4466081_-	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
AXC97472.1|4466092_4466845_-	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
AXC97473.1|4466851_4467472_-	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	58.9	2.4e-63
>prophage 1
CP030003	Salmonella enterica subsp. enterica strain SA20064858 plasmid pSA20064858.1, complete sequence	119613	53111	103262	119613	transposase,integrase	Escherichia_phage(18.18%)	57	75099:75114	105417:105432
AXC97894.1|53111_54287_+|transposase	transposase	transposase	A0A077SLN2	Escherichia_phage	81.6	7.1e-173
AXC97895.1|54343_54814_+	DUF1472 domain-containing protein	NA	NA	NA	NA	NA
AXC97896.1|54734_55235_+	antirestriction protein ArdA	NA	G9FHQ1	Rhodococcus_virus	27.1	1.9e-05
AXC97897.1|55374_55674_-	hypothetical protein	NA	NA	NA	NA	NA
AXC97898.1|55695_55941_+	hypothetical protein	NA	NA	NA	NA	NA
AXC97899.1|55963_56398_+	post-segregation killing protein PndC	NA	NA	NA	NA	NA
AXC97900.1|56491_56758_+	hypothetical protein	NA	NA	NA	NA	NA
AXC97901.1|56822_57764_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	51.0	3.5e-61
AXC97902.1|57825_58032_+	hypothetical protein	NA	NA	NA	NA	NA
AXC97903.1|58062_58314_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AXC97904.1|58347_58545_-	hypothetical protein	NA	NA	NA	NA	NA
AXC97905.1|58553_58769_+	hypothetical protein	NA	NA	NA	NA	NA
AXC97906.1|58893_59742_+	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
AXC97907.1|59827_60163_-	molybdopterin-guanine dinucleotide biosynthesis protein MobC	NA	NA	NA	NA	NA
AXC97908.1|60396_60729_+	nikA protein	NA	NA	NA	NA	NA
AXC97909.1|60739_63439_+	relaxase NikB	NA	NA	NA	NA	NA
AXC97910.1|63476_65768_-	conjugal transfer protein TrbC	NA	NA	NA	NA	NA
AXC97911.1|65760_66831_-	DsbC family protein	NA	NA	NA	NA	NA
AXC97912.1|66849_68058_-	conjugal transfer protein TrbA	NA	NA	NA	NA	NA
AXC97913.1|68425_69766_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
AXC97914.1|69810_69933_+	plasmid mobilization protein	NA	NA	NA	NA	NA
AXC97915.1|70202_70535_-	protein flxA	NA	NA	NA	NA	NA
AXC97916.1|70737_71043_-	hypothetical protein	NA	NA	NA	NA	NA
AXC97917.1|71067_71307_+	antitoxin RelB	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	1.6e-18
AXC97918.1|71306_71594_+	mRNA interferase RelE	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
AXC97973.1|71665_71818_+	Hok/Gef family protein	NA	NA	NA	NA	NA
AXC97919.1|71889_72141_-	hypothetical protein	NA	NA	NA	NA	NA
AXC97920.1|72720_72933_+	hypothetical protein	NA	NA	NA	NA	NA
AXC97921.1|73418_73601_-	hypothetical protein	NA	NA	NA	NA	NA
AXC97974.1|73600_74827_-|transposase	transposase	transposase	O80301	Enterobacteria_phage	95.1	7.9e-191
75099:75114	attL	AAAATAATTAATGCCA	NA	NA	NA	NA
AXC97922.1|75468_75678_+	HEAT repeat domain-containing protein	NA	NA	NA	NA	NA
AXC97923.1|75749_76412_-	ethanolamine utilization protein EutE	NA	NA	NA	NA	NA
AXC97924.1|76482_78654_-	hypothetical protein	NA	NA	NA	NA	NA
AXC97925.1|78750_79335_-	conjugal transfer protein TraX	NA	NA	NA	NA	NA
AXC97926.1|79363_80566_-	conjugal transfer protein	NA	NA	NA	NA	NA
AXC97927.1|80532_81147_-	conjugal transfer protein TraV	NA	NA	NA	NA	NA
AXC97928.1|81146_84191_-	ATP-binding protein	NA	NA	NA	NA	NA
AXC97929.1|84280_85081_-	conjugal transfer protein TraT	NA	NA	NA	NA	NA
AXC97930.1|85064_85253_-	TraS protein	NA	NA	NA	NA	NA
AXC97931.1|85316_85721_-	conjugal transfer protein TraR	NA	NA	NA	NA	NA
AXC97932.1|85771_86299_-	conjugal transfer protein TraQ	NA	NA	NA	NA	NA
AXC97933.1|86298_87003_-	conjugal transfer protein TraP	NA	NA	NA	NA	NA
AXC97934.1|87002_88292_-	conjugal transfer protein TraO	NA	NA	NA	NA	NA
AXC97935.1|88294_89278_-	conjugal transfer protein TraN	NA	NA	NA	NA	NA
AXC97936.1|89288_89981_-	conjugal transfer protein TraM	NA	NA	NA	NA	NA
AXC97937.1|89977_90325_-	conjugal transfer protein	NA	NA	NA	NA	NA
AXC97938.1|90342_94110_-	DNA primase	NA	A0A1B0VML8	Pseudomonas_phage	29.7	3.5e-19
AXC97975.1|94199_94667_-	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	30.8	1.2e-19
AXC97939.1|94785_96013_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	97.3	3.0e-174
AXC97940.1|96100_96391_-	conjugal transfer protein	NA	NA	NA	NA	NA
AXC97941.1|96387_97536_-	plasmid transfer ATPase TraJ	NA	NA	NA	NA	NA
AXC97942.1|97532_98351_-	conjugal transfer protein	NA	NA	NA	NA	NA
AXC97943.1|98347_98806_-	hypothetical protein	NA	NA	NA	NA	NA
AXC97944.1|99200_99785_-	histidine phosphatase family protein	NA	A0A2L1IV13	Escherichia_phage	39.8	7.7e-11
AXC97945.1|99844_101047_-	type IX secretion system membrane protein PorP/SprF	NA	NA	NA	NA	NA
AXC97946.1|101132_101957_-	conjugal transfer protein TraE	NA	NA	NA	NA	NA
AXC97947.1|102107_103262_-|integrase	site-specific integrase	integrase	B5WZU7	Pseudomonas_phage	43.0	1.0e-46
105417:105432	attR	AAAATAATTAATGCCA	NA	NA	NA	NA
