The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP029999	Salmonella enterica subsp. enterica strain SA20113174 chromosome, complete genome	4724618	638729	675095	4724618	head,terminase,holin,tRNA,plate,lysis,tail,capsid,portal,integrase	Escherichia_phage(26.67%)	49	627953:627976	677381:677404
627953:627976	attL	GATAAGCGCAGCGCCATCAGGCAA	NA	NA	NA	NA
AXC89244.1|638729_639767_-|integrase	integrase	integrase	A0A218M4I3	Erwinia_phage	87.1	8.8e-175
AXC89245.1|639766_640342_-	phage repressor protein CI	NA	A0A218M4J1	Erwinia_phage	66.0	8.9e-68
AXC89246.1|640474_640738_+	hypothetical protein	NA	A0A218M4I5	Erwinia_phage	100.0	3.1e-44
AXC89247.1|640768_641278_+	hypothetical protein	NA	A0A0M4QWN1	Salmonella_phage	99.4	4.3e-90
AXC89248.1|641285_641513_+	DUF2724 domain-containing protein	NA	A0A0M4RTI3	Salmonella_phage	90.7	7.3e-34
AXC89249.1|641499_641700_+	hypothetical protein	NA	A0A0M5M7U3	Salmonella_phage	92.4	3.7e-29
AXC89250.1|641766_642000_+	DUF2732 domain-containing protein	NA	Q6K1F6	Salmonella_virus	77.9	1.1e-24
AXC89251.1|641999_642227_+	TraR/DksA family transcriptional regulator	NA	A0A1S6L007	Salmonella_phage	70.7	3.1e-24
AXC89252.1|642223_642532_+	DUF3850 domain-containing protein	NA	C9E2N9	Enterococcus_phage	45.9	2.1e-07
AXC89253.1|642545_644786_+	replication endonuclease	NA	A0A0M3ULG0	Salmonella_phage	92.2	0.0e+00
AXC89254.1|644902_645343_+	DinI family protein	NA	A0A218M4I0	Erwinia_phage	92.0	5.4e-65
AXC89255.1|645625_645925_+	hypothetical protein	NA	NA	NA	NA	NA
AXC89256.1|645961_646270_+	XRE family transcriptional regulator	NA	E5E3S9	Burkholderia_phage	39.2	2.2e-12
AXC89257.1|646247_647198_+	RNA-directed DNA polymerase	NA	E5E3S8	Burkholderia_phage	37.7	2.3e-36
AXC89258.1|647337_647769_-	hypothetical protein	NA	S4TUD6	Salmonella_phage	95.1	1.4e-70
AXC89259.1|647767_647962_+	hypothetical protein	NA	S4TRZ0	Salmonella_phage	92.2	3.4e-24
AXC89260.1|647992_648262_-	hypothetical protein	NA	Q2P9X2	Enterobacteria_phage	82.6	1.1e-25
AXC89261.1|648481_649519_-|portal	phage portal protein	portal	Q6K1J0	Salmonella_virus	79.3	2.0e-163
AXC89262.1|649518_651288_-	oxidoreductase	NA	Q9T0R3	Escherichia_phage	81.2	1.5e-286
AXC89263.1|651452_652316_+|capsid	GPO family capsid scaffolding protein	capsid	A0A218M4L9	Erwinia_phage	76.3	2.2e-118
AXC89264.1|652347_653508_+|capsid	phage major capsid protein, P2 family	capsid	A0A0M4R4W2	Salmonella_phage	62.8	9.6e-130
AXC89265.1|653511_654270_+|terminase	terminase	terminase	Q94MJ2	Enterobacteria_phage	66.3	2.3e-79
AXC89266.1|654367_654868_+|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	68.5	3.8e-59
AXC89267.1|654867_655071_+|tail	phage tail protein	tail	U5N3E7	Enterobacteria_phage	76.1	8.9e-23
AXC89268.1|655061_655283_+	primosomal protein	NA	A0A218M4L5	Erwinia_phage	71.2	5.1e-24
AXC89269.1|655266_655776_+	lysozyme	NA	A0A218M4K3	Erwinia_phage	82.6	4.6e-76
AXC89270.1|655772_656186_+|lysis	LysB family phage lysis regulatory protein	lysis	O80310	Escherichia_phage	60.6	1.3e-36
AXC89271.1|656085_656331_+|holin	holin	holin	S4TNY4	Salmonella_phage	73.1	2.5e-27
AXC89272.1|656293_656761_+|tail	phage tail protein	tail	U5N0S7	Enterobacteria_phage	69.7	1.1e-55
AXC89273.1|656753_657203_+	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	69.4	1.0e-50
AXC89274.1|657271_657913_+|plate	phage baseplate assembly protein V	plate	Q6K1H6	Salmonella_virus	82.2	3.8e-96
AXC89275.1|657909_658257_+|plate	baseplate assembly protein	plate	A0A0F7LDQ1	Escherichia_phage	70.4	2.8e-40
AXC89276.1|658261_659170_+|plate	baseplate assembly protein	plate	Q37840	Escherichia_phage	83.8	2.6e-138
AXC89277.1|659162_659696_+|tail	phage tail protein I	tail	Q37841	Escherichia_phage	88.6	5.6e-93
AXC89278.1|659703_661449_+|tail	phage tail protein	tail	Q37842	Escherichia_phage	75.5	9.2e-92
AXC89279.1|661451_661976_+|tail	tail fiber assembly protein	tail	NA	NA	NA	NA
AXC89280.1|662105_663293_+|tail	phage tail protein	tail	A0A0F7LBW9	Escherichia_phage	82.8	1.1e-189
AXC89281.1|663305_663824_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	75.6	2.0e-71
AXC89282.1|663886_664168_+|tail	phage tail assembly protein	tail	A0A0F7LBN9	Escherichia_phage	79.1	4.7e-30
AXC89283.1|664200_664320_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	84.6	3.7e-13
AXC89284.1|664312_666742_+|tail	phage tail tape measure protein	tail	Q858U7	Yersinia_virus	70.6	2.3e-266
AXC89285.1|666753_667218_+|tail	phage tail protein	tail	A0A0F7LBX3	Escherichia_phage	75.5	5.9e-62
AXC89286.1|667220_668414_+	phage late control D family protein	NA	Q6K1G4	Salmonella_virus	78.4	2.3e-166
AXC89287.1|668453_668672_+	DNA-binding transcriptional regulator	NA	A0A2I8TV89	Erwinia_phage	86.1	4.6e-33
AXC89288.1|669030_669537_+	mismatch-specific DNA-glycosylase	NA	NA	NA	NA	NA
AXC89289.1|669660_671643_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	9.0e-35
AXC89290.1|671657_673403_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.4	2.1e-72
AXC89291.1|673638_673854_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
AXC89292.1|674081_675095_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.5	2.2e-109
677381:677404	attR	GATAAGCGCAGCGCCATCAGGCAA	NA	NA	NA	NA
>prophage 2
CP029999	Salmonella enterica subsp. enterica strain SA20113174 chromosome, complete genome	4724618	1175148	1238371	4724618	head,terminase,tRNA,holin,tail,capsid,portal,integrase	Cronobacter_phage(57.89%)	63	1183126:1183141	1212503:1212518
AXC89753.1|1175148_1175916_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
AXC89754.1|1175956_1176304_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
AXC89755.1|1176460_1177681_-	diguanylate cyclase	NA	A0A2K8I9Y5	Pseudomonas_phage	37.0	1.7e-07
AXC89756.1|1177673_1178192_-	YfiR family protein	NA	NA	NA	NA	NA
AXC89757.1|1178631_1179702_+	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.8	2.4e-90
AXC89758.1|1179711_1180833_+	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
AXC89759.1|1180890_1181799_+	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
AXC89760.1|1181759_1182920_-	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
AXC93089.1|1183019_1183067_-	hypothetical protein	NA	NA	NA	NA	NA
1183126:1183141	attL	AAAACGCGCCCGAAGG	NA	NA	NA	NA
AXC89761.1|1183230_1184250_-|integrase	integrase	integrase	A0A0F7LBR0	Escherichia_phage	58.2	1.4e-108
AXC89762.1|1184289_1184595_-	XRE family transcriptional regulator	NA	A0A0M5M1I9	Salmonella_phage	47.5	1.6e-15
AXC89763.1|1184692_1185031_+	hypothetical protein	NA	NA	NA	NA	NA
AXC89764.1|1185056_1185389_+	hypothetical protein	NA	NA	NA	NA	NA
AXC89765.1|1185398_1185968_+	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	46.3	2.6e-43
AXC89766.1|1185970_1186189_+	hypothetical protein	NA	NA	NA	NA	NA
AXC89767.1|1186227_1188885_+	bifunctional DNA primase/helicase	NA	A0A077K8T2	Ralstonia_phage	47.5	1.2e-244
AXC89768.1|1188912_1189236_-	transcriptional regulator	NA	F1BUM8	Cronobacter_phage	73.1	1.3e-36
AXC89769.1|1189235_1190255_-|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	68.5	1.3e-135
AXC89770.1|1190251_1192036_-|terminase	terminase	terminase	F1BUM5	Cronobacter_phage	69.7	1.8e-247
AXC89771.1|1192093_1193083_+|capsid	phage capsid protein	capsid	F1BUM4	Cronobacter_phage	52.3	2.5e-46
AXC89772.1|1193117_1194146_+|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	71.6	3.7e-133
AXC89773.1|1194157_1194856_+|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	52.6	3.6e-63
AXC89774.1|1194954_1195407_+|head	head completion protein	head	F1BUL8	Cronobacter_phage	64.7	1.2e-48
AXC89775.1|1195403_1195886_+|tail	phage tail protein	tail	F1BUL7	Cronobacter_phage	48.7	2.3e-37
AXC89776.1|1195882_1196587_+	hypothetical protein	NA	F1BUL6	Cronobacter_phage	59.5	4.0e-70
AXC89777.1|1196583_1197711_+	DUF2586 domain-containing protein	NA	F1BUL5	Cronobacter_phage	82.9	8.1e-174
AXC89778.1|1197707_1198163_+	DUF2597 family protein	NA	F1BUL4	Cronobacter_phage	71.5	1.7e-58
AXC89779.1|1198175_1198472_+|holin	holin	holin	C7BGD7	Burkholderia_phage	48.2	2.4e-16
AXC89780.1|1198468_1198810_+	M15 family peptidase	NA	F1BUL3	Cronobacter_phage	91.1	2.2e-50
AXC89781.1|1198809_1199142_+	hypothetical protein	NA	F1BUL2	Cronobacter_phage	70.0	4.4e-35
AXC89782.1|1199068_1199302_+	hypothetical protein	NA	F1BUL1	Cronobacter_phage	83.1	1.7e-30
AXC89783.1|1199279_1199546_+	hypothetical protein	NA	A5X9I7	Aeromonas_virus	61.0	2.4e-20
AXC89784.1|1199733_1201701_+|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	70.7	1.9e-271
AXC89785.1|1201697_1202027_+	DUF2590 family protein	NA	F1BUK8	Cronobacter_phage	72.4	3.8e-39
AXC89786.1|1202023_1203208_+	hypothetical protein	NA	F1BUK6	Cronobacter_phage	78.6	5.1e-179
AXC89787.1|1203194_1203788_+	hypothetical protein	NA	F1BUK5	Cronobacter_phage	82.1	1.4e-89
AXC89788.1|1203797_1205810_+|tail	phage tail protein	tail	F1BUK3	Cronobacter_phage	81.2	2.1e-148
AXC89789.1|1205812_1206343_+|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	32.4	4.4e-13
AXC89790.1|1206332_1207058_+	hypothetical protein	NA	F1BUK1	Cronobacter_phage	56.4	3.8e-68
AXC89791.1|1207029_1207575_+	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	71.4	3.5e-58
AXC89792.1|1207574_1209278_+	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	81.3	1.7e-223
AXC89793.1|1210395_1211868_+	hypothetical protein	NA	NA	NA	NA	NA
AXC89794.1|1212003_1212390_-	hypothetical protein	NA	NA	NA	NA	NA
AXC89795.1|1212547_1212886_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
1212503:1212518	attR	AAAACGCGCCCGAAGG	NA	NA	NA	NA
AXC89796.1|1213157_1213895_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
AXC89797.1|1214026_1215007_+	ribosomal large subunit pseudouridine synthase D	NA	NA	NA	NA	NA
AXC89798.1|1215003_1215735_+	peptidoglycan editing factor PgeF	NA	NA	NA	NA	NA
AXC89799.1|1215864_1218438_+	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.5	3.4e-127
AXC89800.1|1218633_1218834_-	hypothetical protein	NA	NA	NA	NA	NA
AXC89801.1|1224171_1224627_+	DUF4385 domain-containing protein	NA	E3SMI8	Prochlorococcus_phage	49.3	8.6e-34
AXC89802.1|1224730_1226032_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	30.4	1.2e-43
AXC89803.1|1226028_1226352_-	YfiM family lipoprotein	NA	NA	NA	NA	NA
AXC89804.1|1226396_1227752_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
AXC89805.1|1227866_1230527_-	protein lysine acetyltransferase Pat	NA	NA	NA	NA	NA
AXC89806.1|1230580_1231261_-	DTW domain-containing protein	NA	NA	NA	NA	NA
AXC89807.1|1231333_1231753_-	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	40.6	1.2e-16
AXC89808.1|1231956_1232994_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
AXC89809.1|1233109_1233799_-	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	49.5	4.6e-55
AXC89810.1|1234117_1234501_+	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	74.0	6.1e-33
AXC89811.1|1234562_1235150_-	cysteine/O-acetylserine efflux protein	NA	NA	NA	NA	NA
AXC93090.1|1235252_1236152_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AXC89812.1|1236169_1237504_-	ATP-dependent RNA helicase SrmB	NA	A0A1B1IS59	uncultured_Mediterranean_phage	29.7	1.6e-43
AXC89813.1|1237633_1238371_+|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase	tRNA	NA	NA	NA	NA
>prophage 3
CP029999	Salmonella enterica subsp. enterica strain SA20113174 chromosome, complete genome	4724618	1689746	1698917	4724618	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
AXC90210.1|1689746_1690694_+	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.8	3.7e-10
AXC90211.1|1690677_1691409_+	ABC transporter permease	NA	NA	NA	NA	NA
AXC90212.1|1691389_1691497_-	hypothetical protein	NA	NA	NA	NA	NA
AXC90213.1|1691556_1692288_-	transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
AXC90214.1|1692510_1694196_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.3	4.8e-279
AXC90215.1|1694192_1694912_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AXC90216.1|1694958_1695426_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
AXC90217.1|1695482_1696013_-	DUF1307 domain-containing protein	NA	NA	NA	NA	NA
AXC90218.1|1696184_1696643_-	DUF1307 domain-containing protein	NA	Q9EYF5	Enterobacteria_phage	73.2	7.6e-54
AXC90219.1|1696883_1698917_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	6.1e-55
>prophage 4
CP029999	Salmonella enterica subsp. enterica strain SA20113174 chromosome, complete genome	4724618	1766109	1776616	4724618		Enterobacteria_phage(37.5%)	10	NA	NA
AXC90274.1|1766109_1767513_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	2.3e-21
AXC90275.1|1767690_1768584_+	UTP--glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
AXC90276.1|1768960_1770046_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.6e-102
AXC90277.1|1770045_1770945_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.0	6.7e-30
AXC90278.1|1770992_1771871_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	65.5	2.7e-108
AXC90279.1|1771871_1772423_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	1.3e-52
AXC90280.1|1772428_1773403_+	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
AXC90281.1|1773418_1774192_+	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
AXC90282.1|1774196_1775276_+	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.5	2.3e-16
AXC90283.1|1775302_1776616_+	lipopolysaccharide biosynthesis protein RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
>prophage 5
CP029999	Salmonella enterica subsp. enterica strain SA20113174 chromosome, complete genome	4724618	1859163	1866400	4724618		Morganella_phage(33.33%)	8	NA	NA
AXC90363.1|1859163_1859583_+	DNA polymerase V subunit UmuD	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
AXC90364.1|1859585_1860854_+	translesion error-prone DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	92.4	1.4e-227
AXC90365.1|1861308_1861521_+	cold-shock protein CspJ	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
AXC93108.1|1861531_1861720_+	cold-shock protein	NA	NA	NA	NA	NA
AXC90366.1|1861980_1863159_-	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	56.7	7.3e-109
AXC90367.1|1863809_1864109_+	hypothetical protein	NA	NA	NA	NA	NA
AXC90368.1|1864200_1864896_+	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.1	2.8e-07
AXC90369.1|1864969_1866400_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
>prophage 6
CP029999	Salmonella enterica subsp. enterica strain SA20113174 chromosome, complete genome	4724618	2151110	2157767	4724618		Salmonella_phage(33.33%)	9	NA	NA
AXC90655.1|2151110_2151917_-	peptide ABC transporter ATP-binding protein SapF	NA	G3M9Y6	Bacillus_virus	27.4	4.6e-14
AXC90656.1|2151918_2152911_-	peptide ABC transporter ATP-binding protein SapD	NA	NA	NA	NA	NA
AXC90657.1|2152910_2153801_-	peptide ABC transporter permease SapC	NA	NA	NA	NA	NA
AXC90658.1|2154623_2155346_-	hypothetical protein	NA	A0A0P0ZCT1	Stx2-converting_phage	38.9	4.3e-35
AXC90659.1|2155816_2155999_+	hypothetical protein	NA	S4TSR3	Salmonella_phage	77.6	1.0e-22
AXC90660.1|2156248_2156389_+	pertussis toxin subunit	NA	A0A0U2KD26	Escherichia_phage	77.1	6.5e-09
AXC90661.1|2156427_2156727_+	pertussis toxin subunit	NA	A0A0U2KD26	Escherichia_phage	54.3	3.2e-13
AXC90662.1|2156653_2157079_+	subtilase cytotoxin subunit B-like protein	NA	NA	NA	NA	NA
AXC90663.1|2157452_2157767_+	recombinase family protein	NA	A0A1S6L009	Salmonella_phage	86.1	4.3e-40
>prophage 7
CP029999	Salmonella enterica subsp. enterica strain SA20113174 chromosome, complete genome	4724618	2632163	2639401	4724618		Escherichia_phage(42.86%)	8	NA	NA
AXC91127.1|2632163_2632403_+	virulence protein MsgA	NA	K7P6H1	Enterobacteria_phage	88.6	8.5e-33
AXC93139.1|2633282_2634092_+	cytolethal distending toxin subunit B family protein	NA	A5LH53	Enterobacteria_phage	50.0	2.1e-62
AXC91128.1|2634164_2634542_+	DUF1353 domain-containing protein	NA	I1TQ41	Pseudomonas_phage	38.4	2.2e-14
AXC91129.1|2634689_2635232_-	hypothetical protein	NA	A0A0U2S643	Escherichia_phage	67.0	6.2e-71
AXC91130.1|2635415_2636144_-	pertussis toxin-like subunit ArtA	NA	A0A0U2KD26	Escherichia_phage	52.5	1.2e-61
AXC91131.1|2636160_2636574_-	subtilase cytotoxin subunit B	NA	A0A0U2KD34	Escherichia_phage	37.7	5.5e-19
AXC91132.1|2637618_2638743_-	DUF3626 domain-containing protein	NA	NA	NA	NA	NA
AXC91133.1|2639188_2639401_-	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	90.7	2.5e-20
>prophage 8
CP029999	Salmonella enterica subsp. enterica strain SA20113174 chromosome, complete genome	4724618	2644679	2692497	4724618	head,terminase,tRNA,transposase,lysis,tail,capsid,portal,integrase	Enterobacteria_phage(38.1%)	63	2639137:2639152	2688398:2688413
2639137:2639152	attL	TAATAAAAACGGGAAC	NA	NA	NA	NA
AXC91137.1|2644679_2644796_+|tail	phage tail protein	tail	NA	NA	NA	NA
AXC91138.1|2644986_2645187_+	phage virulence factor	NA	NA	NA	NA	NA
AXC91139.1|2645284_2645869_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	84.8	1.7e-87
AXC91140.1|2645868_2648310_-|tail	phage tail protein	tail	A0A0K2FIZ6	Escherichia_phage	62.0	7.3e-87
AXC91141.1|2648363_2648606_-	hypothetical protein	NA	NA	NA	NA	NA
AXC91142.1|2648644_2652007_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	79.9	0.0e+00
AXC91143.1|2652068_2652716_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	78.1	9.3e-90
AXC91144.1|2652613_2653351_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	84.6	1.2e-128
AXC91145.1|2653357_2654056_-|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	75.4	7.9e-103
AXC91146.1|2654065_2654395_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	71.3	7.3e-43
AXC91147.1|2654397_2657493_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	61.6	6.3e-277
AXC91148.1|2657464_2657803_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	62.4	1.3e-31
AXC91149.1|2657799_2658195_-|tail	phage minor tail protein G	tail	A5LH36	Enterobacteria_phage	56.5	2.3e-30
AXC91150.1|2658245_2658992_-|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	76.9	1.9e-99
AXC91151.1|2658999_2659401_-|tail	phage tail protein	tail	Q9G0F3	Phage_Gifsy-1	100.0	8.1e-52
AXC91152.1|2659509_2660640_+|transposase	transposase	transposase	Q9G0F2	Phage_Gifsy-1	99.2	1.9e-215
AXC91153.1|2660688_2661267_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	80.7	1.7e-82
AXC91154.1|2661294_2661678_-|tail	phage tail protein	tail	A0A0K2FJB7	Enterobacteria_phage	55.6	9.2e-29
AXC91155.1|2661688_2662054_-	DNA packaging protein	NA	NA	NA	NA	NA
AXC91156.1|2662111_2663140_-|capsid	minor capsid protein E	capsid	C6ZCY2	Enterobacteria_phage	61.1	1.7e-114
AXC91157.1|2663194_2663542_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	52.7	9.2e-20
AXC91158.1|2663554_2665051_-	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	52.7	4.3e-98
AXC91159.1|2665040_2666621_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	62.8	9.6e-189
AXC91160.1|2666617_2666821_-|tail	phage tail protein	tail	K7PM10	Enterobacteria_phage	72.3	9.5e-17
AXC91161.1|2666804_2668736_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.7	1.8e-258
AXC91162.1|2668707_2669253_-|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	80.6	1.5e-56
AXC91163.1|2669297_2669504_-	hypothetical protein	NA	NA	NA	NA	NA
AXC91164.1|2669538_2669940_+	inhibitor of g-type lysozyme	NA	NA	NA	NA	NA
AXC91165.1|2670166_2670631_-|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	84.7	1.8e-58
AXC91166.1|2670731_2671271_-	lysozyme	NA	S5MQK2	Escherichia_phage	74.1	4.4e-77
AXC93140.1|2671248_2671551_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
AXC93141.1|2671800_2672256_+	DUF2441 domain-containing protein	NA	NA	NA	NA	NA
AXC91167.1|2672267_2672486_-	hypothetical protein	NA	NA	NA	NA	NA
AXC91168.1|2672639_2672828_-	hypothetical protein	NA	NA	NA	NA	NA
AXC91169.1|2672962_2673151_+	hypothetical protein	NA	NA	NA	NA	NA
AXC91170.1|2673070_2673628_-	ORF6N domain-containing protein	NA	A0A0N7C203	Escherichia_phage	78.5	9.5e-51
AXC91171.1|2673677_2673902_-	hypothetical protein	NA	NA	NA	NA	NA
AXC91172.1|2673898_2674453_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	65.3	3.4e-64
AXC91173.1|2674449_2674746_-	DUF1364 family protein	NA	K7P7Q1	Enterobacteria_phage	79.1	3.9e-35
AXC91174.1|2674727_2674922_-	hypothetical protein	NA	S4TNP0	Salmonella_phage	61.5	1.4e-12
AXC91175.1|2674918_2675518_-	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	82.9	3.3e-97
AXC91176.1|2675581_2675830_-	hypothetical protein	NA	NA	NA	NA	NA
AXC91177.1|2676363_2676870_-	hypothetical protein	NA	NA	NA	NA	NA
AXC91178.1|2677172_2677550_-	DUF977 family protein	NA	A0A088CBK9	Shigella_phage	36.1	2.2e-14
AXC91179.1|2677567_2678320_-	DNA replication protein DnaC	NA	A0A088CBP4	Shigella_phage	76.1	8.5e-103
AXC91180.1|2678326_2679196_-	DNA-binding protein	NA	A0A088CD36	Shigella_phage	58.5	6.9e-32
AXC91181.1|2679240_2679735_-	hypothetical protein	NA	NA	NA	NA	NA
AXC91182.1|2679721_2679976_-	XRE family transcriptional regulator	NA	K7PKH4	Enterobacteria_phage	60.9	5.3e-17
AXC91183.1|2680072_2680498_+	helix-turn-helix domain-containing protein	NA	K7PH71	Enterobacterial_phage	56.3	9.3e-14
AXC91184.1|2680808_2680964_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	55.3	4.7e-08
AXC91185.1|2681342_2681627_+	hypothetical protein	NA	K7PGY4	Enterobacteria_phage	53.2	1.7e-08
AXC91186.1|2681701_2682037_+	hypothetical protein	NA	NA	NA	NA	NA
AXC91187.1|2682177_2684868_+	exodeoxyribonuclease VIII	NA	Q9QF34	Lambdoid_phage	83.5	6.8e-118
AXC91188.1|2685725_2686046_+	hypothetical protein	NA	A0A222YY67	Escherichia_phage	59.2	1.8e-33
AXC91189.1|2686038_2686371_+	hypothetical protein	NA	S4TNP2	Salmonella_phage	81.8	8.8e-20
AXC91190.1|2686367_2686919_+	Eaa protein	NA	A0A192Y7X3	Salmonella_phage	34.5	2.8e-10
AXC91191.1|2686968_2687205_+	excisionase	NA	NA	NA	NA	NA
AXC91192.1|2687194_2688337_+|integrase	integrase	integrase	O21929	Phage_21	80.0	1.8e-173
AXC91193.1|2688450_2689701_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	90.7	1.1e-19
2688398:2688413	attR	TAATAAAAACGGGAAC	NA	NA	NA	NA
AXC91194.1|2689872_2690538_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
AXC91195.1|2690534_2690864_+	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
AXC91196.1|2690875_2691337_+	NUDIX hydrolase	NA	NA	NA	NA	NA
AXC91197.1|2691390_2692497_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
>prophage 9
CP029999	Salmonella enterica subsp. enterica strain SA20113174 chromosome, complete genome	4724618	3062506	3101815	4724618	coat,protease,terminase,holin,lysis,tail,portal,integrase	Salmonella_phage(67.74%)	63	3062052:3062074	3101881:3101903
3062052:3062074	attL	CGTTCAACTTAGTATAAAAAAGC	NA	NA	NA	NA
AXC91542.1|3062506_3062869_+	GtrA family protein	NA	I1TED9	Salmonella_phage	99.2	5.0e-61
AXC91543.1|3062865_3063798_+	glycosyltransferase	NA	I1TED8	Salmonella_phage	99.0	1.8e-174
AXC91544.1|3063787_3065245_+	hypothetical protein	NA	A0A192Y7W8	Salmonella_phage	99.0	3.2e-239
AXC91545.1|3065303_3067307_-	endorhamnosidase	NA	A0A192Y6X2	Salmonella_phage	99.6	0.0e+00
AXC91546.1|3067442_3067694_+	Arc family DNA-binding protein	NA	E7C9U8	Salmonella_phage	98.8	4.1e-38
AXC91547.1|3067710_3068130_-	hypothetical protein	NA	B9UDL3	Salmonella_phage	100.0	1.3e-73
AXC91548.1|3068247_3068577_+	hypothetical protein	NA	NA	NA	NA	NA
AXC91549.1|3068596_3070438_-	DNA transfer protein	NA	A0A192Y934	Salmonella_phage	78.3	4.3e-257
AXC93150.1|3070437_3071775_-	DNA transfer protein	NA	I1TEJ5	Salmonella_phage	95.7	1.1e-233
AXC91550.1|3071817_3072507_-	DNA transfer protein	NA	I1TEJ4	Salmonella_phage	95.6	6.4e-89
AXC91551.1|3072509_3072965_-	DUF2824 family protein	NA	A0A1R3Y5P3	Salmonella_virus	98.0	8.2e-85
AXC91552.1|3072964_3073666_-|tail	phage tail protein	tail	C6ZR14	Salmonella_phage	97.9	2.8e-76
AXC91553.1|3073669_3075088_-	hypothetical protein	NA	I1TEJ1	Salmonella_phage	97.2	4.0e-271
AXC91554.1|3075047_3075548_-	hypothetical protein	NA	I1TEJ0	Salmonella_phage	98.2	8.7e-88
AXC91555.1|3075531_3075741_-	hypothetical protein	NA	A0A192Y697	Salmonella_phage	100.0	1.3e-32
AXC91556.1|3075779_3077072_-|coat	coat protein	coat	C6ZR10	Salmonella_phage	99.3	3.2e-243
AXC91557.1|3077071_3077983_-	scaffolding protein	NA	I6S5W6	Salmonella_phage	99.7	1.1e-160
AXC91558.1|3077996_3080174_-|portal	portal protein	portal	Q5C835	Enterobacteria_phage	99.3	0.0e+00
AXC91559.1|3080173_3081673_-|terminase	terminase	terminase	A0A2H4FUR5	Salmonella_phage	100.0	4.8e-307
AXC91560.1|3081650_3082139_-	DNA-packaging protein	NA	O80290	Bacteriophage	100.0	2.9e-88
AXC91561.1|3082142_3082547_-	Decoration protein	NA	A0A192Y6U9	Salmonella_phage	99.3	1.5e-66
AXC91562.1|3082549_3082792_-	DUF2560 family protein	NA	A0A192Y6S9	Salmonella_phage	100.0	1.0e-33
AXC93151.1|3083115_3083637_-	DNA-binding protein	NA	H6WRZ8	Salmonella_phage	100.0	1.9e-101
AXC91563.1|3083849_3084320_-|lysis	lysis protein	lysis	A0A2D1GLQ7	Escherichia_phage	86.8	1.1e-63
AXC91564.1|3084316_3084754_-	lysozyme	NA	Q5G8R3	Enterobacteria_phage	97.9	6.3e-74
AXC91565.1|3084737_3085064_-|holin	phage holin, lambda family	holin	Q5G8R5	Enterobacteria_phage	100.0	1.7e-52
AXC91566.1|3085199_3085409_-	hypothetical protein	NA	M1E3N9	Enterobacteria_phage	97.1	2.2e-32
AXC91567.1|3085498_3086122_-	antitermination protein	NA	K7PM87	Enterobacteria_phage	87.0	8.3e-96
AXC91568.1|3086118_3086307_-	protein ninH	NA	K7PH29	Enterobacteria_phage	100.0	1.9e-27
AXC91569.1|3086303_3086666_-	RusA family crossover junction endodeoxyribonuclease	NA	A5VW85	Enterobacteria_phage	97.5	5.0e-61
AXC91570.1|3086662_3086953_-	DUF1364 domain-containing protein	NA	A0A192Y6R9	Salmonella_phage	100.0	1.0e-51
AXC91571.1|3086945_3087158_-	hypothetical protein	NA	K7PK10	Enterobacteria_phage	98.6	4.7e-35
AXC91572.1|3087150_3087327_-	protein ninF	NA	A0A220NRM2	Escherichia_phage	100.0	1.9e-26
AXC91573.1|3087319_3087661_-	DUF2591 domain-containing protein	NA	Q76H72	Enterobacteria_phage	100.0	2.1e-64
AXC91574.1|3087663_3087840_-	NinE family protein	NA	C6ZR57	Salmonella_phage	98.3	3.0e-27
AXC91575.1|3087821_3087980_-	protein ninD	NA	Q8HAF7	Salmonella_phage	94.2	6.0e-27
AXC91576.1|3087976_3088423_-	recombination protein NinB	NA	I6R0N7	Salmonella_phage	99.3	1.2e-80
AXC91577.1|3088379_3088676_-	hypothetical protein	NA	E7C9R7	Salmonella_phage	99.0	2.6e-47
AXC91578.1|3088678_3088939_-	hypothetical protein	NA	Q8HAG0	Salmonella_phage	98.8	9.9e-43
AXC91579.1|3088938_3089148_-	hypothetical protein	NA	A0A1R3Y5S8	Salmonella_virus	98.6	7.0e-31
AXC91580.1|3089157_3089430_-	DUF4752 family protein	NA	A0A220NQX8	Salmonella_phage	100.0	4.2e-44
AXC91581.1|3089504_3090956_-	helicase DnaB	NA	Q08J37	Stx2-converting_phage	99.0	8.0e-275
AXC91582.1|3090930_3091830_-	DNA replication protein	NA	A0A220NQX5	Salmonella_phage	99.3	1.5e-154
AXC91583.1|3091822_3091969_-	DUF2740 domain-containing protein	NA	A0A075B8K7	Enterobacteria_phage	100.0	1.5e-19
AXC91584.1|3092003_3092282_-	hypothetical protein	NA	A0A220NRS4	Escherichia_phage	92.4	3.8e-40
AXC91585.1|3092388_3092574_-	hypothetical protein	NA	Q5G8T3	Enterobacteria_phage	100.0	5.4e-27
AXC91586.1|3092654_3093305_+	LexA family transcriptional regulator	NA	B1B6L9	Salmonella_phage	99.5	2.1e-121
AXC91587.1|3093643_3093979_+	hypothetical protein	NA	Q5G8T5	Enterobacteria_phage	87.9	1.7e-47
AXC91588.1|3094057_3094252_+	restriction endonuclease	NA	E7C9Q6	Salmonella_phage	100.0	2.5e-30
AXC91589.1|3094869_3095148_+	hypothetical protein	NA	C6ZR42	Salmonella_phage	100.0	1.3e-45
AXC93152.1|3095465_3095627_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	E7C9Q3	Salmonella_phage	100.0	4.9e-24
AXC91590.1|3095619_3095733_+	host cell division inhibitory peptide Kil	NA	C6ZR39	Salmonella_phage	100.0	7.8e-13
AXC91591.1|3095729_3095918_+	hypothetical protein	NA	C6ZR38	Salmonella_phage	98.4	8.5e-28
AXC91592.1|3095926_3096634_+	recombinase	NA	E7C9Q0	Salmonella_phage	97.9	1.0e-137
AXC91593.1|3096633_3096918_+	sigma-70 family RNA polymerase sigma factor	NA	Q76H41	Enterobacteria_phage	100.0	1.4e-45
AXC91594.1|3096964_3097258_+	DUF2856 family protein	NA	E7C9P8	Salmonella_phage	97.9	2.7e-49
AXC91595.1|3097268_3097439_+	DUF2737 family protein	NA	I6S642	Salmonella_phage	100.0	6.1e-25
AXC91596.1|3097435_3097813_+	Eae protein	NA	I6R9B7	Salmonella_phage	100.0	5.1e-64
AXC91597.1|3097922_3098282_+	Eaf protein	NA	T1SA95	Salmonella_phage	92.4	1.1e-60
AXC93153.1|3098431_3098917_+	ead/Ea22-like family protein	NA	A0A2H4FRZ0	Salmonella_phage	78.3	2.2e-59
AXC91598.1|3098916_3099672_+	hypothetical protein	NA	H6WRY1	Salmonella_phage	99.6	4.2e-150
AXC91599.1|3100548_3100767_+	excisionase	NA	A0A1V0E5M4	Salmonella_phage	100.0	5.7e-36
AXC91600.1|3100744_3101815_+|integrase	integrase	integrase	A0A1V0E5M7	Salmonella_phage	99.3	6.8e-154
3101881:3101903	attR	CGTTCAACTTAGTATAAAAAAGC	NA	NA	NA	NA
>prophage 10
CP029999	Salmonella enterica subsp. enterica strain SA20113174 chromosome, complete genome	4724618	3533912	3575273	4724618	head,protease,terminase,holin,plate,tail,capsid,portal,integrase	Shigella_phage(63.64%)	58	3532397:3532444	3571380:3571427
3532397:3532444	attL	AATGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
AXC91988.1|3533912_3534476_-	recombinase family protein	NA	K7PJT4	Enterobacteria_phage	79.1	3.4e-80
AXC91989.1|3535000_3535723_+	SPI-1 type III secretion system guanine nucleotide exchange factor SopE	NA	NA	NA	NA	NA
AXC91990.1|3535919_3536327_-|tail	tail fiber assembly protein	tail	A0A1B0V844	Salmonella_phage	84.2	1.8e-59
AXC91991.1|3536333_3537416_-|tail	phage tail protein	tail	U5P0I1	Shigella_phage	96.2	1.9e-50
AXC91992.1|3537419_3538004_-	DUF2313 domain-containing protein	NA	O22003	Shigella_phage	100.0	1.1e-113
AXC91993.1|3537994_3539053_-|plate	phage baseplate protein	plate	Q8SBG4	Shigella_phage	98.6	5.2e-199
AXC91994.1|3539039_3539468_-|tail	phage tail protein	tail	U5P0R9	Shigella_phage	100.0	2.3e-81
AXC91995.1|3539464_3540013_-|plate	phage baseplate assembly protein V	plate	U5P081	Shigella_phage	97.8	1.9e-96
AXC91996.1|3540012_3541092_-|plate	baseplate protein	plate	Q8SBG7	Shigella_phage	99.7	5.3e-207
AXC91997.1|3541088_3542417_-	DNA circularization protein	NA	Q8SBG8	Shigella_phage	99.3	8.4e-247
AXC91998.1|3542507_3543020_-	hypothetical protein	NA	NA	NA	NA	NA
AXC91999.1|3543101_3544934_-|tail	phage tail tape measure protein	tail	S5FM63	Shigella_phage	98.9	8.8e-303
AXC92000.1|3544926_3545109_-	hypothetical protein	NA	NA	NA	NA	NA
AXC92001.1|3545075_3545345_-|tail	phage tail assembly protein	tail	S5FNR3	Shigella_phage	100.0	3.5e-43
AXC92002.1|3545344_3545701_-|tail	phage tail protein	tail	U5P076	Shigella_phage	100.0	5.3e-63
AXC92003.1|3545700_3547197_-|tail	phage tail protein	tail	M1FN90	Enterobacteria_phage	99.0	7.7e-273
AXC92004.1|3547180_3547351_-	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	100.0	9.3e-26
AXC92005.1|3547359_3547920_-	hypothetical protein	NA	M1FQV7	Enterobacteria_phage	99.5	2.3e-105
AXC92006.1|3547916_3548423_-	hypothetical protein	NA	M1FPE2	Enterobacteria_phage	99.4	5.0e-91
AXC92007.1|3548397_3548808_-|head,tail	head-tail adaptor protein	head,tail	M1FJ87	Enterobacteria_phage	97.8	5.9e-74
AXC92008.1|3548804_3549128_-|head,tail	phage gp6-like head-tail connector protein	head,tail	U5P072	Shigella_phage	99.1	1.1e-56
AXC92009.1|3549102_3549330_-	hypothetical protein	NA	S5FNU1	Shigella_phage	94.9	2.2e-22
AXC92010.1|3549379_3550585_-|capsid	phage major capsid protein	capsid	M1FPN2	Enterobacteria_phage	99.5	3.5e-223
AXC92011.1|3550599_3551295_-|head,protease	HK97 family phage prohead protease	head,protease	U5P4H2	Shigella_phage	98.7	6.2e-124
AXC92012.1|3551236_3552478_-|portal	phage portal protein	portal	U5P411	Shigella_phage	99.5	5.0e-241
AXC92013.1|3552477_3552660_-	hypothetical protein	NA	S5FXQ9	Shigella_phage	100.0	1.7e-25
AXC92014.1|3552671_3554405_-|terminase	terminase large subunit	terminase	U5P0Q5	Shigella_phage	100.0	0.0e+00
AXC92015.1|3554418_3554913_-|terminase	phage terminase small subunit P27 family	terminase	Q8SBI1	Shigella_phage	99.4	1.6e-86
AXC92016.1|3555029_3555380_-	HNH endonuclease	NA	Q8SBD7	Shigella_phage	99.1	3.6e-64
AXC92017.1|3555563_3555956_-	DUF2570 domain-containing protein	NA	Q8SBD9	Shigella_phage	89.2	3.1e-56
AXC92018.1|3555939_3556416_-	lysozyme	NA	S5FV07	Shigella_phage	97.5	2.4e-87
AXC92019.1|3556419_3556755_-|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	100.0	5.2e-60
AXC92020.1|3556831_3557884_-	site-specific DNA-methyltransferase	NA	Q8SBE2	Shigella_phage	98.9	9.8e-206
AXC92021.1|3558033_3558348_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	90.7	1.5e-29
AXC92022.1|3558477_3559230_-	antitermination protein	NA	Q8SBE4	Shigella_phage	100.0	2.8e-138
AXC92023.1|3559243_3560233_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.4	9.5e-195
AXC92024.1|3560240_3561050_-	KilA-N domain-containing protein	NA	A5LH75	Enterobacteria_phage	99.6	1.8e-151
AXC92025.1|3561069_3561459_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	99.2	1.6e-68
AXC92026.1|3561455_3561782_-	LexA family transcriptional regulator	NA	A0A0N7KZF7	Stx2-converting_phage	98.1	4.5e-53
AXC92027.1|3561778_3562432_-	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	98.6	4.7e-126
AXC92028.1|3562431_3562926_-	PerC family transcriptional regulator	NA	K7PJR0	Enterobacteria_phage	98.8	3.3e-87
AXC92029.1|3562922_3563741_-	helix-turn-helix domain-containing protein	NA	Q8SBF1	Shigella_phage	100.0	1.8e-122
AXC93177.1|3563737_3563962_-	hypothetical protein	NA	A0A291AX25	Escherichia_phage	95.9	5.9e-36
AXC92030.1|3563966_3564803_-	ash family protein	NA	A0A291AWU3	Escherichia_phage	99.6	2.2e-152
AXC93178.1|3564799_3565351_-	hypothetical protein	NA	Q8SBF4	Shigella_phage	100.0	7.6e-101
AXC92031.1|3565394_3565595_-	transcriptional regulator	NA	U5P445	Shigella_phage	100.0	7.9e-32
AXC92032.1|3565685_3566360_+	LexA family transcriptional repressor	NA	Q8SBF6	Shigella_phage	100.0	1.2e-132
AXC92033.1|3566772_3566964_-	hypothetical protein	NA	S5FM78	Shigella_phage	100.0	3.3e-27
AXC92034.1|3567105_3567330_-	hypothetical protein	NA	A0A291AWX8	Escherichia_phage	63.1	3.4e-15
AXC92035.1|3567384_3567765_+	hypothetical protein	NA	U5P4J6	Shigella_phage	100.0	3.3e-63
AXC92036.1|3567830_3568655_+	DUF2303 family protein	NA	U5P439	Shigella_phage	99.6	1.7e-149
AXC92037.1|3568782_3569319_+	HD family hydrolase	NA	U5P0T3	Shigella_phage	100.0	4.3e-101
AXC92038.1|3569309_3569672_+	hypothetical protein	NA	U5P092	Shigella_phage	100.0	2.1e-67
AXC92039.1|3569671_3569977_+	hypothetical protein	NA	U5P0J0	Shigella_phage	100.0	6.8e-51
AXC92040.1|3570203_3571367_+|integrase	integrase	integrase	U5P434	Shigella_phage	100.0	2.4e-229
AXC92041.1|3571572_3572823_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	48.0	1.0e-97
3571380:3571427	attR	AATGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
AXC92042.1|3572834_3573938_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	39.8	6.9e-61
AXC92043.1|3574220_3575273_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	58.8	1.5e-113
>prophage 11
CP029999	Salmonella enterica subsp. enterica strain SA20113174 chromosome, complete genome	4724618	3702966	3759374	4724618	head,protease,terminase,tRNA,tail,capsid,portal	uncultured_Caudovirales_phage(46.67%)	53	NA	NA
AXC92148.1|3702966_3704394_-|protease	periplasmic serine endoprotease DegP	protease	A0A1B1IT49	uncultured_Mediterranean_phage	29.2	4.2e-26
AXC92149.1|3704523_3706041_-	deoxyguanosinetriphosphate triphosphohydrolase	NA	NA	NA	NA	NA
AXC92150.1|3706125_3706824_+	5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase	NA	NA	NA	NA	NA
AXC92151.1|3706816_3707617_+	cobalamin-binding protein	NA	NA	NA	NA	NA
AXC92152.1|3707653_3708277_+	hypothetical protein	NA	NA	NA	NA	NA
AXC92153.1|3708377_3708722_-	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	50.5	1.0e-26
AXC92154.1|3708803_3710225_-	ClC family H(+)/Cl(-) exchange transporter	NA	NA	NA	NA	NA
AXC92155.1|3710394_3711675_+	glutamate-1-semialdehyde-2,1-aminomutase	NA	NA	NA	NA	NA
AXC93184.1|3711759_3713799_-	Fe(3+)-hydroxamate ABC transporter permease FhuB	NA	NA	NA	NA	NA
AXC92156.1|3713813_3714704_-	Fe(3+)-hydroxamate ABC transporter substrate-binding protein FhuD	NA	NA	NA	NA	NA
AXC92157.1|3714703_3715501_-	Fe3+-hydroxamate ABC transporter ATP-binding protein FhuC	NA	G9BWD6	Planktothrix_phage	27.4	4.6e-14
AXC92158.1|3715549_3717793_-	ferrichrome porin FhuA	NA	NA	NA	NA	NA
AXC92159.1|3718085_3720608_-	bifunctional glycosyl transferase/transpeptidase	NA	NA	NA	NA	NA
AXC92160.1|3720748_3723232_-	ATP-dependent helicase HrpB	NA	A0A2H4UU36	Bodo_saltans_virus	27.8	3.1e-32
AXC92161.1|3723259_3723790_+	RNA 2',3'-cyclic phosphodiesterase	NA	NA	NA	NA	NA
AXC92162.1|3723806_3724511_+	DNA/RNA nuclease SfsA	NA	NA	NA	NA	NA
AXC92163.1|3724687_3725143_+	RNA polymerase-binding transcription factor DksA	NA	NA	NA	NA	NA
AXC93185.1|3725211_3726108_+|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
AXC92164.1|3726248_3727667_+	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	37.8	1.4e-26
AXC92165.1|3727663_3728143_+	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
AXC92166.1|3728546_3729140_+	fimbrial protein	NA	NA	NA	NA	NA
AXC92167.1|3729405_3730143_+	fimbrial chaperone	NA	NA	NA	NA	NA
AXC92168.1|3730163_3732809_+	outer membrane usher protein	NA	NA	NA	NA	NA
AXC92169.1|3732795_3733362_+	fimbrial protein	NA	NA	NA	NA	NA
AXC92170.1|3733376_3733985_+	fimbrial protein	NA	NA	NA	NA	NA
AXC92171.1|3733984_3734581_+	fimbrial protein	NA	NA	NA	NA	NA
AXC92172.1|3734602_3735871_+	fimbrial-like adhesin	NA	NA	NA	NA	NA
AXC92173.1|3735992_3736787_+	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	NA	NA	NA	NA
AXC92174.1|3736912_3737767_+	pantoate--beta-alanine ligase	NA	NA	NA	NA	NA
AXC92175.1|3737861_3738242_+	aspartate 1-decarboxylase	NA	NA	NA	NA	NA
AXC92176.1|3738248_3739478_-	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
AXC92177.1|3739539_3739980_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
AXC92178.1|3740345_3740897_+	fimbrial protein StiA	NA	NA	NA	NA	NA
AXC92179.1|3740944_3741628_+	long polar fimbrial chaperone LpfB	NA	NA	NA	NA	NA
AXC92180.1|3741654_3744201_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
AXC92181.1|3744209_3745286_+	fimbrial protein StiH	NA	NA	NA	NA	NA
AXC92182.1|3745403_3746174_-	ABC transporter permease	NA	NA	NA	NA	NA
AXC92183.1|3746170_3747097_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	32.7	5.9e-21
AXC92184.1|3747205_3747868_+	carbonate dehydratase	NA	NA	NA	NA	NA
AXC92185.1|3747925_3748462_-	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	33.1	1.0e-17
AXC92186.1|3749193_3749634_+	hypothetical protein	NA	NA	NA	NA	NA
AXC92187.1|3749758_3750052_-	hypothetical protein	NA	NA	NA	NA	NA
AXC92188.1|3750048_3751710_-|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	82.8	2.3e-278
AXC92189.1|3751693_3752050_-|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	83.8	6.1e-51
AXC93186.1|3752168_3752345_-	hypothetical protein	NA	NA	NA	NA	NA
AXC92190.1|3752337_3752778_-	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	76.0	9.1e-65
AXC92191.1|3752777_3753080_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	61.1	1.4e-27
AXC92192.1|3753072_3754287_-|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	87.6	9.9e-210
AXC92193.1|3754288_3754849_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	84.9	2.6e-88
AXC92194.1|3754903_3756073_-|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	76.5	2.7e-164
AXC92195.1|3756346_3756595_-	hypothetical protein	NA	NA	NA	NA	NA
AXC92196.1|3756613_3757039_-	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
AXC92197.1|3757250_3759374_-	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	50.6	8.9e-174
