The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP029992	Salmonella enterica subsp. enterica strain SA20011914 chromosome, complete genome	4807680	177599	185037	4807680		Escherichia_phage(42.86%)	7	NA	NA
AXC79560.1|177599_180212_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.1	5.3e-19
AXC83625.1|180621_180861_+	virulence protein MsgA	NA	K7P6H1	Enterobacteria_phage	84.8	1.2e-31
AXC83626.1|181734_182553_+	cytolethal distending toxin subunit B family protein	NA	A5LH53	Enterobacteria_phage	50.7	1.1e-63
AXC79561.1|182620_182998_+	DUF1353 domain-containing protein	NA	I1TQ41	Pseudomonas_phage	38.4	2.2e-14
AXC79562.1|183146_183689_-	hypothetical protein	NA	A0A0U2S643	Escherichia_phage	67.0	8.1e-71
AXC79563.1|183879_184608_-	pertussis toxin-like subunit ArtA	NA	A0A0U2KD26	Escherichia_phage	51.6	7.8e-61
AXC79564.1|184623_185037_-	subtilase cytotoxin subunit B	NA	A0A0U2KD34	Escherichia_phage	37.7	2.4e-19
>prophage 2
CP029992	Salmonella enterica subsp. enterica strain SA20011914 chromosome, complete genome	4807680	189881	198439	4807680		Salmonella_phage(42.86%)	8	NA	NA
AXC79566.1|189881_190916_+	hypothetical protein	NA	A4KWR9	Enterobacteria_phage	41.1	4.3e-73
AXC79567.1|191451_192099_-	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	36.2	2.1e-25
AXC79568.1|192211_192454_-	hypothetical protein	NA	A0A0P0ZEF0	Stx2-converting_phage	55.1	3.0e-17
AXC79569.1|192431_192602_-	hypothetical protein	NA	NA	NA	NA	NA
AXC79570.1|192608_195353_-	hypothetical protein	NA	A0A0K2FI38	Escherichia_phage	68.2	2.8e-284
AXC79571.1|196282_196522_+	DUF4060 family protein	NA	S4TR31	Salmonella_phage	97.5	4.4e-37
AXC79572.1|196853_197147_+	excisionase	NA	S4TND0	Salmonella_phage	86.2	5.9e-36
AXC79573.1|197146_198439_+	DUF3596 domain-containing protein	NA	S4TSP2	Salmonella_phage	91.4	7.2e-235
>prophage 3
CP029992	Salmonella enterica subsp. enterica strain SA20011914 chromosome, complete genome	4807680	849732	898185	4807680	holin,tail,integrase,terminase	Salmonella_phage(34.62%)	63	846805:846850	894295:894340
846805:846850	attL	TGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
AXC80129.1|849732_850389_-	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	37.3	9.9e-31
AXC80130.1|850500_850740_-	hypothetical protein	NA	A0A0P0ZEF0	Stx2-converting_phage	56.2	2.3e-17
AXC80131.1|850726_851365_-	hypothetical protein	NA	A0A2I7RBK1	Vibrio_phage	40.1	8.1e-30
AXC80132.1|851357_852080_-	DUF2612 domain-containing protein	NA	A0A2P9HXZ0	Yersinia_phage	51.1	3.0e-65
AXC80133.1|852076_853258_-	hypothetical protein	NA	A0A2I7QS90	Vibrio_phage	48.2	4.6e-103
AXC80134.1|853241_853622_-	hypothetical protein	NA	A0A2H5BFY4	Vibrio_phage	56.9	8.0e-25
AXC80135.1|853618_854215_-	hypothetical protein	NA	A0A2P9HY74	Yersinia_phage	63.3	1.7e-45
AXC80136.1|854282_855641_-	SGNH/GDSL hydrolase family protein	NA	A0A223LJ40	Erwinia_phage	54.6	1.9e-129
AXC80137.1|855643_855946_-	hypothetical protein	NA	NA	NA	NA	NA
AXC80138.1|856781_857726_-	hypothetical protein	NA	A0A2P9HXK2	Yersinia_phage	47.1	1.4e-70
AXC83652.1|857725_858061_-	hypothetical protein	NA	A0A2I7RBP0	Vibrio_phage	53.8	2.5e-30
AXC83653.1|858068_858866_-	hypothetical protein	NA	A0A2P9HXI6	Yersinia_phage	42.9	3.4e-49
AXC80139.1|858865_860668_-|tail	phage tail tape measure protein	tail	A0A2I7QS75	Vibrio_phage	46.1	3.2e-87
AXC80140.1|860821_861250_-	hypothetical protein	NA	A0A2P9HXM8	Yersinia_phage	45.7	7.6e-24
AXC80141.1|861259_861691_-	hypothetical protein	NA	A0A2P9HXY3	Yersinia_phage	53.1	1.5e-32
AXC80142.1|861701_863204_-	DUF3383 family protein	NA	A0A2I7QS67	Vibrio_phage	57.2	1.0e-152
AXC80143.1|863204_863693_-	hypothetical protein	NA	A0A2I7QS82	Vibrio_phage	56.1	1.7e-40
AXC80144.1|863689_864046_-	hypothetical protein	NA	NA	NA	NA	NA
AXC80145.1|864042_864615_-	hypothetical protein	NA	A0A2I7QS63	Vibrio_phage	38.1	1.1e-25
AXC80146.1|864631_864994_-	DUF4054 domain-containing protein	NA	Q7Y5T9	Haemophilus_phage	41.4	6.0e-14
AXC80147.1|865008_865977_-	DUF2184 domain-containing protein	NA	NA	NA	NA	NA
AXC80148.1|865980_866472_-	hypothetical protein	NA	NA	NA	NA	NA
AXC80149.1|866474_867623_-	DUF2213 domain-containing protein	NA	A0A2H4J159	uncultured_Caudovirales_phage	33.5	2.1e-15
AXC80150.1|867626_868478_-	hypothetical protein	NA	Q7Y5U5	Haemophilus_phage	33.5	1.1e-29
AXC80151.1|868455_869778_-	DUF1073 domain-containing protein	NA	L7TRA1	Rhizobium_phage	25.2	1.5e-22
AXC80152.1|869777_871196_-|terminase	terminase	terminase	A0A2K9V3I6	Faecalibacterium_phage	40.7	7.5e-84
AXC80153.1|871161_872169_-|terminase	terminase small subunit	terminase	I6X6R5	Burkholderia_virus	46.1	1.8e-44
AXC80154.1|872229_872733_-	hypothetical protein	NA	NA	NA	NA	NA
AXC80155.1|872835_873378_-	DUF2514 family protein	NA	NA	NA	NA	NA
AXC80156.1|873374_874001_-	glycoside hydrolase family 19 protein	NA	Q858F0	Salmonella_phage	81.6	1.4e-95
AXC80157.1|874003_874351_-|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	80.4	9.8e-46
AXC80158.1|874621_875308_+	PipA/GogA/GtgA family type III secretion system effector	NA	Q9MBM0	Phage_Gifsy-2	93.9	9.4e-125
AXC80159.1|875616_875835_-	hypothetical protein	NA	NA	NA	NA	NA
AXC80160.1|875989_876550_-	ORF6N domain-containing protein	NA	A0A0P0ZDQ5	Stx2-converting_phage	86.3	2.0e-56
AXC80161.1|877098_877395_-	hypothetical protein	NA	NA	NA	NA	NA
AXC80162.1|877391_878069_-	antiterminator	NA	I6PDF8	Cronobacter_phage	53.1	1.5e-61
AXC80163.1|878065_878206_-	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	78.9	7.2e-08
AXC80164.1|878202_878814_-	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	99.0	9.3e-92
AXC80165.1|878816_879023_-	hypothetical protein	NA	S4TNP0	Salmonella_phage	64.7	9.9e-22
AXC80166.1|879022_879625_-	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	99.0	3.7e-109
AXC80167.1|879707_879929_-	hypothetical protein	NA	NA	NA	NA	NA
AXC80168.1|880040_880274_-	DinI family protein	NA	H6WRY5	Salmonella_phage	97.4	4.7e-36
AXC80169.1|880569_881148_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	37.6	2.0e-19
AXC80170.1|881729_882056_-	hypothetical protein	NA	NA	NA	NA	NA
AXC83654.1|882149_882218_-	DUF551 domain-containing protein	NA	NA	NA	NA	NA
AXC80171.1|882198_883416_-	hypothetical protein	NA	J9Q803	Salmonella_phage	53.3	3.1e-118
AXC80172.1|883726_883972_-	hypothetical protein	NA	Q5G8U9	Enterobacteria_phage	88.9	3.0e-33
AXC80173.1|883971_884292_-	hypothetical protein	NA	H6WRY0	Salmonella_phage	65.5	6.7e-25
AXC80174.1|884288_884636_-	DUF977 family protein	NA	H6WRX9	Salmonella_phage	97.4	1.6e-56
AXC80175.1|884646_885396_-	DNA replication protein DnaC	NA	S4TNF5	Salmonella_phage	100.0	4.3e-139
AXC80176.1|885398_886382_-	hypothetical protein	NA	H6WRX7	Salmonella_phage	97.4	1.4e-158
AXC80177.1|886466_886841_-	hypothetical protein	NA	S4TTD7	Salmonella_phage	99.2	3.9e-64
AXC80178.1|886806_887046_-	helix-turn-helix domain-containing protein	NA	H6WRX5	Salmonella_phage	47.2	8.3e-12
AXC80179.1|887165_887576_+	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	42.4	8.1e-07
AXC80180.1|887877_888036_+	hypothetical protein	NA	H6WRX3	Salmonella_phage	100.0	2.4e-23
AXC80181.1|888057_888408_+	DNA breaking-rejoining protein	NA	S4TSN6	Salmonella_phage	95.7	4.1e-60
AXC80182.1|888534_891450_+	exodeoxyribonuclease	NA	H6WRX1	Salmonella_phage	94.9	0.0e+00
AXC80183.1|891412_892570_+	enterohemolysin	NA	S4TTE8	Salmonella_phage	99.5	6.1e-217
AXC80184.1|892612_892852_+	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
AXC80185.1|893116_894280_+|integrase	site-specific integrase	integrase	G8C7S0	Escherichia_phage	67.1	1.4e-152
AXC80186.1|894485_895736_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	46.7	5.2e-97
894295:894340	attR	TGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
AXC80187.1|895746_896850_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	39.8	6.9e-61
AXC80188.1|897132_898185_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	58.7	1.0e-114
>prophage 5
CP029992	Salmonella enterica subsp. enterica strain SA20011914 chromosome, complete genome	4807680	1676113	1719047	4807680	tail,plate,tRNA	Burkholderia_phage(42.11%)	45	NA	NA
AXC80833.1|1676113_1677112_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
AXC80834.1|1677199_1678510_-	conjugal transfer protein	NA	NA	NA	NA	NA
AXC80835.1|1678756_1679272_+	transcriptional regulator Zur	NA	NA	NA	NA	NA
AXC80836.1|1679370_1679580_-	CsbD family protein	NA	NA	NA	NA	NA
AXC80837.1|1679601_1679730_-	hypothetical protein	NA	NA	NA	NA	NA
AXC80838.1|1679711_1681037_-	MATE family efflux transporter	NA	NA	NA	NA	NA
AXC80839.1|1681215_1681824_-	LexA repressor	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
AXC80840.1|1681932_1682301_-	diacylglycerol kinase	NA	NA	NA	NA	NA
AXC80841.1|1682471_1684892_+	glycerol-3-phosphate 1-O-acyltransferase	NA	NA	NA	NA	NA
AXC80842.1|1685002_1685875_-	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
AXC80843.1|1685888_1686386_-	chorismate lyase	NA	NA	NA	NA	NA
AXC80844.1|1686566_1687484_-	maltose operon protein MalM	NA	NA	NA	NA	NA
AXC80845.1|1687647_1689006_-	maltoporin	NA	NA	NA	NA	NA
AXC80846.1|1689093_1690203_-	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	47.2	6.2e-17
AXC80847.1|1690563_1691754_+	maltose/maltodextrin ABC transporter substrate-binding protein MalE	NA	NA	NA	NA	NA
AXC80848.1|1691940_1693485_+	maltose ABC transporter permease MalF	NA	NA	NA	NA	NA
AXC80849.1|1693499_1694390_+	maltose ABC transporter permease	NA	NA	NA	NA	NA
AXC80850.1|1694732_1696208_+	D-xylose transporter XylE	NA	NA	NA	NA	NA
AXC80851.1|1696253_1696664_-	phosphate-starvation-inducible protein PsiE	NA	NA	NA	NA	NA
AXC80852.1|1696805_1698902_-	YjbH domain-containing protein	NA	NA	NA	NA	NA
AXC80853.1|1698901_1699639_-	hypothetical protein	NA	NA	NA	NA	NA
AXC80854.1|1699635_1700274_-	YjbF family lipoprotein	NA	NA	NA	NA	NA
AXC80855.1|1700337_1700580_-	outer membrane protein	NA	NA	NA	NA	NA
AXC80856.1|1701022_1702672_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
AXC80857.1|1703060_1704410_+	lysine-sensitive aspartokinase 3	NA	NA	NA	NA	NA
AXC80858.1|1704544_1704892_-	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.5	4.9e-21
AXC80859.1|1705467_1705755_+	hypothetical protein	NA	Q6QIC8	Burkholderia_phage	49.1	1.8e-16
AXC80860.1|1705757_1706363_+	lytic transglycosylase domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	56.5	5.7e-57
AXC80861.1|1706375_1706690_+	hypothetical protein	NA	Q6QIC4	Burkholderia_phage	49.1	4.9e-20
AXC80862.1|1706849_1707305_+	hypothetical protein	NA	NA	NA	NA	NA
AXC80863.1|1707301_1707499_+	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	52.9	5.1e-07
AXC80864.1|1707488_1708904_+|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	69.5	6.3e-184
AXC80865.1|1708903_1709428_+|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.0	4.0e-67
AXC80866.1|1709479_1709797_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
AXC80867.1|1709756_1709885_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
AXC80868.1|1709978_1712264_+|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	28.8	9.3e-68
AXC80869.1|1712263_1713217_+	chemotaxis protein	NA	A4JWL1	Burkholderia_virus	53.1	4.2e-38
AXC83680.1|1713216_1713426_+	hypothetical protein	NA	A4JWL2	Burkholderia_virus	60.3	9.8e-17
AXC80870.1|1713413_1714454_+	phage protein D	NA	A4JWL3	Burkholderia_virus	45.3	3.0e-74
AXC80871.1|1714463_1715186_+|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	42.0	3.9e-12
AXC80872.1|1715283_1715643_+|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	64.2	1.4e-34
AXC80873.1|1715633_1716749_+|plate	baseplate protein	plate	Q6QI99	Burkholderia_phage	53.0	4.3e-103
AXC80874.1|1716741_1717374_+|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	54.9	1.6e-22
AXC80875.1|1717376_1718522_+|tail	phage tail protein	tail	A0A0M3ULF6	Salmonella_phage	52.5	2.7e-52
AXC80876.1|1718531_1719047_+|tail	tail fiber assembly protein	tail	A0A0U2QV64	Escherichia_phage	42.4	1.2e-34
>prophage 6
CP029992	Salmonella enterica subsp. enterica strain SA20011914 chromosome, complete genome	4807680	2710854	2755249	4807680	tRNA,terminase,tail,capsid,integrase,head,holin,portal	Cronobacter_phage(66.67%)	49	2707869:2707884	2738333:2738348
2707869:2707884	attL	TCCGTTGACGATATTG	NA	NA	NA	NA
AXC81726.1|2710854_2711187_+|tRNA	tRNA-binding protein	tRNA	NA	NA	NA	NA
AXC81727.1|2711281_2712661_-	putrescine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	28.5	1.4e-31
AXC81728.1|2713090_2714611_+	PAS domain-containing protein	NA	A0A1B0V854	Salmonella_phage	48.5	5.8e-34
AXC81729.1|2715003_2716572_+	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	27.1	2.2e-12
AXC81730.1|2716568_2717216_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
AXC81731.1|2717447_2718215_+	siderophore-interacting protein	NA	NA	NA	NA	NA
AXC81732.1|2718676_2719714_-|integrase	integrase	integrase	F1BUS9	Erwinia_phage	64.7	6.6e-122
AXC81733.1|2719717_2720284_-	hypothetical protein	NA	Q4ZA70	Staphylococcus_virus	35.0	3.0e-20
AXC81734.1|2720300_2720882_-	phage repressor protein	NA	F1BUS8	Erwinia_phage	39.8	2.5e-33
AXC81735.1|2721017_2721239_+	regulator	NA	NA	NA	NA	NA
AXC81736.1|2721269_2721773_+	hypothetical protein	NA	F1BUN6	Cronobacter_phage	72.5	3.5e-60
AXC81737.1|2721782_2721956_+	hypothetical protein	NA	NA	NA	NA	NA
AXC81738.1|2722185_2722611_+	hypothetical protein	NA	F1BUN5	Cronobacter_phage	49.6	3.8e-23
AXC81739.1|2722610_2723012_+	hypothetical protein	NA	F1BUN2	Cronobacter_phage	66.9	2.9e-49
AXC83726.1|2723157_2723334_+	DUF2732 family protein	NA	NA	NA	NA	NA
AXC83727.1|2723339_2724467_+	DGQHR domain-containing protein	NA	T1SBJ4	Salmonella_phage	69.5	2.0e-148
AXC81740.1|2724463_2725321_+	DNA adenine methylase	NA	F1BUN1	Cronobacter_phage	87.4	1.2e-140
AXC81741.1|2727453_2727660_+	hypothetical protein	NA	NA	NA	NA	NA
AXC81742.1|2727633_2727957_-	transcriptional regulator	NA	F1BUM8	Cronobacter_phage	92.3	8.0e-50
AXC81743.1|2727953_2729015_-|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	77.1	1.8e-162
AXC81744.1|2729011_2730787_-|terminase	terminase	terminase	F1BUM5	Cronobacter_phage	83.4	4.4e-291
AXC81745.1|2730947_2731751_+|capsid	phage capsid protein	capsid	F1BUM4	Cronobacter_phage	56.4	4.1e-79
AXC81746.1|2731812_2732835_+|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	80.9	9.6e-158
AXC81747.1|2732838_2733540_+|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	66.8	9.4e-88
AXC83728.1|2733636_2734089_+|head	head completion protein	head	F1BUL8	Cronobacter_phage	82.7	1.6e-64
AXC81748.1|2734085_2734592_+|tail	phage tail protein	tail	F1BUL7	Cronobacter_phage	69.1	1.5e-63
AXC81749.1|2734588_2735296_+	hypothetical protein	NA	F1BUL6	Cronobacter_phage	76.5	6.8e-102
AXC81750.1|2735292_2736420_+	DUF2586 domain-containing protein	NA	F1BUL5	Cronobacter_phage	83.7	1.9e-175
AXC81751.1|2736416_2736872_+	DUF2597 family protein	NA	F1BUL4	Cronobacter_phage	72.2	1.5e-57
AXC81752.1|2736881_2737175_+|holin	holin	holin	C7BGD7	Burkholderia_phage	46.2	1.3e-14
AXC81753.1|2737171_2737513_+	M15 family peptidase	NA	F1BUL3	Cronobacter_phage	91.1	2.2e-50
AXC81754.1|2737512_2737845_+	hypothetical protein	NA	F1BUL2	Cronobacter_phage	71.8	3.9e-36
AXC81755.1|2737816_2738005_+	hypothetical protein	NA	F1BUL1	Cronobacter_phage	80.6	1.1e-22
AXC81756.1|2737991_2738249_+	hypothetical protein	NA	A5X9I7	Aeromonas_virus	63.4	3.6e-21
AXC81757.1|2738436_2740407_+|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	70.5	3.3e-271
2738333:2738348	attR	TCCGTTGACGATATTG	NA	NA	NA	NA
AXC81758.1|2740403_2740733_+	DUF2590 family protein	NA	F1BUK8	Cronobacter_phage	72.4	3.8e-39
AXC81759.1|2740729_2741914_+	hypothetical protein	NA	F1BUK6	Cronobacter_phage	77.9	1.1e-178
AXC81760.1|2741900_2742494_+	hypothetical protein	NA	F1BUK5	Cronobacter_phage	82.6	2.9e-90
AXC81761.1|2742503_2744531_+|tail	phage tail protein	tail	F1BUK3	Cronobacter_phage	47.6	4.0e-155
AXC81762.1|2744548_2745076_+|tail	phage tail protein	tail	A0A0U2QV64	Escherichia_phage	52.6	3.1e-51
AXC81763.1|2745065_2745791_+	hypothetical protein	NA	F1BUK1	Cronobacter_phage	57.3	1.0e-68
AXC81764.1|2745762_2746308_+	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	71.4	3.5e-58
AXC81765.1|2746307_2748011_+	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	81.3	2.9e-223
AXC81766.1|2748169_2748391_+	hypothetical protein	NA	NA	NA	NA	NA
AXC81767.1|2749185_2749692_+	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
AXC81768.1|2749814_2751797_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	9.0e-35
AXC81769.1|2751811_2753557_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.4	2.1e-72
AXC81770.1|2753792_2754008_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
AXC81771.1|2754235_2755249_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.5	1.7e-109
>prophage 7
CP029992	Salmonella enterica subsp. enterica strain SA20011914 chromosome, complete genome	4807680	3799119	3809136	4807680	tRNA,transposase	Enterobacteria_phage(57.14%)	10	NA	NA
AXC82702.1|3799119_3800067_+	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.8	6.2e-10
AXC82703.1|3800050_3800782_+	ABC transporter permease	NA	NA	NA	NA	NA
AXC82704.1|3800762_3800870_-	hypothetical protein	NA	NA	NA	NA	NA
AXC82705.1|3800929_3801661_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
AXC82706.1|3801883_3803569_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	90.4	1.1e-275
AXC82707.1|3803565_3804285_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AXC83761.1|3804331_3804802_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.4	8.0e-75
AXC82708.1|3804953_3805412_-	DUF1307 domain-containing protein	NA	Q9EYF5	Enterobacteria_phage	74.5	8.9e-55
AXC82709.1|3805690_3807053_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.6	7.2e-76
AXC82710.1|3807102_3809136_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	4.7e-55
