The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP035765	Sphingomonas paucimobilis strain AIMST S2 chromosome, complete genome	4005505	1105625	1139669	4005505	portal,protease,tail,terminase,transposase	uncultured_Caudovirales_phage(50.0%)	39	NA	NA
QBE91481.1|1105625_1106072_+|terminase	terminase	terminase	NA	NA	NA	NA
QBE91482.1|1106037_1108032_+|terminase	terminase	terminase	A0A2H4JIC6	uncultured_Caudovirales_phage	35.1	4.6e-87
QBE91483.1|1108034_1108259_+	hypothetical protein	NA	NA	NA	NA	NA
QBE93924.1|1108348_1109824_+|portal	phage portal protein	portal	D6PFE5	uncultured_phage	30.3	1.7e-46
QBE91484.1|1109824_1111870_+|protease	Clp protease ClpP	protease	B7SYD7	Stenotrophomonas_phage	46.6	8.8e-102
QBE91485.1|1111930_1112230_+	hypothetical protein	NA	NA	NA	NA	NA
QBE91486.1|1112236_1112572_+	DUF2190 family protein	NA	NA	NA	NA	NA
QBE91487.1|1112679_1112976_+	hypothetical protein	NA	NA	NA	NA	NA
QBE91488.1|1112978_1113401_+	HK97 gp10 family phage protein	NA	NA	NA	NA	NA
QBE91489.1|1113397_1113805_+	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
QBE91490.1|1113816_1114296_+	hypothetical protein	NA	NA	NA	NA	NA
QBE91491.1|1114295_1114754_+	hypothetical protein	NA	NA	NA	NA	NA
QBE91492.1|1114837_1115095_+	hypothetical protein	NA	NA	NA	NA	NA
QBE91493.1|1115119_1118332_+|tail	phage tail tape measure protein	tail	A0A2H4J669	uncultured_Caudovirales_phage	28.9	1.7e-14
QBE91494.1|1118331_1118928_+	hypothetical protein	NA	NA	NA	NA	NA
QBE91495.1|1118927_1119497_+	hypothetical protein	NA	NA	NA	NA	NA
QBE91496.1|1119489_1119912_+	hypothetical protein	NA	NA	NA	NA	NA
QBE91497.1|1119908_1121681_+	hypothetical protein	NA	NA	NA	NA	NA
QBE91498.1|1121694_1122093_+	hypothetical protein	NA	NA	NA	NA	NA
QBE91499.1|1122089_1123799_+	hypothetical protein	NA	NA	NA	NA	NA
QBE91500.1|1123810_1124596_+	hypothetical protein	NA	NA	NA	NA	NA
QBE93925.1|1125044_1125494_+	hypothetical protein	NA	NA	NA	NA	NA
QBE91501.1|1125490_1125895_+	hypothetical protein	NA	NA	NA	NA	NA
QBE91502.1|1126021_1126609_+	glycoside hydrolase family 19 protein	NA	A0A2H4JAK8	uncultured_Caudovirales_phage	47.3	2.2e-37
QBE91503.1|1126605_1127043_+	hypothetical protein	NA	NA	NA	NA	NA
QBE91504.1|1127165_1127753_+	hypothetical protein	NA	NA	NA	NA	NA
QBE91505.1|1127775_1128240_+	hypothetical protein	NA	NA	NA	NA	NA
QBE91506.1|1128239_1129637_+	hypothetical protein	NA	NA	NA	NA	NA
QBE91507.1|1129633_1129819_-	hypothetical protein	NA	NA	NA	NA	NA
QBE93926.1|1129863_1130148_+	hypothetical protein	NA	NA	NA	NA	NA
QBE91508.1|1130126_1130309_-	hypothetical protein	NA	NA	NA	NA	NA
QBE91509.1|1130977_1131730_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	29.3	3.7e-13
QBE91510.1|1132289_1133198_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
QBE91511.1|1133298_1134609_+	citrate transporter	NA	NA	NA	NA	NA
QBE91512.1|1134846_1135428_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
QBE91513.1|1135441_1135735_+	hypothetical protein	NA	NA	NA	NA	NA
QBE91514.1|1135731_1136337_+	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
QBE91515.1|1136654_1137509_+	DMT family transporter	NA	NA	NA	NA	NA
QBE91516.1|1138364_1139669_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
>prophage 2
CP035765	Sphingomonas paucimobilis strain AIMST S2 chromosome, complete genome	4005505	1453085	1489395	4005505	plate,portal,tail,terminase,head,integrase,transposase,capsid	Burkholderia_phage(27.27%)	55	1451125:1451176	1489504:1489555
1451125:1451176	attL	CACCGGGTGGTAGCGAAGGAGGGACTTGAACCCCCGACACGCGGATTATGAT	NA	NA	NA	NA
QBE93966.1|1453085_1454150_-|portal	phage portal protein	portal	E5E3S7	Burkholderia_phage	52.6	1.7e-88
QBE91755.1|1456155_1456983_+|capsid	phage capsid protein	capsid	E5E3W9	Burkholderia_phage	32.7	4.4e-28
QBE91756.1|1457030_1458134_+|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	46.3	6.9e-77
QBE91757.1|1458180_1459077_+|terminase	terminase	terminase	A0A1S5NNA5	Burkholderia_phage	34.0	8.8e-30
QBE91758.1|1459078_1459459_+	hypothetical protein	NA	A0A1W6DXI7	Sphingobium_phage	36.8	1.2e-09
QBE91759.1|1459569_1459806_+	hypothetical protein	NA	NA	NA	NA	NA
QBE91760.1|1459802_1460294_+|head	head completion/stabilization protein	head	V9IQW6	Stenotrophomonas_phage	40.7	8.2e-22
QBE91761.1|1460293_1460503_+|tail	phage tail protein	tail	A0A077K8R0	Ralstonia_phage	50.8	8.9e-10
QBE91762.1|1460508_1460850_+	hypothetical protein	NA	NA	NA	NA	NA
QBE91763.1|1460846_1461365_+	lysozyme	NA	S4S2D7	Puniceispirillum_phage	34.1	4.3e-13
QBE91764.1|1461361_1461835_+	hypothetical protein	NA	NA	NA	NA	NA
QBE93967.1|1461806_1462079_+	hypothetical protein	NA	NA	NA	NA	NA
QBE91765.1|1462075_1462411_+	hypothetical protein	NA	NA	NA	NA	NA
QBE91766.1|1462403_1463798_+	hypothetical protein	NA	NA	NA	NA	NA
QBE91767.1|1463794_1464283_+|tail	phage tail protein	tail	A0A1S5NPS3	Burkholderia_phage	43.3	6.2e-22
QBE91768.1|1464279_1464945_+	phage virion morphogenesis protein	NA	A0A0M4RCU1	Salmonella_phage	32.1	3.9e-19
QBE93968.1|1465015_1465912_+|plate	baseplate assembly protein	plate	V9IQV9	Stenotrophomonas_phage	45.2	8.7e-62
QBE91769.1|1465901_1466177_+|tail	phage tail protein I	tail	D5LGZ2	Escherichia_phage	46.2	1.2e-06
QBE91770.1|1466218_1467382_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
QBE91771.1|1467704_1468202_+	hypothetical protein	NA	NA	NA	NA	NA
QBE91772.1|1468296_1468683_+	hypothetical protein	NA	NA	NA	NA	NA
QBE91773.1|1468679_1469696_+	hypothetical protein	NA	V9IQX0	Stenotrophomonas_phage	38.7	7.1e-28
QBE91774.1|1469705_1471553_+	hypothetical protein	NA	NA	NA	NA	NA
QBE91775.1|1471562_1472420_+	hypothetical protein	NA	NA	NA	NA	NA
QBE93969.1|1472499_1473054_+|plate	phage baseplate assembly protein V	plate	V9IQH1	Stenotrophomonas_phage	47.7	2.8e-18
QBE91776.1|1473050_1473428_+	oxidoreductase	NA	A0A1S5NNH3	Burkholderia_phage	45.6	2.9e-19
QBE91777.1|1473424_1474597_+|tail	phage tail protein	tail	Q9ZXK4	Pseudomonas_virus	53.0	4.0e-91
QBE91778.1|1474629_1475145_+|tail	phage major tail tube protein	tail	A0A218M4J0	Erwinia_phage	53.5	3.7e-41
QBE91779.1|1475210_1475531_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
QBE91780.1|1475539_1475665_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
QBE91781.1|1475654_1478066_+|tail	phage tail tape measure protein	tail	Q9ZXK0	Pseudomonas_virus	26.4	6.0e-49
QBE91782.1|1478072_1478459_+|tail	phage tail protein	tail	Q9ZXJ9	Pseudomonas_virus	52.4	5.6e-34
QBE91783.1|1478455_1479484_+	phage late control D family protein	NA	K4PAY4	Burkholderia_phage	40.8	2.1e-64
QBE91784.1|1479493_1479829_-	hypothetical protein	NA	NA	NA	NA	NA
QBE91785.1|1479818_1480187_-	hypothetical protein	NA	NA	NA	NA	NA
QBE91786.1|1480253_1480616_-	hypothetical protein	NA	NA	NA	NA	NA
QBE91787.1|1480612_1481131_-	hypothetical protein	NA	NA	NA	NA	NA
QBE91788.1|1481171_1481783_-	hypothetical protein	NA	NA	NA	NA	NA
QBE91789.1|1481974_1482331_-	hypothetical protein	NA	NA	NA	NA	NA
QBE91790.1|1482344_1482809_-	hypothetical protein	NA	NA	NA	NA	NA
QBE91791.1|1482856_1483234_-	hypothetical protein	NA	NA	NA	NA	NA
QBE91792.1|1483266_1483782_-	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
QBE91793.1|1483870_1484317_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
QBE91794.1|1484430_1484745_+	hypothetical protein	NA	NA	NA	NA	NA
QBE91795.1|1484941_1485436_+	hypothetical protein	NA	NA	NA	NA	NA
QBE91796.1|1485432_1485741_+	transcriptional regulator	NA	NA	NA	NA	NA
QBE91797.1|1485853_1486261_+	hypothetical protein	NA	NA	NA	NA	NA
QBE91798.1|1486381_1486573_+	hypothetical protein	NA	NA	NA	NA	NA
QBE91799.1|1486664_1486928_+	DUF2312 domain-containing protein	NA	A0A2L0V115	Agrobacterium_phage	57.8	2.7e-16
QBE91800.1|1486927_1487389_+	hypothetical protein	NA	NA	NA	NA	NA
QBE91801.1|1487388_1487628_+	hypothetical protein	NA	NA	NA	NA	NA
QBE91802.1|1487630_1487903_+	hypothetical protein	NA	NA	NA	NA	NA
QBE91803.1|1487902_1488136_+	hypothetical protein	NA	NA	NA	NA	NA
QBE91804.1|1488128_1488326_+	hypothetical protein	NA	NA	NA	NA	NA
QBE91805.1|1488315_1489395_+|integrase	integrase	integrase	F8TUV0	EBPR_podovirus	58.4	2.1e-107
1489504:1489555	attR	CACCGGGTGGTAGCGAAGGAGGGACTTGAACCCCCGACACGCGGATTATGAT	NA	NA	NA	NA
>prophage 3
CP035765	Sphingomonas paucimobilis strain AIMST S2 chromosome, complete genome	4005505	1596392	1659449	4005505	transposase,capsid,tail,head	Pseudomonas_phage(15.38%)	56	NA	NA
QBE91866.1|1596392_1596650_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	43.5	2.5e-06
QBE93979.1|1596712_1597909_-	hypothetical protein	NA	NA	NA	NA	NA
QBE93980.1|1598212_1600417_-	methyl-accepting chemotaxis protein	NA	NA	NA	NA	NA
QBE91867.1|1601000_1601189_-	hypothetical protein	NA	NA	NA	NA	NA
QBE91868.1|1601498_1602536_-	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
QBE91869.1|1602611_1603211_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
QBE93981.1|1603272_1605042_-	methyl-accepting chemotaxis protein	NA	NA	NA	NA	NA
QBE93982.1|1605548_1608599_-	TonB-dependent receptor	NA	NA	NA	NA	NA
QBE91870.1|1609440_1609938_-	hypothetical protein	NA	NA	NA	NA	NA
QBE91871.1|1610260_1611424_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
QBE91872.1|1611868_1612981_-	hypothetical protein	NA	NA	NA	NA	NA
QBE91873.1|1613087_1614455_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
QBE91874.1|1614444_1615134_-	response regulator transcription factor	NA	NA	NA	NA	NA
QBE93983.1|1615393_1615846_-	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
QBE91875.1|1615975_1616878_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
QBE91876.1|1617121_1620454_+	PAS domain S-box protein	NA	A0A1V0SGX0	Hokovirus	25.4	3.2e-08
QBE91877.1|1620731_1621715_-	TonB-dependent receptor	NA	NA	NA	NA	NA
QBE91878.1|1621698_1622493_-	hypothetical protein	NA	NA	NA	NA	NA
QBE91879.1|1622489_1623083_-	recombinase family protein	NA	I1ZBD6	Salisaeta_icosahedral_phage	40.8	2.5e-25
QBE91880.1|1623230_1624718_+|transposase	transposase	transposase	A0A0N7ACC7	Bacillus_phage	23.9	1.4e-11
QBE91881.1|1624717_1625548_+	ATP-binding protein	NA	A0A0M3LP72	Mannheimia_phage	28.5	4.9e-11
QBE93984.1|1625544_1626624_-	hypothetical protein	NA	NA	NA	NA	NA
QBE91882.1|1627547_1628123_+	hypothetical protein	NA	NA	NA	NA	NA
QBE91883.1|1628119_1628926_+	(2Fe-2S)-binding protein	NA	NA	NA	NA	NA
QBE93985.1|1628922_1629924_+	hypothetical protein	NA	NA	NA	NA	NA
QBE91884.1|1629916_1630999_+	cation transporter	NA	NA	NA	NA	NA
QBE93986.1|1631045_1632980_+	TonB-dependent receptor	NA	NA	NA	NA	NA
QBE91885.1|1632979_1633861_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
QBE91886.1|1633857_1634841_+	iron ABC transporter permease	NA	NA	NA	NA	NA
QBE91887.1|1634837_1635635_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	25.9	1.2e-11
QBE91888.1|1636307_1636538_+	hypothetical protein	NA	NA	NA	NA	NA
QBE91889.1|1636749_1637055_+	hypothetical protein	NA	NA	NA	NA	NA
QBE91890.1|1637067_1637316_+	hypothetical protein	NA	NA	NA	NA	NA
QBE93987.1|1637492_1638206_-	hypothetical protein	NA	A0A0A0YWF4	Pseudomonas_phage	55.1	1.1e-62
QBE91891.1|1638753_1639176_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
QBE91892.1|1639227_1640625_-	hypothetical protein	NA	NA	NA	NA	NA
QBE91893.1|1640799_1641015_-	hypothetical protein	NA	NA	NA	NA	NA
QBE91894.1|1640947_1641349_-	hypothetical protein	NA	NA	NA	NA	NA
QBE91895.1|1641345_1642008_-	TIGR02594 family protein	NA	A0A1B0WLU0	Flavobacterium_phage	39.3	2.3e-19
QBE91896.1|1642189_1642678_-	hypothetical protein	NA	NA	NA	NA	NA
QBE91897.1|1642740_1644348_-	hypothetical protein	NA	A0A2I7QLN8	Vibrio_phage	30.7	2.9e-23
QBE91898.1|1644353_1648910_-	hypothetical protein	NA	A0A1W6JS43	Salmonella_phage	23.7	1.6e-18
QBE91899.1|1648909_1649317_-	hypothetical protein	NA	A0A2L0V149	Salmonella_phage	40.4	4.4e-13
QBE91900.1|1649313_1649970_-	hypothetical protein	NA	NA	NA	NA	NA
QBE91901.1|1649966_1650578_-	hypothetical protein	NA	NA	NA	NA	NA
QBE91902.1|1650585_1654386_-	hypothetical protein	NA	A0A2H4GY14	Pseudomonas_phage	40.5	1.2e-38
QBE91903.1|1654400_1654658_+	hypothetical protein	NA	NA	NA	NA	NA
QBE91904.1|1654763_1655204_-	hypothetical protein	NA	NA	NA	NA	NA
QBE91905.1|1655200_1655521_-	hypothetical protein	NA	NA	NA	NA	NA
QBE91906.1|1655533_1655971_-	hypothetical protein	NA	NA	NA	NA	NA
QBE91907.1|1656028_1656478_-	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
QBE91908.1|1656416_1656920_-	hypothetical protein	NA	NA	NA	NA	NA
QBE91909.1|1656916_1657237_-|head,tail	head-tail adaptor protein	head,tail	NA	NA	NA	NA
QBE91910.1|1657284_1657812_-|head,tail	phage gp6-like head-tail connector protein	head,tail	NA	NA	NA	NA
QBE91911.1|1657848_1658115_-	hypothetical protein	NA	NA	NA	NA	NA
QBE93988.1|1658198_1659449_-|capsid	phage major capsid protein	capsid	Q3HQT0	Burkholderia_phage	56.6	1.7e-124
>prophage 4
CP035765	Sphingomonas paucimobilis strain AIMST S2 chromosome, complete genome	4005505	2371566	2391643	4005505	portal,protease,tail,head,integrase,capsid	Ralstonia_phage(10.0%)	23	2363061:2363078	2383368:2383385
2363061:2363078	attL	CGGCTCGGCTATCCGCCC	NA	NA	NA	NA
QBE92502.1|2371566_2372790_-|integrase	site-specific integrase	integrase	A0A077KET4	Ralstonia_phage	47.1	3.1e-86
QBE92503.1|2373235_2374000_+	DUF1134 domain-containing protein	NA	NA	NA	NA	NA
QBE92504.1|2374049_2374451_-	hypothetical protein	NA	NA	NA	NA	NA
QBE92505.1|2374459_2375779_-	dihydroorotase	NA	NA	NA	NA	NA
QBE92506.1|2375826_2376585_+	folate-binding protein	NA	NA	NA	NA	NA
QBE92507.1|2376673_2377237_-	PilZ domain-containing protein	NA	NA	NA	NA	NA
QBE92508.1|2377564_2378689_-	OmpA family protein	NA	NA	NA	NA	NA
QBE92509.1|2378805_2379309_-	DUF2793 domain-containing protein	NA	M4QP18	Tetraselmis_viridis_virus	36.2	1.6e-12
QBE92510.1|2379305_2381438_-	hypothetical protein	NA	A0A1W6DWX7	Sphingobium_phage	37.9	3.4e-24
QBE92511.1|2381437_2381806_-	peptidoglycan endopeptidase	NA	NA	NA	NA	NA
QBE92512.1|2381802_2382609_-	DUF2163 domain-containing protein	NA	Q5DN21	Alphaproteobacteria_virus	33.3	6.9e-10
QBE92513.1|2382605_2384876_-	TIGR02217 family protein	NA	A0A140G5Z8	Enterobacteria_phage	29.2	1.4e-52
2383368:2383385	attR	GGGCGGATAGCCGAGCCG	NA	NA	NA	NA
QBE92514.1|2384888_2385428_-|tail	tail tape measure protein	tail	D6PEW0	uncultured_phage	32.2	1.0e-09
QBE94059.1|2385420_2385585_-|tail	phage tail assembly chaperone	tail	NA	NA	NA	NA
QBE92515.1|2385617_2385932_-	gene transfer agent family protein	NA	NA	NA	NA	NA
QBE92516.1|2385928_2386336_-|tail	phage major tail protein, TP901-1 family	tail	NA	NA	NA	NA
QBE92517.1|2386348_2386738_-	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
QBE94060.1|2386734_2387208_-	hypothetical protein	NA	NA	NA	NA	NA
QBE92518.1|2387427_2388423_-|capsid	phage major capsid protein	capsid	A0A2D1GNH4	Pseudomonas_phage	46.8	9.6e-78
QBE92519.1|2388424_2388805_-|head,protease	HK97 family phage prohead protease	head,protease	A0A0U2BX10	Paracoccus_phage	34.3	2.5e-10
QBE92520.1|2388801_2389107_-	hypothetical protein	NA	NA	NA	NA	NA
QBE92521.1|2389103_2390207_-|portal	phage portal protein	portal	W8ECU7	Geobacillus_phage	37.6	9.4e-50
QBE94061.1|2390374_2391643_-	ATP-binding protein	NA	A0A0K0N6T3	Gordonia_phage	39.2	1.6e-69
>prophage 5
CP035765	Sphingomonas paucimobilis strain AIMST S2 chromosome, complete genome	4005505	2889145	2895042	4005505		Staphylococcus_phage(33.33%)	8	NA	NA
QBE92931.1|2889145_2889937_+	ParA family protein	NA	Q8JL10	Natrialba_phage	32.5	1.8e-26
QBE92932.1|2889933_2890860_+	ParB/RepB/Spo0J family partition protein	NA	A0A1C9EHW0	Gordonia_phage	32.7	9.1e-14
QBE92933.1|2890960_2891395_-	hypothetical protein	NA	NA	NA	NA	NA
QBE92934.1|2891391_2891940_-	N-acetyltransferase	NA	NA	NA	NA	NA
QBE92935.1|2891936_2892356_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2I2L4Y7	Orpheovirus	33.8	6.8e-09
QBE92936.1|2892355_2893507_-	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	38.0	9.5e-53
QBE92937.1|2893496_2894099_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	36.5	2.2e-21
QBE94113.1|2894100_2895042_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	31.5	3.1e-33
>prophage 6
CP035765	Sphingomonas paucimobilis strain AIMST S2 chromosome, complete genome	4005505	3988799	4000348	4005505	tRNA	Caulobacter_phage(25.0%)	13	NA	NA
QBE93783.1|3988799_3990257_-|tRNA	cysteine--tRNA ligase	tRNA	A0A0U2SJ70	Niemeyer_virus	29.8	2.4e-29
QBE93784.1|3990662_3990869_+	30S ribosomal protein S21	NA	M1HLV7	Pelagibacter_phage	49.2	1.3e-05
QBE93785.1|3991020_3991593_+	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
QBE94235.1|3992340_3992580_-	hypothetical protein	NA	NA	NA	NA	NA
QBE93786.1|3992774_3993533_-	serine/threonine protein phosphatase	NA	A0A1V0EF12	Caulobacter_phage	42.6	9.3e-33
QBE93787.1|3993612_3994881_-	UDP-N-acetyl-D-mannosamine dehydrogenase	NA	M1IC36	Acanthocystis_turfacea_Chlorella_virus	27.1	1.1e-20
QBE93788.1|3994864_3995995_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	25.8	1.4e-16
QBE93789.1|3996107_3996968_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	47.7	4.7e-65
QBE93790.1|3997172_3997526_-	hypothetical protein	NA	NA	NA	NA	NA
QBE93791.1|3997522_3998281_-	molybdopterin-synthase adenylyltransferase MoeB	NA	NA	NA	NA	NA
QBE93792.1|3998277_3998712_-	hypothetical protein	NA	NA	NA	NA	NA
QBE93793.1|3998708_3999158_-	dUTP diphosphatase	NA	K4JSC8	Caulobacter_phage	56.5	4.8e-37
QBE93794.1|3999154_4000348_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	34.7	2.8e-39
