The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP030760	Rhizobium leguminosarum strain ATCC 14479 chromosome, complete genome	4883137	4126	14835	4883137	protease	Bacillus_phage(16.67%)	7	NA	NA
AXA37632.1|4126_5380_-	diguanylate cyclase (GGDEF) domain protein	NA	A0A127AWB9	Bacillus_phage	34.1	1.0e-12
AXA37633.1|5756_6386_+	ATP-dependent Clp endopeptidase, proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	59.2	9.4e-63
AXA37634.1|6689_7967_+|protease	ATP-dependent Clp protease, ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	58.4	1.7e-132
AXA37635.1|8369_10787_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	49.4	2.5e-204
AXA37636.1|10993_11269_+	Bacterial DNA-binding family protein	NA	A0A172Q061	Acinetobacter_phage	34.1	7.1e-07
AXA37637.1|11641_12541_+	EamA-like transporter family protein	NA	NA	NA	NA	NA
AXA37638.1|12636_14835_+	Esterase-like activity of phytase family protein	NA	M4SLV1	Cyanophage	42.4	7.8e-80
>prophage 2
CP030760	Rhizobium leguminosarum strain ATCC 14479 chromosome, complete genome	4883137	303406	316787	4883137	tRNA	uncultured_Mediterranean_phage(90.91%)	13	NA	NA
AXA37916.1|303406_304420_+	Glycosyl hydrolase 3 N terminal domain family protein	NA	A0A1B1IVS3	uncultured_Mediterranean_phage	42.6	1.6e-24
AXA37917.1|304438_305296_+	ScpA/B family protein	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	38.5	3.3e-34
AXA37918.1|305292_306009_+	Putative transcriptional regulators (Ypuh-like) family protein	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	47.0	2.6e-40
AXA37919.1|306192_306384_+	twin arginine-targeting protein translocase, TatA/E family protein	NA	A0A1B1IVR9	uncultured_Mediterranean_phage	72.1	8.9e-09
AXA37920.1|306435_307047_+	twin arginine-targeting protein translocase TatB	NA	NA	NA	NA	NA
AXA37921.1|307043_307871_+	Sec-independent protein translocase protein (TatC) family protein	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	46.5	5.2e-53
AXA37922.1|308071_309355_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	45.3	1.8e-97
AXA37923.1|309359_310133_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	30.2	2.4e-23
AXA37924.1|310129_310783_+	Protein-L-isoaspartate(D-aspartate) O-methyltransferase (PCMT) family protein	NA	A0A1B1IU40	uncultured_Mediterranean_phage	34.1	8.9e-16
AXA37925.1|311023_312628_+	Peptidase M23 family protein	NA	I3PV24	Clostridium_phage	29.2	5.1e-12
AXA37926.1|312774_313647_-	hypothetical protein	NA	NA	NA	NA	NA
AXA37927.1|313853_314201_+	Preprotein translocase subunit family protein	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	39.1	2.4e-12
AXA37928.1|314246_316787_+	protein-export membrane protein SecD	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	48.2	6.3e-57
>prophage 3
CP030760	Rhizobium leguminosarum strain ATCC 14479 chromosome, complete genome	4883137	594028	604297	4883137		uncultured_Mediterranean_phage(83.33%)	10	NA	NA
AXA38191.1|594028_596950_-	excinuclease ABC subunit A	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	62.1	0.0e+00
AXA38192.1|597234_597744_+	Single-stranded DNA-binding protein	NA	R9TP78	Rhizobium_phage	72.9	1.6e-44
AXA38193.1|597844_598492_-	MarC integral membrane family protein	NA	NA	NA	NA	NA
AXA38194.1|598791_601569_+	DNA gyrase, A subunit	NA	A0A1B1IVS2	uncultured_Mediterranean_phage	42.2	1.5e-75
AXA38195.1|601751_601886_-	hypothetical protein	NA	NA	NA	NA	NA
AXA38196.1|601922_602078_-	hypothetical protein	NA	NA	NA	NA	NA
AXA38197.1|602220_602520_-	hypothetical protein	NA	NA	NA	NA	NA
AXA38198.1|602632_603127_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	35.9	8.8e-24
AXA38199.1|603185_603758_+	Cyclophilin type peptidyl-prolyl cis-trans isomerase/CLD family protein	NA	A0A1B1IVS0	uncultured_Mediterranean_phage	52.8	1.1e-41
AXA38200.1|603787_604297_+	Cyclophilin type peptidyl-prolyl cis-trans isomerase/CLD family protein	NA	A0A1B1IVS0	uncultured_Mediterranean_phage	59.4	4.2e-45
>prophage 4
CP030760	Rhizobium leguminosarum strain ATCC 14479 chromosome, complete genome	4883137	1578908	1592711	4883137		Vibrio_phage(25.0%)	10	NA	NA
AXA39170.1|1578908_1580966_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.6	1.7e-36
AXA39171.1|1581537_1581885_-	Glutathione-dependent formaldehyde-activating enzyme family protein	NA	NA	NA	NA	NA
AXA39172.1|1581895_1582933_-	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	68.6	7.1e-15
AXA39173.1|1583195_1584383_-	glycine C-acetyltransferase	NA	D2TEZ5	Emiliania_huxleyi_virus	28.3	7.5e-37
AXA39174.1|1584547_1585276_-	Methyltransferase domain family protein	NA	A0A1X9I6N4	Streptococcus_phage	42.0	2.4e-49
AXA39175.1|1585324_1587205_-	ATP-dependent DNA helicase RecQ	NA	L7RCS0	Acanthamoeba_polyphaga_moumouvirus	34.4	6.7e-72
AXA39176.1|1587204_1589214_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	42.2	2.2e-89
AXA39177.1|1589843_1590773_+	hypothetical protein	NA	NA	NA	NA	NA
AXA39178.1|1590776_1591232_-	Yqey-like family protein	NA	A0A292GL36	Xanthomonas_phage	38.7	3.1e-15
AXA39179.1|1591499_1592711_+	carbamoyl-phosphate synthase, small subunit	NA	R4TGJ8	Halovirus	33.2	1.1e-40
>prophage 5
CP030760	Rhizobium leguminosarum strain ATCC 14479 chromosome, complete genome	4883137	2557658	2567569	4883137		Mycobacterium_phage(25.0%)	9	NA	NA
AXA40063.1|2557658_2558369_+	Queuosine biosynthesis protein QueC family protein	NA	A0A2P1JXV3	Rhodococcus_phage	48.7	2.3e-49
AXA40064.1|2558368_2558725_+	6-pyruvoyl tetrahydropterin synthase family protein	NA	NA	NA	NA	NA
AXA40065.1|2558721_2559450_+	7-cyano-7-deazaguanosine (preQ0) biosynthesis protein QueE	NA	A0A1U9WRB6	Streptococcus_virus	37.6	2.9e-39
AXA40066.1|2559454_2560675_-	Adenylate and Guanylate cyclase catalytic domain family protein	NA	M1HLN3	Pelagibacter_phage	29.7	5.4e-14
AXA40067.1|2560779_2561754_-	Ribonucleoside-diphosphate reductase subunit beta nrdF2	NA	R4TBI6	Mycobacterium_phage	75.1	7.3e-139
AXA40068.1|2561841_2564046_-	Ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	51.4	4.3e-211
AXA40069.1|2564024_2564429_-	nrdI protein	NA	A0A142F1R4	Bacillus_phage	43.1	6.5e-17
AXA40070.1|2564443_2564665_-	glutaredoxin-like protein NrdH family protein	NA	V5UN81	Mycobacterium_phage	52.1	7.9e-17
AXA40071.1|2565316_2567569_-	heavy metal translocating P-type ATPase family protein	NA	E4ZFI9	Streptococcus_phage	41.2	7.4e-126
>prophage 1
CP030762	Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed2, complete sequence	415988	6421	70954	415988	transposase,integrase	Mycobacterium_phage(16.67%)	67	36152:36211	71702:71715
AXA43471.1|6421_7597_-|transposase	Putative transposase family protein	transposase	NA	NA	NA	NA
AXA43472.1|7610_8471_-|integrase	Phage integrase family protein	integrase	S5W9T9	Leptospira_phage	33.7	1.4e-32
AXA43473.1|9754_10075_+	thioredoxin	NA	A0A1J0GW78	Streptomyces_phage	49.5	2.5e-19
AXA43474.1|10078_10480_+	Thioredoxin family protein	NA	NA	NA	NA	NA
AXA43475.1|11319_12093_-	Thiazole biosynthesis protein ThiG family protein	NA	NA	NA	NA	NA
AXA43476.1|12094_12292_-	thiamine biosynthesis protein ThiS	NA	NA	NA	NA	NA
AXA43477.1|12288_13275_-	glycine oxidase ThiO	NA	NA	NA	NA	NA
AXA43478.1|13277_15002_-	phosphomethylpyrimidine synthase	NA	NA	NA	NA	NA
AXA43479.1|15503_16214_-	hypothetical protein	NA	NA	NA	NA	NA
AXA43480.1|16503_16725_-	hypothetical protein	NA	NA	NA	NA	NA
AXA43481.1|17161_17638_-	AsnC family protein	NA	NA	NA	NA	NA
AXA43482.1|17780_18800_+	1-aminocyclopropane-1-carboxylate deaminase	NA	NA	NA	NA	NA
AXA43483.1|19371_19779_-	hypothetical protein	NA	NA	NA	NA	NA
AXA43484.1|19847_20564_-	hypothetical protein	NA	NA	NA	NA	NA
AXA43485.1|20688_21093_-	hypothetical protein	NA	NA	NA	NA	NA
AXA43486.1|21270_21906_+	Autoinducer synthetase family protein	NA	NA	NA	NA	NA
AXA43487.1|22069_22795_+	Autoinducer binding domain family protein	NA	NA	NA	NA	NA
AXA43488.1|23340_23985_-	ABC transporter family protein	NA	A0A2H4PQG7	Staphylococcus_phage	25.7	2.5e-10
AXA43489.1|23977_24754_-	ABC transporter family protein	NA	A0A2H4PQG7	Staphylococcus_phage	24.1	3.2e-12
AXA43490.1|24750_25713_-	Branched-chain amino acid transport system / permease component family protein	NA	NA	NA	NA	NA
AXA43491.1|25709_26606_-	Branched-chain amino acid transport system / permease component family protein	NA	NA	NA	NA	NA
AXA43492.1|26750_28031_-	Periplasmic binding family protein	NA	NA	NA	NA	NA
AXA43493.1|28561_29392_-	Bacterial transcriptional regulator family protein	NA	NA	NA	NA	NA
AXA43494.1|29951_30920_+	Aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
AXA43495.1|30945_32109_+	Iron-containing alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
AXA43496.1|32156_32948_+	Metallo-beta-lactamase family protein	NA	NA	NA	NA	NA
AXA43497.1|33116_34292_+	alpha/beta hydrolase fold family protein	NA	NA	NA	NA	NA
AXA43498.1|34467_34560_+	hypothetical protein	NA	NA	NA	NA	NA
AXA43499.1|35037_35295_+	hypothetical protein	NA	NA	NA	NA	NA
AXA43500.1|35413_35524_-	hypothetical protein	NA	NA	NA	NA	NA
AXA43501.1|35737_36013_+	putative integral membrane protein	NA	NA	NA	NA	NA
36152:36211	attL	TTATGCCGACCGGCGAACTATGCCGGTTAATCAACTTTTTGCCAACGTTTCCGGCACCAT	NA	NA	NA	NA
AXA43502.1|36275_37517_+|integrase	Phage integrase family protein	integrase	A0A2K9VF00	Mycobacterium_phage	27.8	3.3e-11
36152:36211	attL	TTATGCCGACCGGCGAACTATGCCGGTTAATCAACTTTTTGCCAACGTTTCCGGCACCAT	NA	NA	NA	NA
AXA43503.1|37513_38437_+|integrase	Phage integrase family protein	integrase	NA	NA	NA	NA
AXA43504.1|38433_39435_+|integrase	Phage integrase family protein	integrase	S5M9V8	Brevibacillus_phage	23.9	2.9e-13
AXA43505.1|39317_41003_-	Transposase IS66 family protein	NA	A0A218MNE7	uncultured_virus	31.9	8.1e-45
AXA43506.1|41128_41473_-	IS66 Orf2 like family protein	NA	NA	NA	NA	NA
AXA43507.1|42149_42953_+	4Fe-4S binding domain family protein	NA	NA	NA	NA	NA
AXA43508.1|43592_44789_-	Alpha/beta hydrolase family protein	NA	NA	NA	NA	NA
AXA43509.1|44739_45357_-	Poly(R)-hydroxyalkanoic acid synthase subunit (PHA_synth_III_E) family protein	NA	NA	NA	NA	NA
AXA43510.1|46284_46503_+	Coenzyme A transferase family protein	NA	NA	NA	NA	NA
AXA43511.1|47260_47965_+	Transglycosylase SLT domain family protein	NA	A0A1P8CWQ1	Bacillus_phage	45.8	4.2e-19
AXA43512.1|48430_48970_+	hypothetical protein	NA	NA	NA	NA	NA
AXA43513.1|48966_49536_+	hypothetical protein	NA	NA	NA	NA	NA
AXA43514.1|49607_49859_+	hypothetical protein	NA	NA	NA	NA	NA
AXA43515.1|49878_50793_+	FMN-dependent dehydrogenase family protein	NA	NA	NA	NA	NA
AXA43516.1|52143_53037_+	CobQ/CobB/MinD/ParA nucleotide binding domain family protein	NA	A0A240F4U1	Ochrobactrum_phage	42.1	2.3e-38
AXA43517.1|53036_53147_+	hypothetical protein	NA	NA	NA	NA	NA
AXA43518.1|53139_54393_+	plasmid partitioning protein RepA	NA	A0A240F4U1	Ochrobactrum_phage	40.4	1.7e-68
AXA43519.1|54989_55454_-	Immunity protein 14 family protein	NA	NA	NA	NA	NA
AXA43520.1|55771_56773_-|integrase	Phage integrase family protein	integrase	S5M9V8	Brevibacillus_phage	23.9	2.9e-13
AXA43521.1|56769_57693_-|integrase	Phage integrase family protein	integrase	NA	NA	NA	NA
AXA43522.1|57689_58931_-|integrase	Phage integrase family protein	integrase	A0A2K9VF00	Mycobacterium_phage	27.8	3.3e-11
AXA43523.1|58982_60500_-	Transposase IS66 family protein	NA	A0A0P0ZEB3	Stx2-converting_phage	40.9	7.5e-90
58996:59119	attR	ATGGTGCCGGAAACGTTGGCAAAAAGTTGATTAACCGGCATAGTTCGCCGGTCGGCATAATCATGCTTATGCCGCGCGCGGCATAAGCAGGTCTCGATCAGCGAGGCGATGGTGGCCCAGTTCT	NA	NA	NA	NA
AXA43524.1|60568_60922_-	IS66 Orf2 like family protein	NA	NA	NA	NA	NA
58996:59119	attR	ATGGTGCCGGAAACGTTGGCAAAAAGTTGATTAACCGGCATAGTTCGCCGGTCGGCATAATCATGCTTATGCCGCGCGCGGCATAAGCAGGTCTCGATCAGCGAGGCGATGGTGGCCCAGTTCT	NA	NA	NA	NA
AXA43525.1|60918_61305_-	Transposase family protein	NA	NA	NA	NA	NA
AXA43526.1|61806_62520_-|integrase	Phage integrase family protein	integrase	A0A160DCT0	Gordonia_phage	30.7	4.0e-09
AXA43527.1|62640_62805_-	hypothetical protein	NA	NA	NA	NA	NA
AXA43528.1|62801_63335_-|integrase	Phage integrase family protein	integrase	NA	NA	NA	NA
AXA43529.1|63425_63620_-	hypothetical protein	NA	NA	NA	NA	NA
AXA43530.1|63719_64001_-|integrase	Phage integrase family protein	integrase	NA	NA	NA	NA
AXA43531.1|64211_64622_+	Transposase family protein	NA	NA	NA	NA	NA
AXA43532.1|64618_64966_+	IS66 Orf2 like family protein	NA	A0A0P0ZDM8	Stx2-converting_phage	62.6	9.8e-38
AXA43533.1|65011_66631_+	Transposase IS66 family protein	NA	A0A0P0ZEB3	Stx2-converting_phage	45.5	1.6e-90
AXA43534.1|66682_67924_+|integrase	Phage integrase family protein	integrase	A0A2K9VF00	Mycobacterium_phage	27.8	3.3e-11
AXA43535.1|67920_68844_+|integrase	Phage integrase family protein	integrase	NA	NA	NA	NA
AXA43536.1|68840_69842_+|integrase	Phage integrase family protein	integrase	S5M9V8	Brevibacillus_phage	23.9	2.9e-13
AXA43537.1|70084_70954_-|integrase	Phage integrase family protein	integrase	NA	NA	NA	NA
71702:71715	attR	GCTCGATATCGAAC	NA	NA	NA	NA
>prophage 2
CP030762	Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed2, complete sequence	415988	121061	136652	415988		Escherichia_phage(25.0%)	19	NA	NA
AXA43584.1|121061_121688_+	GTP cyclohydrolase I family protein	NA	E7DN69	Pneumococcus_phage	44.3	4.4e-44
AXA43585.1|121687_122695_+	Adenylosuccinate synthetase family protein	NA	A0A1B3B082	Gordonia_phage	30.9	6.8e-31
AXA43586.1|122691_123990_+	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	34.7	2.0e-19
AXA43587.1|124045_124741_-	4Fe-4S single cluster domain family protein	NA	A0A0A0RTJ1	Escherichia_phage	43.5	3.7e-44
AXA43588.1|124737_125943_-	IMP dehydrogenase / GMP reductase domain family protein	NA	A0A1V0SHK8	Klosneuvirus	36.5	1.2e-66
AXA43589.1|125939_126611_-	Nitrile hydratase, alpha chain family protein	NA	NA	NA	NA	NA
AXA43590.1|126610_127315_-	Queuosine biosynthesis protein QueC family protein	NA	A0A1V0DY95	Dinoroseobacter_phage	40.5	1.9e-32
AXA43591.1|127389_128055_-	Haloacid dehalogenase-like hydrolase family protein	NA	NA	NA	NA	NA
AXA43592.1|128051_128624_-	Phosphoribosyl transferase domain family protein	NA	NA	NA	NA	NA
AXA43593.1|128940_129402_+	6-pyruvoyl tetrahydropterin synthase family protein	NA	NA	NA	NA	NA
AXA43594.1|129538_129712_+	hypothetical protein	NA	A0A077SL39	Escherichia_phage	58.3	3.2e-05
AXA43595.1|129746_130289_+	DDE domain family protein	NA	A0A077SL39	Escherichia_phage	40.3	5.9e-21
AXA43596.1|130301_130547_-	hypothetical protein	NA	NA	NA	NA	NA
AXA43597.1|130543_131173_-	hypothetical protein	NA	NA	NA	NA	NA
AXA43598.1|131984_132191_-	cold-shock DNA-binding domain family protein	NA	A0A1W6JNX5	Morganella_phage	50.0	1.8e-10
AXA43599.1|132432_133143_-	Transposase DDE domain family protein	NA	Q1MVF0	Enterobacteria_phage	37.9	9.7e-32
AXA43600.1|133903_134689_-	Transposase DDE domain family protein	NA	Q1MVF0	Enterobacteria_phage	37.3	9.4e-36
AXA43601.1|134768_135185_+	hypothetical protein	NA	NA	NA	NA	NA
AXA43602.1|135305_136652_-	HTH-like domain family protein	NA	A0A1B1P773	Bacillus_phage	32.1	1.6e-22
