The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP030347	Enterobacter hormaechei strain AR_038 chromosome, complete genome	5018145	208726	218175	5018145	integrase	Enterobacteria_phage(87.5%)	14	202242:202256	218827:218841
202242:202256	attL	CATGCTGGATAAAGA	NA	NA	NA	NA
AWZ96691.1|208726_210007_-	zinc-binding domain of primase-helicase family protein	NA	Q7M2A8	Enterobacteria_phage	78.5	8.9e-153
AWZ98451.1|210021_210342_-	putative p4 phage protein	NA	NA	NA	NA	NA
AWZ97244.1|210338_210599_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ98370.1|210670_211120_-	hypothetical protein	NA	Q7M298	Enterobacteria_phage	70.8	9.7e-46
AWZ95946.1|211112_211412_-	putative derepression protein	NA	Q7M2A0	Enterobacteria_phage	70.1	1.2e-31
AWZ98022.1|211404_211602_-	putative regulator protein cI	NA	Q7M2A7	Enterobacteria_phage	86.2	2.3e-23
AWZ96957.1|211955_212174_-	prophage CP4-57 regulatory family protein	NA	Q7M299	Enterobacteria_phage	69.4	6.2e-22
AWZ98095.1|212566_212755_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ96608.1|212784_213528_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ96654.1|213530_213749_+	ogr/Delta-like zinc finger family protein	NA	Q7M294	Enterobacteria_phage	68.2	1.0e-16
AWZ96398.1|213777_214341_+	polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	65.9	6.0e-61
AWZ99875.1|214679_215819_+	AAA domain protein	NA	NA	NA	NA	NA
AWZ99020.1|215815_216877_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ96067.1|216912_218175_-|integrase	integrase	integrase	B7SYF8	Stenotrophomonas_phage	40.4	8.2e-74
218827:218841	attR	TCTTTATCCAGCATG	NA	NA	NA	NA
>prophage 2
CP030347	Enterobacter hormaechei strain AR_038 chromosome, complete genome	5018145	336273	382204	5018145	tRNA,transposase,integrase	Vibrio_phage(25.0%)	42	359054:359070	382741:382757
AXA00361.1|336273_337224_-|tRNA	tRNA dimethylallyltransferase	tRNA	NA	NA	NA	NA
AWZ96462.1|337216_339061_-	DNA mismatch repair MutL family protein	NA	A0A1B2LRQ5	Wolbachia_phage	30.4	2.2e-59
AWZ96097.1|339070_340408_-	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	30.1	3.3e-17
AWZ98385.1|340424_340886_-|tRNA	tRNA threonylcarbamoyl adenosine modification protein YjeE	tRNA	NA	NA	NA	NA
AWZ96938.1|340878_342402_-	bifunctional NAD(P)H-hydrate repair enzyme Nnr	NA	NA	NA	NA	NA
AWZ99066.1|342400_343540_+	epoxyqueuosine reductase	NA	NA	NA	NA	NA
AWZ99841.1|344728_345475_+	putative receptor protein-tyrosine kinase	NA	NA	NA	NA	NA
AXA00425.1|345594_345807_+	prophage CP4-57 regulatory family protein	NA	NA	NA	NA	NA
AWZ96883.1|345849_346725_+	cobQ/CobB/MinD/ParA nucleotide binding domain protein	NA	NA	NA	NA	NA
AXA00321.1|346726_346951_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ96851.1|346949_348584_+	parB-like nuclease domain protein	NA	NA	NA	NA	NA
AXA00158.1|348599_349160_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ96128.1|349163_350408_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ97087.1|350484_350712_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ96393.1|350724_351507_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ96642.1|351665_352031_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ96351.1|352104_352557_+	single-strand binding family protein	NA	NA	NA	NA	NA
AWZ97038.1|352830_354843_+	DNA topoisomerase III family protein	NA	A0A076FM50	Aureococcus_anophage	23.1	7.0e-11
AWZ99547.1|355073_356045_+	putative cytosine-specific methyltransferase	NA	NA	NA	NA	NA
AWZ97052.1|356008_356170_+	hypothetical protein	NA	A0A2K9V3X0	Faecalibacterium_phage	62.9	8.6e-05
AWZ98869.1|356247_356454_+	cytosine-specific methyltransferase domain protein	NA	NA	NA	NA	NA
AWZ97599.1|357320_358928_+|integrase	integrase core domain protein	integrase	NA	NA	NA	NA
359054:359070	attL	CCGACGATGGTGATGCC	NA	NA	NA	NA
AWZ96121.1|359487_359766_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ95850.1|359864_360992_-	tetracycline resistance protein, class C	NA	NA	NA	NA	NA
AWZ96924.1|361143_361770_+	tetracycline repressor protein class D	NA	NA	NA	NA	NA
AWZ98094.1|361976_363191_-	drug resistance transporter, Bcr/CflA subfamily protein	NA	S4TR35	Salmonella_phage	23.7	9.8e-16
AWZ98635.1|363711_365124_-|transposase	transposase family protein	transposase	NA	NA	NA	NA
AXA00206.1|365431_366868_-	chaperonin GroL	NA	A0A2I7SAK5	Vibrio_phage	61.9	2.7e-150
AWZ98849.1|367292_368339_+|tRNA	queuine tRNA-ribosyltransferase	tRNA	NA	NA	NA	NA
AWZ97643.1|368416_369226_+	calcineurin-like phosphoesterase family protein	NA	NA	NA	NA	NA
AXA00114.1|369251_370007_+	16S rRNA (guanine(1405)-N(7))-methyltransferase	NA	NA	NA	NA	NA
AWZ96381.1|370086_370578_-	sodium/hydrogen exchanger family protein	NA	NA	NA	NA	NA
AXA00431.1|370841_372128_-|transposase	transposase family protein	transposase	NA	NA	NA	NA
AWZ97033.1|372466_372901_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ96509.1|373132_374347_+	drug resistance transporter, Bcr/CflA subfamily protein	NA	S4TR35	Salmonella_phage	30.0	7.0e-22
AWZ96015.1|374799_376092_-|transposase	transposase family protein	transposase	NA	NA	NA	NA
AWZ98017.1|376080_376410_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ97842.1|377042_377756_+	aminoglycoside 3-N-acetyltransferase family protein	NA	O64018	Bacillus_phage	29.8	3.0e-25
AWZ98549.1|378450_379734_-|transposase	transposase family protein	transposase	NA	NA	NA	NA
AWZ96364.1|379722_380052_+	hypothetical protein	NA	NA	NA	NA	NA
AXA00467.1|380382_380514_+	hypothetical protein	NA	NA	NA	NA	NA
AXA00417.1|380722_382204_+|integrase	integrase core domain protein	integrase	NA	NA	NA	NA
382741:382757	attR	GGCATCACCATCGTCGG	NA	NA	NA	NA
>prophage 3
CP030347	Enterobacter hormaechei strain AR_038 chromosome, complete genome	5018145	563496	606419	5018145	plate,tRNA,integrase,tail,portal,protease,terminase	Enterobacteria_phage(23.08%)	58	556007:556022	585177:585192
556007:556022	attL	CTGCACCAGCTGCGCG	NA	NA	NA	NA
AXA00065.1|563496_564534_-|tRNA	tRNA dihydrouridine synthase A family protein	tRNA	NA	NA	NA	NA
AWZ99019.1|564621_565716_+|integrase	phage integrase family protein	integrase	S5MDN5	Escherichia_phage	83.7	3.1e-178
AXA00134.1|566944_567190_+	dinI-like family protein	NA	Q687E4	Enterobacteria_phage	63.8	2.9e-20
AWZ96328.1|567191_567440_+	hypothetical protein	NA	NA	NA	NA	NA
AXA00101.1|567664_567820_+	ycfA-like family protein	NA	A0A0D4DC32	Acinetobacter_phage	78.4	1.2e-16
AWZ96243.1|567841_568252_+	hypothetical protein	NA	Q775F5	Haemophilus_virus	50.4	1.9e-35
AXA00314.1|568903_569200_-|tail	caudovirales tail fiber assembly family protein	tail	U5P083	Shigella_phage	56.1	5.4e-21
AWZ97423.1|569327_571559_-|tail	phage tail fiber repeat family protein	tail	A0A0F7LDR4	Escherichia_phage	38.4	7.2e-57
AWZ99026.1|571561_572113_-|tail	phage tail protein I	tail	A0A0F7LDF3	Escherichia_phage	44.1	3.3e-27
AWZ96379.1|572105_573020_-|plate	baseplate J-like family protein	plate	V5YTH6	Pseudomonas_phage	45.3	7.0e-59
AWZ95899.1|573003_573357_-	lysozyme family protein	NA	E5FFH4	Burkholderia_phage	50.0	5.0e-21
AWZ97042.1|573393_574524_-	phage late control D family protein	NA	R9TNM7	Vibrio_phage	33.4	3.2e-37
AWZ97913.1|574514_574724_-	phage Tail Protein X family protein	NA	R9TR63	Vibrio_phage	53.0	1.6e-11
AXA00070.1|574704_575175_-	phage P2 GpU family protein	NA	D4HTW5	Vibrio_phage	34.1	2.4e-15
AWZ99777.1|575171_577262_-	hypothetical protein	NA	A0A2I7R3J9	Vibrio_phage	32.0	1.9e-27
AWZ97224.1|577236_577377_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ98785.1|577376_577664_-	mu-like prophage FluMu gp41 family protein	NA	NA	NA	NA	NA
AWZ99064.1|577715_578222_-|tail	phage tail tube FII family protein	tail	NA	NA	NA	NA
AWZ99231.1|578218_579688_-|tail	phage tail sheath family protein	tail	R9TMQ0	Vibrio_phage	46.8	3.7e-78
AWZ96168.1|579726_580350_-|plate	phage baseplate assembly V family protein	plate	Q8HAB9	Salmonella_phage	30.8	9.4e-07
AWZ97929.1|580342_580897_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ98162.1|580905_581568_-	hypothetical protein	NA	R9TR34	Vibrio_phage	34.3	7.9e-20
AWZ97647.1|581569_581926_-	phage Head-Tail Attachment family protein	NA	NA	NA	NA	NA
AWZ99722.1|581925_582261_-	hypothetical protein	NA	Q9EYD5	Enterobacteria_phage	42.7	9.9e-11
AWZ99610.1|582329_584387_-|protease	clp protease family protein	protease	S5M7Q8	Escherichia_phage	53.2	4.6e-199
AWZ99144.1|584379_585750_-|portal	phage portal protein, lambda family	portal	K7PHM5	Enterobacterial_phage	57.5	1.2e-142
585177:585192	attR	CGCGCAGCTGGTGCAG	NA	NA	NA	NA
AWZ97007.1|585908_586124_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ98036.1|586120_588241_-|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	74.8	8.3e-305
AWZ97775.1|588244_588748_-	hypothetical protein	NA	K7PJY2	Enterobacterial_phage	62.3	5.2e-48
AWZ96731.1|589068_589215_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ96647.1|589211_589340_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ97988.1|589406_589535_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ99127.1|589618_590155_-	hypothetical protein	NA	K7PHH7	Enterobacteria_phage	91.8	1.9e-80
AXA00456.1|590151_590688_-	phage lysozyme family protein	NA	K7PM52	Enterobacteria_phage	80.6	1.5e-82
AWZ98618.1|590973_591906_-	DNA methylase family protein	NA	A5LH81	Enterobacteria_phage	81.0	1.4e-155
AWZ97132.1|592176_592368_-	hypothetical protein	NA	Q8SBE3	Shigella_phage	79.0	5.1e-20
AWZ95902.1|592553_592889_-	phage antitermination Q family protein	NA	NA	NA	NA	NA
AWZ98688.1|593282_594350_-	hypothetical protein	NA	A0A291AWV9	Escherichia_phage	53.4	2.3e-106
AWZ99729.1|594346_596074_-	C-5 cytosine-specific DNA methylase family protein	NA	H9C171	Pectobacterium_phage	59.8	1.5e-224
AWZ96535.1|596066_596822_-	phage N-6-adenine-methyltransferase	NA	Q8HA94	Salmonella_phage	78.3	4.1e-113
AWZ98626.1|596959_597823_-	conserved phage family protein	NA	A0A1C9IHW0	Salmonella_phage	79.4	2.1e-52
AWZ96992.1|598000_598714_-	phage antirepressor KilAC domain protein	NA	A0A2I7RHG4	Vibrio_phage	51.1	3.0e-49
AWZ98026.1|598874_599432_-	putative phage-encoded DNA-binding protein	NA	A0A1C9II13	Salmonella_phage	67.0	4.0e-65
AWZ99806.1|600178_600439_+	peptidase S24-like family protein	NA	U5P0T5	Shigella_phage	87.1	1.6e-40
AWZ98593.1|600607_600802_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ97345.1|600809_601058_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ99271.1|601032_601188_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ96995.1|601544_601916_+	putative sb37	NA	Q8HAA1	Salmonella_phage	94.3	1.7e-59
AXA00582.1|601973_602801_+	hypothetical protein	NA	Q8HAA2	Salmonella_phage	91.6	1.7e-141
AWZ98720.1|602936_603476_+	hypothetical protein	NA	A0A192Y8M4	Salmonella_phage	74.3	3.5e-74
AWZ95700.1|603472_603661_+	putative prophage exported protein	NA	NA	NA	NA	NA
AWZ97703.1|603732_603954_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ99417.1|604061_604181_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ98823.1|604184_604493_+	hypothetical protein	NA	M9NZE4	Enterobacteria_phage	88.0	3.0e-14
AWZ97516.1|604494_605064_+	putative exonuclease	NA	K7PLW7	Enterobacteria_phage	72.5	2.1e-77
AWZ95808.1|605123_605375_+	pyocin activator PrtN family protein	NA	K7PGU0	Enterobacteria_phage	87.8	4.3e-35
AWZ99910.1|605409_605607_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ96107.1|605876_606419_-	hypothetical protein	NA	A0A139ZPG5	Marinitoga_camini_virus	27.8	6.3e-07
>prophage 4
CP030347	Enterobacter hormaechei strain AR_038 chromosome, complete genome	5018145	830539	839113	5018145	integrase	Enterobacteria_phage(100.0%)	12	824344:824357	834409:834422
824344:824357	attL	CAGGCTGTCAATGC	NA	NA	NA	NA
AXA00404.1|830539_831715_+|integrase	phage integrase family protein	integrase	Q7M297	Enterobacteria_phage	89.4	2.7e-204
AWZ96581.1|831720_833097_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ99320.1|833160_833304_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ95832.1|833309_833873_-	polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	65.9	7.9e-61
AWZ97713.1|833901_834120_-	ogr/Delta-like zinc finger family protein	NA	Q7M294	Enterobacteria_phage	66.7	5.1e-16
AWZ98218.1|834122_834866_-	hypothetical protein	NA	NA	NA	NA	NA
834409:834422	attR	GCATTGACAGCCTG	NA	NA	NA	NA
AWZ96458.1|835163_835313_-	hypothetical protein	NA	NA	NA	NA	NA
AXA00037.1|835451_835670_+	prophage CP4-57 regulatory family protein	NA	Q7M299	Enterobacteria_phage	75.0	1.2e-25
AWZ99258.1|835891_836224_+	ash family protein	NA	Q7M2A7	Enterobacteria_phage	69.4	3.8e-31
AWZ97319.1|836220_836448_+	putative bacteriophage protein	NA	NA	NA	NA	NA
AWZ96819.1|836444_836765_+	putative p4 phage protein	NA	NA	NA	NA	NA
AWZ95846.1|836779_839113_+	poxvirus D5 protein-like family protein	NA	Q7M2A8	Enterobacteria_phage	85.1	0.0e+00
>prophage 5
CP030347	Enterobacter hormaechei strain AR_038 chromosome, complete genome	5018145	1678963	1721738	5018145	plate,tRNA,integrase,capsid,lysis,tail,terminase,portal,head	Salmonella_phage(78.05%)	52	1673422:1673441	1728756:1728775
1673422:1673441	attL	TTCCCCCGAGCGCGATACCG	NA	NA	NA	NA
AWZ97960.1|1678963_1680457_+	methyl-accepting chemotaxis (MCP) signaling domain protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	28.7	9.2e-08
AWZ98726.1|1680453_1680882_-	transcriptional regulator PadR-like family protein	NA	NA	NA	NA	NA
AWZ96284.1|1681093_1681858_+	NADPH-dependent ferric-chelate reductase	NA	NA	NA	NA	NA
AWZ98803.1|1681858_1683028_-	dnaJ domain protein	NA	NA	NA	NA	NA
AWZ99367.1|1683405_1684419_-|integrase	phage integrase family protein	integrase	F1BUS9	Erwinia_phage	60.2	4.8e-117
AWZ99311.1|1684428_1685328_-	putative nAD-dependent DNA ligase	NA	NA	NA	NA	NA
AWZ98210.1|1685339_1685561_-	hypothetical protein	NA	A0A0M4RE65	Salmonella_phage	45.8	2.3e-08
AWZ99918.1|1686169_1686292_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ98597.1|1686326_1686836_+	phage regulatory CII family protein	NA	A0A1S6L008	Salmonella_phage	93.5	1.0e-83
AWZ96743.1|1686897_1687044_+	hypothetical protein	NA	E5G6L4	Salmonella_phage	89.6	1.3e-20
AWZ99072.1|1687007_1687349_+	putative prophage protein	NA	E5G6L5	Salmonella_phage	85.8	4.5e-51
AWZ99503.1|1687416_1687650_+	hypothetical protein	NA	E5G6L6	Salmonella_phage	80.5	5.4e-24
AXA00298.1|1687661_1687877_+	phage/conjugal plasmid C-4 type zinc finger, TraR family protein	NA	A0A1S6L007	Salmonella_phage	93.0	5.9e-33
AWZ95759.1|1687873_1688731_+	DNA adenine methylase family protein	NA	A0A1S6L011	Salmonella_phage	74.0	4.1e-117
AWZ99051.1|1688727_1691121_+	bacteriophage replication protein A	NA	A0A1S6L028	Salmonella_phage	91.1	0.0e+00
AWZ99213.1|1691303_1691438_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ99823.1|1691483_1691717_+	dinI-like family protein	NA	A0A1S6L014	Salmonella_phage	92.2	2.2e-33
AXA00408.1|1691884_1692037_+	hypothetical protein	NA	NA	NA	NA	NA
AXA00402.1|1692188_1693238_-|portal	phage portal protein, PBSX family	portal	A0A1S6KZW5	Salmonella_phage	79.5	4.2e-156
AWZ97047.1|1693237_1694956_-|terminase	ATPase subunit of terminase family protein	terminase	E5G6M4	Salmonella_phage	87.2	4.4e-304
AWZ98147.1|1695150_1695978_+|capsid	phage capsid scaffolding (GPO) serine peptidase family protein	capsid	A0A1S6KZW9	Salmonella_phage	64.6	2.7e-73
AWZ97002.1|1695993_1697142_+|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	68.8	1.2e-132
AWZ96323.1|1697145_1697799_+|terminase	phage small terminase subunit	terminase	E5G6M7	Salmonella_phage	56.1	5.2e-56
AWZ97903.1|1697897_1698365_+|head	phage head completion family protein	head	A0A1S6KZW8	Salmonella_phage	58.7	1.3e-48
AWZ98202.1|1698364_1698568_+	phage Tail Protein X family protein	NA	E5G6M9	Salmonella_phage	100.0	3.8e-34
AWZ98444.1|1698571_1698787_+	putative membrane protein	NA	E5G6N0	Salmonella_phage	66.2	2.0e-20
AWZ97480.1|1698767_1699283_+	phage lysozyme family protein	NA	E5G6N1	Salmonella_phage	76.5	1.8e-72
AWZ98892.1|1699279_1699708_+|lysis	phage lysis regulatory, LysB family protein	lysis	A0A1S6KZX8	Salmonella_phage	85.0	4.0e-57
AWZ97563.1|1699803_1700235_+|tail	P2 phage tail completion R family protein	tail	A0A1S6KZY0	Salmonella_phage	89.5	3.5e-69
AWZ99101.1|1700245_1700674_+	phage virion morphogenesis protein	NA	E5G6N4	Salmonella_phage	86.4	3.0e-60
AWZ95821.1|1700766_1701321_+|plate	phage baseplate assembly V family protein	plate	E5G6N6	Salmonella_phage	96.2	3.4e-101
AXA00547.1|1701317_1701677_+	lysozyme family protein	NA	A0A1S6KZZ4	Salmonella_phage	89.8	2.3e-53
AWZ95883.1|1701663_1702572_+|plate	baseplate J-like family protein	plate	A0A1S6KZY6	Salmonella_phage	92.4	6.1e-148
AWZ99566.1|1702564_1703170_+|tail	phage tail protein I	tail	E5G6N9	Salmonella_phage	94.0	8.1e-112
AWZ95903.1|1703166_1704573_+|tail	phage tail-collar fiber family protein	tail	M1TAS6	Escherichia_phage	74.0	3.5e-142
AWZ99387.1|1705374_1705848_-|tail	caudovirales tail fiber assembly family protein	tail	F1BUP0	Erwinia_phage	59.6	3.3e-52
AXA00290.1|1705943_1706075_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ99256.1|1706728_1706995_+	helix-turn-helix domain of resolvase family protein	NA	A0A0F7LA37	Escherichia_phage	82.9	9.2e-28
AWZ96009.1|1707053_1707806_+	DNA methylase family protein	NA	Q775B4	Bordetella_phage	51.1	1.1e-62
AWZ99613.1|1707886_1709059_+|tail	phage tail sheath family protein	tail	A0A1S6KZY7	Salmonella_phage	92.8	9.5e-210
AXA00018.1|1709068_1709584_+|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	93.0	7.6e-87
AWZ98818.1|1709638_1709941_+	mu-like prophage FluMu gp41 family protein	NA	A0A1S6KZZ9	Salmonella_phage	90.0	3.1e-40
AWZ96596.1|1709955_1710075_+	phage P2 GpE family protein	NA	E5G6Q0	Salmonella_phage	92.3	3.3e-14
AXA00423.1|1710067_1713601_+|tail	phage tail tape measure protein, TP901 family, core region	tail	A0A1S6L010	Salmonella_phage	68.4	0.0e+00
AXA00350.1|1713600_1714086_+	phage P2 GpU family protein	NA	E5G6Q2	Salmonella_phage	95.3	1.1e-63
AWZ97796.1|1714082_1715183_+	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	92.3	1.1e-183
AWZ97162.1|1715807_1716314_+	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
AWZ99533.1|1716414_1718259_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.4e-35
AWZ98391.1|1718411_1720157_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	39.0	1.4e-76
AWZ99423.1|1720272_1720488_-	ribosomal protein S21	NA	NA	NA	NA	NA
AWZ98567.1|1720538_1720721_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ99524.1|1720724_1721738_+|tRNA	tRNA threonylcarbamoyl adenosine modification protein YgjD	tRNA	A0A0R6PI74	Moraxella_phage	58.9	1.4e-108
1728756:1728775	attR	TTCCCCCGAGCGCGATACCG	NA	NA	NA	NA
>prophage 6
CP030347	Enterobacter hormaechei strain AR_038 chromosome, complete genome	5018145	1779676	1807380	5018145	integrase,transposase,terminase	Shigella_phage(47.06%)	31	1797349:1797408	1807688:1807747
AWZ96019.1|1779676_1780924_+|integrase	phage integrase family protein	integrase	NA	NA	NA	NA
AWZ96088.1|1780883_1782677_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ97941.1|1782664_1784782_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ98411.1|1784851_1785214_+	hypothetical protein	NA	NA	NA	NA	NA
AXA00323.1|1785304_1785583_+|terminase	ATPase subunit of terminase family protein	terminase	U5P4I9	Shigella_phage	92.5	4.5e-33
AWZ97169.1|1785639_1786452_+|integrase	integrase core domain protein	integrase	U5P429	Shigella_phage	93.0	5.5e-148
AWZ99986.1|1786786_1787920_+	zinc-binding dehydrogenase family protein	NA	NA	NA	NA	NA
AXA00319.1|1788279_1788783_+|transposase	putative transposase	transposase	U5P0U6	Shigella_phage	98.8	1.8e-93
AWZ96052.1|1788776_1788947_-	maltose acetyltransferase family protein	NA	NA	NA	NA	NA
AWZ96220.1|1789003_1790191_-	lactose permease	NA	NA	NA	NA	NA
AWZ96142.1|1790308_1793377_-	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	96.8	0.0e+00
AWZ97282.1|1793504_1794587_-	bacterial regulatory, lacI family protein	NA	C6ZCU4	Enterobacteria_phage	97.8	9.5e-188
AXA00051.1|1795088_1795403_-|transposase	putative transposase	transposase	U5P0U6	Shigella_phage	97.9	4.2e-48
AWZ98752.1|1795362_1795590_-|transposase	putative transposase	transposase	U5P0U6	Shigella_phage	93.2	4.6e-36
AWZ99295.1|1795961_1797287_-	pyridine nucleotide-disulfide oxidoreductase family protein	NA	A0A2K5B2C5	Erysipelothrix_phage	48.1	6.5e-114
1797349:1797408	attL	TGCCAACTTACTGATTTAGTGTATGATGGTGTTTTTGAGGTGCTCCAGTGGCTTCTGTTT	NA	NA	NA	NA
AWZ98943.1|1797485_1798409_+|transposase	transposase DDE domain protein	transposase	Q9MCT5	Escherichia_phage	97.4	1.5e-173
AWZ98085.1|1798474_1798750_+	putative copper-binding PcoE domain protein	NA	NA	NA	NA	NA
AWZ96778.1|1798949_1799306_-|transposase	transposase IS66 family protein	transposase	A0A0P0ZEB3	Stx2-converting_phage	71.1	3.2e-44
AWZ98152.1|1799336_1800542_-|transposase	transposase IS66 family protein	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.6	4.8e-116
AWZ97631.1|1800572_1800923_-|transposase	putative transposase	transposase	A0A0P0ZBY2	Stx2-converting_phage	65.5	9.6e-41
AWZ96366.1|1800919_1801090_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ98107.1|1801138_1801252_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ96755.1|1801321_1801624_+|transposase	transposase family protein	transposase	Q716C1	Shigella_phage	98.0	1.2e-44
AWZ97776.1|1801863_1802244_+|integrase	integrase core domain protein	integrase	Q716C2	Shigella_phage	94.5	3.2e-58
AWZ96901.1|1802462_1803539_+|transposase	transposase IS116/IS110/IS902 family protein	transposase	NA	NA	NA	NA
AWZ97105.1|1803621_1803753_+|integrase	integrase core domain protein	integrase	U5P429	Shigella_phage	72.5	1.0e-08
AWZ96437.1|1804126_1804963_-	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
AXA00079.1|1805027_1805384_-	glyoxalase-like domain protein	NA	NA	NA	NA	NA
AWZ97198.1|1805469_1806579_-	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	A0A0K0KVL7	Prochlorococcus_phage	28.7	2.2e-30
AWZ96147.1|1806613_1806733_-	transcriptional repressor FrmR	NA	NA	NA	NA	NA
AXA00494.1|1807002_1807380_-|transposase	putative transposase	transposase	Q71TF0	Escherichia_phage	91.2	2.8e-62
1807688:1807747	attR	AAACAGAAGCCACTGGAGCACCTCAAAAACACCATCATACACTAAATCAGTAAGTTGGCA	NA	NA	NA	NA
>prophage 7
CP030347	Enterobacter hormaechei strain AR_038 chromosome, complete genome	5018145	2327307	2371855	5018145	head,tail,terminase,protease	Salmonella_phage(37.74%)	57	NA	NA
AWZ97238.1|2327307_2328774_+	inosine-5'-monophosphate dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	39.1	1.0e-88
AXA00207.1|2328841_2330419_+	GMP synthase	NA	NA	NA	NA	NA
AWZ95941.1|2330611_2331865_+	hypothetical protein	NA	G9L697	Escherichia_phage	80.4	3.6e-191
AWZ97293.1|2331861_2332311_-	phage N-6-adenine-methyltransferase	NA	E5AGF8	Erwinia_phage	53.3	1.4e-39
AWZ99826.1|2332409_2333096_-	hypothetical protein	NA	R9VWB9	Serratia_phage	63.7	9.8e-82
AWZ96845.1|2333092_2333251_-	hypothetical protein	NA	T1SAR0	Salmonella_phage	76.9	2.8e-16
AWZ98251.1|2333243_2333579_-	perC transcriptional activator family protein	NA	T1S9J5	Salmonella_phage	67.0	1.5e-35
AWZ97496.1|2333649_2333898_-	prophage CP4-57 regulatory family protein	NA	A0A193GYW1	Enterobacter_phage	79.3	1.2e-32
AWZ96001.1|2333949_2334969_-	RecT domain protein	NA	Q858E1	Salmonella_phage	97.6	4.6e-184
AWZ98927.1|2334978_2335878_-	putative phage-type endonuclease domain protein	NA	Q858E0	Salmonella_phage	94.6	1.6e-161
AWZ97650.1|2335874_2336174_-	hypothetical protein	NA	A0A0F6R7M4	Escherichia_coli_O157_typing_phage	54.5	2.1e-20
AWZ99749.1|2336170_2336320_-	hypothetical protein	NA	T1SA20	Salmonella_phage	63.8	3.3e-11
AWZ98880.1|2336471_2337062_-	helix-turn-helix family protein	NA	G9L6A6	Escherichia_phage	75.5	1.8e-79
AWZ98600.1|2337216_2337447_+	hypothetical protein	NA	A0A193GYK6	Enterobacter_phage	84.0	1.5e-31
AWZ98491.1|2337613_2337805_+	hypothetical protein	NA	A0A193GYW4	Enterobacter_phage	81.0	1.7e-23
AWZ98721.1|2337804_2338572_+	putative primosomal protein I	NA	A0A193GZ86	Enterobacter_phage	93.7	1.1e-142
AWZ99392.1|2338568_2339354_+	replication P family protein	NA	A0A193GYX1	Enterobacter_phage	87.4	1.3e-133
AWZ99312.1|2339471_2339825_+	hypothetical protein	NA	T1SA23	Salmonella_phage	74.1	3.3e-41
AXA00253.1|2340490_2341168_+	hypothetical protein	NA	G9L6B1	Escherichia_phage	33.6	1.3e-06
AWZ99774.1|2341277_2341664_+	ead/Ea22-like family protein	NA	K7P6V8	Enterobacteria_phage	93.8	2.1e-33
AWZ96413.1|2341666_2341843_+	hypothetical protein	NA	NA	NA	NA	NA
AXA00021.1|2341853_2342438_+	hypothetical protein	NA	G8C7V0	Escherichia_phage	62.0	3.0e-39
AWZ98762.1|2342437_2342743_+	putative oRF6	NA	A5VWB6	Enterobacteria_phage	69.3	1.7e-33
AWZ97633.1|2342732_2342999_+	hypothetical protein	NA	K7PKM4	Enterobacterial_phage	82.5	2.4e-20
AWZ98520.1|2343158_2343497_+	hypothetical protein	NA	A0A193GYX4	Enterobacter_phage	80.4	1.9e-46
AWZ99854.1|2343574_2343904_+	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	64.3	2.5e-30
AWZ96075.1|2343963_2344548_+|terminase	terminase small subunit	terminase	A0A193GYG6	Enterobacter_phage	88.4	1.5e-86
AWZ98353.1|2344544_2346020_+|terminase	putative terminase large subunit	terminase	Q858H3	Salmonella_phage	90.8	1.3e-272
AWZ96138.1|2346063_2346321_-	hypothetical protein	NA	A0A248SKZ7	Klebsiella_phage	43.4	6.0e-08
AWZ98973.1|2346519_2346642_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ98406.1|2346616_2346778_+	hypothetical protein	NA	NA	NA	NA	NA
AXA00257.1|2347140_2347347_+	hypothetical protein	NA	T1SA67	Salmonella_phage	95.6	1.6e-08
AWZ98857.1|2347361_2349032_+|head,tail	bacteriophage head to tail connecting family protein	head,tail	T1S9Z7	Salmonella_phage	94.8	2.8e-303
AWZ98872.1|2349028_2349325_+	hypothetical protein	NA	T1SBI9	Salmonella_phage	90.8	9.2e-45
AWZ97391.1|2349345_2350032_+|protease	putative endoprotease	protease	A0A0F6TJ61	Escherichia_coli_O157_typing_phage	88.5	1.2e-68
AWZ98727.1|2350049_2351036_+	hypothetical protein	NA	G9L6C5	Escherichia_phage	85.7	4.8e-162
AWZ96853.1|2351087_2351528_+	hypothetical protein	NA	A0A193GYT9	Enterobacter_phage	90.4	1.8e-65
AWZ98311.1|2351532_2351898_+	hypothetical protein	NA	G9L6C7	Escherichia_phage	68.6	2.2e-35
AWZ95973.1|2351949_2352273_+	hypothetical protein	NA	A0A193GYH8	Enterobacter_phage	86.9	3.3e-48
AWZ98001.1|2352272_2352878_+	hypothetical protein	NA	A0A193GYT2	Enterobacter_phage	86.1	2.4e-100
AWZ97521.1|2352877_2355343_+	hypothetical protein	NA	Q858G3	Salmonella_phage	92.6	0.0e+00
AWZ96118.1|2355342_2355807_+	hypothetical protein	NA	T1SA73	Salmonella_phage	88.3	2.6e-78
AXA00356.1|2355806_2356346_+	hypothetical protein	NA	A0A0F6TJ56	Escherichia_coli_O157_typing_phage	73.3	4.4e-61
AXA00461.1|2356358_2358887_+	hypothetical protein	NA	Q858G0	Salmonella_phage	94.4	0.0e+00
AWZ97782.1|2358886_2360776_+	hypothetical protein	NA	Q858F9	Salmonella_phage	91.0	0.0e+00
AWZ99577.1|2360775_2363532_+	hypothetical protein	NA	Q858F8	Salmonella_phage	97.2	0.0e+00
AWZ97888.1|2363531_2363723_+	putative membrane protein	NA	Q858F7	Salmonella_phage	74.6	3.1e-17
AWZ97723.1|2363755_2364016_-	hypothetical protein	NA	T1SA06	Salmonella_phage	80.2	9.9e-35
AWZ99821.1|2364211_2366698_+	hypothetical protein	NA	G9L6E4	Escherichia_phage	70.0	3.1e-93
AWZ99353.1|2366694_2368110_-	glucosyl transferase GtrII family protein	NA	A0A0N7CG72	Salmonella_phage	28.7	1.1e-13
AWZ96406.1|2368113_2369028_-	hypothetical protein	NA	U5P087	Shigella_phage	92.4	2.4e-160
AWZ99445.1|2369024_2369324_-	hypothetical protein	NA	U5P0S6	Shigella_phage	81.8	1.4e-37
AWZ95877.1|2369540_2369945_+	putative membrane protein	NA	T1SA79	Salmonella_phage	83.6	1.3e-54
AWZ96599.1|2369931_2370219_+	hypothetical protein	NA	A0A193GYK3	Enterobacter_phage	63.7	3.4e-28
AWZ97058.1|2370208_2370838_+	chitinase class I family protein	NA	Q858F0	Salmonella_phage	82.8	5.8e-97
AWZ98784.1|2370834_2371365_+	hypothetical protein	NA	A0A193GYI0	Enterobacter_phage	78.5	5.9e-58
AWZ96636.1|2371681_2371855_+	AP2 domain protein	NA	A0A1U9AJK5	Stx1_converting_phage	51.9	9.6e-10
>prophage 8
CP030347	Enterobacter hormaechei strain AR_038 chromosome, complete genome	5018145	2459964	2560153	5018145	tRNA,integrase,capsid,tail,protease,portal,terminase,head	Enterobacterial_phage(21.82%)	106	2451385:2451400	2502064:2502079
2451385:2451400	attL	CACTGTTGCAGTTCTT	NA	NA	NA	NA
AWZ95831.1|2459964_2461380_+|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
AWZ98975.1|2461431_2461818_-	hypothetical protein	NA	NA	NA	NA	NA
AXA00058.1|2461819_2462182_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ97628.1|2462804_2464994_+	EAL domain protein	NA	NA	NA	NA	NA
AWZ99426.1|2465040_2466174_-	nucleoside permease NupC	NA	NA	NA	NA	NA
AWZ99443.1|2466636_2467812_+	divalent metal cation transporter MntH	NA	NA	NA	NA	NA
AWZ99368.1|2467845_2468193_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ98851.1|2468319_2469318_-	putative oxidoreductase	NA	NA	NA	NA	NA
AXA00530.1|2469504_2471163_+	indolepyruvate decarboxylase	NA	NA	NA	NA	NA
AWZ97838.1|2471163_2472375_-	voltage gated chloride channel family protein	NA	NA	NA	NA	NA
AWZ99199.1|2472667_2473570_+	glucokinase	NA	NA	NA	NA	NA
AWZ96443.1|2473605_2474337_-	response regulator	NA	A0A2R2ZGH8	Clostridioides_phage	25.5	1.7e-15
AWZ95829.1|2474350_2476048_-	5TMR of 5TMR-LYT family protein	NA	NA	NA	NA	NA
AWZ97644.1|2476434_2477670_+	glutamate-pyruvate aminotransferase AlaC	NA	NA	NA	NA	NA
AWZ97015.1|2478159_2479077_-	lipid A biosynthesis lauroyl (or palmitoleoyl) acyltransferase family protein	NA	A0A1W6JP29	Morganella_phage	54.7	4.8e-76
AWZ96798.1|2479208_2479337_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ98992.1|2479348_2480728_+	diguanylate cyclase DosC	NA	A0A127AWB9	Bacillus_phage	37.0	1.1e-15
AWZ96090.1|2481008_2482178_+|integrase	phage integrase family protein	integrase	A0A2R2Z2Y0	Escherichia_phage	85.3	2.1e-201
AWZ95996.1|2482161_2482347_-	putative 50S ribosomal protein L7/L12	NA	A0A2R2Z2X2	Escherichia_phage	59.6	8.9e-14
AWZ97027.1|2482428_2482905_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ99031.1|2482901_2483372_-	ead/Ea22-like family protein	NA	NA	NA	NA	NA
AWZ98372.1|2483481_2484042_-	hypothetical protein	NA	A0A0F6N6A6	Escherichia_phage	44.4	1.2e-05
AWZ96670.1|2484038_2484866_-	hypothetical protein	NA	K7PKM7	Enterobacterial_phage	87.8	6.0e-126
AWZ96342.1|2484865_2485114_-	hypothetical protein	NA	K7PJS4	Enterobacterial_phage	85.4	4.9e-31
AWZ98991.1|2485283_2485424_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ96677.1|2485881_2486013_-	hypothetical protein	NA	A0A2P1JUD4	Erwinia_phage	69.7	1.3e-06
AXA00422.1|2486322_2486451_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ95802.1|2486805_2487315_-	repressor protein C2	NA	H9C160	Pectobacterium_phage	48.6	1.2e-39
AWZ97290.1|2487769_2488324_+	putative e14 prophage DNA-binding transcriptional regulator	NA	S5FXP0	Shigella_phage	54.1	6.4e-47
AWZ98873.1|2488656_2489610_+	conserved phage family protein	NA	K7PLZ7	Enterobacterial_phage	97.5	2.3e-177
AWZ97018.1|2489615_2490101_+	hypothetical protein	NA	NA	NA	NA	NA
AXA00416.1|2490100_2490760_+	MT-A70 family protein	NA	I6PDF5	Cronobacter_phage	78.9	6.7e-96
AWZ97518.1|2490756_2490984_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ98925.1|2490980_2491301_+	lexA DNA binding domain protein	NA	K7PHB4	Enterobacterial_phage	70.8	1.2e-37
AWZ96319.1|2491297_2491705_+	endodeoxyribonuclease RusA family protein	NA	A0A1C9IIA0	Salmonella_phage	84.3	1.9e-56
AWZ98915.1|2492036_2492570_+	putative kilA DNA-binding domain protein	NA	U5P4K5	Shigella_phage	75.6	1.0e-70
AXA00064.1|2492673_2493567_+	hypothetical protein	NA	K7PJS6	Enterobacterial_phage	92.9	6.4e-166
AWZ97662.1|2493711_2494158_+	hypothetical protein	NA	A0A0U2S606	Escherichia_phage	48.5	5.0e-26
AWZ98241.1|2494741_2495137_+	putative membrane protein	NA	K7PHB9	Enterobacterial_phage	99.2	9.1e-64
AWZ98113.1|2495189_2495405_+	hypothetical protein	NA	K7PKN9	Enterobacterial_phage	98.6	9.0e-34
AWZ97879.1|2495485_2496031_+	chitinase class I family protein	NA	K7PJS7	Enterobacterial_phage	95.0	2.5e-96
AWZ96959.1|2496077_2496314_+	hypothetical protein	NA	G8C7W1	Escherichia_phage	41.6	8.8e-06
AWZ98029.1|2496306_2496456_+	hypothetical protein	NA	G8C7W2	Escherichia_phage	93.3	2.2e-18
AWZ99037.1|2497058_2498516_+	putative glycosyl transferase	NA	K7PKP3	Enterobacterial_phage	90.1	3.5e-270
AWZ97129.1|2498842_2499157_+	HNH endonuclease family protein	NA	A0A1W6DXY0	Salmonella_phage	39.6	2.3e-09
AWZ98344.1|2499309_2499729_+	putative glycosyl transferase	NA	S4TR53	Salmonella_phage	81.2	2.7e-66
AWZ98156.1|2499791_2499977_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ99591.1|2500389_2500710_+|terminase	phage terminase, small subunit, P27 family	terminase	K7PHI2	Enterobacteria_phage	98.1	2.6e-53
AWZ99124.1|2500709_2502467_+	phage Terminase family protein	NA	K7PKT2	Enterobacteria_phage	96.6	0.0e+00
2502064:2502079	attR	AAGAACTGCAACAGTG	NA	NA	NA	NA
AWZ96978.1|2502466_2503771_+|portal	phage portal protein, HK97 family	portal	K7PJU5	Enterobacteria_phage	93.5	1.6e-234
AXA00593.1|2503784_2504633_+|protease	clp protease family protein	protease	K7PH05	Enterobacteria_phage	91.8	9.2e-138
AWZ96714.1|2504642_2505854_+|capsid	phage major capsid protein, HK97 family	capsid	K7PM57	Enterobacteria_phage	87.9	9.5e-197
AWZ95915.1|2505896_2506223_+|head,tail	phage gp6-like head-tail connector family protein	head,tail	K7PKT4	Enterobacteria_phage	82.4	3.4e-48
AWZ96523.1|2506566_2507016_+	hypothetical protein	NA	K7P6X4	Enterobacteria_phage	98.0	1.1e-73
AWZ99263.1|2507419_2507863_+|tail	phage tail family protein	tail	K7PHL2	Enterobacterial_phage	93.8	7.8e-72
AWZ96347.1|2507871_2508255_+|tail	phage tail assembly chaperone family protein	tail	K7PKV6	Enterobacterial_phage	93.7	4.4e-63
AWZ97938.1|2508281_2508563_+	hypothetical protein	NA	Q9MCS5	Enterobacteria_phage	80.2	1.1e-28
AXA00115.1|2508695_2508812_+	hypothetical protein	NA	S4TR42	Salmonella_phage	96.8	1.0e-07
AWZ98786.1|2508865_2509006_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ97534.1|2508977_2512469_+|tail	phage tail tape measure protein, lambda family	tail	A0A2H4JHR1	uncultured_Caudovirales_phage	86.8	0.0e+00
AWZ97966.1|2512471_2512810_+|tail	phage minor tail family protein	tail	K7PKL8	Enterobacterial_phage	59.8	4.3e-38
AWZ98853.1|2512806_2513565_+|tail	phage minor tail protein L	tail	A0A1W6JNX9	Morganella_phage	64.0	1.0e-95
AWZ95834.1|2513567_2514278_+	hypothetical protein	NA	F1C573	Cronobacter_phage	70.2	1.3e-97
AWZ98485.1|2514277_2514865_+|tail	bacteriophage lambda tail assembly I family protein	tail	A0A1P8DTG7	Proteus_phage	47.9	3.6e-48
AWZ97928.1|2514917_2518478_+	hypothetical protein	NA	Q9MCU0	Escherichia_phage	70.6	0.0e+00
AWZ99989.1|2518837_2519509_+	hypothetical protein	NA	A0A2P0WA07	Enterobacter_phage	73.1	5.8e-87
AWZ98427.1|2519616_2519850_+	putative conversion resistant protein Cor	NA	E4WL42	Enterobacteria_phage	78.9	3.9e-30
AWZ95720.1|2519908_2521207_+|tail	putative tail fiber	tail	G8C7K5	Escherichia_phage	66.0	9.4e-150
AWZ99239.1|2521248_2521515_-	dinI-like family protein	NA	K7PKR6	Enterobacteria_phage	93.2	1.4e-39
AWZ98250.1|2521879_2522446_-	isochorismatase family protein	NA	NA	NA	NA	NA
AWZ97262.1|2522708_2524481_+|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
AWZ96278.1|2524482_2524926_+	dihydroneopterin triphosphate pyrophosphatase	NA	NA	NA	NA	NA
AWZ97424.1|2524953_2525694_+	DNA-binding regulatory, YebC/PmpR family protein	NA	NA	NA	NA	NA
AWZ96964.1|2525728_2526250_+	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.6e-10
AWZ95743.1|2526378_2526945_+	holliday junction DNA helicase RuvA	NA	NA	NA	NA	NA
AXA00311.1|2526953_2527964_+	holliday junction DNA helicase RuvB	NA	B3GAM6	uncultured_virus	29.9	2.4e-07
AWZ98139.1|2528016_2528802_-	high-affinity zinc uptake system membrane protein ZnuB	NA	NA	NA	NA	NA
AWZ99873.1|2528798_2529554_-	zinc import ATP-binding protein ZnuC	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.8	8.8e-15
AWZ97266.1|2529631_2530576_+	ABC superfamily high affinity Zn transport protein	NA	NA	NA	NA	NA
AWZ96044.1|2530654_2531911_+	lysM domain protein	NA	A8ATH6	Listeria_phage	40.9	8.5e-15
AWZ99327.1|2532028_2533000_+	lipid A biosynthesis (KDO)2-(lauroyl)-lipid IVA acyltransferase	NA	NA	NA	NA	NA
AWZ99381.1|2533043_2534486_-	pyruvate kinase	NA	NA	NA	NA	NA
AWZ96593.1|2534600_2535470_-	helix-turn-helix domain, rpiR family protein	NA	NA	NA	NA	NA
AWZ99385.1|2535601_2535766_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ96150.1|2535826_2537302_+	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	36.2	6.0e-76
AXA00317.1|2537535_2539347_+	phosphogluconate dehydratase	NA	NA	NA	NA	NA
AWZ96139.1|2539386_2540028_+	KHG/KDPG aldolase	NA	NA	NA	NA	NA
AWZ97634.1|2540102_2541281_-	phosphoribosylglycinamide formyltransferase 2	NA	NA	NA	NA	NA
AWZ96192.1|2541452_2542103_+	inner membrane protein YebE	NA	NA	NA	NA	NA
AWZ95925.1|2542178_2544254_+	prolyl oligopeptidase, N-terminal beta-propeller domain protein	NA	NA	NA	NA	NA
AWZ97148.1|2544235_2544898_-	exodeoxyribonuclease 10	NA	NA	NA	NA	NA
AWZ97970.1|2544922_2545342_-	putative yobB	NA	NA	NA	NA	NA
AWZ97085.1|2545684_2545915_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	7.0e-16
AXA00398.1|2546052_2546424_+	protein YobA	NA	NA	NA	NA	NA
AWZ97324.1|2546425_2547295_+	copper resistance D family protein	NA	NA	NA	NA	NA
AXA00577.1|2547311_2547650_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ97790.1|2548018_2548999_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ99827.1|2549166_2549811_+	serine/threonine-protein phosphatase 1	NA	A0A222YWF0	Escherichia_phage	49.8	1.5e-55
AWZ98495.1|2549845_2550085_-	hypothetical protein	NA	NA	NA	NA	NA
AXA00309.1|2550191_2551634_-	ribosomal RNA small subunit methyltransferase F	NA	NA	NA	NA	NA
AXA00194.1|2551711_2554345_-	mce related family protein	NA	NA	NA	NA	NA
AWZ96601.1|2554313_2555471_-	inner membrane protein YebS	NA	NA	NA	NA	NA
AWZ99115.1|2555729_2556227_+	free methionine-R-sulfoxide reductase	NA	NA	NA	NA	NA
AWZ96808.1|2556323_2557010_+	proP effector	NA	NA	NA	NA	NA
AWZ96820.1|2557029_2559078_+|tail,protease	tail-specific protease	tail,protease	A0A0R6PIZ1	Moraxella_phage	32.6	7.8e-82
AWZ96795.1|2559271_2560153_+|protease	protease HtpX	protease	NA	NA	NA	NA
>prophage 9
CP030347	Enterobacter hormaechei strain AR_038 chromosome, complete genome	5018145	3120472	3131634	5018145		Escherichia_phage(66.67%)	15	NA	NA
AWZ99030.1|3120472_3121687_-	mandelate racemase / muconate lactonizing enzyme, N-terminal domain protein	NA	Q6A202	Oenococcus_phage	30.0	2.5e-48
AWZ97261.1|3121798_3122125_-	hypothetical protein	NA	A0A218MNG8	uncultured_virus	54.5	7.1e-22
AWZ99053.1|3122275_3122614_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ96519.1|3122613_3123174_+	spermidine N(1)-acetyltransferase	NA	NA	NA	NA	NA
AWZ98902.1|3123191_3123902_-	hypothetical protein	NA	NA	NA	NA	NA
AXA00365.1|3124094_3124949_+	glycosyltransferase 17 family protein	NA	M1I711	Paramecium_bursaria_Chlorella_virus	33.2	8.1e-25
AWZ99835.1|3125051_3125357_+	hypothetical protein	NA	NA	NA	NA	NA
AXA00563.1|3125487_3126786_+	molybdopterin oxidoreductase family protein	NA	A0A077SK27	Escherichia_phage	52.0	3.6e-109
AWZ96663.1|3126761_3127925_+	molybdopterin dinucleotide binding domain protein	NA	A0A077SK27	Escherichia_phage	48.7	8.5e-102
AWZ96950.1|3127935_3128553_+	dimethylsulfoxide reductase, chain B	NA	A0A077SL61	Escherichia_phage	58.6	4.0e-74
AWZ97158.1|3128554_3129409_+	DMSO reductase anchor subunit family protein	NA	A0A077SK59	Escherichia_phage	33.1	6.4e-22
AWZ96234.1|3129453_3130068_+	tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	34.7	3.3e-28
AXA00027.1|3130177_3130489_+	yebG family protein	NA	NA	NA	NA	NA
AWZ97546.1|3130603_3130918_-	putative nitroreductase	NA	NA	NA	NA	NA
AWZ98215.1|3130956_3131634_-	chloramphenicol acetyltransferase	NA	G3CFL0	Escherichia_phage	62.6	2.1e-76
>prophage 10
CP030347	Enterobacter hormaechei strain AR_038 chromosome, complete genome	5018145	3368689	3417374	5018145	tRNA,capsid,lysis,tail,portal,protease,terminase,head	Enterobacteria_phage(47.62%)	55	NA	NA
AWZ98490.1|3368689_3369973_+	hypothetical protein	NA	A0A140HLI1	Bacillus_phage	28.3	1.1e-09
AWZ99998.1|3369983_3370106_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ97948.1|3370127_3370262_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ96633.1|3370235_3370364_-	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	63.4	1.1e-07
AXA00518.1|3370870_3371350_-	resolvase, N terminal domain protein	NA	A0A1S6L009	Salmonella_phage	77.2	3.7e-59
AWZ96250.1|3371633_3373631_+	acyltransferase family protein	NA	A0A193GZ69	Enterobacter_phage	39.0	8.5e-118
AWZ96388.1|3373913_3375050_-|tail	putative tail fiber	tail	K7PH95	Enterobacterial_phage	50.4	8.3e-94
AWZ96862.1|3375336_3379536_-	hypothetical protein	NA	Q9MCR7	Enterobacteria_phage	58.1	0.0e+00
AWZ98007.1|3379588_3380176_-|tail	bacteriophage lambda tail assembly I family protein	tail	A0A1P8DTG7	Proteus_phage	47.4	3.6e-48
AWZ99198.1|3380175_3380886_-	hypothetical protein	NA	F1C573	Cronobacter_phage	69.8	1.5e-96
AWZ96860.1|3380888_3381647_-|tail	phage minor tail protein L	tail	A0A1W6JNX9	Morganella_phage	63.2	3.9e-95
AWZ95825.1|3381643_3381982_-|tail	phage minor tail family protein	tail	K7PKL8	Enterobacterial_phage	59.8	7.3e-38
AWZ98003.1|3381984_3385287_-|tail	phage tail tape measure protein, lambda family	tail	K7P7L6	Enterobacteria_phage	84.9	0.0e+00
AWZ95794.1|3385344_3385662_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ96402.1|3385741_3385948_-	hypothetical protein	NA	Q9MCS5	Enterobacteria_phage	95.6	4.0e-31
AXA00580.1|3386028_3386412_-|tail	phage tail assembly chaperone family protein	tail	K7PKV6	Enterobacterial_phage	93.7	4.4e-63
AWZ99054.1|3386420_3386864_-|tail	phage major tail 2 family protein	tail	K7PHL2	Enterobacterial_phage	93.8	4.6e-72
AWZ97202.1|3387267_3387717_-	hypothetical protein	NA	K7P6X4	Enterobacteria_phage	98.7	2.9e-74
AWZ95940.1|3388060_3388387_-|head,tail	phage gp6-like head-tail connector family protein	head,tail	K7PKT4	Enterobacteria_phage	82.4	3.4e-48
AWZ96605.1|3388430_3389642_-|capsid	phage major capsid protein, HK97 family	capsid	K7PM57	Enterobacteria_phage	87.9	9.5e-197
AWZ99447.1|3389651_3390500_-|protease	clp protease family protein	protease	K7PH05	Enterobacteria_phage	91.8	9.2e-138
AWZ96741.1|3390513_3391818_-|portal	phage portal protein, HK97 family	portal	K7PJU5	Enterobacteria_phage	93.5	1.6e-234
AXA00224.1|3391817_3393575_-	phage Terminase family protein	NA	K7PKT2	Enterobacteria_phage	96.6	0.0e+00
AWZ98673.1|3393574_3393895_-|terminase	phage terminase, small subunit, P27 family	terminase	K7PHI2	Enterobacteria_phage	98.1	2.6e-53
AWZ99860.1|3394555_3394975_-	putative glycosyl transferase	NA	S4TR53	Salmonella_phage	79.0	1.8e-62
AWZ97115.1|3395127_3396318_-	putative glycosyl transferase	NA	K7PKP3	Enterobacterial_phage	92.7	1.2e-228
AXA00438.1|3396587_3396731_-	hypothetical protein	NA	A0A220NRM6	Escherichia_phage	93.6	2.5e-16
AWZ99245.1|3397302_3397710_-|lysis	bacteriophage lysis family protein	lysis	M9NYX9	Enterobacteria_phage	73.3	2.7e-47
AWZ95812.1|3397760_3398255_-	lysozyme RrrD	NA	M9P0E5	Enterobacteria_phage	97.6	7.1e-90
AWZ99439.1|3398232_3398388_-|lysis	lysis S family protein	lysis	M9NZI9	Enterobacteria_phage	92.2	1.2e-19
AWZ96024.1|3398853_3399636_-	antitermination family protein	NA	F1C595	Cronobacter_phage	76.4	2.4e-108
AWZ98541.1|3399663_3401043_-	dnaB-like helicase C terminal domain protein	NA	Q8W640	Enterobacteria_phage	68.1	9.0e-175
AWZ96740.1|3401039_3401921_-	AFG1-like ATPase family protein	NA	Q8W641	Enterobacteria_phage	63.3	3.7e-81
AWZ96446.1|3401936_3402848_-	helix-turn-helix domain protein	NA	Q8W642	Enterobacteria_phage	63.3	1.6e-92
AWZ97897.1|3402844_3402982_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ99349.1|3404024_3404195_+	peptidase S24-like family protein	NA	K7PK07	Enterobacteria_phage	79.6	2.2e-19
AWZ98910.1|3404385_3404598_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ95799.1|3404598_3405018_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ96384.1|3405883_3406087_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ96136.1|3406190_3406430_+	hypothetical protein	NA	A0A286S1Q6	Klebsiella_phage	59.7	9.1e-19
AXA00087.1|3406480_3406648_+	hypothetical protein	NA	A0A286S1P6	Klebsiella_phage	61.1	1.3e-11
AWZ96793.1|3406785_3407052_+	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	48.9	1.8e-15
AWZ99673.1|3407051_3407246_+	putative membrane protein	NA	NA	NA	NA	NA
AWZ96153.1|3407242_3408070_+	SPFH domain / Band 7 family protein	NA	Q8W654	Enterobacteria_phage	84.7	3.2e-111
AWZ99742.1|3408115_3408859_+	hypothetical protein	NA	A0A1B5FPC0	Escherichia_phage	94.7	4.6e-133
AWZ99315.1|3408957_3409287_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ98042.1|3409270_3409525_+	hypothetical protein	NA	Q8W657	Enterobacteria_phage	86.8	2.5e-35
AWZ97722.1|3409580_3410894_+	hypothetical protein	NA	Q8W658	Enterobacteria_phage	85.6	6.0e-221
AWZ96361.1|3410920_3411646_+	hypothetical protein	NA	Q859D1	Escherichia_coli_phage	81.1	2.1e-58
AWZ99704.1|3411697_3412093_+	inner membrane protein YecN	NA	NA	NA	NA	NA
AWZ96920.1|3412133_3412877_+|tRNA	tRNA (cmo5U34)-methyltransferase	tRNA	A0A1S6L2V9	Erwinia_phage	30.2	6.1e-29
AXA00244.1|3412873_3413845_+|tRNA	tRNA (mo5U34)-methyltransferase	tRNA	NA	NA	NA	NA
AWZ98266.1|3414019_3414763_-	copper homeostasis protein CutC	NA	NA	NA	NA	NA
AXA00352.1|3414841_3415402_-	protein YecM	NA	NA	NA	NA	NA
AXA00228.1|3415640_3417374_+|tRNA	arginine--tRNA ligase	tRNA	A0A1V0SIS8	Klosneuvirus	36.8	2.0e-86
>prophage 11
CP030347	Enterobacter hormaechei strain AR_038 chromosome, complete genome	5018145	3469643	3507915	5018145	plate,integrase,tail,protease,terminase,portal	Enterobacterial_phage(27.78%)	47	3466975:3466990	3509883:3509898
3466975:3466990	attL	TGCGAAATACCCGGCA	NA	NA	NA	NA
AWZ98246.1|3469643_3469799_+	ycfA-like family protein	NA	A0A0D4DC32	Acinetobacter_phage	78.4	1.2e-16
AXA00139.1|3469820_3470225_+	hypothetical protein	NA	Q775F5	Haemophilus_virus	49.2	3.1e-35
AXA00346.1|3470265_3471336_-	glycosyltransferase 9 family protein	NA	NA	NA	NA	NA
AWZ96767.1|3471412_3471844_-|tail	caudovirales tail fiber assembly family protein	tail	K7PMH7	Enterobacteria_phage	50.0	2.9e-31
AWZ95805.1|3471990_3473589_-|tail	phage tail fiber repeat family protein	tail	A0A0K2FIZ6	Escherichia_phage	42.4	8.3e-39
AWZ96465.1|3474170_3474623_-|tail	phage tail protein I	tail	A0A0F7LDF3	Escherichia_phage	44.1	2.0e-27
AWZ95944.1|3474714_3475629_-|plate	baseplate J-like family protein	plate	V5YTH6	Pseudomonas_phage	46.0	2.8e-60
AWZ99645.1|3475612_3475966_-	lysozyme family protein	NA	E5FFH4	Burkholderia_phage	50.0	8.5e-21
AWZ95751.1|3476002_3477133_-	phage late control D family protein	NA	R9TNM7	Vibrio_phage	32.6	3.5e-36
AWZ99347.1|3477123_3477333_-	phage Tail Protein X family protein	NA	R9TR63	Vibrio_phage	54.5	3.8e-13
AWZ98773.1|3477313_3477784_-	phage P2 GpU family protein	NA	D4HTW5	Vibrio_phage	33.8	2.9e-16
AWZ98995.1|3477780_3479913_-	hypothetical protein	NA	A0A2I7R3J9	Vibrio_phage	31.7	9.7e-27
AWZ99106.1|3480027_3480315_-	mu-like prophage FluMu gp41 family protein	NA	NA	NA	NA	NA
AWZ97379.1|3480366_3480873_-|tail	phage tail tube FII family protein	tail	NA	NA	NA	NA
AXA00193.1|3480869_3482339_-|tail	phage tail sheath family protein	tail	R9TMQ0	Vibrio_phage	47.1	1.1e-77
AWZ96889.1|3482377_3483001_-|plate	phage baseplate assembly V family protein	plate	Q8HAB9	Salmonella_phage	30.8	7.2e-07
AWZ95879.1|3482993_3483548_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ98080.1|3483556_3484219_-	hypothetical protein	NA	R9TR34	Vibrio_phage	36.7	3.2e-21
AWZ95815.1|3484220_3484577_-	phage Head-Tail Attachment family protein	NA	NA	NA	NA	NA
AXA00359.1|3484576_3484912_-	hypothetical protein	NA	NA	NA	NA	NA
AXA00173.1|3484984_3487042_-|protease	clp protease family protein	protease	A0A1B0YZU0	Pseudomonas_phage	57.6	6.4e-201
AWZ95867.1|3487034_3488405_-|portal	phage portal protein, lambda family	portal	K7PHM5	Enterobacterial_phage	57.3	4.5e-142
AWZ97252.1|3488563_3488779_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ96108.1|3488775_3490896_-|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	74.8	6.4e-305
AWZ99810.1|3490899_3491403_-	hypothetical protein	NA	K7PJY2	Enterobacterial_phage	62.9	3.1e-48
AWZ97705.1|3491783_3491939_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ99360.1|3492127_3492355_-	hypothetical protein	NA	A0A1L6Z528	Klebsiella_phage	71.7	2.1e-17
AWZ96653.1|3492427_3492631_-	putative membrane protein	NA	A0A1W6JPG4	Morganella_phage	52.9	1.6e-11
AWZ97992.1|3492779_3493037_-	hypothetical protein	NA	Q8W634	Enterobacteria_phage	53.3	1.6e-16
AXA00558.1|3493023_3493170_-	hypothetical protein	NA	G8C7W2	Escherichia_phage	81.2	1.0e-17
AWZ99279.1|3493162_3493441_-	hypothetical protein	NA	G8C7W1	Escherichia_phage	43.2	1.0e-08
AWZ97641.1|3493448_3494078_-	chitinase class I family protein	NA	G8C7W0	Escherichia_phage	87.1	1.7e-101
AXA00594.1|3494077_3494356_-	hypothetical protein	NA	G8C7V9	Escherichia_phage	85.9	1.5e-36
AWZ99014.1|3494345_3494735_-	putative membrane protein	NA	G8C7V8	Escherichia_phage	92.2	1.1e-58
AWZ97933.1|3495732_3497031_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ95848.1|3497223_3497466_-	phage antitermination Q family protein	NA	A0A0P0ZCW0	Stx2-converting_phage	79.7	1.1e-32
AWZ97503.1|3497582_3498254_-	hypothetical protein	NA	K7PJS6	Enterobacterial_phage	91.0	2.3e-120
AXA00372.1|3498284_3498494_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ97783.1|3498954_3499194_-	lexA DNA binding domain protein	NA	K7PHB4	Enterobacterial_phage	81.0	5.0e-33
AWZ96672.1|3499274_3499934_-	MT-A70 family protein	NA	I6PDF5	Cronobacter_phage	79.3	1.5e-98
AWZ99380.1|3499933_3500428_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ98238.1|3500424_3501351_-	conserved phage family protein	NA	K7PLZ7	Enterobacterial_phage	55.2	9.9e-69
AWZ96332.1|3501760_3502231_-	hypothetical protein	NA	K7PJS5	Enterobacterial_phage	92.9	1.4e-74
AWZ97576.1|3503000_3503210_+	peptidase S24-like family protein	NA	K7PLZ5	Enterobacterial_phage	98.6	8.2e-32
AWZ99251.1|3504180_3504429_+	hypothetical protein	NA	K7PJS4	Enterobacterial_phage	85.4	2.7e-29
AWZ98479.1|3504428_3505463_+	hypothetical protein	NA	K7PKM7	Enterobacterial_phage	94.2	1.7e-178
AWZ99558.1|3506904_3507915_+|integrase	phage integrase family protein	integrase	K7PLZ2	Enterobacterial_phage	90.5	3.7e-178
3509883:3509898	attR	TGCGAAATACCCGGCA	NA	NA	NA	NA
>prophage 12
CP030347	Enterobacter hormaechei strain AR_038 chromosome, complete genome	5018145	3525415	3573760	5018145	coat,integrase,lysis,tail	Cronobacter_phage(33.93%)	67	3538977:3538993	3579235:3579251
AWZ96554.1|3525415_3526666_-	impB/mucB/samB family protein	NA	I6RSM4	Salmonella_phage	90.9	5.0e-225
AWZ98382.1|3526683_3526995_-	hypothetical protein	NA	I6PCW5	Cronobacter_phage	41.7	3.6e-15
AWZ97772.1|3527474_3528407_+	acyltransferase family protein	NA	Q6QI96	Burkholderia_phage	25.8	5.9e-05
AWZ97096.1|3528439_3530614_-	hypothetical protein	NA	B1GS50	Salmonella_phage	63.6	9.2e-57
AWZ96552.1|3530672_3533096_-|tail	phage tail family protein	tail	F1C5A7	Cronobacter_phage	93.5	0.0e+00
AWZ99816.1|3533136_3533493_-	nlpC/P60 family protein	NA	F1C5F2	Cronobacter_phage	89.7	1.1e-60
AWZ99661.1|3533515_3533986_-	hypothetical protein	NA	F1C5F1	Cronobacter_phage	87.8	8.0e-75
AWZ96317.1|3533985_3534483_-	hypothetical protein	NA	F1C5F0	Cronobacter_phage	89.7	3.9e-88
AWZ99936.1|3534482_3538004_-	tape measure domain protein	NA	R9TMK1	Aeromonas_phage	55.9	1.0e-230
AWZ96904.1|3538062_3538746_-	hypothetical protein	NA	F1C5E8	Cronobacter_phage	60.6	3.0e-78
AXA00428.1|3538805_3539447_-	bacterial Ig-like domain family protein	NA	F1C5E5	Cronobacter_phage	82.9	8.1e-54
3538977:3538993	attL	GGTTGGTGCGATATTCA	NA	NA	NA	NA
AWZ96800.1|3539614_3540166_-	HNH endonuclease family protein	NA	G0ZNE5	Cronobacter_phage	53.6	4.4e-48
AWZ99659.1|3540265_3540616_-	hypothetical protein	NA	F1C5E4	Cronobacter_phage	64.3	5.4e-36
AXA00510.1|3541016_3541373_-	hypothetical protein	NA	G0ZNE2	Cronobacter_phage	57.3	7.2e-28
AWZ98793.1|3541372_3541546_-	putative 50S ribosomal protein L13	NA	Q5G8X7	Enterobacteria_phage	49.1	7.8e-12
AWZ98307.1|3541545_3541926_-	hypothetical protein	NA	F1C5E2	Cronobacter_phage	53.7	2.0e-28
AWZ96124.1|3541928_3542219_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ99284.1|3542303_3543401_-|coat	putative phage coat protein	coat	F1C5E1	Cronobacter_phage	77.5	1.0e-160
AWZ99653.1|3543411_3543846_-	hypothetical protein	NA	F1C5E0	Cronobacter_phage	71.5	6.9e-49
AWZ95951.1|3543849_3545253_-	hypothetical protein	NA	F1C5D9	Cronobacter_phage	51.0	5.6e-124
AWZ99588.1|3545352_3545493_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ95921.1|3546110_3547010_-	phage Mu F like family protein	NA	F1C5D8	Cronobacter_phage	64.4	7.0e-104
AWZ96491.1|3547047_3548439_-	hypothetical protein	NA	F1C5D7	Cronobacter_phage	74.4	3.4e-198
AWZ97618.1|3548519_3549995_-	hypothetical protein	NA	A0A1W6JNY3	Morganella_phage	77.0	1.0e-229
AXA00026.1|3550004_3550454_-	hypothetical protein	NA	I6S1P9	Salmonella_phage	82.9	1.5e-54
AWZ98546.1|3550486_3551125_-	hypothetical protein	NA	I6S676	Salmonella_phage	92.9	1.3e-115
AWZ99741.1|3551128_3551272_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ99619.1|3551508_3552012_-	kilA-N domain protein	NA	A0A1V0E5P7	Salmonella_phage	63.6	2.5e-50
AWZ97492.1|3552405_3552813_-|lysis	bacteriophage lysis family protein	lysis	M9NYX9	Enterobacteria_phage	71.9	1.0e-46
AWZ99412.1|3552863_3553358_-	lysozyme RrrD	NA	M9P0E5	Enterobacteria_phage	97.6	7.1e-90
AWZ96896.1|3553335_3553491_-|lysis	lysis S family protein	lysis	M9NZI9	Enterobacteria_phage	92.2	1.2e-19
AWZ97283.1|3553851_3554352_-	phage antitermination Q family protein	NA	G8C7V7	Escherichia_phage	96.3	9.3e-90
AWZ95956.1|3554464_3555109_-	bacteriophage Lambda NinG family protein	NA	S4TSR3	Salmonella_phage	71.0	9.6e-79
AWZ99760.1|3555101_3555272_-	putative NinE-like protein from lambdoid prophage DLP12	NA	K7P7K0	Enterobacteria_phage	89.3	5.9e-20
AWZ96177.1|3555271_3555727_-	putative phage protein	NA	I6PD71	Cronobacter_phage	66.2	7.0e-60
AWZ96573.1|3556192_3556393_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ96173.1|3556385_3557312_-	hypothetical protein	NA	K7P7E4	Enterobacteria_phage	31.4	7.2e-19
AWZ95735.1|3557308_3557719_-	ead/Ea22-like family protein	NA	K7P6V8	Enterobacteria_phage	88.6	4.7e-31
AWZ98388.1|3557715_3557925_-	putative orf-90	NA	T1S9K2	Salmonella_phage	92.8	7.0e-31
AWZ98173.1|3557969_3558116_-	hypothetical protein	NA	F1C5B6	Cronobacter_phage	61.7	2.0e-08
AXA00483.1|3558391_3558688_-	putative protein ren	NA	M1FPD5	Enterobacteria_phage	53.6	8.7e-19
AWZ96344.1|3558687_3560106_-	dnaB-like helicase N terminal domain protein	NA	Q716D2	Shigella_phage	88.0	5.3e-231
AWZ96660.1|3560110_3560908_-	putative gene O protein	NA	F1C5C3	Cronobacter_phage	46.8	4.8e-64
AWZ98090.1|3561002_3561149_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ99880.1|3561238_3561805_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ98069.1|3561835_3562057_-	helix-turn-helix family protein	NA	M9NZA8	Enterobacteria_phage	100.0	3.5e-33
AWZ98041.1|3562174_3562885_+	repressor protein CI	NA	M9NZE3	Enterobacteria_phage	95.8	6.5e-129
AWZ96766.1|3562959_3563340_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ96857.1|3563381_3563564_-	hypothetical protein	NA	G8C7T7	Escherichia_phage	83.6	8.5e-17
AXA00028.1|3564644_3564824_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ97571.1|3565048_3565222_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ96989.1|3565218_3565377_+	hypothetical protein	NA	G8C7T3	Escherichia_phage	88.5	1.2e-19
AWZ97978.1|3565433_3565580_+	putative phage encoded cell division inhibitor protein	NA	G8C7T2	Escherichia_phage	100.0	5.0e-20
AWZ97538.1|3565656_3566694_+	hypothetical protein	NA	A0A077KCC0	Edwardsiella_phage	75.4	2.0e-38
AWZ96309.1|3566701_3566986_+	hypothetical protein	NA	G8C7T1	Escherichia_phage	89.4	1.4e-45
AXA00362.1|3567004_3567850_+	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	56.9	5.3e-69
AWZ96216.1|3567846_3568527_+	exonuclease	NA	M9NZE1	Enterobacteria_phage	95.1	1.2e-127
AWZ96559.1|3568598_3568952_+	hypothetical protein	NA	M9NYX4	Enterobacteria_phage	94.0	3.6e-56
AWZ98579.1|3568948_3569101_+	hypothetical protein	NA	T1SAR0	Salmonella_phage	46.2	9.6e-06
AWZ98149.1|3569097_3569757_+	MT-A70 family protein	NA	G8C7S6	Escherichia_phage	93.2	5.0e-123
AWZ99666.1|3569753_3569972_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ98877.1|3569968_3570580_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ98386.1|3570576_3570768_+	hypothetical protein	NA	A0A0P0ZC60	Stx2-converting_phage	61.0	1.3e-12
AWZ96732.1|3570859_3571075_+	phage/conjugal plasmid C-4 type zinc finger, TraR family protein	NA	M1FQT7	Enterobacteria_phage	62.9	5.0e-16
AWZ97889.1|3571074_3571530_+	hypothetical protein	NA	A0A2D2W6E9	Pectobacterium_phage	52.9	2.9e-37
AWZ97645.1|3571741_3572068_+	hypothetical protein	NA	K7PGV7	Enterobacterial_phage	81.9	5.0e-44
AXA00094.1|3572464_3573760_+|integrase	phage integrase family protein	integrase	Q20GI2	Phage_258-320	68.9	3.9e-180
3579235:3579251	attR	TGAATATCGCACCAACC	NA	NA	NA	NA
>prophage 13
CP030347	Enterobacter hormaechei strain AR_038 chromosome, complete genome	5018145	3657195	3667918	5018145		Bodo_saltans_virus(12.5%)	9	NA	NA
AWZ97408.1|3657195_3657807_+	phosphoribosyl-ATP diphosphatase	NA	A0A2H4UVM0	Bodo_saltans_virus	29.3	1.6e-14
AWZ96886.1|3657846_3658827_-	chain length determinant protein	NA	NA	NA	NA	NA
AWZ97239.1|3659021_3660026_+	NAD dependent epimerase/dehydratase family protein	NA	A0A2K9L0I7	Tupanvirus	29.0	4.3e-33
AWZ96703.1|3660075_3661242_-	nucleotide sugar dehydrogenase family protein	NA	A0A1J0FA55	Only_Syngen_Nebraska_virus	54.0	7.0e-112
AWZ97181.1|3661480_3662299_-	glucose-1-phosphate thymidylyltransferase	NA	I7I009	Enterobacteria_phage	60.8	7.8e-94
AWZ98181.1|3662362_3663349_-	dTDP-glucose 4,6-dehydratase	NA	A0A291LAD7	Escherichia_phage	53.2	2.7e-88
AWZ97695.1|3663537_3664944_-	6-phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.5	4.7e-38
AWZ96089.1|3665109_3666480_-	phosphoglucomutase/phosphomannomutase, C-terminal domain protein	NA	A0A127AWJ1	Bacillus_phage	27.7	2.0e-33
AWZ99674.1|3666589_3667918_-	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	30.2	1.1e-49
>prophage 14
CP030347	Enterobacter hormaechei strain AR_038 chromosome, complete genome	5018145	3927985	4007346	5018145	tRNA,integrase,capsid,tail,portal,protease,terminase,head	Enterobacteria_phage(28.89%)	87	3968921:3968936	4004573:4004588
AWZ96189.1|3927985_3928798_-|tRNA	tRNA pseudouridine(38-40) synthase	tRNA	NA	NA	NA	NA
AWZ99406.1|3928797_3929811_-	semialdehyde dehydrogenase, dimerization domain protein	NA	NA	NA	NA	NA
AWZ96152.1|3929877_3931014_-	D-isomer specific 2-hydroxyacid dehydrogenase, NAD binding domain protein	NA	A0A2R8FDS8	Brazilian_cedratvirus	27.3	2.3e-19
AWZ97743.1|3931125_3932130_+	flagellar regulator flk	NA	NA	NA	NA	NA
AWZ99470.1|3932215_3933394_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ96789.1|3933461_3934679_-	3-oxoacyl-[acyl-carrier-protein] synthase 1	NA	NA	NA	NA	NA
AWZ99343.1|3934837_3936835_+|tRNA	tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC	tRNA	NA	NA	NA	NA
AXA00445.1|3936893_3937172_-	yfcL family protein	NA	NA	NA	NA	NA
AXA00090.1|3937185_3937731_-	elongation factor P hydroxylase	NA	NA	NA	NA	NA
AWZ97173.1|3937730_3938540_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
AWZ97287.1|3938539_3939364_-	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
AWZ97009.1|3939366_3940452_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	46.9	8.5e-88
AWZ99459.1|3940512_3941445_-	protein-(glutamine-N5) methyltransferase, ribosomal protein L3-specific	NA	NA	NA	NA	NA
AWZ98514.1|3941590_3942142_+	smr domain protein	NA	NA	NA	NA	NA
AXA00396.1|3942188_3942575_-	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
AWZ99712.1|3942883_3945031_-	fatty oxidation complex, alpha subunit FadJ	NA	NA	NA	NA	NA
AXA00085.1|3945030_3946341_-	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
AXA00527.1|3946569_3946812_-	hypothetical protein	NA	NA	NA	NA	NA
AXA00353.1|3947226_3948510_+	outer membrane transport family protein	NA	NA	NA	NA	NA
AWZ98474.1|3948552_3949305_-	putative phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
AXA00148.1|3949619_3950549_+	inner membrane protein YfdC	NA	E7DYY8	Enterobacteria_phage	83.6	4.1e-139
AWZ95807.1|3950810_3951077_+	dinI-like family protein	NA	K7PKR6	Enterobacteria_phage	93.2	6.8e-39
AWZ97083.1|3951118_3952417_-|tail	putative tail fiber	tail	G8C7K5	Escherichia_phage	66.0	2.7e-149
AWZ98804.1|3952475_3952709_-	putative conversion resistant protein Cor	NA	E4WL42	Enterobacteria_phage	78.9	3.9e-30
AWZ98518.1|3952816_3953488_-	hypothetical protein	NA	A0A2P0WA07	Enterobacter_phage	73.1	5.8e-87
AWZ99866.1|3953847_3957408_-	hypothetical protein	NA	Q9MCU0	Escherichia_phage	70.6	0.0e+00
AWZ97818.1|3957460_3958048_-|tail	bacteriophage lambda tail assembly I family protein	tail	A0A1P8DTG7	Proteus_phage	47.9	3.6e-48
AWZ96692.1|3958047_3958758_-	hypothetical protein	NA	F1C573	Cronobacter_phage	70.2	1.3e-97
AWZ99371.1|3958760_3959519_-|tail	phage minor tail protein L	tail	A0A1W6JNX9	Morganella_phage	64.0	1.0e-95
AWZ98465.1|3959515_3959854_-|tail	phage minor tail family protein	tail	K7PKL8	Enterobacterial_phage	59.8	4.3e-38
AWZ97048.1|3959856_3963348_-|tail	phage tail tape measure protein, lambda family	tail	A0A2H4JHR1	uncultured_Caudovirales_phage	86.8	0.0e+00
AWZ99628.1|3963394_3963631_-	hypothetical protein	NA	S4TR42	Salmonella_phage	92.3	5.8e-34
AWZ98211.1|3963785_3964046_-	hypothetical protein	NA	Q9MCS5	Enterobacteria_phage	97.7	4.2e-41
AWZ97411.1|3964072_3964456_-|tail	phage tail assembly chaperone family protein	tail	K7PKV6	Enterobacterial_phage	93.7	4.4e-63
AWZ99680.1|3964464_3964908_-|tail	phage tail family protein	tail	K7PHL2	Enterobacterial_phage	93.8	7.8e-72
AWZ96534.1|3965311_3965761_-	hypothetical protein	NA	K7P6X4	Enterobacteria_phage	98.0	1.1e-73
AWZ97295.1|3966104_3966431_-|head,tail	phage gp6-like head-tail connector family protein	head,tail	K7PKT4	Enterobacteria_phage	82.4	3.4e-48
AWZ97291.1|3966473_3967685_-|capsid	phage major capsid protein, HK97 family	capsid	K7PM57	Enterobacteria_phage	87.9	9.5e-197
AWZ98120.1|3967694_3968543_-|protease	clp protease family protein	protease	K7PH05	Enterobacteria_phage	91.8	9.2e-138
AWZ99542.1|3968556_3969861_-|portal	phage portal protein, HK97 family	portal	K7PJU5	Enterobacteria_phage	93.5	1.6e-234
3968921:3968936	attL	TGCGTCAGGAACTGGA	NA	NA	NA	NA
AWZ99593.1|3969860_3971618_-	phage Terminase family protein	NA	K7PKT2	Enterobacteria_phage	96.6	0.0e+00
AWZ99337.1|3971617_3971938_-|terminase	phage terminase, small subunit, P27 family	terminase	K7PHI2	Enterobacteria_phage	98.1	2.6e-53
AWZ96954.1|3972598_3973018_-	putative glycosyl transferase	NA	S4TR53	Salmonella_phage	79.0	1.8e-62
AWZ98172.1|3973170_3974628_-	putative glycosyl transferase	NA	K7PKP3	Enterobacterial_phage	93.2	2.0e-278
AWZ97661.1|3975223_3975400_-	hypothetical protein	NA	K7PM01	Enterobacterial_phage	95.5	8.8e-19
AWZ99068.1|3975368_3975644_-	hypothetical protein	NA	K7PGW4	Enterobacterial_phage	96.0	9.3e-07
AWZ97526.1|3975640_3976183_-	glycosyl hydrolase 108 family protein	NA	A0A0U2I1S0	Escherichia_phage	73.2	2.3e-78
AWZ98935.1|3976288_3976420_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ97055.1|3977248_3977893_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ99210.1|3977879_3977996_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ99715.1|3978306_3979263_-	hypothetical protein	NA	K7PJS6	Enterobacterial_phage	91.8	7.3e-176
AWZ99193.1|3979292_3979694_-	phage antirepressor KilAC domain protein	NA	G0ZND1	Cronobacter_phage	57.7	2.8e-36
AWZ97584.1|3980033_3980234_-	endodeoxyribonuclease RusA family protein	NA	K7PKN5	Enterobacterial_phage	87.3	1.5e-27
AWZ98446.1|3980419_3980743_-	lexA DNA binding domain protein	NA	K7PHB4	Enterobacterial_phage	90.4	4.1e-46
AWZ97910.1|3980739_3981399_-	MT-A70 family protein	NA	I6PDF5	Cronobacter_phage	77.9	2.3e-96
AWZ96736.1|3981398_3981599_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ97296.1|3981584_3981821_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ96894.1|3981889_3982717_-	conserved phage family protein	NA	U5P0A0	Shigella_phage	80.7	6.8e-29
AWZ99733.1|3983100_3983661_-	putative e14 prophage DNA-binding transcriptional regulator	NA	A5LH68	Enterobacteria_phage	51.6	9.3e-46
AWZ97080.1|3984014_3984722_+	peptidase S24-like family protein	NA	G8C7U1	Escherichia_phage	70.1	4.3e-80
AWZ99408.1|3984769_3985204_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ97739.1|3986634_3986883_+	hypothetical protein	NA	K7PJS4	Enterobacterial_phage	84.1	1.2e-29
AWZ98596.1|3986882_3987710_+	hypothetical protein	NA	K7PKM7	Enterobacterial_phage	85.6	1.5e-121
AWZ95886.1|3987706_3988135_+	hypothetical protein	NA	M9NZE4	Enterobacteria_phage	53.2	4.6e-21
AWZ95897.1|3988307_3988652_+	hypothetical protein	NA	K7PGV7	Enterobacterial_phage	74.3	2.7e-40
AWZ97652.1|3988731_3989001_+	hypothetical protein	NA	K7PKM4	Enterobacterial_phage	74.2	1.5e-30
AXA00406.1|3989271_3990414_+|integrase	phage integrase family protein	integrase	O21929	Phage_21	49.0	1.4e-93
AXA00243.1|3990633_3991134_+|tRNA	ybaK / prolyl-tRNA synthetases associated domain protein	tRNA	NA	NA	NA	NA
AWZ96312.1|3991154_3991331_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ99466.1|3991542_3992874_+	inner membrane symporter YicJ	NA	NA	NA	NA	NA
AXA00477.1|3992889_3994926_+	glycosyl hydrolases 31 family protein	NA	NA	NA	NA	NA
AWZ99366.1|3995059_3995479_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ98997.1|3995462_3996254_-	bacterial regulatory helix-turn-helix, AraC family protein	NA	NA	NA	NA	NA
AWZ97071.1|3996353_3997541_+	cyanate transporter family protein	NA	NA	NA	NA	NA
AWZ99185.1|3997572_3998280_-	glutamine amidotransferase class-I family protein	NA	NA	NA	NA	NA
AWZ98866.1|3998449_3998776_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ96884.1|3998776_3999082_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ95724.1|3999162_3999417_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ97728.1|3999728_4000757_+	putative diguanylate cyclase YeaP	NA	G3MA91	Bacillus_virus	31.4	2.5e-12
AWZ99453.1|4001029_4001278_-	transglycosylase associated family protein	NA	NA	NA	NA	NA
AWZ98209.1|4001599_4001740_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ99923.1|4001864_4003364_+	EAL domain protein	NA	NA	NA	NA	NA
AWZ96463.1|4003368_4003614_-	hypothetical protein	NA	NA	NA	NA	NA
AXA00230.1|4003689_4004940_-	isocitrate dehydrogenase, NADP-dependent	NA	Q77Z09	Phage_21	94.4	7.9e-21
4004573:4004588	attR	TCCAGTTCCTGACGCA	NA	NA	NA	NA
AXA00306.1|4005057_4005720_+	pseudouridine synthase family protein	NA	NA	NA	NA	NA
AWZ96493.1|4005719_4006193_+	phosphatase NudJ	NA	NA	NA	NA	NA
AWZ99430.1|4006233_4007346_+|tRNA	tRNA (5-methylaminomethyl-2-thiouridylate)-methyltransferase	tRNA	NA	NA	NA	NA
>prophage 1
CP030345	Enterobacter hormaechei strain AR_038 plasmid unnamed1	152715	6742	48494	152715	transposase,integrase	Escherichia_phage(31.82%)	38	4462:4475	49826:49839
4462:4475	attL	GCCCTGGTGAACAG	NA	NA	NA	NA
AWZ95578.1|6742_7453_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	42.5	2.2e-15
AWZ95658.1|7611_7866_+	antitoxin RelB	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	48.8	1.5e-11
AWZ95622.1|7855_8146_+	mRNA interferase RelE	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	61.1	3.0e-24
AWZ95602.1|8318_9023_-|integrase	integrase core domain protein	integrase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
AWZ95598.1|9073_9841_+	initiator Replication family protein	NA	A0A218MNI2	uncultured_virus	43.5	1.8e-47
AWZ95663.1|10808_11633_-	phosphotransferase enzyme family protein	NA	NA	NA	NA	NA
AWZ95672.1|11748_13224_-	ABC transporter family protein	NA	A0A1B0RXA0	Streptococcus_phage	59.0	2.3e-160
AWZ95646.1|13622_14744_-|transposase	transposase DDE domain protein	transposase	A0A0F7LAS3	uncultured_marine_virus	35.4	3.3e-50
AWZ95595.1|15522_16296_-	16S rRNA methylase	NA	NA	NA	NA	NA
AWZ95579.1|16621_17359_-|transposase	transposase DDE domain protein	transposase	A0A1V0E8E1	Vibrio_phage	60.2	5.8e-80
AWZ95669.1|17694_18927_-|transposase	transposase family protein	transposase	NA	NA	NA	NA
AWZ95676.1|19640_20480_-	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
AWZ95649.1|21056_21851_+	beta-lactamase NDM-1	NA	NA	NA	NA	NA
AWZ95600.1|21854_22220_+	bleomycin resistance protein	NA	NA	NA	NA	NA
AWZ95588.1|22224_22863_+	N-(5'phosphoribosyl)anthranilate (PRA) isomerase family protein	NA	NA	NA	NA	NA
AWZ95682.1|22873_23536_-	disulfide bond corrector DsbC family protein	NA	NA	NA	NA	NA
AWZ95616.1|23778_25011_-|transposase	transposase family protein	transposase	NA	NA	NA	NA
AWZ95555.1|25724_26564_-	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
AWZ95627.1|27068_27860_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ95650.1|27917_28040_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ95613.1|28909_29923_+|integrase	integron integrase family protein	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
AWZ95581.1|30038_30743_-|transposase	transposase IS66 family protein	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AWZ95586.1|31041_31836_+	aminoglycoside 3-N-acetyltransferase family protein	NA	NA	NA	NA	NA
AWZ95635.1|33069_33315_+	putative membrane protein	NA	NA	NA	NA	NA
AWZ95660.1|33401_34502_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ95659.1|34616_35987_+|transposase	transposase DDE domain protein	transposase	NA	NA	NA	NA
AWZ95540.1|36807_37668_+	beta-lactamase TEM	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
AWZ95565.1|38074_38452_-|transposase	putative transposase	transposase	Q71TF0	Escherichia_phage	88.8	1.5e-60
AWZ95624.1|38496_38724_-	insA N-terminal domain protein	NA	Q71TE9	Escherichia_phage	96.0	3.5e-36
AWZ95684.1|38923_40408_-	reverse transcriptase family protein	NA	A0A0U4J920	Pseudomonas_phage	35.5	9.1e-32
AWZ95617.1|40816_41248_+	protein UmuD	NA	A0A1W6JNS2	Morganella_phage	53.3	1.6e-29
AWZ95537.1|41394_42519_+	impB/mucB/samB family protein	NA	F1C5A5	Cronobacter_phage	61.6	5.5e-130
AWZ95569.1|42600_43575_-	parB	NA	Q38420	Escherichia_phage	54.4	2.6e-88
AWZ95661.1|43574_44780_-	plasmid partition protein A	NA	A0A077SL49	Escherichia_phage	69.6	2.4e-163
AWZ95679.1|45194_45464_+	LWamide neuropeptides domain protein	NA	NA	NA	NA	NA
AWZ95585.1|45819_46647_-	initiator Replication family protein	NA	A0A222YYK1	Escherichia_phage	31.1	1.5e-23
AWZ95623.1|47543_47711_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ95542.1|47768_48494_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	92.9	6.0e-53
49826:49839	attR	CTGTTCACCAGGGC	NA	NA	NA	NA
>prophage 2
CP030345	Enterobacter hormaechei strain AR_038 plasmid unnamed1	152715	58606	107286	152715	holin,transposase,integrase	Escherichia_phage(33.33%)	39	67578:67637	100102:102578
AWZ95657.1|58606_59644_-|integrase	integrase core domain protein	integrase	A0A1B1P773	Bacillus_phage	39.5	4.7e-51
AWZ95639.1|60707_61595_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ95662.1|62601_63087_+|transposase	transposase IS116/IS110/IS902 family protein	transposase	NA	NA	NA	NA
AWZ95638.1|63370_65359_+	AAA ATPase domain protein	NA	NA	NA	NA	NA
AWZ95544.1|65355_67140_+	uvrD/REP helicase N-terminal domain protein	NA	A7KV33	Bacillus_phage	26.8	9.6e-20
67578:67637	attL	GGCACTGTTGCAAAGTTAGCGATGAGGCAGCCTTTTGTCTTATTCAAAGGCCTTACATTT	NA	NA	NA	NA
AWZ95675.1|67629_68334_-|integrase	integrase core domain protein	integrase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AWZ95593.1|68380_69862_-|transposase	tn3 transposase DDE domain protein	transposase	Q1MVP5	Enterobacteria_phage	99.8	1.5e-284
AWZ95574.1|70715_70988_+	cupin fold metallo, WbuC family protein	NA	NA	NA	NA	NA
AWZ95628.1|71034_71910_-	beta-lactamase CTX-M-1	NA	A0A1B0VBP7	Salmonella_phage	82.4	1.1e-125
AWZ95570.1|72374_73079_+|integrase	integrase core domain protein	integrase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AWZ95561.1|73710_74541_-	beta-lactamase OXA-1	NA	NA	NA	NA	NA
AWZ95589.1|75369_76074_-	DDE domain protein	NA	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AWZ95559.1|76124_77654_+|transposase	tn3 transposase DDE domain protein	transposase	A0A1B0V7H9	Salmonella_phage	100.0	1.4e-293
AWZ95688.1|77724_78096_+	endonuclease	NA	A0A1B2LRT6	Wolbachia_phage	38.2	1.3e-16
AWZ95606.1|78791_79667_+	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
AWZ95535.1|80525_80681_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ95685.1|80774_81659_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ95582.1|81718_82003_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ95590.1|82091_82385_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ95551.1|82384_82990_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ95552.1|83025_83598_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ95678.1|84726_85599_-	restriction endonuclease family protein	NA	NA	NA	NA	NA
AWZ95644.1|86623_88057_+	DNA (cytosine-5-)-methyltransferase family protein	NA	E5E3X6	Burkholderia_phage	51.6	4.9e-107
AWZ95686.1|88091_89300_-	type-2 restriction enzyme EcoRII	NA	E5E3X4	Burkholderia_phage	41.9	4.6e-34
AWZ95594.1|89655_90213_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ95614.1|91036_92314_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ95665.1|92377_94075_-|holin	transporter, betaine/carnitine/choline transporter family protein	holin	A0A2I7QNT1	Vibrio_phage	26.2	2.7e-19
AWZ95571.1|94664_95084_-	putative DNA-invertase from lambdoid prophage Rac	NA	I1ZBD6	Salisaeta_icosahedral_phage	34.6	5.0e-12
AWZ95541.1|96066_96666_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ95556.1|96927_97632_+	DDE domain protein	NA	A0A077SL39	Escherichia_phage	99.6	1.2e-138
AWZ95601.1|97876_99358_+|transposase	tn3 transposase DDE domain protein	transposase	Q1MVP5	Enterobacteria_phage	99.8	1.5e-284
AWZ95673.1|99404_100109_+|transposase	transposase IS66 family protein	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AWZ95599.1|101467_101686_-	hypothetical protein	NA	Q1MVP5	Enterobacteria_phage	100.0	4.4e-36
AWZ95605.1|101849_102407_+	transposon Tn3 resolvase	NA	Q1MVP4	Enterobacteria_phage	98.4	2.0e-93
AWZ95619.1|103264_104053_+	hypothetical protein	NA	NA	NA	NA	NA
100102:102578	attR	AAATGTAAGGCCTTTGAATAAGACAAAAGGCTGCCTCATCGCTAACTTTGCAACAGTGCCTTCTGAAGAGTCCAAGGAATCAAACTTGAACAACAAAAATAGGTTATATGAAAGCATCATCATTTGAAACACGGCTTCATTCGCCCAAAATGACTTTAGCAAGAGATGACCCACCGCCATGTCGTATTTGGCTTCTTTGATATAGTTTTCAGCATTACCACGCTTTTCATAGTATATAACTACTTTTTCAGAAAGCAAGGTAGTATTTGTTACAAAGAAAAAGTAGTCGTATTCGGAACCTTCTAAAAGTGATAATTGTGCTCTTTCTTTTTCTGGTTTCAGTACGCGAGATACGACAAATCTTCTGTCTTTTTCCCATTTAACTAATTTTGTATACAGTTCTGTAGTTTCTCTACCTTCTTCTCCTTTAACGAATACAATTGATGAATTCGTTGCTTGTGAGGTGAGTGTAGAATAACTTTTGGCTTTAATTAAATATTTGCATCCAAGAGATTCTATCGTTTCGATAATTTTTTCATCAAAGTAGCCACTATCCATTCGAAATAAAATTTCTAAATCGTCTGATTTGATGTTAGCAACAATTTCTTTGATCATTTCCGCAGCACCGTTTGCAGTGTAAGTATTGCCACTTCTTACAAATCCGGTAACATATGCTTTTAATTCGTCGCAAAATGCAAATTGGATATTGTAGCATCGGTTTCCCAGTTTCTTAGGATTATATCCTTTTGACGCACCTTCTTGATGACCTTCTACGTTAATTACACTACTATCAATATCAATCGTAATGGATGTCAATTTACTTTTAGTGAGCAGTTTTTTAAAGACTTTAAAATTAATGTCTCTAAACATTTGGGTTGTCTTGAAGTTGAAGTTTCCTAGAAACCGTGACACTGTTTCAGGTTCTTTTACGGAAATATCAAACTCGTTGACGAGGGGATCATTTTGAAGTAGCTTTAGACGTTCTAACTTATCAATGCCAATGAAGTGACCGCAGAGCATGGTCTTTATATGATTCATCTTGATTTTATTTGTTGAGTCATTATCAAATACGAGGTCATTTTCAATAAAATCAAAAATCCCATTGCTTTTTGCATTCTCAAGGAGCAGAAAAAGACCTGCATTTGATGTTAGATTCTTAGCTTTGAAATCAATTTTATTAATCATAATTAGAACCCCTTTTTACTACTTTTCTTACTATTATTTTACCATATATCGAGTCATAAAAGCTGATAATTTAACATATTTTTGAGCACTTTTCTTTCACCCAATGGGTGAAAGCTGAATTTCGAAGGAATGCATATTTATCAAGGCTTTGATTATGCTTTTTGAAGTACTGACGTAGAATCTAGGTATGATTCATATCGGTGAGGAAGGTGCCCAGAAAACGGACACATCCAATTTGCAGGGCAATGCCCAGACGGTTGTGATCACCTCTGCTTTTTCCGATAAATTCCTTGTCTGCTTCATCAAGGTGAAAATATCGTGCCAGCTGAAGCTCATCCGGTTCACCGGTGAATCTGCCATAGCTTTCAGTCTGCTCAGTGGTCAGAAAGTCAACGGGCATATCGGCCTCCCTGCCTGACGGGCATTTAGTAACATTTTTCCAACCGTACGAAATGTTATAAATTATCAGACATAGTAAAACGGCTTCGTTTGAGTGTCCATTAAATCGTCATTTTGGCATAATAGACACATCGTGTCTGATATTCGATTTAAGGTACATTTTTATGCGAATTTTTGGTTATGCGCGGGTCTCAACCAGCCAGCAGTCCCTCGATATTCAGATCAGAGCGCTCAAAGATGCAGGGGTAAAAGCTAACCGCATCTTTACCGACAAGGCATCCGGCAGTTCAACAGATCGGGAAGGGCTGGATTTGCTGAGGATGAAGGTGGAGGAAGGTGATGTCATTCTGGTGAAGAAGCTCGACCGTCTTGGCCGCGACACCGCCGACATGATCCAACTGATAAAAGAGTTTGATGCTCAGGGTGTAGCGGTTCGGTTTATTGACGACGGGATCAGTACCGACGGTGATATGGGGCAAATGGTGGTCACCATCCTGTCGGCTGTGGCACAGGCTGAACGCCGGAGGATCCTAGAGCGCACGAATGAGGGCCGACAGGAAGCAAAGCTGAAAGGAATCAAATTTGGCCGCAGGCGTACCGTGGACAGGAACGTCGTGCTGACGCTTCATCAGAAGGGCACTGGTGCAACGGAAATTGCTCATCAGCTCAGTATTGCCCGCTCCACGGTTTATAAAATTCTTGAAGACGAAAGGGCCTCGTGATACGCCTATTTTTATAGGTTAATGTCATGATAATAATGGTTTCTTAGACGTCAGGTGGCACTTTTCGGGGAAATGTGCGCGGAACCCCTATTTGTTTATTTTTCTAAATACATTCAAATATGTATCCGCTCATGAGACAATAACCCTGATAAATGCTTCAATAATATTGAA	NA	NA	NA	NA
AWZ95546.1|104136_104937_+	penicillin binding transpeptidase domain protein	NA	NA	NA	NA	NA
AWZ95604.1|105331_105454_+	helix-turn-helix domain of resolvase family protein	NA	Q1MVP4	Enterobacteria_phage	97.5	1.0e-13
AWZ95625.1|105792_106716_-|transposase	transposase DDE domain protein	transposase	Q9MCT5	Escherichia_phage	99.3	1.1e-176
AWZ95566.1|106908_107286_-|transposase	putative transposase	transposase	Q71TF0	Escherichia_phage	93.6	1.9e-63
>prophage 3
CP030345	Enterobacter hormaechei strain AR_038 plasmid unnamed1	152715	128658	134534	152715	integrase	uncultured_Caudovirales_phage(33.33%)	7	123361:123375	129374:129388
123361:123375	attL	CTTATGTATTACATA	NA	NA	NA	NA
AWZ95583.1|128658_129369_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	42.5	2.2e-15
AWZ95591.1|129527_129782_+	antitoxin RelB	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	48.8	1.5e-11
129374:129388	attR	CTTATGTATTACATA	NA	NA	NA	NA
AWZ95677.1|129771_130062_+	mRNA interferase RelE	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	61.1	3.0e-24
AWZ95640.1|130234_130939_-	DDE domain protein	NA	A0A077SL39	Escherichia_phage	99.6	1.2e-138
AWZ95645.1|130989_131757_+	initiator Replication family protein	NA	A0A218MNI2	uncultured_virus	43.5	1.8e-47
AWZ95560.1|132825_133548_-	phosphotransferase enzyme family protein	NA	NA	NA	NA	NA
AWZ95539.1|133856_134534_-	putative aBC transporter ATP-binding protein	NA	A0A2I4R674	Erysipelothrix_phage	58.9	2.5e-53
>prophage 4
CP030345	Enterobacter hormaechei strain AR_038 plasmid unnamed1	152715	141541	146508	152715	transposase,integrase	Escherichia_phage(66.67%)	8	130989:131002	145800:145813
130989:131002	attL	TTTGCAACAGTGCC	NA	NA	NA	NA
AWZ95603.1|141541_142381_-	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
AWZ95626.1|142885_143677_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ95615.1|143731_143863_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ95558.1|144722_145736_+|integrase	integron integrase family protein	integrase	A0A1P8DJJ6	Virus_Rctr41k	40.8	1.5e-57
AWZ95671.1|145851_146037_-|transposase	putative transposase IS26	transposase	A0A077SL39	Escherichia_phage	98.2	1.2e-23
145800:145813	attR	GGCACTGTTGCAAA	NA	NA	NA	NA
AWZ95568.1|146018_146180_-	DDE domain protein	NA	A0A077SL39	Escherichia_phage	98.1	1.3e-24
AWZ95536.1|146176_146326_-	DDE domain protein	NA	A0A077SL39	Escherichia_phage	100.0	2.0e-11
AWZ95576.1|146307_146508_-	putative p21 protein	NA	A0A077SL39	Escherichia_phage	100.0	3.4e-19
>prophage 1
CP030350	Enterobacter hormaechei strain AR_038 plasmid unnamed5, complete sequence	106698	76014	81863	106698	transposase	Shigella_phage(50.0%)	8	NA	NA
AXA00671.1|76014_76587_+	resolvase, N terminal domain protein	NA	M9Q1K0	Clostridium_phage	39.4	3.4e-19
AXA00668.1|76959_78015_+	hypothetical protein	NA	NA	NA	NA	NA
AXA00608.1|78101_78476_+	resolvase, N terminal domain protein	NA	A0A219YB42	Aeromonas_phage	43.6	2.8e-14
AXA00686.1|78794_79067_-	pentapeptide repeats family protein	NA	NA	NA	NA	NA
AXA00620.1|79818_80010_+|transposase	transposase family protein	transposase	Q76S41	Shigella_phage	72.2	3.2e-14
AXA00706.1|80049_80214_+|transposase	putative iS2 transposase	transposase	Q76S41	Shigella_phage	83.3	3.4e-17
AXA00612.1|80342_80999_+	HTH-like domain protein	NA	Q9ZXG3	Shigella_phage	70.3	1.8e-88
AXA00633.1|81047_81863_-	beta-lactamase TEM	NA	Q1MVP3	Enterobacteria_phage	63.3	3.6e-91
