The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP030331	Escherichia coli strain AR_452 chromosome, complete genome	4818472	843379	912058	4818472	tRNA,transposase,integrase	Escherichia_phage(29.41%)	63	892418:892477	906390:907008
AWZ70433.1|843379_844360_-|tRNA	tRNA-modifying protein YgfZ	tRNA	NA	NA	NA	NA
AWZ69371.1|844436_844610_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ68198.1|844602_844869_+	antitoxin CptB	NA	NA	NA	NA	NA
AWZ68523.1|844849_845257_+	toxin CptA	NA	NA	NA	NA	NA
AWZ72159.1|845296_845773_-	flavodoxin	NA	NA	NA	NA	NA
AWZ68680.1|845929_846826_+	tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	28.6	6.7e-30
AWZ71691.1|846850_847561_+	thioredoxin-like domain protein	NA	NA	NA	NA	NA
AWZ67947.1|847566_849300_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	28.5	3.2e-60
AWZ68157.1|849451_849607_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ70708.1|849607_850489_+	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	39.0	1.5e-05
AWZ71158.1|850498_852016_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.7	5.9e-87
AWZ70610.1|852058_852607_-	isopentenyl-diphosphate delta-isomerase	NA	NA	NA	NA	NA
AWZ72372.1|852729_852855_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ69966.1|852856_854155_-	putative purine permease YgfU	NA	Q9KX94	Enterobacteria_phage	27.3	1.8e-23
AWZ70534.1|854740_856660_+	glutamate synthase, small subunit domain protein	NA	NA	NA	NA	NA
AWZ70399.1|856659_857148_+	4Fe-4S dicluster domain protein	NA	NA	NA	NA	NA
AWZ70378.1|857183_858551_-	permease family protein	NA	A0A0R6PHV4	Moraxella_phage	73.1	2.1e-160
AWZ69419.1|858586_859903_-	guanine deaminase	NA	NA	NA	NA	NA
AWZ71319.1|859920_861135_-	uracil-xanthine permease family protein	NA	NA	NA	NA	NA
AWZ70179.1|861485_864356_-	molybdopterin-binding domain of aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
AWZ69395.1|864352_865132_-	FAD binding domain in molybdopterin dehydrogenase family protein	NA	NA	NA	NA	NA
AWZ70971.1|865182_866511_-	protein SsnA	NA	NA	NA	NA	NA
AWZ70318.1|866513_869612_-	putative selenate reductase, YgfK subunit	NA	NA	NA	NA	NA
AWZ69703.1|869933_870512_-	molybdenum hydroxylase accessory protein, YgfJ family	NA	NA	NA	NA	NA
AWZ68622.1|870905_871385_+	putative selenium-dependent hydroxylase accessory protein YqeC	NA	NA	NA	NA	NA
AWZ70648.1|871432_873058_+	xdhC Rossmann domain protein	NA	NA	NA	NA	NA
AWZ70395.1|873098_874031_-	carbamate kinase	NA	NA	NA	NA	NA
AWZ69466.1|874078_875464_-	dihydropyrimidinase	NA	NA	NA	NA	NA
AWZ68362.1|875516_876728_-	peptidase M20/M25/M40 family protein	NA	NA	NA	NA	NA
AWZ72067.1|876785_877982_-	diaminopropionate ammonia-lyase	NA	NA	NA	NA	NA
AWZ72431.1|878039_879227_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ68251.1|879705_881484_+	AAA domain family protein	NA	NA	NA	NA	NA
AWZ69002.1|881523_882003_-	2Fe-2S iron-sulfur cluster binding domain protein	NA	NA	NA	NA	NA
AWZ68003.1|881999_882878_-	FAD binding domain in molybdopterin dehydrogenase family protein	NA	NA	NA	NA	NA
AWZ69789.1|882888_885147_-	molybdopterin-binding domain of aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
AWZ70010.1|885600_886356_+	peptidase M23 family protein	NA	I2E8W3	Clostridium_phage	36.8	1.1e-12
AWZ71857.1|886741_888352_+	glycosyl hydrolases 15 family protein	NA	NA	NA	NA	NA
AWZ70294.1|888909_889431_+	type III secretion apparatus protein, YscQ/HrcQ family	NA	NA	NA	NA	NA
AWZ71639.1|889420_890086_+	type III secretion apparatus protein, YscR/HrcR family	NA	NA	NA	NA	NA
AWZ71794.1|890095_890281_+	bacterial export, 3 family protein	NA	NA	NA	NA	NA
AWZ70698.1|890356_891124_+	type III secretion apparatus protein SpaR/YscT/HrcT	NA	NA	NA	NA	NA
AWZ72418.1|891132_891864_+	surface presentation of antigens protein SpaS	NA	NA	NA	NA	NA
AWZ72497.1|891983_892253_+	flhB HrpN YscU SpaS family protein	NA	NA	NA	NA	NA
892418:892477	attL	GGGTAATGACTCCAACTTATTGATAGTGTTTTATGTTCAGATAATGCCCGATGACTTTGT	NA	NA	NA	NA
AWZ69991.1|892433_892937_-|transposase	putative transposase	transposase	Q71TF0	Escherichia_phage	100.0	1.5e-95
AWZ71105.1|893359_894199_+	dihydropteroate synthase	NA	NA	NA	NA	NA
AWZ68583.1|895002_895767_-	bacterial dnaA family protein	NA	A0A2L1IVB6	Escherichia_phage	35.4	2.7e-32
AWZ70069.1|895774_897298_-|integrase	integrase core domain protein	integrase	A0A2L1IVA1	Escherichia_phage	24.2	1.2e-15
AWZ71208.1|897420_898965_+|integrase	integrase core domain protein	integrase	A0A1B1P773	Bacillus_phage	34.6	1.0e-38
AWZ68142.1|899015_899876_-	bacterial TniB family protein	NA	NA	NA	NA	NA
AWZ69436.1|899878_901558_-|integrase	integrase core domain protein	integrase	NA	NA	NA	NA
AWZ71686.1|901632_902301_-	EAL domain protein	NA	NA	NA	NA	NA
AWZ72426.1|902336_902573_-	merE family protein	NA	NA	NA	NA	NA
AWZ72569.1|902569_902932_-	mercuric resistance transcriptional repressor protein MerD	NA	NA	NA	NA	NA
AWZ72381.1|902949_904644_-	mercuric reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.6	8.8e-39
AWZ71178.1|904695_905109_-	merC mercury resistance family protein	NA	NA	NA	NA	NA
AWZ72414.1|905153_905429_-	mercuric transport protein periplasmic component	NA	NA	NA	NA	NA
AWZ71426.1|905442_905793_-	merT mercuric transport family protein	NA	NA	NA	NA	NA
AWZ68566.1|905864_906299_+	hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
AWZ69158.1|906405_906909_-|transposase	putative transposase	transposase	Q71TF0	Escherichia_phage	100.0	1.5e-95
AWZ70703.1|907040_910046_-|transposase	tn3 transposase DDE domain protein	transposase	Q1MVP5	Enterobacteria_phage	100.0	0.0e+00
906390:907008	attR	GGGTAATGACTCCAACTTATTGATAGTGTTTTATGTTCAGATAATGCCCGATGACTTTGTCATGCAGCTCCACCGATTTTGAGAACGACAGCGACTTCCGTCCCAGCCGTGCCAGGTGCTGCCTCAGATTCAGGTTATGCCGCTCAATTCGCTGCGTATATCGCTTGCTGATTACGTGCAGCTTTCCCTTCAGGCGGGATTCATACAGCGGCCAGCCATCCGTCATCCATATCACCACGTCAAAGGGTGACAGCAGGCTCATAAGACGCCCCAGCGTCGCCATAGTGCGTTCACCGAATACGTGCGCAACAACCGTCTTCCGGAGCCTGTCATACGCGTAAAACAGCCAGCGCTGGCGCGATTTAGCCCCGACGTATCCCCACTGTTCGTCCATTTCCGCGCAGACGATGACGTCACTGCCCGGCTGTATGCGCGAGGTTACCGACTGCGGCCTGAGTTTTTTAAATGGCGGAAAATCGTGTTGAGGCCAACGCCCATAATGCGGGCGGTTGCCCGGCATCCAACGCCATTCATGGCCATATCAATGATTTTCTGGTGCGTACCGGGTTGAGAAGCGGTGTAAGTGAACTGCAGTTGCCATGTTTTACGGCAGTGAGAG	NA	NA	NA	NA
AWZ68788.1|910209_910767_+	transposon Tn3 resolvase	NA	Q1MVP4	Enterobacteria_phage	100.0	7.0e-94
AWZ68689.1|910949_911810_+	beta-lactamase TEM	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
AWZ71242.1|911920_912058_-	insA N-terminal domain protein	NA	Q71TE9	Escherichia_phage	100.0	4.0e-11
>prophage 2
CP030331	Escherichia coli strain AR_452 chromosome, complete genome	4818472	1049739	1056879	4818472		Escherichia_phage(83.33%)	6	NA	NA
AWZ68555.1|1049739_1050378_-	class II Aldolase and Adducin N-terminal domain protein	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
AWZ69876.1|1050374_1051637_-	hypothetical protein	NA	A0A077SLJ7	Escherichia_phage	61.7	5.7e-136
AWZ71223.1|1051633_1052542_-	NAD binding domain of 6-phosphogluconate dehydrogenase family protein	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
AWZ69722.1|1052737_1053505_+	deoR C terminal sensor domain protein	NA	A0A077SK06	Escherichia_phage	56.7	3.3e-70
AWZ72499.1|1053555_1054212_-	serine/threonine-protein phosphatase 2	NA	A0A222YWF0	Escherichia_phage	46.7	4.3e-50
AWZ70003.1|1054317_1056879_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.8	2.3e-30
>prophage 3
CP030331	Escherichia coli strain AR_452 chromosome, complete genome	4818472	1649469	1658899	4818472		Enterobacteria_phage(87.5%)	10	NA	NA
AWZ69082.1|1649469_1650396_+	CBS domain protein	NA	G3M9Y6	Bacillus_virus	30.8	1.7e-23
AWZ70383.1|1650400_1651132_+	putative osmoprotectant uptake system permease protein YehW	NA	NA	NA	NA	NA
AWZ70086.1|1651279_1652011_-	merR regulatory family protein	NA	Q9EYF2	Enterobacteria_phage	99.0	2.8e-111
AWZ70499.1|1652232_1653918_+	putative sensor-like histidine kinase YehU	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
AWZ70272.1|1653914_1654634_+	response regulator	NA	NA	NA	NA	NA
AWZ68403.1|1654680_1655151_+	hypothetical protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
AWZ72556.1|1655191_1655500_-	hypothetical protein	NA	Q9EYF5	Enterobacteria_phage	99.0	1.0e-46
AWZ68350.1|1655500_1655641_-	hypothetical protein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.7e-17
AWZ71305.1|1655765_1657766_-	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	96.0	0.0e+00
AWZ71604.1|1657762_1658899_-	VWA domain containing CoxE-like family protein	NA	Q9EYF7	Enterobacteria_phage	97.1	4.6e-161
>prophage 4
CP030331	Escherichia coli strain AR_452 chromosome, complete genome	4818472	1750241	1758649	4818472		Enterobacteria_phage(33.33%)	8	NA	NA
AWZ71550.1|1750241_1751636_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	31.9	1.4e-18
AWZ69892.1|1751810_1752704_+	regulatory protein GalF	NA	A0A127AW70	Bacillus_phage	42.0	1.0e-46
AWZ69650.1|1753075_1754161_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.2	2.1e-102
AWZ70253.1|1754160_1755060_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.5	1.1e-27
AWZ69617.1|1755117_1755993_+	glucose-1-phosphate thymidylyltransferase	NA	I7I009	Enterobacteria_phage	64.1	3.9e-107
AWZ69974.1|1755996_1757055_+	putative membrane protein	NA	NA	NA	NA	NA
AWZ70734.1|1757057_1757876_+	glycosyl transferase 2 family protein	NA	NA	NA	NA	NA
AWZ70702.1|1757830_1758649_+	hypothetical protein	NA	A0A2P0VMU2	Tetraselmis_virus	33.9	6.8e-29
>prophage 5
CP030331	Escherichia coli strain AR_452 chromosome, complete genome	4818472	1985030	2036360	4818472	tail,protease,holin,tRNA,transposase	Escherichia_phage(20.0%)	55	NA	NA
AWZ68506.1|1985030_1987091_+|protease	protease 2	protease	NA	NA	NA	NA
AWZ71367.1|1987087_1987750_-	exodeoxyribonuclease 10	NA	Q6UAU3	Klebsiella_phage	41.6	2.0e-07
AWZ71493.1|1987773_1988430_-	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
AWZ71376.1|1988531_1988762_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	1.3e-14
AWZ72240.1|1988900_1989275_+	protein YobA	NA	NA	NA	NA	NA
AWZ69386.1|1989278_1990151_+	inner membrane protein YebZ	NA	NA	NA	NA	NA
AWZ71218.1|1990166_1990505_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ68126.1|1990900_1991557_+	serine/threonine-protein phosphatase 1	NA	A0A222YWF0	Escherichia_phage	50.7	8.0e-57
AWZ69897.1|1991557_1991749_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ71778.1|1991853_1992090_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ69596.1|1992207_1993647_-	ribosomal RNA small subunit methyltransferase F	NA	NA	NA	NA	NA
AWZ72080.1|1993726_1996360_-	mce related family protein	NA	NA	NA	NA	NA
AWZ68852.1|1996328_1997567_-	inner membrane protein YebS	NA	NA	NA	NA	NA
AWZ71400.1|1997741_1998239_+	free methionine-R-sulfoxide reductase	NA	NA	NA	NA	NA
AWZ70306.1|1998335_1999034_+	proP effector	NA	NA	NA	NA	NA
AWZ68576.1|1999053_2001102_+|tail,protease	tail-specific protease	tail,protease	A0A0R6PIZ1	Moraxella_phage	33.5	6.8e-86
AWZ70173.1|2001293_2002175_+|protease	protease HtpX	protease	NA	NA	NA	NA
AWZ68288.1|2002220_2003594_-	sugar (and other) transporter family protein	NA	NA	NA	NA	NA
AWZ68782.1|2003770_2004562_+	transcriptional regulator KdgR	NA	NA	NA	NA	NA
AWZ72376.1|2004704_2004944_-	yobH-like family protein	NA	NA	NA	NA	NA
AWZ72326.1|2005102_2005246_+	protein MgrB	NA	NA	NA	NA	NA
AWZ70597.1|2005320_2005608_+	yebO-like family protein	NA	NA	NA	NA	NA
AWZ69388.1|2006276_2006420_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ70348.1|2006432_2006642_+	cold shock-like protein CspC	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
AWZ69363.1|2006807_2007617_+	23S rRNA (guanine(745)-N(1))-methyltransferase	NA	NA	NA	NA	NA
AWZ67967.1|2007613_2008180_-	putative manganese efflux pump MntP	NA	NA	NA	NA	NA
AWZ68488.1|2008608_2009067_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ69108.1|2009121_2009973_-	PTS system, mannose/fructose/sorbose, IID component family protein	NA	NA	NA	NA	NA
AWZ70903.1|2009985_2010786_-	PTS system, mannose/fructose/sorbose, IIC component family protein	NA	NA	NA	NA	NA
AWZ69444.1|2010848_2011820_-	PTS system mannose-specific EIIAB component	NA	NA	NA	NA	NA
AWZ72405.1|2012282_2013839_+	hypothetical protein	NA	A0A0R6PEZ3	Moraxella_phage	45.4	1.7e-41
AWZ71434.1|2013842_2015441_-	EAL domain protein	NA	NA	NA	NA	NA
AWZ70054.1|2015571_2016870_-	L-serine ammonia-lyase	NA	NA	NA	NA	NA
AWZ69450.1|2017119_2017698_-	NUDIX domain protein	NA	NA	NA	NA	NA
AWZ72519.1|2017701_2019063_-	aminodeoxychorismate synthase, component I	NA	S4VT78	Pandoravirus	33.4	3.4e-41
AWZ70979.1|2019136_2019316_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ70357.1|2019435_2019735_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ70822.1|2019985_2020102_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ69557.1|2020157_2020502_-	endoribonuclease L-PSP family protein	NA	NA	NA	NA	NA
AWZ70505.1|2020633_2022544_+	helicase C-terminal domain protein	NA	A0A127AW80	Bacillus_phage	31.9	4.5e-92
AWZ68891.1|2022601_2023297_+|tRNA	tRNA threonylcarbamoyl adenosine modification protein YeaZ	tRNA	NA	NA	NA	NA
AWZ69080.1|2023336_2023918_+	outer membrane lipo, Slp family protein	NA	NA	NA	NA	NA
AWZ68866.1|2024122_2025808_+	long-chain-fatty-acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	26.0	1.5e-35
AWZ69711.1|2025889_2027005_+	ribonuclease D	NA	NA	NA	NA	NA
AWZ70523.1|2027058_2028024_-	oxidoreductase FAD-binding domain protein	NA	NA	NA	NA	NA
AWZ69612.1|2028079_2029204_-	rieske domain protein	NA	NA	NA	NA	NA
AWZ72278.1|2029235_2030846_-|holin	transporter, betaine/carnitine/choline transporter family protein	holin	NA	NA	NA	NA
AWZ70947.1|2031096_2032182_-	tartrate dehydrogenase	NA	NA	NA	NA	NA
AWZ69179.1|2032284_2033208_+	HTH-type transcriptional regulator DmlR	NA	NA	NA	NA	NA
AWZ69609.1|2033334_2033973_+	leucine efflux protein	NA	NA	NA	NA	NA
AWZ71125.1|2034040_2034175_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ70512.1|2034145_2034505_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ68600.1|2034508_2034697_+	YoaG domain protein	NA	NA	NA	NA	NA
AWZ72201.1|2034924_2035077_-|transposase	putative transposase IS200 like protein	transposase	NA	NA	NA	NA
AWZ68197.1|2035151_2036360_+|transposase	transposase, IS605 OrfB family	transposase	A0A077SL42	Escherichia_phage	92.8	6.0e-207
>prophage 6
CP030331	Escherichia coli strain AR_452 chromosome, complete genome	4818472	2255141	2310005	4818472	head,capsid,lysis,portal,terminase,integrase,tail,holin,protease	Enterobacteria_phage(48.84%)	63	2252845:2252858	2265210:2265223
2252845:2252858	attL	GCGGCAATCAGCAT	NA	NA	NA	NA
AWZ69590.1|2255141_2257568_-	anaerobic dimethyl sulfoxide reductase, A subunit, DmsA/YnfE family protein	NA	A0A077SK27	Escherichia_phage	49.1	2.9e-213
AWZ71631.1|2257766_2258072_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ69951.1|2258266_2258890_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ71498.1|2258892_2259453_-	spermidine N(1)-acetyltransferase	NA	NA	NA	NA	NA
AWZ69271.1|2259487_2259829_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ70812.1|2259963_2260290_+	hypothetical protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
AWZ70388.1|2260495_2261710_+	mandelate racemase / muconate lactonizing enzyme, N-terminal domain protein	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
AWZ70125.1|2261721_2262741_+	zinc-binding dehydrogenase family protein	NA	E3SJ82	Synechococcus_phage	25.9	9.7e-17
AWZ69509.1|2262928_2264209_-|integrase	phage integrase family protein	integrase	B6DZ48	Enterobacteria_phage	62.6	1.7e-156
AWZ68495.1|2264243_2264495_-	hypothetical protein	NA	S4TND0	Salmonella_phage	50.0	2.2e-15
AWZ71619.1|2264567_2265950_-	exonuclease family protein	NA	A0A192Y6E0	Salmonella_phage	56.7	8.1e-59
2265210:2265223	attR	ATGCTGATTGCCGC	NA	NA	NA	NA
AWZ69802.1|2266063_2267038_-	putative exonuclease VIII	NA	NA	NA	NA	NA
AWZ68635.1|2267131_2267323_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ69276.1|2267319_2267508_-	dicB family protein	NA	NA	NA	NA	NA
AWZ69764.1|2267548_2267707_+	putative ybl82 protein	NA	NA	NA	NA	NA
AWZ69910.1|2268047_2268263_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ68486.1|2268292_2268421_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ71661.1|2268422_2268659_-	hypothetical protein	NA	M4QQ57	Salicola_phage	51.1	1.4e-06
AWZ68870.1|2268843_2269095_-	putative dNA-binding helix-turn-helix protein	NA	NA	NA	NA	NA
AWZ70989.1|2269655_2270054_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ70407.1|2270125_2271196_+	hypothetical protein	NA	A0A088CD36	Shigella_phage	64.6	4.7e-62
AWZ69341.1|2271236_2271659_+	hypothetical protein	NA	A0A0U2QQN3	Escherichia_phage	88.5	4.8e-63
AWZ70200.1|2272299_2273997_+|holin	transporter, betaine/carnitine/choline transporter family protein	holin	A0A2I7QNT1	Vibrio_phage	26.5	1.2e-19
AWZ70962.1|2274060_2275338_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ69633.1|2275468_2276350_-	bacterial regulatory helix-turn-helix, lysR family protein	NA	NA	NA	NA	NA
AWZ72227.1|2276346_2277039_-	chaC-like family protein	NA	NA	NA	NA	NA
AWZ70737.1|2277050_2278250_-	major Facilitator Superfamily protein	NA	NA	NA	NA	NA
AWZ68398.1|2279167_2279302_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ68191.1|2279645_2280623_+	hypothetical protein	NA	U5P0K4	Shigella_phage	55.6	1.4e-102
AWZ70619.1|2280743_2281010_+	endodeoxyribonuclease RusA family protein	NA	V5URS4	Shigella_phage	62.2	7.8e-19
AWZ69127.1|2281006_2281828_+	antitermination family protein	NA	K7P7B9	Enterobacteria_phage	58.6	2.1e-78
AWZ70909.1|2282728_2282860_+	hypothetical protein	NA	H6WZJ7	Escherichia_phage	100.0	3.7e-06
AWZ72311.1|2283805_2284201_+	tolA C-terminal family protein	NA	NA	NA	NA	NA
AWZ69320.1|2284452_2284668_+|lysis	lysis S family protein	lysis	A5LH82	Enterobacteria_phage	95.8	5.9e-33
AWZ68513.1|2284667_2285165_+	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	97.6	1.1e-90
AWZ69028.1|2285161_2285623_+|lysis	bacteriophage lysis family protein	lysis	A0A0K2FJD0	Enterobacteria_phage	98.0	2.7e-75
AWZ71408.1|2285654_2285948_-	lipoprotein bor	NA	K7PL54	Enterobacteria_phage	91.8	2.0e-44
AWZ70362.1|2286893_2287439_+|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	98.3	4.0e-94
AWZ72214.1|2287593_2289339_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.7	0.0e+00
AWZ72169.1|2289335_2289542_+|head,tail	head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	98.5	4.9e-29
AWZ68844.1|2289538_2291140_+|portal	phage portal protein, lambda family	portal	A0A0K2FJC0	Enterobacteria_phage	98.5	3.6e-308
AWZ72164.1|2291120_2292440_+|protease	clp protease family protein	protease	A0A2I6TC87	Escherichia_phage	97.5	3.4e-232
AWZ69209.1|2292449_2292782_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
AWZ72365.1|2292837_2293863_+|capsid	phage major capsid E family protein	capsid	C6ZCY2	Enterobacteria_phage	97.7	1.4e-188
AWZ69266.1|2293904_2294300_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	95.5	5.7e-58
AWZ71932.1|2294311_2294665_+|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	98.3	2.6e-62
AWZ69721.1|2294676_2295255_+|tail	prophage minor tail Z family protein	tail	A0A2R9YJK4	Escherichia_phage	99.5	3.5e-80
AWZ69565.1|2295251_2295647_+|tail	minor tail protein U	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
AWZ68305.1|2295654_2296395_+|tail	major tail protein V	tail	A0A0K2FJ05	Enterobacteria_phage	99.6	1.7e-132
AWZ72456.1|2296410_2296833_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	3.1e-70
AWZ71533.1|2296814_2297249_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	99.2	1.5e-64
AWZ68321.1|2297241_2299803_+|tail	phage tail tape measure protein, lambda family	tail	A0A2R9YJM8	Escherichia_phage	90.7	0.0e+00
AWZ69817.1|2299799_2300129_+|tail	phage minor tail family protein	tail	A0A0K2FIE9	Enterobacteria_phage	98.2	8.1e-58
AWZ70588.1|2300128_2300827_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.3	1.1e-131
AWZ69332.1|2300832_2301576_+	hypothetical protein	NA	K7PLW1	Enterobacteria_phage	97.6	2.3e-148
AWZ71952.1|2301572_2302145_+|tail	bacteriophage lambda tail assembly I family protein	tail	A0A0K2FJB0	Escherichia_phage	85.8	1.7e-79
AWZ68226.1|2302205_2305619_+|tail	phage tail family protein	tail	K7PKJ2	Enterobacteria_phage	97.8	0.0e+00
AWZ70096.1|2305688_2306288_+	enterobacterial Ail/Lom family protein	NA	A0A0P0ZCF6	Stx2-converting_phage	95.5	3.5e-107
AWZ72218.1|2306288_2306462_-	hypothetical protein	NA	Q6H9T0	Enterobacteria_phage	98.2	4.3e-26
AWZ70369.1|2306849_2307647_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ68238.1|2307622_2307757_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ68883.1|2307717_2309424_+|tail	phage tail fiber repeat family protein	tail	U5N099	Enterobacteria_phage	56.9	6.9e-76
AWZ71211.1|2309435_2310005_+|tail	caudovirales tail fiber assembly family protein	tail	K7PMH7	Enterobacteria_phage	94.1	3.9e-100
>prophage 7
CP030331	Escherichia coli strain AR_452 chromosome, complete genome	4818472	2972941	3090674	4818472	head,capsid,lysis,portal,terminase,transposase,integrase,tail,protease,tRNA,plate	Salmonella_phage(59.65%)	115	2965902:2965917	3061741:3061756
2965902:2965917	attL	GTTACCGCCATCGCCA	NA	NA	NA	NA
AWZ70966.1|2972941_2974234_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
AWZ68211.1|2974324_2975668_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.8	2.1e-80
AWZ68180.1|2975678_2976290_-	outer membrane lipocarrier protein LolA	NA	NA	NA	NA	NA
AWZ69894.1|2976444_2980512_-	ftsK/SpoIIIE family protein	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
AWZ72002.1|2980646_2981141_-	leucine-responsive regulatory protein	NA	NA	NA	NA	NA
AWZ68230.1|2981503_2981617_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ69852.1|2981685_2982651_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	8.5e-63
AWZ69479.1|2982773_2984540_+	thiol reductant ABC exporter, CydD subunit	NA	W8CYL7	Bacillus_phage	24.3	5.4e-23
AWZ69614.1|2984540_2986262_+	thiol reductant ABC exporter, CydC subunit	NA	W8CYL7	Bacillus_phage	25.2	1.9e-20
AWZ69333.1|2986303_2987008_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
AWZ70247.1|2987292_2987511_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
AWZ68837.1|2988195_2990472_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
AWZ70376.1|2990502_2990823_-|protease	ATP-dependent Clp protease adaptor ClpS family protein	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
AWZ70326.1|2991145_2991370_+	cold shock domain protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
AWZ70412.1|2991442_2993389_-	macrolide export ATP-binding/permease protein MacB	NA	G9BWD6	Planktothrix_phage	40.1	5.0e-38
AWZ70421.1|2993385_2994501_-	macrolide-specific efflux protein MacA	NA	NA	NA	NA	NA
AWZ72438.1|2994615_2995608_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ68915.1|2995604_2997263_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ71707.1|2997688_2998384_+	aquaporin Z	NA	NA	NA	NA	NA
AWZ70764.1|2998878_2999778_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ71364.1|2999921_3001574_+	hydroxylamine reductase	NA	NA	NA	NA	NA
AWZ72094.1|3001585_3002554_+	NADH oxidoreductase hcr	NA	NA	NA	NA	NA
AWZ68314.1|3002686_3004405_+	pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.0	5.2e-31
AWZ68691.1|3004441_3005443_+	low specificity L-threonine aldolase	NA	NA	NA	NA	NA
AWZ69353.1|3005453_3006884_+	NADH(P)-binding family protein	NA	NA	NA	NA	NA
AWZ70828.1|3006982_3007996_+	NAD dependent epimerase/dehydratase family protein	NA	NA	NA	NA	NA
AWZ72115.1|3007992_3008823_-	N-acetylmuramoyl-L-alanine amidase AmiD	NA	A0A1B0UZW5	Roseobacter_phage	30.0	5.7e-07
AWZ68027.1|3008819_3009143_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ68718.1|3009268_3009784_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ68572.1|3010001_3010730_+	ABC transporter family protein	NA	G9BWD6	Planktothrix_phage	36.7	6.0e-29
AWZ70287.1|3010747_3011479_+	lysine-arginine-ornithine-binding periplasmic family protein	NA	NA	NA	NA	NA
AWZ70744.1|3011485_3012202_+	amino ABC transporter, permease, 3-TM region, His/Glu/Gln/Arg/opine family domain protein	NA	NA	NA	NA	NA
AWZ69745.1|3012201_3012870_+	amino ABC transporter, permease, 3-TM region, His/Glu/Gln/Arg/opine family domain protein	NA	NA	NA	NA	NA
AWZ68087.1|3013161_3013893_+	lysine-arginine-ornithine-binding periplasmic family protein	NA	NA	NA	NA	NA
AWZ69006.1|3014067_3015195_-	23S rRNA (uracil-5-)-methyltransferase RumB	NA	A0A1X9I6F4	Streptococcus_phage	27.3	4.6e-28
AWZ70752.1|3015235_3015724_-	inner membrane protein YbjO	NA	NA	NA	NA	NA
AWZ68205.1|3015783_3016629_-	binding-protein-dependent transport system inner membrane component family protein	NA	NA	NA	NA	NA
AWZ69477.1|3016625_3017579_-	binding-protein-dependent transport system inner membrane component family protein	NA	NA	NA	NA	NA
AWZ70775.1|3017588_3018722_-	polyamine ABC transporter, ATP-binding family protein	NA	G3M9Y6	Bacillus_virus	33.5	4.2e-29
AWZ68169.1|3018816_3019929_-	bacterial extracellular solute-binding family protein	NA	NA	NA	NA	NA
AWZ68965.1|3020201_3020324_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ71214.1|3020280_3020757_-	bacterial sensory transduction regulator family protein	NA	NA	NA	NA	NA
AWZ70864.1|3020844_3021747_-	alpha-L-glutamate ligase, RimK family protein	NA	I3ULC9	Synechococcus_phage	34.4	2.6e-37
AWZ71747.1|3021807_3022530_-	oxygen-insensitive NADPH nitroreductase	NA	NA	NA	NA	NA
AWZ69872.1|3022513_3022801_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ70359.1|3022960_3023218_+	glutaredoxin, GrxA family	NA	A0A2I7SAE2	Vibrio_phage	61.9	8.6e-23
AWZ71485.1|3023247_3023625_-	inner membrane protein YbjM	NA	NA	NA	NA	NA
AWZ70241.1|3023894_3025580_+	aspT/YidE/YbjL antiporter duplication domain protein	NA	NA	NA	NA	NA
AWZ70790.1|3026757_3027858_-	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	88.3	1.0e-176
AWZ71000.1|3027854_3028340_-	phage P2 GpU family protein	NA	E5G6Q2	Salmonella_phage	80.6	3.7e-67
AWZ71508.1|3028336_3031414_-|tail	phage tail tape measure protein, TP901 family, core region	tail	E5G6Q1	Salmonella_phage	63.0	0.0e+00
AWZ68662.1|3031406_3031526_-	phage P2 GpE family protein	NA	E5G6Q0	Salmonella_phage	87.2	2.8e-13
AWZ69913.1|3031540_3031843_-	mu-like prophage FluMu gp41 family protein	NA	A0A1S6KZZ9	Salmonella_phage	89.0	5.3e-40
AWZ68462.1|3031897_3032413_-|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	94.7	4.8e-89
AWZ71670.1|3032422_3033595_-|tail	phage tail sheath family protein	tail	A0A1S6KZY7	Salmonella_phage	90.0	7.8e-204
AWZ70980.1|3033727_3034162_-|tail	caudovirales tail fiber assembly family protein	tail	A0A0F7LDZ0	Escherichia_phage	40.6	4.2e-22
AWZ68361.1|3034161_3035892_-|tail	phage tail fiber repeat family protein	tail	A0A0M3ULH6	Salmonella_phage	62.8	6.1e-80
AWZ72346.1|3035888_3036494_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	91.5	6.4e-109
AWZ72081.1|3036486_3037395_-|plate	baseplate J-like family protein	plate	A0A1S6KZY6	Salmonella_phage	90.1	5.0e-142
AWZ71904.1|3037381_3037741_-	lysozyme family protein	NA	A0A1S6KZZ4	Salmonella_phage	87.4	3.2e-52
AWZ71016.1|3037737_3038316_-|plate	phage baseplate assembly V family protein	plate	A0A1S6KZX7	Salmonella_phage	85.9	6.1e-93
AWZ68669.1|3038555_3039761_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ71356.1|3039747_3040200_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	88.6	8.5e-58
AWZ68692.1|3040192_3040624_-|tail	P2 phage tail completion R family protein	tail	E5G6N3	Salmonella_phage	94.4	4.4e-72
AWZ69958.1|3040719_3041148_-|lysis	phage lysis regulatory, LysB family protein	lysis	E5G6N2	Salmonella_phage	88.7	2.3e-57
AWZ70660.1|3041144_3041660_-	phage lysozyme family protein	NA	E5G6N1	Salmonella_phage	91.2	1.8e-88
AWZ69636.1|3041640_3041856_-	putative membrane protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
AWZ68284.1|3041859_3042063_-	phage Tail Protein X family protein	NA	E5G6M9	Salmonella_phage	91.0	6.8e-31
AWZ71532.1|3042062_3042527_-|head	phage head completion family protein	head	A0A1S6KZW8	Salmonella_phage	89.0	1.9e-76
AWZ70972.1|3042622_3043273_-|terminase	phage small terminase subunit	terminase	E5G6M7	Salmonella_phage	95.8	1.5e-111
AWZ69692.1|3043276_3044335_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.1	6.4e-181
AWZ69905.1|3044351_3045185_-|capsid	phage capsid scaffolding (GPO) serine peptidase family protein	capsid	A0A1S6KZW9	Salmonella_phage	88.8	1.8e-122
AWZ68332.1|3045327_3047094_+|terminase	terminase-like family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.3	0.0e+00
AWZ68372.1|3047093_3048128_+|portal	phage portal protein, PBSX family	portal	E5G6M3	Salmonella_phage	89.6	4.8e-173
AWZ71774.1|3048179_3049331_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ68648.1|3050358_3050583_-	dinI-like family protein	NA	E5G6M1	Salmonella_phage	100.0	3.6e-33
AWZ70042.1|3050593_3050782_-	putative levan regulatory protein	NA	E5G6M0	Salmonella_phage	96.8	1.6e-26
AWZ69074.1|3050934_3053349_-	bacteriophage replication protein A	NA	E5G6L9	Salmonella_phage	95.4	0.0e+00
AWZ70674.1|3053345_3054203_-	DNA adenine methylase family protein	NA	E5G6L8	Salmonella_phage	93.7	1.7e-155
AWZ71933.1|3054199_3054427_-	phage/conjugal plasmid C-4 type zinc finger, TraR family protein	NA	E5G6L7	Salmonella_phage	98.7	6.0e-36
AWZ68418.1|3054426_3054660_-	hypothetical protein	NA	E5G6L6	Salmonella_phage	97.4	1.1e-32
AWZ71471.1|3054727_3055069_-	putative fels-2 prophage protein	NA	E5G6L5	Salmonella_phage	99.1	4.6e-56
AWZ72187.1|3055032_3055233_-	protein fil	NA	E5G6L4	Salmonella_phage	97.0	2.1e-32
AWZ70471.1|3055240_3055750_-	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.2	1.3e-86
AWZ69559.1|3055776_3055929_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ69362.1|3056092_3057031_+	bacteriophage CI repressor helix-turn-helix domain protein	NA	A0A1S6KZZ7	Salmonella_phage	39.6	6.1e-34
AWZ72016.1|3057041_3058031_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ70968.1|3058117_3059170_+|integrase	phage integrase family protein	integrase	A0A218M4I3	Erwinia_phage	56.7	3.0e-106
AWZ69338.1|3059274_3059811_-	bacterial regulatory, tetR family protein	NA	NA	NA	NA	NA
AWZ71811.1|3059894_3061103_+	inner membrane protein YbjJ	NA	NA	NA	NA	NA
AWZ68730.1|3061102_3061918_+	flavine mononucleotide phosphatase YbjI	NA	NA	NA	NA	NA
3061741:3061756	attR	TGGCGATGGCGGTAAC	NA	NA	NA	NA
AWZ68946.1|3062009_3062288_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ71562.1|3062328_3063561_-	multidrug transporter MdfA	NA	NA	NA	NA	NA
AWZ70608.1|3063845_3064442_+	putative undecaprenyl-diphosphatase YbjG	NA	NA	NA	NA	NA
AWZ71019.1|3064499_3065258_+	deoxyribose operon repressor	NA	NA	NA	NA	NA
AWZ71321.1|3065304_3066507_-	D-alanyl-D-alanine carboxypeptidase DacC	NA	B6DZZ7	Stx2-converting_phage	48.0	8.2e-100
AWZ70144.1|3066753_3067380_+	glutathione S-transferase GstB	NA	NA	NA	NA	NA
AWZ70482.1|3067376_3068492_-	soluble aldose sugar dehydrogenase YliI	NA	NA	NA	NA	NA
AWZ71743.1|3068602_3068986_-	biofilm formation family protein	NA	NA	NA	NA	NA
AWZ71665.1|3069198_3070524_+	ribosomal protein S12 methylthiotransferase RimO	NA	NA	NA	NA	NA
AWZ70696.1|3070570_3071899_-	diguanylate cyclase domain protein	NA	NA	NA	NA	NA
AWZ71829.1|3071906_3074255_-	putative cyclic di-GMP phosphodiesterase YliE	NA	NA	NA	NA	NA
AWZ71522.1|3074432_3075344_-	glutathione transport system permease protein GsiD	NA	NA	NA	NA	NA
AWZ71675.1|3075346_3076267_-	glutathione transport system permease protein GsiC	NA	NA	NA	NA	NA
AWZ71337.1|3076284_3077823_-	glutathione-binding protein GsiB	NA	NA	NA	NA	NA
AWZ72445.1|3077842_3079714_-	nickel import ATP-binding protein NikD	NA	G9BWD6	Planktothrix_phage	29.7	4.0e-16
AWZ68119.1|3079700_3080666_-	isoaspartyl peptidase	NA	NA	NA	NA	NA
AWZ68491.1|3080869_3082105_+	molybdopterin molybdenumtransferase	NA	NA	NA	NA	NA
AWZ69126.1|3082104_3082854_+	molybdopterin synthase sulfurylase MoeB	NA	NA	NA	NA	NA
AWZ71775.1|3082929_3083592_-	fructose-6-phosphate aldolase	NA	A0A0E3HJ81	Synechococcus_phage	34.6	5.7e-26
AWZ70801.1|3083722_3084622_+	glycyl-radical enzyme activating family protein	NA	NA	NA	NA	NA
AWZ72208.1|3084627_3087060_+	glycyl radical enzyme, PFL2/glycerol dehydratase family protein	NA	A0A076YHZ7	Citrobacter_phage	43.5	6.1e-09
AWZ68130.1|3087205_3088021_+	sugar phosphatase YbiV	NA	NA	NA	NA	NA
AWZ69884.1|3088172_3089438_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ71721.1|3089693_3090674_-|transposase	transposase IS116/IS110/IS902 family protein	transposase	NA	NA	NA	NA
>prophage 8
CP030331	Escherichia coli strain AR_452 chromosome, complete genome	4818472	3655473	3714655	4818472	head,terminase,integrase,tail,holin	Salmonella_phage(39.06%)	83	3668031:3668078	3710752:3710799
AWZ71684.1|3655473_3656862_-	putative dNA transfer protein p33	NA	B6SCW4	Bacteriophage	52.6	3.5e-118
AWZ68326.1|3656894_3657572_-	DNA transfer protein gp7	NA	Q2A0B2	Sodalis_phage	71.6	9.2e-56
AWZ69201.1|3657565_3658027_-	hypothetical protein	NA	Q2A0B3	Sodalis_phage	72.2	2.9e-61
AWZ69813.1|3658043_3658205_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ72299.1|3658387_3658501_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ71766.1|3658789_3661546_-	hypothetical protein	NA	A0A1W6JPG0	Morganella_phage	57.3	1.8e-299
AWZ68453.1|3661532_3661904_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ71055.1|3661896_3662238_-	hypothetical protein	NA	A0A1B5FPL8	Escherichia_phage	61.5	2.5e-33
AWZ69586.1|3662248_3662851_-	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	36.3	2.6e-25
AWZ68765.1|3662843_3663065_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ68862.1|3663061_3663325_-|holin	putative second beta subunit of nicotinic acetylcholine receptor	holin	NA	NA	NA	NA
AWZ68927.1|3663321_3663516_-	putative prophage protein	NA	NA	NA	NA	NA
AWZ70385.1|3663508_3664576_-	ash family protein	NA	A0A1C9IHV9	Salmonella_phage	38.4	5.0e-16
AWZ70890.1|3664744_3665578_-	antA/AntB antirepressor family protein	NA	G9L6G1	Escherichia_phage	47.5	5.3e-21
AWZ70747.1|3665590_3665896_-	hypothetical protein	NA	A0A1W6JPH9	Morganella_phage	54.7	7.3e-21
AWZ69355.1|3666293_3666407_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ70120.1|3666652_3667867_-	hypothetical protein	NA	Q7M297	Enterobacteria_phage	56.5	9.7e-133
3668031:3668078	attL	AATGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
AWZ69465.1|3668355_3668526_+|integrase	integrase core domain protein	integrase	A0A1B0Z042	Pseudomonas_phage	70.0	8.2e-14
AWZ69712.1|3668567_3669311_-	bacterial regulatory helix-turn-helix, AraC family protein	NA	NA	NA	NA	NA
AWZ71754.1|3670135_3670909_+	hypothetical protein	NA	G9IA57	Pseudomonas_phage	38.5	2.4e-36
AWZ72541.1|3670969_3671524_-	resolvase, N terminal domain protein	NA	A0A1S6L009	Salmonella_phage	89.0	1.3e-87
AWZ69776.1|3671845_3671977_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ71737.1|3671955_3672375_+|tail	caudovirales tail fiber assembly family protein	tail	A0A0F7LDZ0	Escherichia_phage	54.4	2.9e-36
AWZ69478.1|3672346_3672949_-|tail	caudovirales tail fiber assembly family protein	tail	M1SV83	Escherichia_phage	87.0	8.9e-95
AWZ69630.1|3672948_3673788_-	phage Tail Collar domain protein	NA	A0A0F7LCR3	Escherichia_phage	61.8	1.1e-50
AWZ72130.1|3673787_3674468_-	hypothetical protein	NA	A0A0M5M1K4	Salmonella_phage	77.9	3.8e-102
AWZ70902.1|3674464_3675664_-	hypothetical protein	NA	A0A0M4RD32	Salmonella_phage	83.1	4.1e-184
AWZ71267.1|3675663_3676017_-	putative bacteriophage protein	NA	A0A0M4R339	Salmonella_phage	90.6	3.1e-55
AWZ68812.1|3676016_3676772_-	putative translation initiation factor IF-2	NA	A0A0M5M1K7	Salmonella_phage	85.7	4.5e-112
AWZ71777.1|3676814_3677168_-	toxin YafO, type II toxin-antitoxin system family protein	NA	NA	NA	NA	NA
AWZ68014.1|3677232_3677805_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ71307.1|3677973_3678123_-	hypothetical protein	NA	A0A0M4RTY3	Salmonella_phage	95.8	2.7e-21
AWZ70552.1|3678326_3679394_-	hypothetical protein	NA	A0A0M4QX01	Salmonella_phage	81.1	1.6e-158
AWZ70645.1|3679396_3679699_-	hypothetical protein	NA	A0A0M4R5B7	Salmonella_phage	89.0	3.5e-47
AWZ71472.1|3679698_3680286_-	hypothetical protein	NA	A0A0M3ULD5	Salmonella_phage	88.5	5.8e-83
AWZ68659.1|3680285_3682274_-	putative lytic transglycosylase, catalytic	NA	A0A0M4REK7	Salmonella_phage	74.1	1.8e-269
AWZ69652.1|3682451_3682904_-	putative bacteriophage protein	NA	A0A0M4S6U8	Salmonella_phage	72.0	3.0e-55
AWZ68864.1|3682907_3683348_-	hypothetical protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	75.3	7.0e-57
AWZ68428.1|3683358_3684504_-	hypothetical protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	73.8	4.7e-161
AWZ70374.1|3684507_3685056_-	putative bacteriophage protein	NA	A0A0M4R331	Salmonella_phage	76.8	1.1e-80
AWZ72165.1|3685045_3685435_-	hypothetical protein	NA	A0A0M3ULK0	Salmonella_phage	96.1	1.1e-66
AWZ71166.1|3685421_3685976_-	hypothetical protein	NA	A0A0M4S631	Salmonella_phage	84.8	1.8e-81
AWZ71087.1|3685972_3686380_-	hypothetical protein	NA	A0A0M5M3S2	Salmonella_phage	94.1	1.1e-67
AWZ68175.1|3686345_3686567_-	hypothetical protein	NA	A0A0M4RTX5	Salmonella_phage	68.6	7.7e-12
AWZ69182.1|3686608_3687550_-	hypothetical protein	NA	A0A0M3ULD3	Salmonella_phage	86.9	6.3e-156
AWZ72432.1|3687561_3688068_-	hypothetical protein	NA	A0A0M4QWZ6	Salmonella_phage	79.9	2.9e-70
AWZ72312.1|3688071_3689292_-	hypothetical protein	NA	A0A0M4R5A6	Salmonella_phage	88.0	7.1e-200
AWZ68707.1|3689306_3689915_-|head	phage head morphogenesis, SPP1 gp7 family domain protein	head	A0A0M4REK0	Salmonella_phage	96.0	3.8e-109
AWZ71198.1|3689928_3691398_-	hypothetical protein	NA	A0A0M4S6U1	Salmonella_phage	94.7	1.5e-268
AWZ72095.1|3691397_3693020_-|terminase	phage terminase large subunit	terminase	A0A0M5M1R6	Salmonella_phage	95.4	3.0e-312
AWZ68188.1|3693022_3693574_-|terminase	terminase small subunit	terminase	G0ZND3	Cronobacter_phage	70.3	1.9e-67
AWZ68978.1|3693527_3694142_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ70285.1|3694274_3694460_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ71616.1|3694603_3694996_-	putative rz1 lytic protein	NA	U5P0U9	Shigella_phage	79.1	1.8e-48
AWZ68645.1|3694979_3695456_-	phage lysozyme family protein	NA	U5P0A9	Shigella_phage	95.6	1.6e-83
AWZ70631.1|3695442_3695748_-	putative membrane protein	NA	A0A286N2Q5	Klebsiella_phage	87.6	7.0e-40
AWZ70103.1|3696069_3696759_-	phage antitermination Q family protein	NA	I6PDF8	Cronobacter_phage	48.9	1.7e-57
AWZ71392.1|3696755_3696893_-	hypothetical protein	NA	K7PHH3	Enterobacteria_phage	72.1	1.3e-09
AWZ71425.1|3696892_3697255_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.6	1.5e-60
AWZ68708.1|3697251_3697542_-	hypothetical protein	NA	K7PGZ6	Enterobacteria_phage	92.7	9.6e-47
AWZ71808.1|3697534_3697705_-	putative protein ninE	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
AWZ69037.1|3697704_3698160_-	putative phage protein	NA	I6PD71	Cronobacter_phage	66.2	5.9e-59
AWZ69405.1|3698451_3698565_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ71797.1|3698799_3699360_-	putative uDP-N-acetylglucosamine acyltransferase	NA	NA	NA	NA	NA
AWZ69993.1|3699847_3700003_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ69682.1|3700134_3700836_-	replication P family protein	NA	K7P6G2	Enterobacteria_phage	99.6	3.8e-129
AWZ69251.1|3700832_3701762_-	phage replication protein O, N-terminal domain	NA	A0A0M5M7Y1	Salmonella_phage	63.4	1.2e-109
AWZ71569.1|3701848_3702388_-	hypothetical protein	NA	K7PJT7	Enterobacteria_phage	66.5	7.5e-61
AWZ72123.1|3702457_3702688_-	helix-turn-helix family protein	NA	A0A2H4FNF3	Salmonella_phage	68.0	1.5e-21
AWZ70908.1|3702726_3703482_+	peptidase S24-like family protein	NA	Q76H56	Enterobacteria_phage	75.0	1.4e-92
AWZ69878.1|3703604_3704354_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ69162.1|3704350_3705178_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ69011.1|3705686_3705893_+	putative phage encoded cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	85.3	3.2e-28
AWZ72263.1|3705968_3706265_+	host-nuclease inhibitor protein gam	NA	A0A1I9LJN1	Stx_converting_phage	99.0	3.6e-49
AWZ69504.1|3706270_3707056_+	phage recombination protein Bet	NA	A0A0N7KZJ3	Stx2-converting_phage	100.0	1.1e-148
AWZ71935.1|3707052_3707733_+	exonuclease	NA	A0A0P0ZCD4	Stx2-converting_phage	99.6	3.5e-132
AWZ70092.1|3707884_3708442_+	phage N-6-adenine-methyltransferase	NA	E5AGF8	Erwinia_phage	62.3	2.0e-61
AWZ71136.1|3708518_3708734_+	putative ybl17	NA	A0A1I9LJM7	Stx_converting_phage	100.0	1.0e-32
AWZ71940.1|3709025_3709148_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ69936.1|3709575_3710739_+|integrase	phage integrase family protein	integrase	S5FNS2	Shigella_phage	100.0	4.1e-229
AWZ72109.1|3710943_3712197_-	gamma-glutamyl phosphate reductase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	5.8e-96
3710752:3710799	attR	AATGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
AWZ68048.1|3712208_3713312_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
AWZ69932.1|3713599_3714655_+	outer membrane pore protein E	NA	Q1MVN1	Enterobacteria_phage	60.9	2.0e-118
>prophage 9
CP030331	Escherichia coli strain AR_452 chromosome, complete genome	4818472	4102132	4149320	4818472	integrase,transposase	Escherichia_phage(23.08%)	54	4101647:4101661	4138014:4138028
4101647:4101661	attL	TTTTCATGCTGCTTT	NA	NA	NA	NA
AWZ70638.1|4102132_4102729_-|integrase	phage integrase family protein	integrase	A0A2L1IV36	Escherichia_phage	53.4	3.9e-50
AWZ70094.1|4103206_4103809_-|integrase	phage integrase family protein	integrase	A0A2L1IV36	Escherichia_phage	52.3	3.1e-55
AWZ71545.1|4105433_4105982_+	putative N-acetylneuraminic acid outer membrane channel protein NanC	NA	NA	NA	NA	NA
AWZ69921.1|4106001_4107108_+	mutarotase, YjhT family protein	NA	NA	NA	NA	NA
AWZ68714.1|4107172_4108153_+	hypothetical protein	NA	Q08JA2	Stx2-converting_phage	55.9	2.5e-102
AWZ69791.1|4108364_4109237_+	HNH endonuclease family protein	NA	NA	NA	NA	NA
AWZ72287.1|4109406_4111482_+	ATPase associated with various cellular activities family protein	NA	K4I1H4	Acidithiobacillus_phage	33.8	4.5e-37
AWZ72037.1|4111474_4112818_+	mcrBC 5-methylcytosine restriction system component family protein	NA	NA	NA	NA	NA
AWZ68517.1|4113072_4113201_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ69117.1|4113251_4115399_+	N-6 DNA Methylase family protein	NA	B3GAM1	uncultured_virus	43.8	2.6e-19
AWZ69325.1|4115398_4116853_+	type I restriction modification DNA specificity domain protein	NA	A0A142K7G3	Mycobacterium_phage	24.5	2.1e-09
AWZ69253.1|4116888_4118175_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ69140.1|4118171_4122458_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ71941.1|4122468_4123317_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ69131.1|4123319_4124477_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ70211.1|4124466_4126152_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ70428.1|4126288_4126702_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ68481.1|4126698_4128168_+	kinase domain protein	NA	A0A2K9L5Y0	Tupanvirus	26.5	1.4e-11
AWZ68696.1|4128368_4129634_-|integrase	phage integrase family protein	integrase	B7SYF8	Stenotrophomonas_phage	43.1	1.1e-81
AWZ69196.1|4130095_4130242_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ71439.1|4130326_4130524_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ71517.1|4130543_4131032_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ72090.1|4131028_4131406_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ68938.1|4131566_4131707_-	yagB/YeeU/YfjZ family protein	NA	NA	NA	NA	NA
AWZ68377.1|4131906_4132128_-	hypothetical protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.9e-10
AWZ71727.1|4132214_4132691_-	DNA repair RadC family protein	NA	NA	NA	NA	NA
AWZ69709.1|4132705_4133185_-	antirestriction family protein	NA	A9J566	Pseudomonas_phage	31.0	2.6e-12
AWZ72206.1|4133284_4133425_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ69575.1|4133450_4134269_-	hypothetical protein	NA	A0A2C9CX26	Yersinia_phage	39.5	6.5e-48
AWZ70212.1|4134358_4134535_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ68921.1|4134597_4135275_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ71822.1|4135422_4136103_-	WYL domain protein	NA	NA	NA	NA	NA
AWZ71140.1|4136131_4136287_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ71226.1|4136305_4137190_-	50S ribosome-binding GTPase family protein	NA	NA	NA	NA	NA
AWZ71163.1|4137295_4138258_+	hypothetical protein	NA	NA	NA	NA	NA
4138014:4138028	attR	TTTTCATGCTGCTTT	NA	NA	NA	NA
AWZ69571.1|4138254_4139109_-	replication regulatory RepB family protein	NA	NA	NA	NA	NA
AWZ68550.1|4139862_4139979_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ69569.1|4140653_4140767_+	putative membrane protein	NA	NA	NA	NA	NA
AWZ70590.1|4140783_4140957_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ69059.1|4140955_4141093_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ68351.1|4141136_4141868_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ68713.1|4142377_4142830_+	bacterial transferase hexapeptide family protein	NA	NA	NA	NA	NA
AWZ69693.1|4143524_4144064_+	H-NS histone family protein	NA	NA	NA	NA	NA
AWZ70405.1|4144547_4144664_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ70160.1|4145481_4146048_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ71845.1|4146294_4146870_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ69414.1|4146941_4147175_+	prophage CP4-57 regulatory family protein	NA	NA	NA	NA	NA
AWZ71330.1|4147186_4147330_+	putative regulatory protein	NA	NA	NA	NA	NA
AWZ69923.1|4147417_4147966_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ71649.1|4147984_4148113_-	proQ/FINO family protein	NA	NA	NA	NA	NA
AWZ71277.1|4148112_4148481_-	HTH-like domain protein	NA	NA	NA	NA	NA
AWZ69242.1|4148477_4148783_-|transposase	transposase family protein	transposase	NA	NA	NA	NA
AWZ71010.1|4148924_4149134_-|transposase	putative transposase	transposase	U5P0U6	Shigella_phage	98.6	2.2e-32
AWZ68595.1|4149134_4149320_-|transposase	putative transposase	transposase	Q71TF0	Escherichia_phage	83.6	2.8e-23
>prophage 10
CP030331	Escherichia coli strain AR_452 chromosome, complete genome	4818472	4155734	4202856	4818472	integrase,transposase,tRNA	Stx2-converting_phage(23.08%)	48	4152460:4152475	4194818:4194833
4152460:4152475	attL	TCAACAGCCTGCTGCA	NA	NA	NA	NA
AWZ69855.1|4155734_4156691_+	fe(3+) dicitrate transport system permease protein FecD	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.1	1.1e-17
AWZ70286.1|4156723_4156888_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ71856.1|4156892_4157459_+	ABC transporter family protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	26.5	6.1e-05
AWZ70792.1|4158016_4158274_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ70840.1|4158356_4159196_-|integrase	integrase core domain protein	integrase	Q716C2	Shigella_phage	97.1	1.6e-163
AWZ71762.1|4159271_4160423_-	helix-turn-helix domain protein	NA	W5R8L2	Staphylococcus_phage	35.6	4.4e-42
AWZ71884.1|4160554_4160722_+|transposase	putative transposase	transposase	NA	NA	NA	NA
AWZ70152.1|4160715_4161393_+|integrase	integrase core domain protein	integrase	Q716C2	Shigella_phage	61.0	1.2e-79
AWZ71379.1|4161385_4162390_-|transposase	transposase IS66 family protein	transposase	A0A0P0ZEB3	Stx2-converting_phage	53.8	7.4e-86
AWZ68354.1|4162409_4162757_-|transposase	putative transposase	transposase	A0A0P0ZDM8	Stx2-converting_phage	75.7	4.4e-46
AWZ70162.1|4162756_4163407_-|transposase	transposase family protein	transposase	A0A0P0ZCV4	Stx2-converting_phage	43.6	4.0e-16
AWZ68545.1|4163532_4163658_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ70722.1|4163698_4165063_-	phosphoglycerate transporter family protein	NA	NA	NA	NA	NA
AWZ68399.1|4165407_4166679_+	phosphoglycerate transport regulatory protein PgtC	NA	NA	NA	NA	NA
AWZ72577.1|4166675_4168685_+	phosphoglycerate transport system sensor protein pgtB	NA	NA	NA	NA	NA
AWZ71687.1|4168674_4169922_+	transport activator	NA	NA	NA	NA	NA
AWZ68292.1|4170188_4170311_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ69432.1|4170425_4170740_+	putative dNA binding protein	NA	NA	NA	NA	NA
AWZ71359.1|4172119_4172374_+	pap fimbrial major pilin protein	NA	NA	NA	NA	NA
AWZ70108.1|4172460_4173048_+	PAP fimbrial minor pilin protein	NA	NA	NA	NA	NA
AWZ70986.1|4173168_4175679_+	outer membrane usher protein PapC	NA	NA	NA	NA	NA
AWZ72506.1|4175747_4176479_+	chaperone protein PapD	NA	NA	NA	NA	NA
AWZ70582.1|4176515_4177079_+	putative minor fimbrial subunit protein PixJ	NA	NA	NA	NA	NA
AWZ72060.1|4177703_4178696_+	putative pixG protein	NA	NA	NA	NA	NA
AWZ71308.1|4179420_4179534_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ72197.1|4181111_4182377_-|integrase	phage integrase family protein	integrase	Q7M297	Enterobacteria_phage	38.0	2.2e-79
AWZ70728.1|4183174_4184677_+	hypothetical protein	NA	A0A248XCZ8	Klebsiella_phage	44.8	6.1e-84
AWZ69996.1|4184795_4185878_-	lipopolysaccharide export system permease protein LptG	NA	NA	NA	NA	NA
AWZ69091.1|4185877_4186885_-	lipopolysaccharide export system permease protein LptF	NA	NA	NA	NA	NA
AWZ69822.1|4186891_4187020_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ70494.1|4187244_4188756_+	cytosol aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.0	6.0e-47
AWZ69508.1|4188889_4189333_+	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
AWZ69816.1|4189332_4192188_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.7	1.8e-140
AWZ71116.1|4192243_4193440_-	inner membrane protein YjgN	NA	NA	NA	NA	NA
AWZ69458.1|4193632_4194136_+	acetyltransferase family protein	NA	NA	NA	NA	NA
AWZ71548.1|4194181_4194598_-	regulator of ribonuclease activity B	NA	NA	NA	NA	NA
AWZ70731.1|4194759_4195764_+	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
4194818:4194833	attR	TCAACAGCCTGCTGCA	NA	NA	NA	NA
AWZ68699.1|4195864_4196095_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ69628.1|4196081_4197425_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ72255.1|4197547_4198000_-	toxin-antitoxin biofilm protein TabA	NA	NA	NA	NA	NA
AWZ70139.1|4198144_4198738_-	bacterial regulatory, tetR family protein	NA	NA	NA	NA	NA
AWZ71554.1|4198808_4199522_+	short chain dehydrogenase family protein	NA	NA	NA	NA	NA
AWZ71840.1|4199652_4200048_+	endoribonuclease L-PSP family protein	NA	NA	NA	NA	NA
AWZ68926.1|4200152_4200290_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ72283.1|4200466_4201402_+	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	40.2	2.9e-52
AWZ69310.1|4201414_4201876_+	aspartate carbamoyltransferase, regulatory subunit	NA	NA	NA	NA	NA
AWZ71316.1|4201948_4202335_+	enamine/imine deaminase	NA	NA	NA	NA	NA
AWZ72013.1|4202400_4202856_+|transposase	transposase family protein	transposase	NA	NA	NA	NA
>prophage 1
CP030329	Escherichia coli strain AR_452 plasmid unnamed1, complete sequence	128762	2302	52215	128762	transposase,integrase	Escherichia_phage(33.33%)	57	34134:34147	51639:51652
AWZ67883.1|2302_2581_-|transposase	transposase domain protein	transposase	NA	NA	NA	NA
AWZ67887.1|2577_3696_-|transposase	transposase family protein	transposase	NA	NA	NA	NA
AWZ67842.1|3720_4182_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ67877.1|4336_4990_-|integrase	phage integrase, N-terminal SAM-like domain protein	integrase	A0A2I7SAK5	Vibrio_phage	58.1	1.1e-21
AWZ67835.1|5880_5994_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ67855.1|6051_6831_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ67928.1|7335_8175_+	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
AWZ67900.1|8579_10121_+|transposase	transposase family protein	transposase	NA	NA	NA	NA
AWZ67917.1|10433_11465_+	disulfide bond corrector DsbC family protein	NA	NA	NA	NA	NA
AWZ67859.1|11475_12114_-	N-(5'phosphoribosyl)anthranilate (PRA) isomerase family protein	NA	NA	NA	NA	NA
AWZ67910.1|12118_12484_-	bleomycin resistance protein	NA	NA	NA	NA	NA
AWZ67902.1|12487_13300_-	beta-lactamase NDM-1	NA	NA	NA	NA	NA
AWZ67818.1|13400_13595_-|transposase	putative transposase for insertion sequence element IS1086 domain protein	transposase	NA	NA	NA	NA
AWZ67826.1|13858_14563_+|integrase	integrase core domain protein	integrase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AWZ67884.1|14663_15479_-	putative macrolide phosphotransferase K	NA	NA	NA	NA	NA
AWZ67868.1|15658_16825_+	major Facilitator Superfamily protein	NA	NA	NA	NA	NA
AWZ67882.1|16932_17409_+	erythromycin resistance repressor protein	NA	NA	NA	NA	NA
AWZ67876.1|17901_18666_-|transposase	transposase IS66 family protein	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
AWZ67920.1|18642_18822_+|transposase	putative transposase domain protein	transposase	NA	NA	NA	NA
AWZ67831.1|18967_19525_+	transposon Tn3 resolvase	NA	Q1MVP4	Enterobacteria_phage	100.0	7.0e-94
AWZ67915.1|19707_20568_+	beta-lactamase TEM	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
AWZ67815.1|21184_22600_+	reverse transcriptase family protein	NA	D4HTV9	Vibrio_phage	26.6	1.4e-10
AWZ67823.1|22850_23054_+	plasmid stabilization system family protein	NA	NA	NA	NA	NA
AWZ67814.1|23179_23347_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ67846.1|25054_25558_+|transposase	putative transposase	transposase	Q71TF0	Escherichia_phage	94.0	1.1e-90
AWZ67805.1|25597_26338_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	1.6e-24
AWZ67936.1|27017_27179_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ67810.1|27302_27428_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ67841.1|27548_28289_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	56.9	5.4e-25
AWZ67885.1|28611_29589_-	repFIB replication protein A	NA	J9Q7H0	Salmonella_phage	63.9	4.6e-101
AWZ67825.1|30488_30758_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ67858.1|30935_31292_+	acetyltransferase family protein	NA	NA	NA	NA	NA
AWZ67851.1|31514_31640_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ67854.1|31878_32109_-	antidote-toxin recognition MazE family protein	NA	NA	NA	NA	NA
AWZ67809.1|32307_34890_-	PHP domain protein	NA	A0A1B1IUG5	uncultured_Mediterranean_phage	23.7	5.8e-18
34134:34147	attL	GGCTGTGGGTCAGG	NA	NA	NA	NA
AWZ67863.1|35319_35805_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ67874.1|35833_36271_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ67926.1|36772_37906_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ67806.1|37939_38452_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ67821.1|38738_40304_+	AAA domain protein	NA	NA	NA	NA	NA
AWZ67905.1|40360_41230_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ67808.1|41231_41939_-	transcriptional repressor PifC	NA	NA	NA	NA	NA
AWZ67908.1|42134_42320_-	transcriptional repressor PifC domain protein	NA	NA	NA	NA	NA
AWZ67914.1|42612_43545_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ67873.1|43548_44544_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ67847.1|45221_45572_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ67848.1|45641_46250_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ67839.1|46356_46596_+|integrase	phage integrase family protein	integrase	NA	NA	NA	NA
AWZ67878.1|46634_46751_+	putative resolvase	NA	NA	NA	NA	NA
AWZ67929.1|46901_47078_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	94.4	3.6e-20
AWZ67921.1|47215_47491_-	ribbon-helix-helix, copG family protein	NA	NA	NA	NA	NA
AWZ67844.1|47484_47748_-	putative lexA DNA-binding domain protein	NA	A0A222YXS3	Escherichia_phage	46.8	1.7e-13
AWZ67893.1|48357_49329_+	plasmid segregation protein ParM	NA	A0A222YXF2	Escherichia_phage	42.6	9.7e-67
AWZ67923.1|49333_49726_+	plasmid stability family protein	NA	NA	NA	NA	NA
AWZ67833.1|49730_49979_-	hypothetical protein	NA	F1C5A5	Cronobacter_phage	57.7	6.6e-20
AWZ67865.1|50032_50608_-	impB/mucB/samB family protein	NA	F1C5A5	Cronobacter_phage	57.3	4.0e-52
AWZ67869.1|51234_52215_-|transposase	transposase DDE domain protein	transposase	A0A077SK28	Escherichia_phage	97.2	2.9e-180
51639:51652	attR	GGCTGTGGGTCAGG	NA	NA	NA	NA
>prophage 2
CP030329	Escherichia coli strain AR_452 plasmid unnamed1, complete sequence	128762	79537	128012	128762	transposase,integrase,protease,tRNA	Acidithiobacillus_phage(22.22%)	52	109213:109224	128016:128027
AWZ67909.1|79537_80041_+|transposase	putative transposase	transposase	U5P0U6	Shigella_phage	99.4	3.7e-94
AWZ67879.1|80871_81159_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ67857.1|81277_82099_+	hypothetical protein	NA	A0A2C9CYF8	Yersinia_phage	38.2	3.4e-44
AWZ67849.1|82394_82904_-	transglycosylase SLT domain protein	NA	NA	NA	NA	NA
AWZ67834.1|83316_83700_+	relaxosome protein TraM	NA	NA	NA	NA	NA
AWZ67827.1|83886_84576_+	putative protein TraJ	NA	NA	NA	NA	NA
AWZ67837.1|84887_85070_+	relaxosome protein TraY	NA	NA	NA	NA	NA
AWZ67924.1|85102_85465_+	type IV conjugative transfer system pilin TraA	NA	NA	NA	NA	NA
AWZ67897.1|85469_85781_+	type IV conjugative transfer system protein TraL	NA	NA	NA	NA	NA
AWZ67804.1|85838_86369_+	type IV conjugative transfer system protein TraE	NA	NA	NA	NA	NA
AWZ67896.1|86355_87084_+	type-F conjugative transfer system secretin TraK	NA	NA	NA	NA	NA
AWZ67812.1|87083_88535_+	bacterial conjugation TrbI-like family protein	NA	NA	NA	NA	NA
AWZ67913.1|88524_89085_+	traP family protein	NA	NA	NA	NA	NA
AWZ67811.1|89071_89392_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ67934.1|89384_89636_+	putative trbG	NA	NA	NA	NA	NA
AWZ67860.1|89632_90148_+	type IV conjugative transfer system protein TraV	NA	NA	NA	NA	NA
AWZ67801.1|90282_90504_+	phage/conjugal plasmid C-4 type zinc finger, TraR family protein	NA	A2I309	Vibrio_virus	40.8	2.0e-07
AWZ67891.1|90663_93291_+	type-IV secretion system protein TraC	NA	NA	NA	NA	NA
AWZ67933.1|93287_93674_+	type-F conjugative transfer system protein TrbI	NA	NA	NA	NA	NA
AWZ67819.1|93670_94303_+	type-F conjugative transfer system protein TraW	NA	NA	NA	NA	NA
AWZ67824.1|94299_95292_+	traU family protein	NA	NA	NA	NA	NA
AWZ67895.1|95300_95939_+	type-F conjugative transfer system pilin assembly protein TrbC	NA	NA	NA	NA	NA
AWZ67932.1|95935_96316_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ67872.1|96650_98414_+	type-F conjugative transfer system mating-pair stabilization protein TraN	NA	NA	NA	NA	NA
AWZ67816.1|98440_98698_+	conjugal transfer TrbE family protein	NA	NA	NA	NA	NA
AWZ67840.1|98690_99434_+	type-F conjugative transfer system pilin assembly protein TraF	NA	NA	NA	NA	NA
AWZ67930.1|99963_100200_+	type-F conjugative transfer system pilin chaperone TraQ	NA	NA	NA	NA	NA
AWZ67836.1|100186_100732_+	type-F conjugative transfer system pilin assembly thiol-disulfide isomerase TrbB	NA	NA	NA	NA	NA
AWZ67820.1|100721_101024_+	putative trbJ	NA	NA	NA	NA	NA
AWZ67853.1|101023_102397_+	conjugative relaxosome accessory transposon family protein	NA	NA	NA	NA	NA
AWZ67813.1|102393_105213_+	putative traG protein	NA	NA	NA	NA	NA
AWZ67843.1|105760_106492_+	enterobacterial TraT complement resistance family protein	NA	NA	NA	NA	NA
AWZ67922.1|106744_108934_+	type IV conjugative transfer system coupling protein TraD	NA	NA	NA	NA	NA
AWZ67898.1|108942_109341_-|tRNA	tRNA(fMet)-specific endonuclease VapC	tRNA	NA	NA	NA	NA
109213:109224	attL	CAGCTCCATCAG	NA	NA	NA	NA
AWZ67862.1|109340_109568_-	antitoxin VapB	NA	NA	NA	NA	NA
AWZ67886.1|109853_114920_+	conjugative transfer relaxase protein TraI	NA	NA	NA	NA	NA
AWZ67800.1|115420_116737_+|integrase	integrase core domain protein	integrase	K4I413	Acidithiobacillus_phage	47.6	2.0e-115
AWZ67845.1|116748_117498_+	istB-like ATP binding family protein	NA	K4HZD4	Acidithiobacillus_phage	48.3	3.9e-55
AWZ67935.1|117597_118272_+	type-F conjugative transfer system pilin acetylase TraX	NA	A0A077JBM8	Xanthomonas_phage	30.5	2.4e-08
AWZ67901.1|118326_118887_+	fertility inhibition protein	NA	NA	NA	NA	NA
AWZ67911.1|119199_119337_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ67938.1|120416_120986_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ67927.1|121444_121627_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ67906.1|122863_123721_+	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
AWZ67856.1|124421_124562_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ67867.1|124540_124663_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ67829.1|124659_125313_+|protease	CAAX protease self-immunity family protein	protease	NA	NA	NA	NA
AWZ67916.1|125405_125663_+	mRNA interferase PemK	NA	NA	NA	NA	NA
AWZ67871.1|125664_125997_+	mRNA interferase PemK	NA	NA	NA	NA	NA
AWZ67861.1|126439_126700_+|transposase	putative transposase	transposase	Q71TF0	Escherichia_phage	98.7	1.6e-40
AWZ67817.1|126696_127230_-|transposase	tn3 transposase DDE domain protein	transposase	Q1MVP5	Enterobacteria_phage	98.9	3.9e-94
AWZ67807.1|127307_128012_-|integrase	integrase core domain protein	integrase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
128016:128027	attR	CAGCTCCATCAG	NA	NA	NA	NA
