The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP030323	Staphylococcus aureus strain AR_475 chromosome, complete genome	2790267	1374699	1385402	2790267	transposase,integrase	Staphylococcus_phage(63.64%)	11	1371625:1371642	1379964:1379981
1371625:1371642	attL	TCAAATGATGACATTTAA	NA	NA	NA	NA
AWZ63165.1|1374699_1376346_+|transposase	transposase DDE domain protein	transposase	A0ZS58	Staphylococcus_virus	99.1	1.6e-292
AWZ64740.1|1377087_1377876_-	hypothetical protein	NA	A0A2H4PQI0	Staphylococcus_phage	95.4	7.0e-140
AWZ62706.1|1378269_1379562_+|integrase	integrase core domain protein	integrase	A0A2L1IVA1	Escherichia_phage	30.8	2.6e-14
AWZ64749.1|1379554_1380316_+	bacterial dnaA family protein	NA	A0A059NT77	Lactococcus_phage	44.2	1.1e-54
1379964:1379981	attR	TTAAATGTCATCATTTGA	NA	NA	NA	NA
AWZ64041.1|1380656_1380953_+	bacterial SH3 domain protein	NA	A0A1P8L6B4	Staphylococcus_phage	100.0	1.3e-51
AWZ64935.1|1381047_1381497_-	chemotaxis inhibitory protein	NA	A0A1P8L6A8	Staphylococcus_phage	100.0	1.1e-78
AWZ63506.1|1382181_1382532_+	complement inhibitor	NA	A0A1P8L6B0	Staphylococcus_phage	100.0	7.5e-54
AWZ63646.1|1382584_1382776_-	putative membrane protein	NA	M9NS66	Staphylococcus_phage	100.0	1.7e-23
AWZ63538.1|1382920_1383076_+	hypothetical protein	NA	A0A1P8L6A1	Staphylococcus_phage	100.0	1.4e-20
AWZ63323.1|1383766_1384297_+	type I restriction modification DNA specificity domain protein	NA	A0A2H4PQP5	Staphylococcus_phage	32.5	1.7e-09
AWZ63392.1|1384547_1385402_+	peptidase M23 family protein	NA	E5G070	Clostridium_phage	37.9	6.4e-06
>prophage 2
CP030323	Staphylococcus aureus strain AR_475 chromosome, complete genome	2790267	1390956	1433929	2790267	protease,tRNA	Staphylococcus_phage(94.29%)	43	NA	NA
AWZ64205.1|1390956_1391529_-	hypothetical protein	NA	A0A2H4PQN4	Staphylococcus_phage	94.8	3.2e-25
AWZ64635.1|1391629_1391971_-	hypothetical protein	NA	A0A2H4PQN6	Staphylococcus_phage	93.8	2.8e-53
AWZ64461.1|1392011_1392638_-	putative lipoprotein	NA	A0A2H4PQM7	Staphylococcus_phage	84.6	5.8e-81
AWZ62607.1|1392713_1393709_-	hypothetical protein	NA	A0A2H4PQN2	Staphylococcus_phage	92.7	1.7e-66
AWZ64609.1|1393789_1394404_-	excalibur calcium-binding domain protein	NA	A0A2H4PQM8	Staphylococcus_phage	66.2	1.7e-24
AWZ63277.1|1394715_1395198_+	hypothetical protein	NA	A0A2H4PQN7	Staphylococcus_phage	97.9	4.2e-79
AWZ63502.1|1395357_1396836_+	O-succinylbenzoate-CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	96.7	3.4e-281
AWZ64815.1|1396840_1397842_+	o-succinylbenzoate synthase	NA	A0A2H4PQM0	Staphylococcus_phage	97.6	4.1e-185
AWZ62964.1|1397838_1398096_-	putative membrane protein insertion efficiency factor	NA	A0A2H4PQM5	Staphylococcus_phage	100.0	7.2e-46
AWZ64733.1|1398155_1398635_+	nucleoside triphosphatase YtkD	NA	A0A2H4PQM4	Staphylococcus_phage	98.7	1.1e-84
AWZ63897.1|1398615_1399386_+	prolyl oligopeptidase family protein	NA	A0A2H4PQM6	Staphylococcus_phage	98.0	8.0e-141
AWZ63905.1|1399679_1401272_-	phosphoenolpyruvate carboxykinase	NA	A0A2H4PQN1	Staphylococcus_phage	99.8	0.0e+00
AWZ62496.1|1401643_1402837_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	99.7	1.9e-218
AWZ64382.1|1402961_1403870_+	nuclease-related domain protein	NA	A0A2H4PQQ8	Staphylococcus_phage	100.0	3.4e-138
AWZ64549.1|1404081_1404915_+	aldo/keto reductase family protein	NA	A0A2H4PQR8	Staphylococcus_phage	99.3	1.3e-157
AWZ62992.1|1405164_1405518_-	crcB-like family protein	NA	A0A2H4PQQ7	Staphylococcus_phage	99.1	1.0e-21
AWZ64487.1|1405514_1405880_-	crcB-like family protein	NA	A0A2H4PQR0	Staphylococcus_phage	98.3	6.2e-59
AWZ63610.1|1406135_1406438_-	putative membrane protein	NA	NA	NA	NA	NA
AWZ63227.1|1406695_1407409_+	transaldolase	NA	M1PR54	Cyanophage	34.5	1.2e-18
AWZ64960.1|1407877_1408498_-|protease	CAAX protease self-immunity family protein	protease	NA	NA	NA	NA
AWZ64992.1|1408664_1409300_-|protease	CAAX protease self-immunity family protein	protease	NA	NA	NA	NA
AWZ63079.1|1409597_1410041_+	hypothetical protein	NA	A0A2H4PQT8	Staphylococcus_phage	98.6	2.4e-57
AWZ63784.1|1410027_1410171_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ63870.1|1410583_1411054_-	RNA polymerase sigma factor SigS	NA	A0A2H4PQT5	Staphylococcus_phage	97.4	4.4e-81
AWZ64806.1|1411252_1411477_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ62560.1|1411752_1412607_+	mannosyl-glycoendo-beta-N-acetylglucosaminidase family protein	NA	Q4ZCC7	Staphylococcus_virus	38.1	4.9e-38
AWZ64024.1|1413011_1413404_-	arsenate reductase	NA	A0A2H4PQT9	Staphylococcus_phage	98.5	1.3e-70
AWZ63160.1|1413421_1414711_-	arsenite/antimonite efflux pump membrane family protein	NA	A0A2H4PQU3	Staphylococcus_phage	97.4	4.8e-223
AWZ63349.1|1415549_1417052_+	FAD-NAD(P)-binding family protein	NA	A0A2H4PQX2	Staphylococcus_phage	98.6	1.1e-29
AWZ62529.1|1417532_1418576_+	riboflavin biosynthesis protein RibD	NA	A0A2H4PQS8	Staphylococcus_phage	98.5	1.2e-195
AWZ63614.1|1418582_1419215_+	riboflavin synthase, alpha subunit	NA	A0A2H4PQS5	Staphylococcus_phage	98.6	2.4e-111
AWZ63577.1|1419225_1420407_+	riboflavin biosynthesis protein RibBA	NA	A0A2H4PQS2	Staphylococcus_phage	99.2	1.6e-225
AWZ64053.1|1420419_1420884_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	99.4	5.8e-70
AWZ64931.1|1421005_1422007_-	proline dehydrogenase family protein	NA	A0A2H4PQT6	Staphylococcus_phage	98.8	1.7e-183
AWZ64696.1|1422121_1422238_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ63379.1|1422240_1423068_+	alpha/beta hydrolase family protein	NA	NA	NA	NA	NA
AWZ64821.1|1423639_1424041_+	HTH-type transcriptional regulator rot	NA	NA	NA	NA	NA
AWZ63512.1|1424160_1424724_-	methyltransferase domain protein	NA	A0A2H4PQV0	Staphylococcus_phage	98.4	3.5e-101
AWZ62791.1|1424720_1425674_-	radical SAM superfamily protein	NA	A0A2H4PQV5	Staphylococcus_phage	100.0	2.2e-79
AWZ64735.1|1425783_1426965_+	major Facilitator Superfamily protein	NA	A0A2H4PQR6	Staphylococcus_phage	99.5	1.2e-217
AWZ64864.1|1427256_1429671_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	99.5	0.0e+00
AWZ63051.1|1429692_1430004_+	rhodanese-like domain protein	NA	A0A2H4PQR9	Staphylococcus_phage	98.1	5.3e-51
AWZ64427.1|1430329_1433929_+	sasC/Mrp/FmtB intercellular aggregation domain protein	NA	A0A2H4PQU6	Staphylococcus_phage	91.0	2.6e-258
>prophage 3
CP030323	Staphylococcus aureus strain AR_475 chromosome, complete genome	2790267	1562864	1571907	2790267	tRNA	uncultured_Mediterranean_phage(50.0%)	7	NA	NA
AWZ64112.1|1562864_1563869_+	holliday junction DNA helicase RuvB	NA	B3GAM6	uncultured_virus	29.1	1.7e-05
AWZ64108.1|1563870_1564896_+|tRNA	tRNA ribosyltransferase-isomerase	tRNA	NA	NA	NA	NA
AWZ62920.1|1564918_1566058_+|tRNA	queuine tRNA-ribosyltransferase	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	44.7	5.4e-85
AWZ63066.1|1566076_1566337_+	preprotein translocase, YajC subunit	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	35.3	8.2e-05
AWZ64221.1|1566611_1568891_+	protein-export membrane protein SecD	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	35.8	1.8e-31
AWZ62848.1|1569093_1571367_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	29.5	2.1e-64
AWZ63449.1|1571388_1571907_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	45.8	2.1e-28
>prophage 4
CP030323	Staphylococcus aureus strain AR_475 chromosome, complete genome	2790267	1642550	1650862	2790267		Caulobacter_phage(16.67%)	7	NA	NA
AWZ62813.1|1642550_1644350_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	36.0	3.5e-54
AWZ63998.1|1644573_1645680_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	38.1	1.1e-37
AWZ63302.1|1645810_1646488_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ63721.1|1646490_1647591_+	NIF3 family protein	NA	A0A1S5V250	Saudi_moumouvirus	30.6	1.0e-08
AWZ64410.1|1647704_1649051_+	helicase domain protein	NA	A0A1V0SIR5	Klosneuvirus	34.0	2.4e-55
AWZ62491.1|1649060_1649951_+	putative endonuclease 4	NA	A0A2H4UU70	Bodo_saltans_virus	33.1	3.4e-26
AWZ64684.1|1650076_1650862_+	ABC transporter family protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.3	6.1e-19
>prophage 5
CP030323	Staphylococcus aureus strain AR_475 chromosome, complete genome	2790267	1781586	1873311	2790267	capsid,portal,holin,integrase,tail,protease,lysis,head	Staphylococcus_phage(89.04%)	98	1779616:1779640	1825014:1825038
1779616:1779640	attL	CGAAAGATGCATTGAATGGTGATGC	NA	NA	NA	NA
AWZ62719.1|1781586_1782624_-|integrase	integrase	integrase	Q38086	Staphylococcus_phage	99.7	5.9e-179
AWZ62616.1|1782796_1783336_-	pemK-like family protein	NA	U5U4R0	Staphylococcus_phage	33.1	9.0e-14
AWZ64032.1|1783475_1783643_-	hypothetical protein	NA	Q4ZDJ4	Staphylococcus_virus	100.0	1.7e-24
AWZ63620.1|1783842_1784028_-	hypothetical protein	NA	A0A2I6PDS4	Staphylococcus_phage	100.0	2.3e-25
AWZ62892.1|1784014_1784170_-	hypothetical protein	NA	A0A2I6PDR9	Staphylococcus_phage	100.0	6.3e-21
AWZ62641.1|1784181_1784889_-	helix-turn-helix family protein	NA	G4KNM8	Staphylococcus_phage	99.6	1.0e-129
AWZ63867.1|1785059_1785299_+	helix-turn-helix family protein	NA	G4KNM9	Staphylococcus_phage	100.0	2.3e-38
AWZ64365.1|1785311_1785572_+	putative transcriptional regulator	NA	A7TW91	Staphylococcus_phage	100.0	2.7e-40
AWZ62907.1|1785595_1786135_-	putative phi PVL orf 33-like protein	NA	A7TW92	Staphylococcus_phage	100.0	1.7e-97
AWZ63147.1|1786191_1786944_+	phage antirepressor KilAC domain protein	NA	A0A1X9H0A0	Staphylococcus_phage	100.0	8.7e-140
AWZ63260.1|1786960_1787155_+	hypothetical protein	NA	A0A1X9H0A2	Staphylococcus_phage	100.0	1.5e-19
AWZ63431.1|1787185_1787326_+	hypothetical protein	NA	A0A2I6PDG0	Staphylococcus_phage	100.0	1.9e-16
AWZ64503.1|1787340_1787973_-	putative phage protein	NA	A7TW95	Staphylococcus_phage	100.0	1.5e-113
AWZ63470.1|1788031_1788352_+	hypothetical protein	NA	A0A2I6PDH6	Staphylococcus_phage	100.0	1.5e-56
AWZ63819.1|1788602_1788863_+	hypothetical protein	NA	A0A1W6JQ03	Staphylococcus_phage	100.0	7.6e-43
AWZ64804.1|1789143_1791087_+	AAA domain protein	NA	A0A2I6PDH3	Staphylococcus_phage	99.2	0.0e+00
AWZ64900.1|1791088_1792009_+	recombinase, phage RecT family protein	NA	A0A2I6PDH5	Staphylococcus_phage	99.7	3.0e-166
AWZ62492.1|1792221_1792698_+	beta-lactamase superfamily domain protein	NA	A0A1W6JPL3	Staphylococcus_phage	96.9	6.8e-82
AWZ64933.1|1792698_1793169_+	single-stranded DNA-binding family protein	NA	S4V682	Staphylococcus_phage	96.2	3.1e-79
AWZ63002.1|1793198_1794083_+	dnaD domain protein	NA	S4V6D4	Staphylococcus_phage	96.6	3.1e-136
AWZ64542.1|1794089_1794308_+	hypothetical protein	NA	A0A1P8L6E4	Staphylococcus_phage	100.0	1.4e-37
AWZ63050.1|1794316_1794721_+	endodeoxyribonuclease RusA family protein	NA	A0A0E3XBN4	Staphylococcus_phage	98.5	1.0e-70
AWZ63378.1|1794733_1795102_+	PVL ORF-50-like family protein	NA	I1W656	Staphylococcus_phage	100.0	6.3e-51
AWZ64174.1|1795105_1795348_+	phage family protein	NA	A0A1P8L6E3	Staphylococcus_phage	100.0	3.0e-41
AWZ62837.1|1795362_1795614_+	hypothetical protein	NA	G4KNP4	Staphylococcus_phage	96.4	4.1e-38
AWZ63788.1|1795802_1795931_+	hypothetical protein	NA	A0A2I6PDX3	Staphylococcus_phage	95.2	1.6e-14
AWZ63377.1|1796060_1796222_+	hypothetical protein	NA	W5R9K6	Staphylococcus_phage	100.0	1.4e-23
AWZ62836.1|1796236_1796770_+	dUTPase family protein	NA	A0A0H3U2Z8	Staphylococcus_phage	98.9	5.1e-94
AWZ63319.1|1796806_1797013_+	hypothetical protein	NA	S4V684	Staphylococcus_phage	100.0	7.6e-30
AWZ62494.1|1797009_1797159_+	transcriptional activator RinB family protein	NA	R9QSU6	Staphylococcus_phage	100.0	1.8e-17
AWZ63662.1|1797365_1797968_+	hypothetical protein	NA	D2JLD8	Staphylococcus_phage	99.5	4.5e-107
AWZ64468.1|1797964_1798168_+	hypothetical protein	NA	R9QT57	Staphylococcus_phage	100.0	6.3e-29
AWZ63664.1|1798195_1798612_+	phage transcriptional regulator, RinA family protein	NA	A0A1X9H0U8	Staphylococcus_phage	100.0	2.9e-76
AWZ62570.1|1798843_1799143_+	HNH endonuclease family protein	NA	A0EWY8	Staphylococcus_phage	100.0	4.6e-52
AWZ64501.1|1799273_1799618_+	hypothetical protein	NA	G4KNP9	Staphylococcus_phage	100.0	9.4e-57
AWZ62938.1|1799614_1801276_+	phage Terminase family protein	NA	A0A2I6PDJ8	Staphylococcus_phage	100.0	0.0e+00
AWZ62861.1|1801291_1802479_+|portal	phage portal protein, HK97 family	portal	A0A2I6PDI1	Staphylococcus_phage	100.0	1.0e-219
AWZ63523.1|1802462_1803200_+|protease	clp protease family protein	protease	C8CH20	Staphylococcus_phage	100.0	2.3e-129
AWZ63955.1|1803223_1804369_+|capsid	phage major capsid protein, HK97 family	capsid	A0A1X9H072	Staphylococcus_phage	100.0	5.6e-215
AWZ64346.1|1804388_1804673_+	hypothetical protein	NA	A0A2I6PDJ3	Staphylococcus_phage	100.0	1.8e-45
AWZ62578.1|1804662_1804947_+|head,tail	phage gp6-like head-tail connector family protein	head,tail	A0A2I6PDJ5	Staphylococcus_phage	100.0	2.3e-45
AWZ64274.1|1804930_1805293_+|head,tail	phage head-tail joining family protein	head,tail	G4KNQ4	Staphylococcus_phage	100.0	4.4e-65
AWZ63154.1|1805289_1805694_+	hypothetical protein	NA	A0A2I6PDJ6	Staphylococcus_phage	100.0	4.3e-69
AWZ63437.1|1805690_1806098_+	hypothetical protein	NA	G4KNQ6	Staphylococcus_phage	100.0	7.1e-72
AWZ62901.1|1806098_1806743_+|tail	phage major tail, phi13 family protein	tail	W5R9H4	Staphylococcus_phage	100.0	6.5e-120
AWZ64942.1|1806868_1807009_+	bacterial Ig-like domain family protein	NA	W5R8L9	Staphylococcus_phage	100.0	1.1e-16
AWZ63929.1|1807058_1807409_+	hypothetical protein	NA	G4KNQ8	Staphylococcus_phage	100.0	7.8e-59
AWZ64833.1|1807462_1807597_+	hypothetical protein	NA	A0A2I6PDX7	Staphylococcus_phage	100.0	9.6e-18
AWZ64335.1|1807653_1812165_+|tail	phage tail tape measure protein, TP901 family, core region	tail	A0A1X9H084	Staphylococcus_phage	90.8	0.0e+00
AWZ63744.1|1812161_1813646_+|tail	phage tail family protein	tail	A0A2I6PDJ0	Staphylococcus_phage	100.0	1.2e-297
AWZ63238.1|1813661_1817447_+	phage minor structural, N-terminal region domain protein	NA	A0A1X9H0H3	Staphylococcus_phage	98.4	0.0e+00
AWZ62985.1|1817436_1817589_+	hypothetical protein	NA	D2JLG0	Staphylococcus_phage	100.0	5.2e-20
AWZ63604.1|1817635_1817923_+	hypothetical protein	NA	D2JLG1	Staphylococcus_phage	100.0	1.3e-43
AWZ64773.1|1818046_1818277_+	hypothetical protein	NA	D2JLG2	Staphylococcus_phage	100.0	1.2e-31
AWZ62493.1|1818468_1818603_+	putative membrane protein	NA	D2JLG3	Staphylococcus_phage	100.0	9.3e-13
AWZ63997.1|1818814_1819069_+|holin	holin, phage phi LC3 family	holin	D2JLG4	Staphylococcus_phage	100.0	4.1e-41
AWZ62770.1|1819080_1819836_+	CHAP domain protein	NA	D2JLG5	Staphylococcus_phage	100.0	3.4e-152
AWZ63134.1|1820026_1820518_+	staphylokinase	NA	A0A1X9H028	Staphylococcus_phage	100.0	9.5e-87
AWZ64130.1|1821206_1821503_+	bacterial SH3 domain protein	NA	A0A1P8L6B4	Staphylococcus_phage	100.0	1.3e-51
AWZ64037.1|1821597_1822047_-	chemotaxis inhibitory protein	NA	A0A1P8L6A8	Staphylococcus_phage	100.0	1.1e-78
AWZ64111.1|1822727_1823078_+	complement inhibitor	NA	A7TWS0	Staphylococcus_phage	100.0	7.5e-54
AWZ64856.1|1823130_1823322_-	putative membrane protein	NA	M9NS66	Staphylococcus_phage	100.0	1.7e-23
AWZ64630.1|1823466_1823622_+	hypothetical protein	NA	A0A1P8L6A1	Staphylococcus_phage	100.0	1.4e-20
AWZ64892.1|1824361_1837480_+	GA module family protein	NA	NA	NA	NA	NA
1825014:1825038	attR	CGAAAGATGCATTGAATGGTGATGC	NA	NA	NA	NA
AWZ63625.1|1837666_1837909_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ63809.1|1837930_1842661_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ64817.1|1842719_1843121_-	RNase H family protein	NA	NA	NA	NA	NA
AWZ63732.1|1843362_1844067_-	conserved hypothetical integral membrane family protein	NA	A0A2H4J2N7	uncultured_Caudovirales_phage	23.8	8.4e-12
AWZ64158.1|1844517_1844769_+	scaffold Nfu/NifU N terminal family protein	NA	NA	NA	NA	NA
AWZ62613.1|1844806_1845931_+	conserved virulence factor C	NA	NA	NA	NA	NA
AWZ64543.1|1845946_1846384_+	bacillithiol system oxidoreductase, YphP/YqiW family protein	NA	NA	NA	NA	NA
AWZ64641.1|1846807_1847764_+	thymidylate synthase	NA	A0A0N9SH48	Staphylococcus_phage	85.2	1.6e-167
AWZ63871.1|1847963_1848443_+	dihydrofolate reductase	NA	A0A0N9S8H6	Staphylococcus_phage	79.9	2.0e-73
AWZ63835.1|1848457_1849297_+	EDD, DegV family domain protein	NA	A0A0N9SI50	Staphylococcus_phage	76.5	3.0e-48
AWZ63232.1|1849390_1849924_+	peptide-methionine (S)-S-oxide reductase	NA	NA	NA	NA	NA
AWZ62694.1|1849916_1850345_+	methionine-R-sulfoxide reductase	NA	NA	NA	NA	NA
AWZ64681.1|1850356_1850857_+	glucose-specific phosphotransferase enzyme IIA component	NA	NA	NA	NA	NA
AWZ64903.1|1850856_1851078_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ63885.1|1851269_1852760_+|protease	putative CtpA-like serine protease	protease	A0A0R6PIZ1	Moraxella_phage	28.5	8.6e-22
AWZ64747.1|1853159_1853669_+	acetyltransferase domain protein	NA	NA	NA	NA	NA
AWZ63271.1|1853680_1854751_+	undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase	NA	NA	NA	NA	NA
AWZ64455.1|1854767_1855382_+	PAP2 superfamily protein	NA	NA	NA	NA	NA
AWZ64478.1|1856523_1857183_+	response regulator	NA	W8CYM9	Bacillus_phage	33.8	1.1e-34
AWZ63258.1|1857179_1858535_+	signal transduction histidine-protein kinase ArlS	NA	A0A1V0SGX0	Hokovirus	25.0	8.9e-10
AWZ63944.1|1858823_1861622_+	oxoglutarate dehydrogenase (succinyl-transferring), E1 component	NA	NA	NA	NA	NA
AWZ63856.1|1861635_1862904_+	dihydrolipoyllysine-residue succinyltransferase	NA	NA	NA	NA	NA
AWZ64797.1|1863483_1864293_+	glyoxalase/Bleomycin resistance /Dioxygenase superfamily protein	NA	NA	NA	NA	NA
AWZ63384.1|1864321_1864525_+	putative hypothetical protein YozC	NA	NA	NA	NA	NA
AWZ62553.1|1864705_1865497_+	ATPase associated with various cellular activities family protein	NA	R4TG24	Halovirus	34.2	3.3e-12
AWZ62782.1|1865510_1867397_+	cobalamin biosynthesis CobT VWA domain protein	NA	NA	NA	NA	NA
AWZ64632.1|1867621_1868965_+	branched-chain amino acid transport system II carrier protein	NA	NA	NA	NA	NA
AWZ64376.1|1869038_1870175_-	telA-like protein	NA	A0A291I9K4	Lactobacillus_phage	28.3	7.4e-34
AWZ64812.1|1870206_1870830_-|lysis	5-bromo-4-chloroindolyl phosphate hydrolysis family protein	lysis	NA	NA	NA	NA
AWZ64306.1|1870854_1871124_-	acylphosphatase family protein	NA	NA	NA	NA	NA
AWZ63469.1|1871282_1871591_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ64344.1|1871761_1871962_+	cold shock protein CspA	NA	Q9AZD3	Lactococcus_phage	66.2	8.4e-18
AWZ64383.1|1872158_1872560_+	putative membrane protein	NA	NA	NA	NA	NA
AWZ63735.1|1872693_1873311_+|protease	protease synthase and sporulation protein PAI 2	protease	NA	NA	NA	NA
>prophage 6
CP030323	Staphylococcus aureus strain AR_475 chromosome, complete genome	2790267	1963755	1972531	2790267	head,integrase	Staphylococcus_phage(70.0%)	14	1960831:1960848	1979145:1979162
1960831:1960848	attL	ATTCAATCATTAATATAT	NA	NA	NA	NA
AWZ64563.1|1963755_1964289_-|head	putative phage head morphogenesis protein	head	M1Q184	Streptococcus_phage	32.6	7.8e-18
AWZ64899.1|1964491_1964614_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ64319.1|1964941_1965220_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ63091.1|1965375_1965570_-	LSM domain protein	NA	A0A1J0MG79	Staphylococcus_phage	71.4	2.8e-18
AWZ62889.1|1965569_1965827_-	hypothetical protein	NA	A0A1J0MF61	Staphylococcus_phage	62.7	1.4e-25
AWZ63987.1|1965820_1966093_-	putative phage F-like protein	NA	A0A1J0MFV1	Staphylococcus_phage	62.5	8.8e-26
AWZ64459.1|1966297_1966549_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ64160.1|1966565_1966721_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ63255.1|1967291_1967477_-	hypothetical protein	NA	A0A0F6N3H3	Staphylococcus_phage	78.7	2.4e-19
AWZ62906.1|1967810_1969103_+|integrase	integrase core domain protein	integrase	A0A2L1IVA1	Escherichia_phage	30.8	2.6e-14
AWZ64004.1|1969095_1969857_+	istB-like ATP binding family protein	NA	A0A059NT77	Lactococcus_phage	44.2	1.1e-54
AWZ64530.1|1970917_1971124_-	hypothetical protein	NA	A0A2H4PQT0	Staphylococcus_phage	56.7	1.9e-12
AWZ63704.1|1971419_1971632_-	hypothetical protein	NA	A0A1W6JNK0	Staphylococcus_phage	71.0	3.1e-18
AWZ62927.1|1972333_1972531_-	cro/C1-type HTH DNA-binding domain protein	NA	A0A1W6JNK0	Staphylococcus_phage	48.4	1.7e-10
1979145:1979162	attR	ATATATTAATGATTGAAT	NA	NA	NA	NA
>prophage 7
CP030323	Staphylococcus aureus strain AR_475 chromosome, complete genome	2790267	2233092	2241565	2790267		Synechococcus_phage(33.33%)	9	NA	NA
AWZ63472.1|2233092_2233659_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	40.1	3.6e-29
AWZ63237.1|2233661_2234690_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	41.4	1.3e-61
AWZ62512.1|2234682_2236167_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	31.5	1.6e-44
AWZ63325.1|2236145_2238335_-	phosphoribosylformylglycinamidine synthase II	NA	A6N228	Microbacterium_phage	39.7	1.8e-140
AWZ64133.1|2238327_2238999_-	phosphoribosylformylglycinamidine synthase I	NA	NA	NA	NA	NA
AWZ63544.1|2239000_2239264_-	phosphoribosylformylglycinamidine synthase, purS protein	NA	NA	NA	NA	NA
AWZ63931.1|2239263_2239968_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	M4R1E8	Synechococcus_phage	41.2	1.4e-46
AWZ64013.1|2239971_2241096_-	N5-carboxyaminoimidazole ribonucleotide synthase	NA	NA	NA	NA	NA
AWZ63971.1|2241082_2241565_-	phosphoribosylaminoimidazole carboxylase, catalytic subunit	NA	A0A2P0VNU7	Tetraselmis_virus	44.7	8.0e-22
>prophage 8
CP030323	Staphylococcus aureus strain AR_475 chromosome, complete genome	2790267	2272777	2319464	2790267	tRNA,transposase,protease,bacteriocin	Streptococcus_phage(28.57%)	42	NA	NA
AWZ64626.1|2272777_2273419_-|bacteriocin	putative bacteriocin ABC transporter family protein	bacteriocin	G9BWD6	Planktothrix_phage	33.7	1.7e-19
AWZ64965.1|2273415_2273736_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ64380.1|2273738_2275703_-|bacteriocin	bacteriocin-associated integral membrane family protein	bacteriocin	NA	NA	NA	NA
AWZ62821.1|2275746_2276034_-|bacteriocin	bacteriocin family protein	bacteriocin	NA	NA	NA	NA
AWZ62788.1|2277023_2278670_-|transposase	transposase DDE domain protein	transposase	A0A146ICT8	Staphylococcus_phage	99.3	3.7e-292
AWZ63785.1|2279065_2279596_-|protease	CAAX protease self-immunity family protein	protease	NA	NA	NA	NA
AWZ64377.1|2279682_2279859_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ64871.1|2280057_2281044_+	lipoyltransferase and lipoate-ligase family protein	NA	NA	NA	NA	NA
AWZ63560.1|2281124_2281343_-	IDEAL domain protein	NA	NA	NA	NA	NA
AWZ63586.1|2281552_2282122_+	comK family protein	NA	NA	NA	NA	NA
AWZ62574.1|2282610_2284122_-	5'-nucleotidase, C-terminal domain protein	NA	NA	NA	NA	NA
AWZ63876.1|2284260_2285619_-	cation transport family protein	NA	NA	NA	NA	NA
AWZ64835.1|2285635_2287945_-	trypsin-like peptidase domain protein	NA	W5SAB9	Pithovirus	27.4	2.1e-11
AWZ62980.1|2288175_2288973_-	integral membrane, YkoY family protein	NA	S5MAL1	Bacillus_phage	40.5	1.6e-30
AWZ63981.1|2289280_2290843_-	peptide chain release factor 3	NA	A0A1S5SF82	Streptococcus_phage	28.2	2.2e-36
AWZ63107.1|2290842_2291094_-	yueH-like family protein	NA	NA	NA	NA	NA
AWZ63140.1|2291083_2292568_-	UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--L- lysine ligase	NA	NA	NA	NA	NA
AWZ62986.1|2293000_2294176_+	processive diacylglycerol glucosyltransferase	NA	NA	NA	NA	NA
AWZ64262.1|2294257_2294473_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ63556.1|2294561_2295344_+	putative glycolipid permease LtaA	NA	NA	NA	NA	NA
AWZ63116.1|2295456_2295966_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ64758.1|2296700_2297552_-	hhH-GPD superbase excision DNA repair family protein	NA	NA	NA	NA	NA
AWZ63223.1|2297553_2298279_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ62827.1|2298444_2299203_-	esterase family protein	NA	NA	NA	NA	NA
AWZ63371.1|2299345_2300914_-	amino acid carrier family protein	NA	NA	NA	NA	NA
AWZ62638.1|2301255_2302341_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ64325.1|2302537_2303308_-	enoyl-[acyl-carrier-protein] reductase [NADPH] FabI	NA	NA	NA	NA	NA
AWZ64423.1|2303586_2305431_-	sodium/hydrogen exchanger family protein	NA	NA	NA	NA	NA
AWZ64793.1|2305440_2306826_-	magnesium transporter	NA	NA	NA	NA	NA
AWZ62662.1|2306846_2307701_-	RNA pseudouridylate synthase family protein	NA	NA	NA	NA	NA
AWZ64055.1|2307697_2308507_-	ATP-NAD kinase family protein	NA	NA	NA	NA	NA
AWZ63485.1|2308523_2309159_-	putative RelA/SpoT domain protein	NA	NA	NA	NA	NA
AWZ63293.1|2309175_2309523_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ63419.1|2309708_2310302_+	CYTH domain protein	NA	NA	NA	NA	NA
AWZ64430.1|2310405_2310771_+	globin family protein	NA	NA	NA	NA	NA
AWZ63001.1|2310793_2311600_+	thioredoxin family protein	NA	NA	NA	NA	NA
AWZ64827.1|2312059_2313868_-	oligoendopeptidase F	NA	A0A1X9I5X5	Streptococcus_phage	24.5	5.5e-47
AWZ64237.1|2313915_2314902_-	competence CoiA-like family protein	NA	NA	NA	NA	NA
AWZ64177.1|2315022_2315742_-	adapter protein MecA	NA	NA	NA	NA	NA
AWZ63468.1|2316112_2316508_-	regulatory protein spx	NA	NA	NA	NA	NA
AWZ63862.1|2316802_2317792_+|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
AWZ64276.1|2317817_2319464_-|transposase	transposase DDE domain protein	transposase	A0ZS58	Staphylococcus_virus	99.1	1.6e-292
>prophage 9
CP030323	Staphylococcus aureus strain AR_475 chromosome, complete genome	2790267	2411359	2429368	2790267	integrase,terminase,coat	Staphylococcus_phage(79.17%)	28	2410377:2410398	2431041:2431062
2410377:2410398	attL	AGGGAGTGGGACAGAAATGATA	NA	NA	NA	NA
AWZ64828.1|2411359_2411545_-	hypothetical protein	NA	A0A0F6N3H3	Staphylococcus_phage	100.0	2.7e-26
AWZ64157.1|2412253_2412811_+	putative penicillin binding protein	NA	A0A1W6JQE5	Staphylococcus_phage	73.8	1.4e-70
AWZ64195.1|2412888_2413689_-	enterotoxin type B	NA	A0A097PAT7	Streptococcus_pyogenes_phage	49.4	1.0e-53
AWZ64689.1|2413996_2414566_-|terminase	terminase small subunit	terminase	Q4ZE85	Staphylococcus_phage	97.9	1.0e-100
AWZ62707.1|2414562_2414904_-	putative pathogenicity island protein	NA	A0A1W6JQM3	Staphylococcus_phage	99.1	3.8e-58
AWZ64072.1|2414906_2415434_-|coat	putative spore coat protein	coat	A0A1W6JQH7	Staphylococcus_phage	97.1	3.5e-87
AWZ63465.1|2415484_2415703_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ64203.1|2415720_2416299_-	putative pathogenicity island protein	NA	A0A2H4JBG0	uncultured_Caudovirales_phage	38.4	1.4e-28
AWZ63537.1|2416310_2416652_-	putative saPI1 ORF8-like protein	NA	Q4ZE66	Staphylococcus_phage	99.1	1.4e-57
AWZ64687.1|2417168_2417810_-	putative saPI1 ORF9-like protein	NA	Q4ZE67	Staphylococcus_phage	91.5	1.5e-108
AWZ63214.1|2417806_2418091_-	putative pathogenicity island protein	NA	A0A1W6JQE4	Staphylococcus_phage	95.7	1.9e-47
AWZ63152.1|2418092_2418455_-	putative interference protein with phage growth	NA	A0A1W6JQD5	Staphylococcus_phage	99.2	8.9e-66
AWZ63458.1|2418740_2420210_-	virulence-associated E family protein	NA	A0A1W6JQD6	Staphylococcus_phage	99.0	2.9e-288
AWZ64857.1|2420226_2421096_-	primase C terminal 1 family protein	NA	A0A1W6JQL5	Staphylococcus_phage	92.7	3.4e-156
AWZ64642.1|2421159_2421480_-	hypothetical protein	NA	Q4ZE75	Staphylococcus_phage	51.9	1.3e-20
AWZ63589.1|2421482_2421692_-	putative pathogenicity island protein	NA	Q4ZE76	Staphylococcus_phage	94.2	1.7e-29
AWZ63085.1|2421684_2421831_-	putative membrane protein	NA	NA	NA	NA	NA
AWZ62586.1|2421842_2422115_-	putative pathogenicity island DNA-binding protein	NA	Q4ZE77	Staphylococcus_phage	90.0	9.7e-41
AWZ62592.1|2422107_2422371_-	helix-turn-helix family protein	NA	A0A2H4J9X2	uncultured_Caudovirales_phage	94.8	3.1e-36
AWZ64608.1|2422563_2422896_+	helix-turn-helix family protein	NA	A0A1J0MFC1	Staphylococcus_phage	74.5	1.6e-37
AWZ63553.1|2422907_2423366_+	hypothetical protein	NA	A0A0H4J322	Staphylococcus_phage	83.0	5.1e-66
AWZ63505.1|2423382_2423814_+	hypothetical protein	NA	Q4ZCB6	Staphylococcus_virus	56.0	5.1e-36
AWZ62857.1|2423883_2424612_+	toxin beta-grasp domain protein	NA	A0EX09	Staphylococcus_phage	35.4	2.3e-28
AWZ64374.1|2424635_2425364_+	toxin beta-grasp domain protein	NA	A0EX09	Staphylococcus_phage	31.8	5.5e-22
AWZ62859.1|2425452_2426673_+|integrase	phage integrase family protein	integrase	Q4ZE80	Staphylococcus_phage	47.5	6.4e-100
AWZ62576.1|2426815_2427637_-	NLPA lipofamily protein	NA	NA	NA	NA	NA
AWZ62891.1|2427654_2428308_-	methionine import system permease protein MetP	NA	NA	NA	NA	NA
AWZ64094.1|2428342_2429368_-	methionine import ATP-binding protein MetN 2	NA	G9BWD6	Planktothrix_phage	36.8	9.4e-28
2431041:2431062	attR	TATCATTTCTGTCCCACTCCCT	NA	NA	NA	NA
>prophage 10
CP030323	Staphylococcus aureus strain AR_475 chromosome, complete genome	2790267	2511938	2536024	2790267	transposase	uncultured_Caudovirales_phage(33.33%)	18	NA	NA
AWZ64483.1|2511938_2512700_-	ABC transporter family protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	31.6	8.5e-18
AWZ64757.1|2512696_2513653_-	fecCD transport family protein	NA	A0A2H4J116	uncultured_Caudovirales_phage	57.8	1.2e-05
AWZ64048.1|2513639_2514611_-	fecCD transport family protein	NA	A0A2H4IY97	uncultured_Caudovirales_phage	78.9	4.3e-139
AWZ64922.1|2515304_2516276_-	ribonucleoside-diphosphate reductase subunit beta	NA	A0A2H4J4P3	uncultured_Caudovirales_phage	91.0	2.7e-170
AWZ64081.1|2516393_2518499_-	ribonucleoside-diphosphate reductase, alpha subunit	NA	A0A2H4J2N6	uncultured_Caudovirales_phage	91.7	0.0e+00
AWZ63949.1|2518461_2518860_-	nrdI protein	NA	A0A2H4J545	uncultured_Caudovirales_phage	72.0	1.2e-52
AWZ63621.1|2519660_2520527_+	eamA-like transporter family protein	NA	NA	NA	NA	NA
AWZ63637.1|2520546_2521047_+	7-cyano-7-deazaguanine reductase	NA	E7DN65	Pneumococcus_phage	71.5	5.9e-52
AWZ64101.1|2521386_2522892_+	H+ symporter family protein	NA	A0A0P0IY73	Acinetobacter_phage	32.2	2.0e-58
AWZ62846.1|2523163_2524081_+	putative lipid kinase	NA	A0A1V0SBJ0	Catovirus	22.0	6.2e-07
AWZ62872.1|2524688_2525231_-	putative 5'(3')-deoxyribonucleotidase	NA	NA	NA	NA	NA
AWZ63175.1|2525389_2526448_-	histidinol-phosphate transaminase	NA	A0A1X6WGT4	Pacmanvirus	26.4	1.4e-21
AWZ64065.1|2526687_2528202_-	substrate binding domain of ABC-type glycine betaine transport system family protein	NA	NA	NA	NA	NA
AWZ64881.1|2528194_2529172_-	ABC transporter family protein	NA	G3M9Y6	Bacillus_virus	33.3	5.4e-25
AWZ62675.1|2529393_2531172_-	ATP-dependent DNA helicase RecQ	NA	A0A2P1EM61	Moumouvirus	36.8	6.5e-77
AWZ62843.1|2531186_2533064_-	heme ABC exporter, ATP-binding protein CcmA	NA	A0A2K9L3Z8	Tupanvirus	30.6	4.3e-55
AWZ63436.1|2533414_2533900_-|transposase	transposase IS200 like family protein	transposase	A0A1P8BMC0	Lactococcus_phage	35.4	3.8e-19
AWZ64122.1|2534083_2536024_-	lipoteichoic acid synthase	NA	W6LM83	Streptococcus_phage	39.5	1.3e-110
>prophage 11
CP030323	Staphylococcus aureus strain AR_475 chromosome, complete genome	2790267	2539172	2546992	2790267		Pandoravirus(16.67%)	10	NA	NA
AWZ62902.1|2539172_2540324_-	aminodeoxychorismate synthase, component I	NA	S4VNU7	Pandoravirus	36.1	2.1e-23
AWZ63764.1|2540307_2540901_-	glutamine amidotransferase of anthranilate synthase/aminodeoxychorismate synthase family protein	NA	A0A0P0IKJ1	Acinetobacter_phage	44.0	6.8e-39
AWZ64513.1|2541251_2541920_+	queuosine biosynthesis protein QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	57.5	9.6e-66
AWZ63817.1|2541921_2542341_+	queuosine biosynthesis protein QueD	NA	S4U060	uncultured_phage	28.7	6.3e-07
AWZ62555.1|2542344_2543058_+	7-cyano-7-deazaguanosine (preQ0) biosynthesis protein QueE	NA	A0A1U9WRB6	Streptococcus_virus	43.5	6.5e-52
AWZ64150.1|2543156_2543741_+	putative membrane protein	NA	NA	NA	NA	NA
AWZ63263.1|2544020_2544461_+	electron transfer DM13 family protein	NA	NA	NA	NA	NA
AWZ63855.1|2544802_2545276_+	doxX family protein	NA	NA	NA	NA	NA
AWZ63919.1|2545250_2545937_+	response regulator	NA	NA	NA	NA	NA
AWZ63572.1|2545936_2546992_+	histidine protein kinase SaeS	NA	A0A1V0SGX0	Hokovirus	29.8	3.6e-14
>prophage 1
CP030324	Staphylococcus aureus strain AR_475 plasmid unnamed1, complete sequence	27168	1161	16355	27168	transposase	Staphylococcus_phage(33.33%)	18	NA	NA
AWZ65000.1|1161_2628_-	ABC transporter family protein	NA	A0A2I4R674	Erysipelothrix_phage	37.9	3.9e-67
AWZ65023.1|3101_3776_+|transposase	transposase IS66 family protein	transposase	A0A0N9RU54	Staphylococcus_phage	97.3	1.7e-126
AWZ65024.1|3915_4590_+	response regulator	NA	NA	NA	NA	NA
AWZ65018.1|4586_4769_+	putative membrane protein	NA	NA	NA	NA	NA
AWZ65012.1|4865_5468_+	histidine kinase-, DNA gyrase B-, and HSP90-like ATPase family protein	NA	Q6XLV6	Feldmannia_irregularis_virus	29.6	2.8e-08
AWZ65030.1|5592_6513_+	ABC transporter family protein	NA	A0A2H4PQG7	Staphylococcus_phage	42.2	1.0e-41
AWZ65025.1|6553_7243_+	ABC-2 transporter family protein	NA	NA	NA	NA	NA
AWZ65001.1|7256_7460_+	bacitracin resistance BacA family protein	NA	NA	NA	NA	NA
AWZ65017.1|7489_8164_+|transposase	transposase IS66 family protein	transposase	A0A0N9RU54	Staphylococcus_phage	97.3	1.7e-126
AWZ65011.1|8340_8940_+	streptomycin adenylyltransferase family protein	NA	E4ZFP8	Streptococcus_phage	99.5	1.2e-115
AWZ65016.1|8936_9479_+	acetyltransferase family protein	NA	A0A1B0RXL7	Streptococcus_phage	100.0	8.9e-94
AWZ65021.1|9571_10366_+	aminoglycoside 3'-phosphotransferase	NA	E4ZFP6	Streptococcus_phage	100.0	2.3e-154
AWZ65008.1|10848_10977_+	putative hTH domain protein	NA	E4ZFP5	Streptococcus_phage	100.0	6.2e-14
AWZ65005.1|11018_11693_-	DDE domain protein	NA	A0A0N9SKD3	Staphylococcus_phage	99.6	6.8e-128
AWZ65019.1|12433_13012_-	resolvase, N terminal domain protein	NA	A0A0A7NPV4	Enterobacteria_phage	51.7	4.9e-42
AWZ65027.1|13275_13656_-	methicillin resistance regulatory protein MecI	NA	NA	NA	NA	NA
AWZ65015.1|13645_15403_-	regulatory protein BlaR1	NA	NA	NA	NA	NA
AWZ65026.1|15509_16355_+	beta-lactamase	NA	A0A1B0VBP7	Salmonella_phage	34.0	5.7e-31
