The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP030341	Klebsiella pneumoniae strain AR_362 chromosome, complete genome	5379490	739109	772367	5379490	integrase,head,tRNA,portal,terminase,capsid,protease,tail	uncultured_Caudovirales_phage(68.75%)	34	756717:756734	772712:772729
AWZ75005.1|739109_740057_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	37.2	2.2e-07
AWZ77767.1|740071_740566_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	40.3	2.5e-18
AWZ72611.1|740709_741834_+	DNA protecting protein DprA	NA	NA	NA	NA	NA
AWZ75079.1|741805_742279_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ73658.1|742304_742847_+	topoisomerase DNA binding C4 zinc finger family protein	NA	NA	NA	NA	NA
AWZ75349.1|742851_743424_+|tRNA	tRNA threonylcarbamoyladenosine biosynthesis protein RimN	tRNA	NA	NA	NA	NA
AWZ77859.1|743427_744246_+	shikimate dehydrogenase	NA	NA	NA	NA	NA
AWZ73258.1|744242_744500_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ76902.1|744475_745030_-	bacterial transferase hexapeptide family protein	NA	NA	NA	NA	NA
AWZ77730.1|750825_751047_-	prokaryotic membrane lipolipid attachment site family protein	NA	NA	NA	NA	NA
AWZ72828.1|751340_754451_-	RND transporter, hydrophobe/amphiphile efflux-1 family protein	NA	NA	NA	NA	NA
AWZ75744.1|754463_755603_-	efflux transporter, RND family, MFP subunit	NA	NA	NA	NA	NA
AWZ75446.1|755981_756632_+	putative acrEF/envCD operon repressor	NA	NA	NA	NA	NA
756717:756734	attL	GTATCAGTTCATGCCGTA	NA	NA	NA	NA
AWZ77448.1|756907_758134_+|integrase	phage integrase family protein	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	62.2	1.8e-150
AWZ74488.1|758226_759168_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ72636.1|759349_759634_+	prophage CP4-57 regulatory family protein	NA	NA	NA	NA	NA
AWZ72606.1|759644_760424_+	phage antirepressor KilAC domain protein	NA	Q8HA02	Enterobacteria_phage	51.5	6.2e-40
AWZ75979.1|760965_761145_+	hypothetical protein	NA	A0A2H4JGW3	uncultured_Caudovirales_phage	94.9	2.6e-26
AWZ73223.1|761137_761326_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ75563.1|761318_761633_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ76433.1|761629_761998_+	hypothetical protein	NA	A0A2H4JCX7	uncultured_Caudovirales_phage	81.1	3.7e-51
AWZ76681.1|761994_762360_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ77143.1|762365_764495_+	hypothetical protein	NA	A0A1W6JPG0	Morganella_phage	62.4	3.4e-205
AWZ77655.1|764837_765173_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ77646.1|765221_765734_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ74782.1|765997_767164_+|capsid	phage major capsid protein, HK97 family	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	95.9	9.8e-207
AWZ74991.1|767215_767776_+|head,protease	phage prohead protease, HK97 family	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	95.7	1.2e-98
AWZ75765.1|767777_769019_+|portal	phage portal protein, HK97 family	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	96.5	1.0e-230
AWZ77599.1|769195_769351_+|head,tail	phage head-tail joining family protein	head,tail	A0A1P8DTK6	Proteus_phage	54.0	7.2e-09
AWZ76299.1|769347_769647_+|head,tail	phage gp6-like head-tail connector family protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	80.8	3.4e-39
AWZ77541.1|769697_770090_+	HNH endonuclease family protein	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	90.0	1.4e-64
AWZ73522.1|770076_770235_+	hypothetical protein	NA	A0A2H4JCY9	uncultured_Caudovirales_phage	88.0	2.5e-17
AWZ76566.1|770365_770722_+|terminase	phage terminase, small subunit, P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	99.2	5.5e-60
AWZ77726.1|770705_772367_+	phage Terminase family protein	NA	A0A2H4JB64	uncultured_Caudovirales_phage	97.8	0.0e+00
772712:772729	attR	GTATCAGTTCATGCCGTA	NA	NA	NA	NA
>prophage 2
CP030341	Klebsiella pneumoniae strain AR_362 chromosome, complete genome	5379490	1528943	1575178	5379490	head,integrase,tRNA,portal,terminase,capsid,lysis,tail,plate	Salmonella_phage(87.5%)	58	1527237:1527283	1563804:1563850
1527237:1527283	attL	TTTGGTGGAGCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACAT	NA	NA	NA	NA
AWZ75808.1|1528943_1529969_-|integrase	phage integrase family protein	integrase	A0A1S6L016	Salmonella_phage	93.8	1.5e-190
AWZ73086.1|1529971_1530289_-	putative phage regulatory protein cI	NA	A0A1S6KZZ7	Salmonella_phage	49.5	1.5e-24
AWZ77145.1|1530723_1530966_+	putative bacteriophage regulatory protein	NA	A0A1S6KZZ6	Salmonella_phage	98.8	4.0e-38
AWZ72883.1|1530998_1531508_+	phage regulatory CII family protein	NA	A0A1S6L008	Salmonella_phage	85.8	1.1e-77
AWZ76603.1|1531593_1531716_+	hypothetical protein	NA	A0A1S6L005	Salmonella_phage	60.5	5.9e-06
AWZ76907.1|1531679_1532018_+	putative prophage protein	NA	A0A218M4I7	Erwinia_phage	58.0	6.2e-29
AWZ73625.1|1532085_1532319_+	hypothetical protein	NA	A0A1S6L021	Salmonella_phage	90.9	6.0e-31
AWZ74354.1|1532318_1532546_+	phage/conjugal plasmid C-4 type zinc finger, TraR family protein	NA	A0A1S6L007	Salmonella_phage	92.0	5.1e-35
AWZ75594.1|1532542_1533394_+	DNA adenine methylase family protein	NA	A0A1S6L011	Salmonella_phage	75.4	2.2e-115
AWZ75445.1|1533390_1535775_+	bacteriophage replication protein A	NA	A0A1S6L028	Salmonella_phage	87.9	0.0e+00
AWZ74363.1|1535937_1536126_+	putative levan regulatory protein	NA	A0A1S6L006	Salmonella_phage	90.3	2.2e-23
AWZ73761.1|1536137_1536371_+	dinI-like family protein	NA	A0A0M4S6H1	Salmonella_phage	96.1	2.0e-34
AWZ77265.1|1536466_1537150_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ75236.1|1537136_1538216_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ73610.1|1538215_1539217_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ77226.1|1540064_1540967_-|portal	phage portal protein, PBSX family	portal	A0A1S6KZW5	Salmonella_phage	89.1	4.7e-156
AWZ73678.1|1541107_1542862_-|terminase	terminase-like family protein	terminase	A0A1S6KZW3	Salmonella_phage	91.8	0.0e+00
AWZ73155.1|1543011_1543845_+|capsid	phage capsid scaffolding (GPO) serine peptidase family protein	capsid	A0A1S6KZW9	Salmonella_phage	77.6	4.4e-100
AWZ75575.1|1543861_1544914_+|capsid	phage major capsid protein, P2 family	capsid	A0A1S6KZZ3	Salmonella_phage	91.0	6.8e-175
AWZ77459.1|1544917_1545571_+|terminase	phage small terminase subunit	terminase	A0A1S6KZX1	Salmonella_phage	80.0	1.9e-90
AWZ72798.1|1545666_1546131_+|head	phage head completion family protein	head	A0A1S6KZW8	Salmonella_phage	85.7	1.5e-73
AWZ77685.1|1546130_1546334_+	phage Tail Protein X family protein	NA	E5G6M9	Salmonella_phage	89.6	9.8e-30
AWZ75798.1|1546337_1546553_+	putative membrane protein	NA	E5G6N0	Salmonella_phage	88.7	6.1e-30
AWZ75447.1|1546533_1547043_+	phage lysozyme family protein	NA	E5G6N1	Salmonella_phage	85.2	1.6e-81
AWZ74814.1|1547047_1547431_+	putative membrane protein	NA	A0A1S6KZZ2	Salmonella_phage	45.4	1.9e-18
AWZ77170.1|1547427_1547856_+|lysis	phage lysis regulatory, LysB family protein	lysis	A0A1S6KZX8	Salmonella_phage	82.5	7.1e-54
AWZ73827.1|1547951_1548374_+|tail	P2 phage tail completion R family protein	tail	A0A1S6KZY0	Salmonella_phage	83.2	8.2e-63
AWZ74525.1|1548366_1548813_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	72.3	2.5e-54
AWZ75363.1|1548835_1549702_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ73866.1|1549796_1550369_+|plate	phage baseplate assembly V family protein	plate	E5G6N6	Salmonella_phage	70.8	1.4e-76
AWZ75621.1|1550365_1550728_+	lysozyme family protein	NA	A0A1S6KZZ4	Salmonella_phage	85.6	8.4e-48
AWZ76778.1|1550714_1551623_+|plate	baseplate J-like family protein	plate	E5G6N8	Salmonella_phage	68.9	1.9e-109
AWZ76177.1|1551663_1552287_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	56.0	6.7e-53
AWZ75324.1|1552288_1554238_+	cotH family protein	NA	Q6QI97	Burkholderia_phage	38.9	1.0e-06
AWZ73084.1|1554247_1555366_+	hypothetical protein	NA	A0A248XD67	Klebsiella_phage	38.0	4.4e-55
AWZ76735.1|1555417_1556491_+|tail	phage tail-collar fiber family protein	tail	A0A1S6KZZ8	Salmonella_phage	53.6	6.6e-40
AWZ76095.1|1556639_1557812_+|tail	phage tail sheath family protein	tail	A0A1S6KZY7	Salmonella_phage	91.5	3.4e-207
AWZ76311.1|1557821_1558337_+|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	84.2	1.4e-80
AWZ73533.1|1558389_1558689_+	mu-like prophage FluMu gp41 family protein	NA	E5G6P9	Salmonella_phage	78.0	8.2e-33
AWZ77088.1|1558703_1558823_+	phage P2 GpE family protein	NA	E5G6Q0	Salmonella_phage	87.2	2.2e-13
AWZ77441.1|1558815_1561446_+|tail	phage tail tape measure protein, TP901 family, core region	tail	E5FFG5	Burkholderia_phage	41.9	8.9e-115
AWZ77113.1|1561442_1561928_+	phage P2 GpU family protein	NA	E5G6Q2	Salmonella_phage	80.1	5.2e-61
AWZ76768.1|1561924_1563019_+	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	83.6	2.4e-170
AWZ73577.1|1563331_1563499_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ73332.1|1563632_1563779_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ74430.1|1564312_1564795_-	ssrA-binding protein	NA	W5RAM5	Staphylococcus_phage	47.4	2.3e-29
1563804:1563850	attR	TTTGGTGGAGCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACAT	NA	NA	NA	NA
AWZ72940.1|1564944_1565382_+	ribosome association toxin RatA	NA	NA	NA	NA	NA
AWZ74864.1|1565371_1565662_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ74937.1|1565728_1566070_-	smpA / OmlA family protein	NA	NA	NA	NA	NA
AWZ75332.1|1566217_1567879_-	DNA repair protein RecN	NA	NA	NA	NA	NA
AWZ76530.1|1567965_1568844_-	ATP-NAD kinase family protein	NA	NA	NA	NA	NA
AWZ73300.1|1568968_1569559_+	protein GrpE	NA	NA	NA	NA	NA
AWZ74827.1|1569678_1570920_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ75720.1|1570984_1571776_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
AWZ75710.1|1571939_1573304_+	signal recognition particle protein	NA	NA	NA	NA	NA
AWZ74231.1|1573563_1573812_+	ribosomal protein S16	NA	NA	NA	NA	NA
AWZ76757.1|1573920_1574379_+	16S rRNA processing protein RimM	NA	NA	NA	NA	NA
AWZ75419.1|1574410_1575178_+|tRNA	tRNA (guanine(37)-N(1))-methyltransferase	tRNA	NA	NA	NA	NA
>prophage 3
CP030341	Klebsiella pneumoniae strain AR_362 chromosome, complete genome	5379490	1679903	1724746	5379490	integrase,head,terminase,protease,tail	Salmonella_phage(38.78%)	56	1682467:1682481	1693647:1693661
AWZ76028.1|1679903_1681370_+	inosine-5'-monophosphate dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.7	1.2e-87
AWZ77123.1|1681437_1683015_+	GMP synthase	NA	NA	NA	NA	NA
1682467:1682481	attL	TCTGCCGCTTCCGCC	NA	NA	NA	NA
AWZ74228.1|1683207_1684458_+|integrase	phage integrase family protein	integrase	A0A1X9TCT6	Enterobacter_phage	85.3	1.4e-206
AWZ72876.1|1684474_1684666_-	putative cell division initiation protein	NA	NA	NA	NA	NA
AWZ73710.1|1684841_1685435_-	MT-A70 family protein	NA	T1SA14	Salmonella_phage	92.4	4.3e-110
AWZ75711.1|1685431_1685590_-	hypothetical protein	NA	T1SAR0	Salmonella_phage	78.8	1.9e-17
AWZ76399.1|1685582_1685867_-	perC transcriptional activator family protein	NA	T1S9J5	Salmonella_phage	72.3	5.6e-31
AWZ73161.1|1685985_1686234_-	prophage CP4-57 regulatory family protein	NA	A0A0F6TJ45	Escherichia_coli_O157_typing_phage	69.5	1.1e-27
AWZ76996.1|1686285_1686738_-	recombinase, phage RecT family protein	NA	Q858E1	Salmonella_phage	91.9	5.7e-70
AWZ75260.1|1687317_1688217_-	putative phage-type endonuclease domain protein	NA	Q858E0	Salmonella_phage	93.0	1.5e-159
AWZ74949.1|1688213_1688513_-	hypothetical protein	NA	A0A0F6R7M4	Escherichia_coli_O157_typing_phage	54.5	2.1e-20
AWZ77521.1|1688509_1688659_-	hypothetical protein	NA	G9L6A5	Escherichia_phage	84.2	7.9e-13
AWZ75221.1|1688879_1689461_-	helix-turn-helix family protein	NA	Q858D7	Salmonella_phage	64.8	1.9e-65
AWZ77122.1|1689614_1689848_+	hypothetical protein	NA	T1SAR5	Salmonella_phage	66.2	9.2e-24
AWZ77111.1|1689994_1690204_+	hypothetical protein	NA	A0A193GYW4	Enterobacter_phage	78.3	1.8e-26
AWZ72672.1|1690203_1690971_+	putative primosomal protein I	NA	A0A193GZ86	Enterobacter_phage	91.4	8.9e-140
AWZ73838.1|1690967_1691753_+	replication P family protein	NA	A0A193GYX1	Enterobacter_phage	87.4	8.2e-133
AWZ73672.1|1691917_1692220_+	hypothetical protein	NA	A0A0F6R8N5	Escherichia_coli_O157_typing_phage	83.0	1.4e-43
AWZ73603.1|1692281_1692416_+	putative membrane protein	NA	NA	NA	NA	NA
AWZ75816.1|1692412_1692823_+	hypothetical protein	NA	A0A2P1MXC5	Escherichia_phage	42.2	3.1e-14
AWZ77580.1|1692806_1692998_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ74919.1|1692994_1693420_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ74935.1|1693416_1694160_+	hypothetical protein	NA	A6N3G8	Burkholderia_virus	59.5	1.5e-19
1693647:1693661	attR	GGCGGAAGCGGCAGA	NA	NA	NA	NA
AWZ75855.1|1694159_1694330_+	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	69.6	2.5e-15
AWZ77560.1|1694330_1694543_+	hypothetical protein	NA	A0A0F6TJE4	Escherichia_coli_O157_typing_phage	45.5	8.1e-11
AWZ72930.1|1694539_1695208_+	hypothetical protein	NA	Q6UAT8	Klebsiella_phage	52.5	1.5e-05
AWZ77564.1|1695200_1695440_+	hypothetical protein	NA	G8C7S3	Escherichia_phage	48.0	4.6e-10
AWZ73559.1|1695439_1695778_+	hypothetical protein	NA	A0A193GYX4	Enterobacter_phage	80.0	4.7e-45
AWZ73406.1|1695852_1696110_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ76090.1|1696187_1696772_+|terminase	terminase small subunit	terminase	T1SBI8	Salmonella_phage	88.1	2.4e-89
AWZ77591.1|1696768_1698244_+	hypothetical protein	NA	Q858H3	Salmonella_phage	93.1	3.8e-280
AWZ75611.1|1698310_1698622_-	phage family protein	NA	A0A0F6TJP2	Escherichia_coli_O157_typing_phage	45.2	2.5e-16
AWZ73860.1|1699423_1699630_+	hypothetical protein	NA	T1SA67	Salmonella_phage	88.2	4.8e-08
AWZ76007.1|1699644_1701327_+|head,tail	bacteriophage head to tail connecting family protein	head,tail	A0A0F6TJD8	Escherichia_coli_O157_typing_phage	84.6	2.3e-265
AWZ76648.1|1701323_1701620_+	hypothetical protein	NA	T1SBI9	Salmonella_phage	70.4	1.2e-33
AWZ75521.1|1701622_1702303_+|protease	putative endoprotease	protease	G9L6C4	Escherichia_phage	83.5	4.0e-75
AWZ75526.1|1702317_1703304_+	hypothetical protein	NA	A0A193GZ49	Enterobacter_phage	93.9	1.6e-178
AWZ76982.1|1703357_1703795_+	hypothetical protein	NA	A0A193GYT9	Enterobacter_phage	91.0	4.8e-66
AWZ72895.1|1703805_1704147_+	hypothetical protein	NA	G9L6C7	Escherichia_phage	70.8	4.0e-36
AWZ74759.1|1704197_1704521_+	hypothetical protein	NA	G9L6C8	Escherichia_phage	85.0	5.3e-46
AWZ73030.1|1704520_1705126_+	hypothetical protein	NA	A0A0F6TJN5	Escherichia_coli_O157_typing_phage	78.5	2.8e-88
AWZ72730.1|1705125_1707624_+	hypothetical protein	NA	Q858G3	Salmonella_phage	84.0	0.0e+00
AWZ73237.1|1707833_1708088_+	hypothetical protein	NA	Q858G2	Salmonella_phage	83.3	2.2e-39
AWZ77133.1|1708087_1708627_+	hypothetical protein	NA	A0A0F6TJ56	Escherichia_coli_O157_typing_phage	80.0	6.1e-71
AWZ76925.1|1708637_1711469_+	hypothetical protein	NA	Q858G0	Salmonella_phage	75.7	0.0e+00
AWZ75533.1|1711468_1713379_+	hypothetical protein	NA	Q858F9	Salmonella_phage	81.9	5.2e-290
AWZ73893.1|1713378_1716144_+	hypothetical protein	NA	Q858F8	Salmonella_phage	94.5	0.0e+00
AWZ74749.1|1716140_1716260_-	putative membrane protein	NA	NA	NA	NA	NA
AWZ74177.1|1716755_1717445_-	BRO family, N-terminal domain protein	NA	G9L6E2	Escherichia_phage	65.2	1.6e-79
AWZ77166.1|1718212_1720579_+	putative endo-N-acetylneuraminidase	NA	A0A2H5BN49	Klebsiella_phage	79.5	9.1e-268
AWZ72988.1|1720587_1720740_+	hypothetical protein	NA	A0A2H5BN82	Klebsiella_phage	54.3	1.9e-06
AWZ77065.1|1720863_1721268_+	putative membrane protein	NA	T1SA79	Salmonella_phage	84.1	9.3e-56
AWZ75453.1|1721254_1721560_+	hypothetical protein	NA	A0A193GYK3	Enterobacter_phage	82.4	2.7e-39
AWZ73702.1|1721549_1722179_+	chitinase class I family protein	NA	Q858F0	Salmonella_phage	76.4	3.1e-90
AWZ75685.1|1722175_1722658_+	hypothetical protein	NA	Q858E9	Salmonella_phage	80.6	3.0e-61
AWZ74240.1|1722877_1724746_-	type I phosphodiesterase / nucleotide pyrophosphatase family protein	NA	A0A2P0VMN7	Tetraselmis_virus	22.6	2.6e-07
>prophage 4
CP030341	Klebsiella pneumoniae strain AR_362 chromosome, complete genome	5379490	2053642	2060549	5379490		Planktothrix_phage(33.33%)	7	NA	NA
AWZ77239.1|2053642_2054506_+	ABC transporter family protein	NA	G9BWD6	Planktothrix_phage	27.5	5.7e-10
AWZ75610.1|2054516_2055290_+	ABC transporter family protein	NA	G9BWD6	Planktothrix_phage	36.3	1.5e-25
AWZ74419.1|2055400_2055532_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ77689.1|2055532_2056426_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.8	6.1e-15
AWZ72706.1|2056671_2058033_-	peptidase U32 family protein	NA	Q6DW11	Phage_TP	94.5	2.5e-206
AWZ75149.1|2058351_2059074_-	transcriptional regulatory, C terminal family protein	NA	W8CYM9	Bacillus_phage	33.2	6.4e-31
AWZ74035.1|2059070_2060549_-	signal transduction histidine-protein kinase BaeS	NA	W8CYF6	Bacillus_phage	28.3	1.1e-29
>prophage 5
CP030341	Klebsiella pneumoniae strain AR_362 chromosome, complete genome	5379490	2097080	2104705	5379490		Enterobacteria_phage(28.57%)	7	NA	NA
AWZ74628.1|2097080_2098487_+	6-phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.7	4.7e-38
AWZ76851.1|2098711_2099776_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	55.0	3.4e-105
AWZ74599.1|2099802_2100672_+	glucose-1-phosphate thymidylyltransferase	NA	I7I009	Enterobacteria_phage	67.0	9.8e-111
AWZ73041.1|2100703_2101594_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	33.6	2.8e-28
AWZ73454.1|2101608_2102163_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	58.2	3.8e-52
AWZ77020.1|2102343_2103510_+	nucleotide sugar dehydrogenase family protein	NA	M1I798	Paramecium_bursaria_Chlorella_virus	54.7	4.1e-112
AWZ76728.1|2103703_2104705_+	polysaccharide biosynthesis family protein	NA	E3T4Y8	Cafeteria_roenbergensis_virus	28.6	1.2e-30
>prophage 6
CP030341	Klebsiella pneumoniae strain AR_362 chromosome, complete genome	5379490	3077257	3088144	5379490		Escherichia_phage(87.5%)	9	NA	NA
AWZ76021.1|3077257_3080365_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.6	0.0e+00
AWZ77420.1|3080419_3081685_+	lactose permease	NA	NA	NA	NA	NA
AWZ72971.1|3081715_3082804_-	AAA domain protein	NA	A0A077SLJ9	Escherichia_phage	100.0	8.0e-211
AWZ73633.1|3082890_3083151_-	hypothetical protein	NA	A0A077SK33	Escherichia_phage	97.7	3.5e-40
AWZ75908.1|3083448_3084309_+	beta-lactamase SHV-1	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
AWZ76228.1|3084329_3085091_-	deoR-like helix-turn-helix domain protein	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
AWZ75970.1|3085351_3086254_+	NAD binding domain of 6-phosphogluconate dehydrogenase family protein	NA	A0A077SLF7	Escherichia_phage	99.3	7.7e-159
AWZ76978.1|3086265_3087531_+	hypothetical protein	NA	A0A077SLJ7	Escherichia_phage	99.5	6.6e-233
AWZ74125.1|3087523_3088144_+	class II Aldolase and Adducin N-terminal domain protein	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
>prophage 7
CP030341	Klebsiella pneumoniae strain AR_362 chromosome, complete genome	5379490	3312364	3355412	5379490	integrase,protease,transposase,terminase,lysis	uncultured_Caudovirales_phage(31.11%)	60	3346525:3346539	3352534:3352548
AWZ76064.1|3312364_3315388_-	hypothetical protein	NA	A0A286S1P0	Klebsiella_phage	44.7	1.6e-22
AWZ74683.1|3315443_3315641_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ76614.1|3315615_3315747_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ74699.1|3315867_3316032_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ74848.1|3316506_3316953_-	hypothetical protein	NA	A0A0M5M1K4	Salmonella_phage	46.0	1.1e-28
AWZ77741.1|3317276_3318467_-	putative bacteriophage protein	NA	A0A0M4RD32	Salmonella_phage	72.7	1.9e-157
AWZ72760.1|3318472_3318826_-	putative bacteriophage protein	NA	A0A2H4J629	uncultured_Caudovirales_phage	80.3	2.3e-50
AWZ77594.1|3318827_3319481_-	putative translation initiation factor IF-2	NA	A0A2H4J8H6	uncultured_Caudovirales_phage	63.5	1.0e-59
AWZ74040.1|3319534_3319885_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ73360.1|3320137_3320323_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ73198.1|3320375_3320717_-	hypothetical protein	NA	A0A2H4J1A5	uncultured_Caudovirales_phage	46.6	1.8e-23
AWZ75230.1|3320716_3321739_-	putative bacteriophage protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	54.2	9.2e-100
AWZ72684.1|3321741_3321969_-	putative bacteriophage protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	56.0	4.6e-20
AWZ72637.1|3322044_3322458_-	hypothetical protein	NA	A0A2H4J1B3	uncultured_Caudovirales_phage	55.9	8.1e-31
AWZ74509.1|3322643_3324647_-	transglycosylase SLT domain protein	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	63.6	1.2e-247
AWZ72874.1|3324636_3324789_-	putative nTP pyrophosphohydrolase including oxidative damage repair enzyme	NA	A0A2H4J1A2	uncultured_Caudovirales_phage	88.0	7.6e-19
AWZ74049.1|3324824_3325250_-	putative bacteriophage protein	NA	A0A2H4J2V6	uncultured_Caudovirales_phage	63.4	2.6e-40
AWZ74875.1|3325253_3325454_-	hypothetical protein	NA	A0A0M5M1K6	Salmonella_phage	80.3	1.6e-24
AWZ73447.1|3325651_3325894_+|transposase	transposase family protein	transposase	Q6H9S4	Enterobacteria_phage	37.0	2.0e-05
AWZ72761.1|3325890_3326769_+|integrase	integrase core domain protein	integrase	U5P429	Shigella_phage	43.5	2.6e-50
AWZ75943.1|3327010_3328156_-	hypothetical protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	76.9	6.3e-166
AWZ76296.1|3328159_3328600_-	putative bacteriophage protein	NA	A0A2H4J1A0	uncultured_Caudovirales_phage	51.7	1.6e-40
AWZ75699.1|3328694_3329081_-	putative phage protein	NA	A0A2H4J1A4	uncultured_Caudovirales_phage	78.2	1.1e-48
AWZ77584.1|3329080_3329587_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ76617.1|3329583_3330003_-	hypothetical protein	NA	A0A0M5M3S2	Salmonella_phage	60.7	3.3e-40
AWZ76030.1|3329971_3330253_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ72932.1|3330292_3331228_-	hypothetical protein	NA	A0A2H4J191	uncultured_Caudovirales_phage	77.1	2.3e-137
AWZ73003.1|3331245_3331740_-	putative bacteriophage protein	NA	A0A2H4JHM9	uncultured_Caudovirales_phage	62.7	4.2e-50
AWZ75567.1|3331743_3332730_-	hypothetical protein	NA	A0A0M4R5A6	Salmonella_phage	52.6	1.7e-79
AWZ76905.1|3333601_3335053_-	hypothetical protein	NA	A0A0M4S6U1	Salmonella_phage	68.8	3.8e-192
AWZ76586.1|3335290_3336691_-|terminase	phage terminase, large subunit, PBSX family	terminase	A0A077KAW0	Edwardsiella_phage	69.0	9.4e-188
AWZ77146.1|3336641_3337130_-	putative bacteriophage protein	NA	NA	NA	NA	NA
AWZ77373.1|3338050_3338440_-	putative rz1 lytic protein	NA	A0A192Y6H8	Salmonella_phage	49.2	9.4e-21
AWZ73852.1|3338436_3338967_-	phage lysozyme family protein	NA	K7PLY1	Enterobacteria_phage	77.1	2.7e-79
AWZ74390.1|3338969_3339218_-|lysis	lysis S family protein	lysis	NA	NA	NA	NA
AWZ73188.1|3339235_3339364_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ74835.1|3339401_3339557_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ75741.1|3339623_3340406_-	antitermination family protein	NA	F1C595	Cronobacter_phage	76.8	7.2e-113
AWZ77430.1|3340402_3340879_-	hypothetical protein	NA	A0A286N2Q1	Klebsiella_phage	100.0	1.8e-90
AWZ76129.1|3340875_3341838_-	toprim domain protein	NA	A0A286N2Q0	Klebsiella_phage	99.4	4.8e-183
AWZ72961.1|3341839_3343453_-	DEAD/DEAH box helicase family protein	NA	A0A286N2P9	Klebsiella_phage	95.9	2.1e-311
AWZ75977.1|3344339_3344507_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ72639.1|3345232_3345547_+	hypothetical protein	NA	A0A286S1T9	Klebsiella_phage	100.0	1.0e-49
AWZ77556.1|3345539_3345728_+	hypothetical protein	NA	A0A286S1P8	Klebsiella_phage	100.0	4.6e-26
AWZ73065.1|3346101_3346263_+	hypothetical protein	NA	A0A286S1Q6	Klebsiella_phage	96.2	1.5e-20
3346525:3346539	attL	AGGCGCTGCAGGTCC	NA	NA	NA	NA
AWZ74252.1|3346577_3346700_+	hypothetical protein	NA	A0A286S1P6	Klebsiella_phage	100.0	1.3e-16
AWZ77209.1|3346696_3347122_+	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	77.9	3.5e-53
AWZ73751.1|3347118_3347313_+	putative membrane protein	NA	NA	NA	NA	NA
AWZ75074.1|3347309_3348137_+	SPFH domain / Band 7 family protein	NA	Q8W654	Enterobacteria_phage	84.0	5.5e-111
AWZ77811.1|3348241_3348760_+	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	98.8	1.7e-94
AWZ75429.1|3348771_3349476_+	phage regulatory Rha family protein	NA	A0A286S260	Klebsiella_phage	88.2	4.7e-111
AWZ75504.1|3349465_3349690_+	hypothetical protein	NA	A0A286S2B3	Klebsiella_phage	89.2	3.1e-29
AWZ75577.1|3349743_3349899_+	hypothetical protein	NA	A0A286S2B6	Klebsiella_phage	100.0	2.8e-21
AWZ72966.1|3349895_3350375_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ73037.1|3350447_3350594_+	putative bacteriophage protein	NA	A0A1B5FPC2	Escherichia_phage	70.8	2.9e-15
AWZ74456.1|3350604_3350796_+	hypothetical protein	NA	A0A0M4RTZ2	Salmonella_phage	73.8	3.9e-20
AWZ73785.1|3350776_3351958_-|integrase	phage integrase family protein	integrase	A0A0M4QX09	Salmonella_phage	84.2	5.6e-202
AWZ74276.1|3352154_3352703_+|protease	intracellular protease, PfpI family protein	protease	NA	NA	NA	NA
3352534:3352548	attR	GGACCTGCAGCGCCT	NA	NA	NA	NA
AWZ76453.1|3352901_3354434_-	HD domain protein	NA	A0A1B1ISR1	uncultured_Mediterranean_phage	30.0	1.1e-21
AWZ72997.1|3354650_3355412_-	enoyl-(Acyl carrier) reductase family protein	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.5	2.4e-20
>prophage 8
CP030341	Klebsiella pneumoniae strain AR_362 chromosome, complete genome	5379490	3778850	3860066	5379490	head,integrase,tRNA,protease,portal,terminase,capsid,lysis,tail,plate	Salmonella_phage(64.81%)	92	3822641:3822659	3860141:3860159
AWZ75369.1|3778850_3780572_+	thiol reductant ABC exporter, CydC subunit	NA	A0A2R8FG22	Brazilian_cedratvirus	34.3	1.5e-14
AWZ76856.1|3780616_3781318_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
AWZ73952.1|3781671_3781890_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
AWZ76963.1|3782010_3784290_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
AWZ75652.1|3784320_3784638_-|protease	ATP-dependent Clp protease adaptor ClpS family protein	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
AWZ73380.1|3784963_3785185_+	cold shock domain protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
AWZ74629.1|3785261_3787202_-	macrolide export ATP-binding/permease protein MacB	NA	G9BWD6	Planktothrix_phage	40.5	1.9e-37
AWZ77925.1|3787198_3788314_-	macrolide-specific efflux protein MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
AWZ75540.1|3788460_3790119_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ73373.1|3790311_3790485_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ73187.1|3790538_3791234_+	aquaporin Z	NA	NA	NA	NA	NA
AWZ77849.1|3791230_3791344_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ74111.1|3791349_3792249_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ73514.1|3792392_3794045_+	hydroxylamine reductase	NA	NA	NA	NA	NA
AWZ73081.1|3794055_3795024_+	NADH oxidoreductase hcr	NA	NA	NA	NA	NA
AWZ77117.1|3795235_3795670_-	doxX family protein	NA	NA	NA	NA	NA
AWZ73943.1|3795821_3797540_+	pyruvate dehydrogenase	NA	NA	NA	NA	NA
AWZ74245.1|3797578_3798580_+	low specificity L-threonine aldolase	NA	NA	NA	NA	NA
AWZ75297.1|3798590_3800033_+	NAD dependent epimerase/dehydratase family protein	NA	NA	NA	NA	NA
AWZ75906.1|3800120_3801134_+	NAD dependent epimerase/dehydratase family protein	NA	NA	NA	NA	NA
AWZ72682.1|3801130_3801961_-	N-acetylmuramoyl-L-alanine amidase AmiD	NA	A0A1B0UZW5	Roseobacter_phage	31.6	4.1e-05
AWZ73475.1|3801992_3803132_-	diguanylate cyclase domain protein	NA	NA	NA	NA	NA
AWZ73955.1|3804009_3804525_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ74059.1|3804751_3805480_+	ABC transporter family protein	NA	G9BWD6	Planktothrix_phage	37.1	1.2e-29
AWZ76954.1|3805500_3806232_+	lysine-arginine-ornithine-binding periplasmic family protein	NA	NA	NA	NA	NA
AWZ75780.1|3806238_3806955_+	amino ABC transporter, permease, 3-TM region, His/Glu/Gln/Arg/opine family domain protein	NA	NA	NA	NA	NA
AWZ73117.1|3806954_3807623_+	amino ABC transporter, permease, 3-TM region, His/Glu/Gln/Arg/opine family domain protein	NA	NA	NA	NA	NA
AWZ75651.1|3807806_3808538_+	lysine-arginine-ornithine-binding periplasmic family protein	NA	NA	NA	NA	NA
AWZ75774.1|3808580_3810053_-	histidine kinase-, DNA gyrase B-, and HSP90-like ATPase family protein	NA	W8CYF6	Bacillus_phage	31.8	7.9e-28
AWZ74549.1|3810049_3810766_-	response regulator	NA	W8CYM9	Bacillus_phage	36.9	2.1e-34
AWZ77899.1|3810844_3811972_-	23S rRNA (uracil-5-)-methyltransferase RumB	NA	A0A2K5B251	Erysipelothrix_phage	25.6	1.3e-19
AWZ72869.1|3812013_3812502_-	inner membrane protein YbjO	NA	NA	NA	NA	NA
AWZ75111.1|3812559_3813405_-	binding-protein-dependent transport system inner membrane component family protein	NA	NA	NA	NA	NA
AWZ76635.1|3813401_3814355_-	binding-protein-dependent transport system inner membrane component family protein	NA	NA	NA	NA	NA
AWZ75783.1|3814365_3815499_-	polyamine ABC transporter, ATP-binding family protein	NA	G3M9Y6	Bacillus_virus	34.9	2.2e-30
AWZ76445.1|3815662_3816775_-	bacterial extracellular solute-binding family protein	NA	NA	NA	NA	NA
AWZ74786.1|3817123_3817603_-	bacterial sensory transduction regulator family protein	NA	NA	NA	NA	NA
AWZ77258.1|3817691_3818594_-	alpha-L-glutamate ligase, RimK family protein	NA	A0A1D7SR78	Cyanophage	35.3	2.0e-34
AWZ77072.1|3818708_3819038_-	oxygen-insensitive NADPH nitroreductase	NA	NA	NA	NA	NA
AWZ76931.1|3819273_3819432_-	NADPH-flavin oxidoreductase domain protein	NA	NA	NA	NA	NA
AWZ77179.1|3819415_3819703_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ72629.1|3819905_3820169_+	glutaredoxin, GrxA family	NA	A0A2I7SAE2	Vibrio_phage	73.1	1.6e-27
AWZ74598.1|3820175_3820559_-	inner membrane protein YbjM	NA	NA	NA	NA	NA
AWZ76659.1|3820825_3822511_+	aspT/YidE/YbjL antiporter duplication domain protein	NA	NA	NA	NA	NA
AWZ75516.1|3822502_3822625_-	hypothetical protein	NA	NA	NA	NA	NA
3822641:3822659	attL	ATGGGTTTTTTGTTGCCTG	NA	NA	NA	NA
AWZ72908.1|3822730_3822886_-	ogr/Delta-like zinc finger family protein	NA	E5G6Q4	Salmonella_phage	65.3	3.8e-10
AWZ72831.1|3823040_3824141_-	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	87.4	4.9e-176
AWZ72937.1|3824137_3824623_-	phage P2 GpU family protein	NA	E5G6Q2	Salmonella_phage	75.6	7.2e-63
AWZ76415.1|3824619_3827247_-|tail	phage tail tape measure protein, TP901 family, core region	tail	E5FFG5	Burkholderia_phage	42.0	5.6e-117
AWZ75125.1|3827239_3827359_-	phage P2 GpE family protein	NA	E5G6Q0	Salmonella_phage	87.2	2.2e-13
AWZ73013.1|3827373_3827673_-	mu-like prophage FluMu gp41 family protein	NA	E5G6P9	Salmonella_phage	79.0	3.7e-33
AWZ74347.1|3827725_3828241_-|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	85.4	1.3e-81
AWZ76049.1|3828250_3829423_-|tail	phage tail sheath family protein	tail	A0A1S6KZY7	Salmonella_phage	93.3	1.9e-210
AWZ72612.1|3829561_3830638_-|tail	phage tail-collar fiber family protein	tail	Q37842	Escherichia_phage	44.8	1.2e-25
AWZ75056.1|3830667_3830871_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ73253.1|3830867_3831599_-	concanavalin A-like lectin/glucanases superfamily protein	NA	NA	NA	NA	NA
AWZ76151.1|3831602_3834554_-	hypothetical protein	NA	A0A2H4N7A3	Pectobacterium_phage	50.9	1.2e-06
AWZ77235.1|3834555_3835155_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	60.5	1.3e-58
AWZ74160.1|3835147_3836056_-|plate	baseplate J-like family protein	plate	E5G6N8	Salmonella_phage	66.9	7.6e-106
AWZ76733.1|3836042_3836405_-	lysozyme family protein	NA	A0A1S6KZZ4	Salmonella_phage	84.7	5.8e-49
AWZ72710.1|3836401_3836974_-|plate	phage baseplate assembly V family protein	plate	E5G6N6	Salmonella_phage	72.3	4.7e-77
AWZ73641.1|3837020_3837761_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ72754.1|3837757_3838204_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	71.2	2.2e-50
AWZ72723.1|3838196_3838628_-|tail	P2 phage tail completion R family protein	tail	A0A1S6KZY0	Salmonella_phage	82.5	9.9e-64
AWZ72933.1|3838590_3838737_-	hypothetical protein	NA	A0A1S6KZX6	Salmonella_phage	76.1	6.0e-13
AWZ74974.1|3838723_3839152_-|lysis	phage lysis regulatory, LysB family protein	lysis	A0A1S6KZX8	Salmonella_phage	77.9	9.6e-51
AWZ77092.1|3839148_3839532_-	putative membrane protein	NA	A0A1S6KZZ2	Salmonella_phage	42.0	2.1e-17
AWZ74117.1|3839536_3840046_-	phage lysozyme family protein	NA	E5G6N1	Salmonella_phage	83.4	2.1e-81
AWZ75415.1|3840026_3840149_-	putative secretory protein	NA	E5G6N0	Salmonella_phage	85.0	2.9e-13
AWZ76402.1|3840245_3840449_-	phage Tail Protein X family protein	NA	A0A1S6KZY4	Salmonella_phage	88.1	1.3e-29
AWZ76162.1|3840448_3840913_-|head	phage head completion family protein	head	A0A1S6KZW8	Salmonella_phage	89.0	8.4e-77
AWZ76205.1|3841008_3841659_-|terminase	phage small terminase subunit	terminase	E5G6M7	Salmonella_phage	96.3	8.7e-112
AWZ77935.1|3841662_3842721_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.1	1.1e-180
AWZ75770.1|3842737_3843571_-|capsid	phage capsid scaffolding (GPO) serine peptidase family protein	capsid	A0A1S6KZW9	Salmonella_phage	88.8	6.3e-123
AWZ75550.1|3843713_3845480_+|terminase	terminase-like family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.0	0.0e+00
AWZ77205.1|3845479_3846505_+|portal	phage portal protein, PBSX family	portal	A0A1S6KZW5	Salmonella_phage	86.7	7.6e-171
AWZ74889.1|3846566_3848309_-	AIPR family protein	NA	NA	NA	NA	NA
AWZ75920.1|3848584_3848773_-	putative fels-2 prophage protein	NA	NA	NA	NA	NA
AWZ76781.1|3849376_3849610_-	dinI-like family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
AWZ73156.1|3849620_3849809_-	putative levan regulatory protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
AWZ73252.1|3849962_3852377_-	bacteriophage replication protein A	NA	E5G6L9	Salmonella_phage	97.5	0.0e+00
AWZ75455.1|3852373_3853231_-	DNA adenine methylase family protein	NA	E5G6L8	Salmonella_phage	95.4	2.0e-156
AWZ75168.1|3853227_3853455_-	phage/conjugal plasmid C-4 type zinc finger, TraR family protein	NA	E5G6L7	Salmonella_phage	98.7	6.0e-36
AWZ77286.1|3853454_3853688_-	hypothetical protein	NA	E5G6L6	Salmonella_phage	96.1	4.1e-32
AWZ74410.1|3853755_3854097_-	putative fels-2 prophage protein	NA	E5G6L5	Salmonella_phage	99.1	4.6e-56
AWZ73869.1|3854060_3854261_-	protein fil	NA	E5G6L4	Salmonella_phage	97.0	1.6e-32
AWZ76766.1|3854268_3854778_-	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.8	5.8e-87
AWZ75093.1|3854804_3854957_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ73543.1|3855120_3856056_+	bacteriophage CI repressor helix-turn-helix domain protein	NA	A0A1S6KZZ7	Salmonella_phage	39.9	1.8e-30
AWZ75502.1|3856067_3857012_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ73508.1|3857110_3858598_-	reverse transcriptase family protein	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
AWZ77391.1|3859085_3860066_+|integrase	phage integrase family protein	integrase	A0A218M4I3	Erwinia_phage	57.2	1.4e-97
3860141:3860159	attR	ATGGGTTTTTTGTTGCCTG	NA	NA	NA	NA
>prophage 9
CP030341	Klebsiella pneumoniae strain AR_362 chromosome, complete genome	5379490	4302102	4350451	5379490	integrase,coat,tRNA,terminase,lysis	Cronobacter_phage(27.08%)	62	4298389:4298435	4347523:4347569
4298389:4298435	attL	AATGGCACGCCCTACAGGATTCGAACCTGTGACCTACGGCTTAGAAG	NA	NA	NA	NA
AWZ77473.1|4302102_4305009_-	hypothetical protein	NA	A0A286S1P0	Klebsiella_phage	50.0	1.6e-19
AWZ73844.1|4305176_4307654_-	hypothetical protein	NA	F1C5A7	Cronobacter_phage	45.6	2.7e-198
AWZ76827.1|4307640_4308036_-	nlpC/P60 family protein	NA	F1C5F2	Cronobacter_phage	54.0	8.0e-36
AWZ73181.1|4308032_4308503_-	hypothetical protein	NA	R9TPR6	Aeromonas_phage	41.0	2.5e-28
AWZ74360.1|4308502_4308979_-	hypothetical protein	NA	A0A2P1MXB5	Escherichia_phage	49.7	3.0e-37
AWZ77056.1|4309021_4312468_-	tape measure domain protein	NA	Q5G8W8	Enterobacteria_phage	48.6	1.4e-163
AWZ75406.1|4312560_4312818_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ74247.1|4313191_4313977_-	BRO family, N-terminal domain protein	NA	A0A2L1IV39	Escherichia_phage	59.7	1.9e-84
AWZ77416.1|4314042_4314756_-	P22AR C-terminal domain protein	NA	H6WRU8	Salmonella_phage	50.2	3.9e-49
AWZ76409.1|4314745_4314916_-	arc-like DNA binding domain protein	NA	I6R9A8	Salmonella_phage	87.0	6.1e-17
AWZ77331.1|4315177_4315375_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ76202.1|4315391_4315862_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ75345.1|4316155_4316353_-	hypothetical protein	NA	K7PM89	Enterobacteria_phage	68.2	6.4e-10
AWZ73054.1|4316412_4317168_-	kilA-N domain protein	NA	K7PGT4	Enterobacteria_phage	51.0	2.4e-60
AWZ77706.1|4317343_4318021_-	hypothetical protein	NA	F1C5E8	Cronobacter_phage	57.9	4.8e-73
AWZ77197.1|4318073_4318826_-	bacterial Ig-like domain family protein	NA	G0ZNE6	Cronobacter_phage	42.1	5.8e-43
AWZ75690.1|4318894_4319128_-	hypothetical protein	NA	G0ZNE4	Cronobacter_phage	47.4	4.3e-13
AWZ73038.1|4319283_4319709_-	hypothetical protein	NA	R9TPP7	Aeromonas_phage	47.9	5.1e-28
AWZ77464.1|4319711_4320074_-	hypothetical protein	NA	A0A173GCE0	Salmonella_phage	45.0	1.8e-18
AWZ77857.1|4320246_4320627_-	hypothetical protein	NA	F1C5E2	Cronobacter_phage	55.3	5.3e-29
AWZ77889.1|4320629_4320869_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ75243.1|4320879_4321974_-|coat	putative phage coat protein	coat	F1C5E1	Cronobacter_phage	62.8	1.7e-123
AWZ72952.1|4321985_4322414_-	hypothetical protein	NA	F1C5E0	Cronobacter_phage	60.8	1.6e-42
AWZ74619.1|4322417_4323803_-	hypothetical protein	NA	F1C5D9	Cronobacter_phage	60.0	2.3e-154
AWZ73687.1|4323875_4324280_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ75695.1|4324393_4325293_-	phage Mu F like family protein	NA	F1C5D8	Cronobacter_phage	69.7	8.0e-116
AWZ74112.1|4325372_4326794_-	hypothetical protein	NA	F1C5D7	Cronobacter_phage	57.1	9.6e-148
AWZ74145.1|4326806_4328279_-|terminase	putative terminase large subunit	terminase	A0A1W6JNY3	Morganella_phage	82.5	1.3e-248
AWZ75389.1|4328278_4328881_-	putative dNA repair protein RecN	NA	G8C7P2	Escherichia_phage	80.9	5.4e-76
AWZ74494.1|4329097_4329259_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ72872.1|4329449_4329581_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ74888.1|4329686_4330151_-|lysis	bacteriophage lysis family protein	lysis	Q76H63	Enterobacteria_phage	73.2	2.4e-55
AWZ77070.1|4330147_4330678_-	phage lysozyme family protein	NA	G9L6J6	Escherichia_phage	78.5	6.0e-79
AWZ75304.1|4330680_4330929_-|lysis	lysis S family protein	lysis	NA	NA	NA	NA
AWZ73737.1|4331838_4332528_-	phage antitermination Q family protein	NA	I6PDF8	Cronobacter_phage	54.5	1.4e-56
AWZ77159.1|4332524_4332704_-	AP2 domain protein	NA	NA	NA	NA	NA
AWZ76667.1|4333181_4333817_-	bacteriophage Lambda NinG family protein	NA	M9NYX8	Enterobacteria_phage	77.9	2.7e-81
AWZ74357.1|4333809_4333980_-	putative NinE-like protein from lambdoid prophage DLP12	NA	G8C7V4	Escherichia_phage	73.2	1.3e-14
AWZ75727.1|4333979_4334435_-	putative phage protein	NA	K7P7B8	Enterobacteria_phage	69.5	8.0e-56
AWZ73712.1|4334935_4335583_-	hypothetical protein	NA	A5LH60	Enterobacteria_phage	32.6	4.5e-12
AWZ73504.1|4335755_4336598_-	ead/Ea22-like family protein	NA	A0A2H4FRZ0	Salmonella_phage	60.8	1.8e-29
AWZ73238.1|4336594_4336708_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ77831.1|4336704_4337211_-	hypothetical protein	NA	A0A0A6Z565	Enterobacter_phage	59.6	3.0e-27
AWZ73435.1|4337207_4337501_-	putative protein ren	NA	O48423	Enterobacteria_phage	65.6	3.3e-26
AWZ75054.1|4337500_4338931_-	replicative DNA helicase	NA	Q9MCT4	Escherichia_phage	66.7	2.6e-185
AWZ75486.1|4338920_4339772_-	putative gene O protein	NA	F1C5C3	Cronobacter_phage	56.3	5.3e-85
AWZ73742.1|4339812_4339959_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ77347.1|4340044_4340266_-	bacteriophage CII family protein	NA	G8EYH8	Enterobacteria_phage	41.7	6.9e-05
AWZ76843.1|4341096_4341357_+	peptidase S24-like family protein	NA	A0A2I6PIE7	Escherichia_phage	68.2	2.5e-30
AWZ74672.1|4341761_4341923_+	hypothetical protein	NA	B5WZV1	Pseudomonas_phage	56.9	2.4e-07
AWZ76483.1|4341940_4342078_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ74057.1|4342058_4342217_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ72800.1|4342305_4342590_+	hypothetical protein	NA	G8C7T1	Escherichia_phage	62.8	8.0e-30
AWZ73048.1|4342605_4343451_+	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	59.2	6.9e-69
AWZ73288.1|4343447_4344128_+	exonuclease	NA	A0A0M3ULE0	Salmonella_phage	93.4	7.9e-124
AWZ72877.1|4344279_4344936_+	MT-A70 family protein	NA	G8C7S6	Escherichia_phage	87.5	2.7e-113
AWZ75178.1|4344932_4345700_+	hypothetical protein	NA	D5LH17	Escherichia_phage	53.4	1.7e-66
AWZ75530.1|4345916_4346132_+	phage/conjugal plasmid C-4 type zinc finger, TraR family protein	NA	A0A0K2FI84	Escherichia_phage	52.9	4.0e-13
AWZ73446.1|4346345_4347509_+|integrase	phage integrase family protein	integrase	G8C7S0	Escherichia_phage	87.3	3.3e-202
AWZ73486.1|4347939_4348806_+	bifunctional protein FolD	NA	A0A249XZQ2	Enterococcus_phage	34.8	1.3e-30
4347523:4347569	attR	AATGGCACGCCCTACAGGATTCGAACCTGTGACCTACGGCTTAGAAG	NA	NA	NA	NA
AWZ75781.1|4348807_4349020_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ74200.1|4349065_4350451_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	35.4	3.5e-46
>prophage 10
CP030341	Klebsiella pneumoniae strain AR_362 chromosome, complete genome	5379490	4560006	4571660	5379490	capsid	Enterobacteria_phage(70.0%)	15	NA	NA
AWZ75194.1|4560006_4561110_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.5	4.8e-62
AWZ75231.1|4561120_4562374_+	gamma-glutamyl phosphate reductase	NA	A0A1X9I5D4	Streptococcus_phage	44.9	8.9e-89
AWZ73790.1|4562726_4563917_+	hypothetical protein	NA	Q7M297	Enterobacteria_phage	62.7	6.4e-145
AWZ73413.1|4563904_4564855_+	cobQ/CobB/MinD/ParA nucleotide binding domain protein	NA	A0A1X9IGI7	Lactococcus_phage	27.1	1.2e-13
AWZ75186.1|4564854_4565280_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ74952.1|4565626_4565776_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ76777.1|4565848_4566415_-	polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	64.3	1.5e-59
AWZ74261.1|4566432_4566678_-	ogr/Delta-like zinc finger family protein	NA	Q7M294	Enterobacteria_phage	58.0	1.9e-19
AWZ76764.1|4566674_4567412_-|capsid	putative glyco3, capsid size determination protein Sid	capsid	Q7M2A2	Enterobacteria_phage	60.7	9.0e-73
AWZ74883.1|4567711_4567849_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ74860.1|4567953_4568220_+	prophage CP4-57 regulatory family protein	NA	Q7M299	Enterobacteria_phage	71.6	2.6e-30
AWZ74415.1|4568579_4568774_+	putative phage immunity repressor protein	NA	Q7M2A7	Enterobacteria_phage	85.5	3.2e-22
AWZ73132.1|4568818_4568998_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ77834.1|4568994_4569315_+	putative dNA replication protein	NA	NA	NA	NA	NA
AWZ74078.1|4569326_4571660_+	putative P4-specific DNA primase	NA	Q7M2A8	Enterobacteria_phage	82.2	0.0e+00
>prophage 11
CP030341	Klebsiella pneumoniae strain AR_362 chromosome, complete genome	5379490	5038049	5045731	5379490	integrase,capsid,transposase	Enterobacteria_phage(85.71%)	12	5030972:5030986	5042806:5042820
5030972:5030986	attL	ACCTCCGCCACCGGC	NA	NA	NA	NA
AWZ77426.1|5038049_5038529_-|integrase	integrase core domain protein	integrase	A0A0N9SIX5	Staphylococcus_phage	29.7	1.6e-06
AWZ74622.1|5038661_5038817_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ72762.1|5038894_5039161_-|transposase	transposase family protein	transposase	NA	NA	NA	NA
AWZ72703.1|5039757_5039874_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ74870.1|5039906_5042240_-	poxvirus D5 protein-like family protein	NA	Q7M2A8	Enterobacteria_phage	83.9	0.0e+00
AWZ73854.1|5042254_5042575_-	DNA replication protein, phage-associated	NA	NA	NA	NA	NA
AWZ74312.1|5042571_5042799_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ76682.1|5042795_5042990_-	putative phage immunity repressor protein	NA	Q7M2A7	Enterobacteria_phage	85.5	7.2e-22
5042806:5042820	attR	ACCTCCGCCACCGGC	NA	NA	NA	NA
AWZ76539.1|5043340_5043607_-	prophage CP4-57 regulatory family protein	NA	Q7M299	Enterobacteria_phage	71.6	2.0e-30
AWZ77409.1|5044167_5044905_+|capsid	putative glyco3, capsid size determination protein Sid	capsid	Q7M2A2	Enterobacteria_phage	59.4	1.1e-70
AWZ74558.1|5044901_5045147_+	ogr/Delta-like zinc finger family protein	NA	Q7M294	Enterobacteria_phage	56.8	5.5e-19
AWZ73154.1|5045164_5045731_+	polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	63.8	9.7e-59
>prophage 12
CP030341	Klebsiella pneumoniae strain AR_362 chromosome, complete genome	5379490	5240870	5245957	5379490	integrase	Escherichia_phage(33.33%)	8	5240117:5240131	5248508:5248522
5240117:5240131	attL	CGGTAGCGTAAATCC	NA	NA	NA	NA
AWZ76436.1|5240870_5241554_+	integral membrane, YjbE family protein	NA	W8EBD0	Pseudomonas_phage	42.2	5.1e-30
AWZ76561.1|5241510_5241624_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ77694.1|5241699_5242617_+	curved DNA-binding protein	NA	A0A1V0SCV5	Indivirus	42.2	2.8e-07
AWZ75555.1|5242616_5242922_+	chaperone modulatory protein CbpM	NA	NA	NA	NA	NA
AWZ76303.1|5243090_5243612_+	helix-turn-helix domain protein	NA	A0A1B1P776	Bacillus_phage	33.5	1.3e-14
AWZ77342.1|5243668_5244454_+|integrase	integrase core domain protein	integrase	A0A2I6AZV9	Macacine_betaherpesvirus	67.7	3.3e-73
AWZ75258.1|5244619_5244991_-	plasmid stability family protein	NA	A0A222YWJ6	Escherichia_phage	53.7	2.8e-22
AWZ73776.1|5245000_5245957_-	plasmid segregation protein ParM	NA	A0A222YXF2	Escherichia_phage	78.0	1.3e-143
5248508:5248522	attR	CGGTAGCGTAAATCC	NA	NA	NA	NA
>prophage 1
CP030343	Klebsiella pneumoniae strain AR_362 plasmid unnamed1, complete sequence	207546	528	47292	207546	integrase,transposase	Escherichia_phage(34.62%)	46	33410:33424	52106:52120
AWZ78063.1|528_876_-|transposase	transposase IS66 family protein	transposase	A0A0P0ZEB3	Stx2-converting_phage	98.3	2.6e-62
AWZ78064.1|943_1462_-|transposase	transposase IS66 family protein	transposase	A0A0P0ZEB3	Stx2-converting_phage	90.1	1.7e-86
AWZ78065.1|1506_2481_-|transposase	transposase IS66 family protein	transposase	A0A0P0ZBS5	Stx2-converting_phage	91.8	2.7e-149
AWZ78066.1|2530_2878_-|transposase	putative transposase	transposase	A0A0P0ZDM8	Stx2-converting_phage	95.7	2.0e-59
AWZ78067.1|4440_5553_-	radical SAM superfamily protein	NA	S5WIP3	Leptospira_phage	33.8	1.5e-47
AWZ78068.1|5545_6934_-	4Fe-4S single cluster domain protein	NA	S5VT21	Leptospira_phage	29.0	6.3e-51
AWZ78069.1|7165_7669_-|transposase	putative transposase	transposase	Q71TF0	Escherichia_phage	100.0	1.5e-95
AWZ78070.1|8141_8801_+	chloramphenicol acetyltransferase	NA	G3CFL0	Escherichia_phage	100.0	8.4e-131
AWZ78071.1|9001_9379_-	acetyltransferase family protein	NA	NA	NA	NA	NA
AWZ78072.1|9445_12412_-|transposase	tn3 transposase DDE domain protein	transposase	A0A1B0V7H9	Salmonella_phage	73.6	0.0e+00
AWZ78073.1|12414_12975_-	resolvase, N terminal domain protein	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
AWZ78074.1|13100_13301_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ78075.1|13653_14667_-|integrase	integron integrase family protein	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
AWZ78076.1|15728_16508_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ78077.1|17012_17852_+	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
AWZ78078.1|18338_19544_+	chromate transporter, chromate ion transporter family protein	NA	NA	NA	NA	NA
AWZ78079.1|19554_19860_+	transcriptional regulator PadR-like family protein	NA	NA	NA	NA	NA
AWZ78080.1|20086_20851_+	DDE domain protein	NA	A0A077SL39	Escherichia_phage	65.7	4.3e-86
AWZ78081.1|21343_21928_-	erythromycin resistance repressor protein	NA	NA	NA	NA	NA
AWZ78082.1|21927_23166_-	major Facilitator Superfamily protein	NA	NA	NA	NA	NA
AWZ78083.1|23162_24068_-	phosphotransferase enzyme family protein	NA	NA	NA	NA	NA
AWZ78084.1|24189_24894_-|integrase	integrase core domain protein	integrase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AWZ78085.1|25044_25860_+	phosphotransferase enzyme family protein	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	100.0	6.1e-163
AWZ78086.1|26049_26655_-|transposase	transposase IS66 family protein	transposase	A0A077SL39	Escherichia_phage	99.5	6.4e-117
AWZ78087.1|26765_28031_-|transposase	tn3 transposase DDE domain protein	transposase	A0A1B0V7H9	Salmonella_phage	67.1	5.4e-142
AWZ78088.1|28021_28726_+	DDE domain protein	NA	A0A077SL39	Escherichia_phage	99.6	1.2e-138
AWZ78089.1|28919_29240_-	hypothetical protein	NA	Q38213	Escherichia_phage	52.9	3.2e-27
AWZ78090.1|29848_30409_+	ABC transporter family protein	NA	G9BWD6	Planktothrix_phage	38.4	1.6e-13
AWZ78091.1|30405_31269_+	phosphate/phosphite/phosphonate ABC transporter, periplasmic binding family protein	NA	NA	NA	NA	NA
AWZ78092.1|31277_32105_+	phosphonate ABC transporter, permease protein PhnE	NA	NA	NA	NA	NA
AWZ78093.1|32113_33124_+	phosphonate dehydrogenase	NA	A0A1V0SBV6	Catovirus	25.1	1.4e-15
AWZ78094.1|33117_33987_+	bacterial regulatory, arsR family protein	NA	NA	NA	NA	NA
33410:33424	attL	CCTACCTTCTCCAGC	NA	NA	NA	NA
AWZ78095.1|34094_34730_+	hypothetical protein	NA	Q38213	Escherichia_phage	52.8	1.2e-33
AWZ78096.1|35195_36176_-|transposase	transposase DDE domain protein	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
AWZ78097.1|36434_36938_-|transposase	putative transposase	transposase	U5P0U6	Shigella_phage	92.2	1.8e-88
AWZ78098.1|37067_37190_+	putative allantoinase domain protein	NA	NA	NA	NA	NA
AWZ78099.1|38322_38460_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ78100.1|38478_39048_+	hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
AWZ78101.1|39162_41958_+	istB-like ATP binding family protein	NA	K4FB40	Cronobacter_phage	41.0	5.2e-129
AWZ78102.1|41954_42155_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ78103.1|42653_43142_+	phosphate-starvation-inducible E family protein	NA	NA	NA	NA	NA
AWZ78104.1|43128_44091_+	peptidase M48 family protein	NA	NA	NA	NA	NA
AWZ78105.1|44405_44711_+|transposase	putative transposase	transposase	NA	NA	NA	NA
AWZ78106.1|44821_45433_+|integrase	integrase core domain protein	integrase	A0A2I6AZV9	Macacine_betaherpesvirus	45.9	4.0e-42
AWZ78107.1|45641_45773_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ78108.1|45933_47292_-|integrase	integrase core domain protein	integrase	NA	NA	NA	NA
52106:52120	attR	GCTGGAGAAGGTAGG	NA	NA	NA	NA
>prophage 2
CP030343	Klebsiella pneumoniae strain AR_362 plasmid unnamed1, complete sequence	207546	61653	111322	207546	integrase,holin,transposase	Bacillus_phage(16.0%)	44	70127:70141	106791:106805
AWZ78129.1|61653_62469_+|transposase	transposase family protein	transposase	A9YX10	Burkholderia_phage	25.9	1.7e-11
AWZ78130.1|62770_63274_+|transposase	transposase family protein	transposase	NA	NA	NA	NA
AWZ78131.1|63334_63514_+	putative plasmid stabilization protein	NA	NA	NA	NA	NA
AWZ78132.1|63745_64180_-	putative copper-binding protein PcoE	NA	NA	NA	NA	NA
AWZ78133.1|64396_65797_-	heavy metal sensor kinase family protein	NA	W8CYF6	Bacillus_phage	26.3	4.1e-18
AWZ78134.1|65793_66474_-	response regulator	NA	W8CYM9	Bacillus_phage	34.4	8.7e-30
AWZ78135.1|66528_67458_-	copper resistance D family protein	NA	NA	NA	NA	NA
AWZ78136.1|67462_67843_-	copper resistance protein C	NA	NA	NA	NA	NA
AWZ78137.1|67882_68773_-	copper resistance protein B	NA	NA	NA	NA	NA
AWZ78138.1|68778_70596_-	copper resistance protein A	NA	NA	NA	NA	NA
70127:70141	attL	ATGGCACCGTATACC	NA	NA	NA	NA
AWZ78139.1|70829_71279_+	putative copper resistant protein PcoE	NA	NA	NA	NA	NA
AWZ78140.1|71567_72305_+	peptidase M23 family protein	NA	A0A2H4JAF5	uncultured_Caudovirales_phage	32.5	1.2e-11
AWZ78141.1|72338_72536_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ78142.1|72576_74937_-	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	35.8	7.3e-84
AWZ78143.1|75150_75591_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ78144.1|75677_78824_-	cation efflux system protein CusA	NA	S5VTK5	Leptospira_phage	22.5	4.0e-61
AWZ78145.1|78834_79965_-	cation efflux system protein CusB	NA	NA	NA	NA	NA
AWZ78146.1|80240_80594_-	cation efflux system protein CusF	NA	NA	NA	NA	NA
AWZ78147.1|80622_82008_-	efflux transporter, outer membrane factor (OMF) lipo, NodT family protein	NA	NA	NA	NA	NA
AWZ78148.1|82197_82878_+	transcriptional regulatory protein CusR	NA	W8CYM9	Bacillus_phage	35.6	2.1e-31
AWZ78149.1|82870_84346_+	heavy metal sensor kinase family protein	NA	W8CYF6	Bacillus_phage	30.1	1.0e-27
AWZ78150.1|84596_85028_+	silver-binding protein SilE	NA	NA	NA	NA	NA
AWZ78151.1|85323_85728_-|transposase	transposase family protein	transposase	NA	NA	NA	NA
AWZ78152.1|85881_86277_-|transposase	putative transposase	transposase	Q71TF0	Escherichia_phage	92.4	5.7e-66
AWZ78153.1|86429_86825_+|transposase	transposase family protein	transposase	Q76S41	Shigella_phage	75.4	1.4e-43
AWZ78154.1|86782_87664_+|integrase	integrase core domain protein	integrase	Q9ZXG3	Shigella_phage	63.2	1.2e-100
AWZ78155.1|88048_88552_+|transposase	putative transposase	transposase	U5P0U6	Shigella_phage	93.2	1.6e-84
AWZ78156.1|88703_90701_+|holin	transporter, betaine/carnitine/choline transporter family protein	holin	A0A2I7QNT1	Vibrio_phage	25.9	9.7e-21
AWZ78157.1|90763_92041_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ78158.1|93023_93860_-	EAL domain protein	NA	NA	NA	NA	NA
AWZ78159.1|96009_96150_-|transposase	transposase family protein	transposase	Q9MCT5	Escherichia_phage	100.0	1.3e-17
AWZ78160.1|96322_96934_-|transposase	transposase DDE domain protein	transposase	Q9MCT5	Escherichia_phage	99.4	3.5e-99
AWZ78161.1|97336_98284_-	diguanylate cyclase domain protein	NA	G3MA91	Bacillus_virus	30.6	1.8e-12
AWZ78162.1|99427_100168_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	58.6	5.4e-25
AWZ78163.1|100884_101583_-	repFIB replication protein A	NA	J9Q7H0	Salmonella_phage	55.7	5.2e-54
AWZ78164.1|102646_103813_+	cobQ/CobB/MinD/ParA nucleotide binding domain protein	NA	A0A2I6B2X3	Macacine_betaherpesvirus	97.7	1.4e-224
AWZ78165.1|103812_104784_+	protein SopB	NA	I3WF22	Macacine_betaherpesvirus	86.6	4.1e-150
AWZ78166.1|104783_105746_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ78167.1|106280_106565_+	helix-turn-helix domain protein	NA	A0A1W6JP07	Morganella_phage	86.8	1.0e-40
AWZ78168.1|106561_107419_+|transposase	transposase, IS605 OrfB family	transposase	A0A1B0VCD8	Salmonella_phage	80.9	1.0e-128
106791:106805	attR	ATGGCACCGTATACC	NA	NA	NA	NA
AWZ78169.1|107441_107597_-	antitoxin, type II toxin-antitoxin system family protein	NA	NA	NA	NA	NA
AWZ78170.1|107735_109007_-	impB/mucB/samB family protein	NA	F1C5A5	Cronobacter_phage	63.7	5.6e-155
AWZ78171.1|109006_109432_-	peptidase S24-like family protein	NA	A0A1W6JNS2	Morganella_phage	49.6	8.3e-31
AWZ78172.1|109834_111322_+	reverse transcriptase family protein	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
>prophage 1
CP030342	Klebsiella pneumoniae strain AR_362 plasmid unnamed2, complete sequence	113639	27785	39877	113639		Escherichia_phage(25.0%)	10	NA	NA
AWZ77988.1|27785_28415_-	DNA methylase family protein	NA	A0A2I7RE86	Vibrio_phage	36.0	1.5e-20
AWZ77959.1|28923_29154_-	putative membrane protein	NA	NA	NA	NA	NA
AWZ78043.1|29214_29886_-	plasmid stability family protein	NA	NA	NA	NA	NA
AWZ77967.1|29888_30863_-	plasmid segregation protein ParM	NA	A0A222YXF2	Escherichia_phage	46.8	1.4e-73
AWZ78023.1|31091_31523_+	protein UmuD	NA	A0A1W6JNS2	Morganella_phage	52.5	1.0e-28
AWZ77998.1|31522_32794_+	impB/mucB/samB family protein	NA	F1C5A5	Cronobacter_phage	63.7	3.6e-154
AWZ77944.1|33194_34091_+	replication protein RepA	NA	Q71TL8	Escherichia_phage	53.8	3.3e-69
AWZ78040.1|34475_35618_+	plasmid partition protein A	NA	Q1MVJ3	Enterobacteria_phage	90.0	7.6e-196
AWZ77964.1|35614_36589_+	parB	NA	Q1MVJ4	Enterobacteria_phage	62.3	1.4e-105
AWZ77965.1|37849_39877_+	N-6 DNA Methylase family protein	NA	A0A220A2U5	Liberibacter_phage	26.6	2.1e-26
>prophage 2
CP030342	Klebsiella pneumoniae strain AR_362 plasmid unnamed2, complete sequence	113639	44452	73354	113639	integrase,transposase	Escherichia_phage(35.29%)	35	53132:53146	75236:75250
AWZ78000.1|44452_45721_+|transposase	transposase family protein	transposase	Q6V7R1	Burkholderia_virus	34.7	5.2e-60
AWZ77987.1|47026_47143_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ78013.1|47527_48310_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	90.2	4.6e-51
AWZ77997.1|48309_48642_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ78039.1|48648_49047_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ78025.1|49072_49318_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ78012.1|49429_49702_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ77957.1|49783_49903_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ78003.1|50224_50659_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ78027.1|50642_50873_+	antidote-toxin recognition MazE family protein	NA	NA	NA	NA	NA
AWZ77958.1|50869_51286_+	PIN domain protein	NA	NA	NA	NA	NA
AWZ78015.1|51359_52070_+	AAA domain protein	NA	NA	NA	NA	NA
AWZ78008.1|52154_52379_+	insA C-terminal domain protein	NA	A0A2L1IV22	Escherichia_phage	94.6	1.7e-35
AWZ77948.1|52423_52801_+|transposase	putative transposase	transposase	Q71TF0	Escherichia_phage	93.6	1.9e-63
AWZ78045.1|52962_53385_+	merC mercury resistance family protein	NA	NA	NA	NA	NA
53132:53146	attL	TTGCCGCGCTGGCCT	NA	NA	NA	NA
AWZ78010.1|53436_55131_+	mercuric reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.6	8.8e-39
AWZ77996.1|55148_55511_+	mercuric resistance transcriptional repressor protein MerD	NA	NA	NA	NA	NA
AWZ77978.1|55507_55744_+	merE family protein	NA	NA	NA	NA	NA
AWZ77949.1|55779_56448_+	EAL domain protein	NA	NA	NA	NA	NA
AWZ78050.1|56738_57791_+|integrase	integrase core domain protein	integrase	NA	NA	NA	NA
AWZ78006.1|57837_58248_+|integrase	integrase core domain protein	integrase	A0A077SL39	Escherichia_phage	100.0	1.9e-72
AWZ78005.1|58358_59219_-	beta-lactamase TEM	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
AWZ77963.1|59401_59524_-	helix-turn-helix domain of resolvase family protein	NA	Q1MVP4	Enterobacteria_phage	97.5	1.0e-13
AWZ77962.1|60962_61667_-|transposase	transposase IS66 family protein	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AWZ77966.1|61739_64637_+|transposase	tn3 transposase DDE domain protein	transposase	A0A1B0V7H9	Salmonella_phage	37.7	2.7e-181
AWZ77955.1|64725_65346_+	resolvase, N terminal domain protein	NA	A0A219Y912	Aeromonas_phage	31.5	2.0e-09
AWZ78041.1|65735_65855_+	putative membrane protein	NA	NA	NA	NA	NA
AWZ78001.1|66144_66279_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ77956.1|66511_66871_-	hypothetical protein	NA	A0A218MND9	uncultured_virus	62.0	3.6e-19
AWZ77975.1|67042_67264_-|transposase	putative transposase	transposase	A0A1V0E8E1	Vibrio_phage	64.3	2.4e-13
AWZ78061.1|67374_68559_+|transposase	transposase DDE domain protein	transposase	NA	NA	NA	NA
AWZ78028.1|68835_70155_+|transposase	transposase DDE domain protein	transposase	Q9MBP7	Staphylococcus_prophage	24.2	1.9e-12
AWZ77980.1|70404_71286_-	carbapenem-hydrolyzing beta-lactamase Sme-1	NA	A0A1B0VBP7	Salmonella_phage	52.2	2.2e-73
AWZ77953.1|71573_72353_-	istB-like ATP binding family protein	NA	A0A2L1IVB6	Escherichia_phage	61.8	2.5e-89
AWZ78024.1|72349_73354_-|integrase	integrase core domain protein	integrase	A0A2L1IVA1	Escherichia_phage	50.8	8.7e-87
75236:75250	attR	AGGCCAGCGCGGCAA	NA	NA	NA	NA
