The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP028429	Escherichia coli strain RM9131 chromosome, complete genome	5238870	326300	336628	5238870	transposase	Enterobacteria_phage(20.0%)	11	NA	NA
AWZ50372.1|326300_327356_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	61.1	7.0e-119
AWZ50373.1|327643_328747_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
AWZ50374.1|328758_330012_+	gamma-glutamyl-phosphate reductase	NA	A0A1X9I5D4	Streptococcus_phage	47.0	1.7e-95
AWZ50375.1|330367_331582_+	DUF4102 domain-containing protein	NA	Q7M297	Enterobacteria_phage	56.5	7.5e-133
AWZ50376.1|331724_332606_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ50377.1|332803_333001_+	AlpA family transcriptional regulator	NA	A0A1V0E8E5	Vibrio_phage	48.1	1.7e-07
AWZ50378.1|333000_333432_+	hypothetical protein	NA	A0A1W6JPH9	Morganella_phage	49.0	5.1e-28
AWZ50379.1|333444_333840_+	hypothetical protein	NA	A0A139ZPI9	Marinitoga_camini_virus	36.6	2.1e-07
AWZ50380.1|333865_335078_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
AWZ50381.1|335044_335308_+	hypothetical protein	NA	A0A0N7BTS3	Escherichia_phage	75.7	3.4e-06
AWZ50382.1|335557_336628_+	DNA (cytosine-5-)-methyltransferase	NA	A0A1B1IRZ3	uncultured_Mediterranean_phage	29.6	2.6e-20
>prophage 2
CP028429	Escherichia coli strain RM9131 chromosome, complete genome	5238870	550426	630318	5238870	capsid,transposase,protease,head,tRNA,tail	Escherichia_phage(33.33%)	74	NA	NA
AWZ50582.1|550426_550906_-|tRNA	Cys-tRNA(Pro) deacylase	tRNA	NA	NA	NA	NA
AWZ50583.1|550921_551200_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ50584.1|551109_551904_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ50585.1|552041_552383_+	addiction module antidote protein, HigA family	NA	A0A222YWD7	Escherichia_phage	74.5	2.1e-40
AWZ50586.1|552496_555001_-	copper-exporting P-type ATPase CopA	NA	A0A218MNH6	uncultured_virus	38.4	3.8e-115
AWZ50587.1|555262_556195_+	glutaminase	NA	NA	NA	NA	NA
AWZ50588.1|556197_557490_+	amino acid permease	NA	NA	NA	NA	NA
AWZ50589.1|557614_558022_+	transcriptional regulator	NA	NA	NA	NA	NA
AWZ50590.1|558022_558481_-	NfeD family protein	NA	NA	NA	NA	NA
AWZ50591.1|558477_559395_-	paraslipin	NA	NA	NA	NA	NA
AWZ50592.1|559540_560218_+	iron ABC transporter ATP-binding protein FetA	NA	G3M9Y6	Bacillus_virus	33.8	3.1e-27
AWZ50593.1|560204_560987_+	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
AWZ50594.1|561049_561904_-	co-chaperone YbbN	NA	NA	NA	NA	NA
AWZ50595.1|561964_562774_-	oxidoreductase	NA	NA	NA	NA	NA
AWZ50596.1|562763_563390_-	arylesterase	NA	NA	NA	NA	NA
AWZ50597.1|563357_564044_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.6	2.9e-33
AWZ50598.1|564040_566455_+	ABC transporter permease	NA	NA	NA	NA	NA
AWZ50599.1|571076_571337_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ50600.1|571375_571567_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ50601.1|572568_573663_-|tRNA	tRNA 2-selenouridine(34) synthase MnmH	tRNA	NA	NA	NA	NA
AWZ50602.1|573731_574658_-	HTH-type transcriptional activator AllS	NA	NA	NA	NA	NA
AWZ50603.1|574887_575370_+	ureidoglycolate lyase	NA	NA	NA	NA	NA
AWZ50604.1|575447_576263_+	transcriptional regulator	NA	NA	NA	NA	NA
AWZ50605.1|576352_578134_+	glyoxylate carboligase	NA	E4WLQ6	Ostreococcus_tauri_virus	27.0	7.8e-38
AWZ50606.1|578146_578923_+	hydroxypyruvate isomerase	NA	NA	NA	NA	NA
AWZ50607.1|579022_579901_+	2-hydroxy-3-oxopropionate reductase	NA	NA	NA	NA	NA
AWZ50608.1|580069_581524_+	putative allantoin permease	NA	NA	NA	NA	NA
AWZ50609.1|581583_582945_+	cyclic amidohydrolase	NA	NA	NA	NA	NA
AWZ50610.1|583001_584303_+	uracil/xanthine transporter	NA	NA	NA	NA	NA
AWZ50611.1|584324_585470_+	glycerate kinase	NA	W6LM47	Streptococcus_phage	41.9	1.1e-48
AWZ50612.1|585598_586384_-	(S)-ureidoglycine aminohydrolase	NA	NA	NA	NA	NA
AWZ50613.1|586394_587630_-	allantoate amidohydrolase	NA	NA	NA	NA	NA
AWZ50614.1|587651_588701_-	ureidoglycolate dehydrogenase	NA	NA	NA	NA	NA
AWZ50615.1|589017_590685_+	acyl-CoA synthetase FdrA	NA	NA	NA	NA	NA
AWZ50616.1|590694_591954_+	DUF1116 domain-containing protein	NA	NA	NA	NA	NA
AWZ50617.1|591964_592780_+	DUF2877 domain-containing protein	NA	NA	NA	NA	NA
AWZ50618.1|592776_593670_+	carbamate kinase	NA	NA	NA	NA	NA
AWZ50619.1|593806_594874_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
AWZ50620.1|594870_595380_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	NA	NA	NA	NA
AWZ50621.1|595497_596220_-	UDP-2,3-diacylglucosamine hydrolase	NA	NA	NA	NA	NA
AWZ50622.1|596222_596717_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
AWZ50623.1|596890_598276_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.0e-45
AWZ50624.1|598311_598833_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
AWZ50625.1|598940_599153_-	ribosome-associated protein	NA	NA	NA	NA	NA
AWZ50626.1|599154_600021_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
AWZ50627.1|600501_601044_+	type 1 fimbrial protein subunit FimA	NA	NA	NA	NA	NA
AWZ50628.1|601263_601956_+	molecular chaperone FimC	NA	NA	NA	NA	NA
AWZ50629.1|601986_604596_+	outer membrane usher protein	NA	NA	NA	NA	NA
AWZ50630.1|605647_606163_+	fimbriae assembly protein	NA	NA	NA	NA	NA
AWZ50631.1|606165_606798_-	DNA-binding response regulator	NA	NA	NA	NA	NA
AWZ50632.1|608008_608341_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	5.0e-55
AWZ50633.1|608396_609422_+|capsid	minor capsid protein E	capsid	C6ZCY2	Enterobacteria_phage	97.4	3.1e-188
AWZ50634.1|609463_609859_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	95.5	5.7e-58
AWZ50635.1|609870_610170_+|tail	phage tail protein	tail	A0A2R9YJJ5	Escherichia_phage	98.9	8.4e-46
AWZ50636.1|610190_611403_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	57.1	8.3e-100
AWZ50637.1|611496_612075_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	1.3e-79
AWZ50638.1|612071_612467_+|tail	phage tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	98.5	1.4e-69
AWZ54978.1|612474_613215_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	98.0	1.0e-129
AWZ50639.1|613230_613653_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	3.1e-70
AWZ50640.1|613634_614069_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
AWZ50641.1|614061_616242_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	90.7	0.0e+00
AWZ50642.1|616247_617460_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
AWZ54977.1|617530_618157_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AWZ50643.1|618255_618561_+|tail	phage tail protein	tail	K7PMH7	Enterobacteria_phage	76.5	2.8e-12
AWZ50644.1|618744_620229_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
AWZ50645.1|620415_621369_-|protease	protease 7	protease	NA	NA	NA	NA
AWZ50646.1|621394_621586_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ50647.1|621771_621888_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ50648.1|621881_622643_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AWZ50649.1|622699_622912_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ50650.1|622825_623716_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ50651.1|623716_626689_-	phage receptor	NA	NA	NA	NA	NA
AWZ50652.1|626675_628913_-	phage adsorption protein NrfB	NA	NA	NA	NA	NA
AWZ50653.1|629181_630318_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
>prophage 3
CP028429	Escherichia coli strain RM9131 chromosome, complete genome	5238870	849743	869068	5238870	transposase,holin,integrase	Enterobacteria_phage(54.55%)	28	854983:854997	868384:868398
AWZ50852.1|849743_850820_-|integrase	integrase	integrase	K7P6P6	Enterobacteria_phage	99.4	1.8e-199
AWZ50853.1|850833_851244_-	lysozyme	NA	A0A0N7KZA0	Stx2-converting_phage	99.2	1.1e-64
AWZ50854.1|852529_852820_+	hypothetical protein	NA	K7PH23	Enterobacteria_phage	100.0	2.5e-50
AWZ50855.1|853116_853479_+	hypothetical protein	NA	A0A2I6PIG0	Escherichia_phage	67.9	4.4e-33
AWZ50856.1|853450_853861_+	recombination protein NinB	NA	A0A0P0ZCW6	Stx2-converting_phage	98.5	2.1e-71
AWZ50857.1|853857_854034_+	NinE family protein	NA	A5VW90	Enterobacteria_phage	100.0	4.6e-28
AWZ50858.1|854036_854396_+	DUF2591 domain-containing protein	NA	G8EYI2	Enterobacteria_phage	95.0	2.7e-62
AWZ50859.1|854395_854572_+	protein ninF	NA	A0A220NRM2	Escherichia_phage	100.0	1.9e-26
AWZ50860.1|854564_854777_+	hypothetical protein	NA	K7PK10	Enterobacteria_phage	100.0	1.6e-35
AWZ50861.1|854769_855060_+	DUF1364 domain-containing protein	NA	K7PK25	Enterobacteria_phage	97.9	7.1e-50
854983:854997	attL	GACGCCAGACTTTAC	NA	NA	NA	NA
AWZ50862.1|855056_855419_+	RusA family crossover junction endodeoxyribonuclease	NA	A5VW85	Enterobacteria_phage	98.3	3.5e-62
AWZ50863.1|855415_855604_+	protein ninH	NA	A5VW84	Enterobacteria_phage	100.0	5.5e-27
AWZ50864.1|855815_856775_-	DUF2219 domain-containing protein	NA	NA	NA	NA	NA
AWZ50865.1|857114_857237_+	YlcG family protein	NA	NA	NA	NA	NA
AWZ50866.1|857251_857941_+	antitermination protein	NA	I6PDF8	Cronobacter_phage	48.1	1.5e-58
AWZ50867.1|858152_858869_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ50868.1|858954_859113_+	DUF3927 domain-containing protein	NA	NA	NA	NA	NA
AWZ50869.1|859411_861262_+	DUF1737 domain-containing protein	NA	B6DZ89	Enterobacteria_phage	95.9	0.0e+00
AWZ50870.1|861540_861702_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ50871.1|861700_861916_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	97.2	1.7e-32
AWZ50872.1|861915_862104_+	lysozyme	NA	A0A0N7KZA0	Stx2-converting_phage	100.0	1.9e-19
AWZ50873.1|862106_863320_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
AWZ50874.1|863373_863577_+	hypothetical protein	NA	A0A1I9LJT0	Stx_converting_phage	97.0	1.4e-28
AWZ50875.1|863682_864564_+	T3SS effector protein NleH	NA	A5LH48	Enterobacteria_phage	90.4	3.9e-147
AWZ50876.1|864787_865618_+	cell division protein	NA	A5LH49	Enterobacteria_phage	97.8	7.6e-153
AWZ50877.1|865741_866113_-|integrase	integrase	integrase	K7PH54	Enterobacteria_phage	95.1	1.1e-58
AWZ50878.1|867331_867712_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ50879.1|867855_869068_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
868384:868398	attR	GTAAAGTCTGGCGTC	NA	NA	NA	NA
>prophage 4
CP028429	Escherichia coli strain RM9131 chromosome, complete genome	5238870	1079722	1122281	5238870	protease,lysis,transposase,holin	Escherichia_phage(37.93%)	62	NA	NA
AWZ51057.1|1079722_1081483_-|protease	Lon protease	protease	NA	NA	NA	NA
AWZ51058.1|1081668_1082121_+	macrodomain Ter protein	NA	NA	NA	NA	NA
AWZ54990.1|1082196_1083237_-	outer membrane protein A	NA	NA	NA	NA	NA
AWZ51059.1|1083391_1083610_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ51060.1|1083593_1084103_-	cell division inhibitor SulA	NA	NA	NA	NA	NA
AWZ51061.1|1084375_1084951_+	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
AWZ54991.1|1084913_1087067_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
AWZ51062.1|1087085_1087532_-	YccF domain-containing protein	NA	NA	NA	NA	NA
AWZ51063.1|1087654_1089709_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.9	7.7e-21
AWZ51064.1|1089740_1090199_-	methylglyoxal synthase	NA	NA	NA	NA	NA
AWZ51065.1|1090294_1090957_-	DUF2057 domain-containing protein	NA	NA	NA	NA	NA
AWZ51066.1|1091129_1091543_+	CoA-binding protein	NA	NA	NA	NA	NA
AWZ51067.1|1091587_1091905_-	heat-shock protein HspQ	NA	NA	NA	NA	NA
AWZ51068.1|1091962_1093153_-	ribosomal RNA large subunit methyltransferase I	NA	NA	NA	NA	NA
AWZ51069.1|1093247_1093526_+	acylphosphatase	NA	NA	NA	NA	NA
AWZ51070.1|1093522_1093852_-	sulfurtransferase TusE	NA	NA	NA	NA	NA
AWZ51071.1|1093942_1094602_-	BAX inhibitor protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	54.9	5.2e-48
AWZ51072.1|1097407_1098621_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
AWZ51073.1|1098672_1100097_-	exonuclease	NA	NA	NA	NA	NA
AWZ51074.1|1100189_1100381_-	DUF1482 domain-containing protein	NA	NA	NA	NA	NA
AWZ51075.1|1100377_1100566_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
AWZ54992.1|1101097_1101472_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ51076.1|1101483_1101636_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	53.2	3.9e-07
AWZ51077.1|1101673_1101868_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ51078.1|1101908_1102625_-	LexA family transcriptional repressor	NA	H9C160	Pectobacterium_phage	42.0	3.8e-52
AWZ51079.1|1102674_1102890_+	transcriptional regulator	NA	NA	NA	NA	NA
AWZ51080.1|1102886_1103312_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
AWZ51081.1|1103383_1104454_+	phage replisome organizer	NA	A0A088CD36	Shigella_phage	65.2	3.2e-63
AWZ51082.1|1104494_1104917_+	DUF977 domain-containing protein	NA	A0A0U2QQN3	Escherichia_phage	92.1	1.1e-64
AWZ51083.1|1104913_1105210_+	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	93.7	7.5e-47
AWZ51084.1|1105206_1105668_+	hypothetical protein	NA	Q8VNQ2	Enterobacteria_phage	92.9	3.4e-38
AWZ51085.1|1105645_1106002_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	98.3	3.0e-58
AWZ51086.1|1106052_1106265_+	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	94.3	5.8e-33
AWZ51087.1|1106350_1106515_+	O-polysaccharide acetyltransferase inhibitor	NA	A0A1I9LJM2	Stx_converting_phage	90.7	2.0e-17
AWZ51088.1|1106516_1106780_+	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	72.4	8.8e-31
AWZ51089.1|1106790_1107660_+	DUF551 domain-containing protein	NA	A0A1U9AJ59	Stx1_converting_phage	76.8	5.2e-120
AWZ51090.1|1107775_1107880_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ51091.1|1107868_1108024_-	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	83.8	1.9e-09
AWZ51092.1|1108068_1108281_+	Hok/Gef family protein	NA	A0A0U2QV81	Escherichia_phage	91.4	1.2e-25
AWZ51093.1|1108448_1108709_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ51094.1|1108728_1109778_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	3.4e-110
AWZ51095.1|1109790_1110162_+	hypothetical protein	NA	V5URS4	Shigella_phage	63.7	1.3e-35
AWZ51096.1|1110151_1110523_+	antitermination protein	NA	Q777W5	Enterobacteria_phage	84.0	1.0e-53
AWZ51097.1|1110674_1111493_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
AWZ51098.1|1111779_1111977_+	TrmB family transcriptional regulator	NA	S5MQK8	Escherichia_phage	96.9	2.6e-27
AWZ51099.1|1112114_1112828_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AWZ51100.1|1113274_1113478_-	hypothetical protein	NA	Q8VNP0	Enterobacteria_phage	96.7	1.8e-28
AWZ51101.1|1113595_1115446_+	DUF1737 domain-containing protein	NA	B6DZ89	Enterobacteria_phage	95.9	0.0e+00
AWZ51102.1|1115724_1115886_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ51103.1|1115884_1116100_+|holin	holin	holin	Q6H9V8	Enterobacteria_phage	97.2	1.7e-32
AWZ51104.1|1116062_1116407_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ51105.1|1116355_1116592_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ51106.1|1116560_1116743_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ51107.1|1116787_1117321_+	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	94.4	3.1e-99
AWZ51108.1|1117541_1117655_+	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	97.3	5.6e-11
AWZ51109.1|1117656_1118124_+|lysis	lysis protein	lysis	Q7AYI6	Enterobacteria_phage	93.5	2.2e-72
AWZ51110.1|1118206_1118347_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ51111.1|1118588_1118903_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
AWZ54993.1|1118984_1119209_-	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	90.6	1.7e-19
AWZ51112.1|1119258_1120472_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
AWZ51113.1|1120558_1121452_-	molecular chaperone Tir	NA	NA	NA	NA	NA
AWZ51114.1|1121897_1122281_-	secretion protein EspV	NA	Q6H9S1	Enterobacteria_phage	84.3	4.4e-55
>prophage 5
CP028429	Escherichia coli strain RM9131 chromosome, complete genome	5238870	1345857	1414540	5238870	capsid,lysis,transposase,terminase,holin,head,integrase,tRNA,tail	Stx2-converting_phage(33.96%)	76	1340951:1340965	1347432:1347446
1340951:1340965	attL	GATCGCGATGTACGC	NA	NA	NA	NA
AWZ51338.1|1345857_1346976_-|integrase	integrase	integrase	Q77Z04	Phage_21	43.9	2.9e-83
AWZ51339.1|1346944_1347214_-	excisionase	NA	NA	NA	NA	NA
AWZ51340.1|1347275_1349741_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	57.1	8.8e-56
1347432:1347446	attR	GCGTACATCGCGATC	NA	NA	NA	NA
AWZ51341.1|1349833_1350025_-	DUF1482 domain-containing protein	NA	NA	NA	NA	NA
AWZ51342.1|1350021_1350210_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
AWZ51343.1|1350693_1350912_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ51344.1|1350952_1351342_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ51345.1|1351268_1351433_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ51346.1|1351637_1351916_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
AWZ51347.1|1351917_1352145_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ51348.1|1352129_1352564_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ51349.1|1352598_1352901_+	transcriptional regulator	NA	K7PHA1	Enterobacteria_phage	34.8	1.5e-05
AWZ51350.1|1352897_1353323_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
AWZ55012.1|1353345_1354308_+	DNA-binding protein	NA	U5P0A0	Shigella_phage	51.2	2.1e-69
AWZ51351.1|1354802_1356016_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
AWZ51352.1|1356530_1357109_+	hypothetical protein	NA	A0A0U2RXY7	Escherichia_phage	100.0	2.6e-104
AWZ51353.1|1357068_1358166_-	beta family protein	NA	A0A0U2S621	Escherichia_phage	99.5	1.4e-210
AWZ51354.1|1358800_1360014_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
AWZ51355.1|1360051_1360192_+	type I toxin-antitoxin system hok family toxin	NA	A0A0U2QV81	Escherichia_phage	95.0	2.2e-12
AWZ51356.1|1360233_1360413_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ51357.1|1360359_1360632_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	49.2	9.4e-12
AWZ51358.1|1360633_1361689_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	47.8	2.4e-87
AWZ51359.1|1361689_1362055_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	64.3	1.6e-38
AWZ51360.1|1362063_1362594_+	DUF1133 domain-containing protein	NA	A0A0U2S606	Escherichia_phage	72.6	9.3e-72
AWZ51361.1|1362712_1363033_+	lipoprotein	NA	S5MQK8	Escherichia_phage	97.4	2.5e-35
AWZ51362.1|1363183_1364242_+	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	94.0	2.0e-198
AWZ51363.1|1364733_1364919_+	hypothetical protein	NA	Q5MBW5	Stx1-converting_phage	94.6	4.6e-26
AWZ51364.1|1365038_1366889_+	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	98.1	0.0e+00
AWZ51365.1|1367167_1367329_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ51366.1|1367327_1367543_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	7.7e-33
AWZ51367.1|1367547_1367892_+	DUF1327 domain-containing protein	NA	A0A0P0ZD64	Stx2-converting_phage	100.0	1.0e-58
AWZ51368.1|1367942_1368476_+	lysozyme	NA	A0A0N7KZF9	Stx2-converting_phage	98.9	7.4e-101
AWZ51369.1|1368746_1369316_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
AWZ51370.1|1369469_1369937_+|lysis	lysis protein	lysis	Q6H9V3	Enterobacteria_phage	100.0	6.9e-79
AWZ51371.1|1370299_1370527_-	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
AWZ51372.1|1370568_1370934_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	99.2	2.0e-65
AWZ51373.1|1370902_1371109_+	hypothetical protein	NA	H6WZK7	Escherichia_phage	83.8	7.4e-25
AWZ51374.1|1371224_1371788_+|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	100.0	3.8e-79
AWZ51375.1|1371784_1373446_+|terminase	terminase large subunit	terminase	H6WZK9	Escherichia_phage	98.9	0.0e+00
AWZ51376.1|1373509_1375447_+|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	99.7	0.0e+00
AWZ55013.1|1375491_1375713_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
AWZ51377.1|1378401_1378728_+|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
AWZ51378.1|1378737_1379088_+|head,tail	head-tail adaptor protein	head,tail	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
AWZ51379.1|1379084_1379531_+	hypothetical protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
AWZ51380.1|1379527_1379872_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
AWZ51381.1|1379938_1380655_+|tail	phage tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	98.7	5.6e-128
AWZ51382.1|1380660_1381035_+|tail	phage tail protein	tail	A0A0P0ZE84	Stx2-converting_phage	98.4	6.6e-64
AWZ51383.1|1381058_1381340_+|tail	phage tail protein	tail	A0A0P0ZDE6	Stx2-converting_phage	100.0	1.3e-45
AWZ51384.1|1381391_1384634_+|tail	phage tail tape measure protein	tail	A0A0P0ZE78	Stx2-converting_phage	98.5	0.0e+00
AWZ51385.1|1384626_1384968_+|tail	phage tail protein	tail	H6WZM2	Escherichia_phage	95.6	5.3e-60
AWZ51386.1|1384967_1385666_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.4	4.4e-130
AWZ55014.1|1385682_1386003_-	Arc family DNA-binding protein	NA	A0A0P0ZBD1	Stx2-converting_phage	100.0	3.0e-49
AWZ51387.1|1386110_1386284_+	Arc family DNA-binding protein	NA	A0A0P0ZC65	Stx2-converting_phage	100.0	3.4e-23
AWZ51388.1|1387331_1388069_+|tail	phage tail protein	tail	A0A0P0ZDT1	Stx2-converting_phage	98.8	1.9e-147
AWZ51389.1|1387966_1388647_+|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	98.2	8.7e-115
AWZ51390.1|1388883_1392363_+	host specificity protein J	NA	A0A0P0ZDT4	Stx2-converting_phage	97.4	0.0e+00
AWZ51391.1|1392429_1393029_+	Ail/Lom family protein	NA	Q687E7	Enterobacteria_phage	100.0	8.0e-112
AWZ51392.1|1393093_1394416_+|tail	phage tail protein	tail	Q687E6	Enterobacteria_phage	99.1	2.4e-76
AWZ51393.1|1394417_1394687_+|tail	phage tail protein	tail	A0A2R2Z347	Escherichia_phage	98.9	2.4e-44
AWZ51394.1|1394902_1397251_+	type III secretion system effector HECT-type E3 ubiquitin transferase	NA	NA	NA	NA	NA
AWZ51395.1|1397841_1401243_+	DUF4765 domain-containing protein	NA	A0A0N7KZG3	Stx2-converting_phage	39.2	1.0e-219
AWZ51396.1|1401399_1401990_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ51397.1|1402012_1402138_+	NleB	NA	Q8HAB2	Salmonella_phage	58.3	8.7e-05
AWZ51398.1|1402217_1402493_-	secretion protein EspO	NA	NA	NA	NA	NA
AWZ51399.1|1402553_1403915_-	type III secretion protein GogB	NA	Q9MBM1	Phage_Gifsy-1	28.9	4.0e-50
AWZ51400.1|1404035_1404248_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ51401.1|1404278_1405142_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
AWZ51402.1|1405125_1406262_-	Fe3+/spermidine/putrescine ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	39.8	9.4e-29
AWZ55015.1|1406240_1406456_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ51403.1|1406511_1407741_+	peptidase T	NA	NA	NA	NA	NA
AWZ51404.1|1407886_1409008_-	50S ribosomal protein L16 arginine hydroxylase	NA	NA	NA	NA	NA
AWZ51405.1|1409083_1410544_-	sensor protein PhoQ	NA	NA	NA	NA	NA
AWZ51406.1|1410543_1411215_-	two-component system response regulator PhoP	NA	NA	NA	NA	NA
AWZ51407.1|1411382_1412753_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	4.2e-108
AWZ55016.1|1412756_1413398_-	lysogenization protein HflD	NA	NA	NA	NA	NA
AWZ51408.1|1413433_1414540_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
>prophage 6
CP028429	Escherichia coli strain RM9131 chromosome, complete genome	5238870	1515756	1588778	5238870	lysis,transposase,terminase,holin,protease,portal,tail	Enterobacteria_phage(45.1%)	79	NA	NA
AWZ51502.1|1515756_1516305_+	recombinase family protein	NA	G8I4U3	Mycobacterium_phage	36.1	2.7e-21
AWZ51503.1|1517815_1518004_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ51504.1|1518151_1519364_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
AWZ51505.1|1519428_1519965_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	71.9	4.1e-59
AWZ55026.1|1519997_1520279_+	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	75.8	1.6e-30
AWZ51506.1|1520275_1520572_+	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	93.7	4.4e-47
AWZ51507.1|1520568_1521030_+	hypothetical protein	NA	Q8VNQ2	Enterobacteria_phage	95.2	6.9e-39
AWZ51508.1|1521007_1521364_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	97.5	6.7e-58
AWZ51509.1|1521459_1521831_+	hypothetical protein	NA	A0A0N7KZJ2	Stx2-converting_phage	78.9	2.7e-49
AWZ51510.1|1521827_1522181_+	DUF551 domain-containing protein	NA	Q9EY98	Enterobacteria_phage	65.0	5.5e-36
AWZ51511.1|1522386_1522686_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2R2Z2Y1	Escherichia_phage	96.0	1.6e-49
AWZ51512.1|1522691_1522949_-	type II toxin-antitoxin system ParD family antitoxin	NA	A0A0N7C055	Escherichia_phage	88.0	6.6e-31
AWZ51513.1|1523084_1523363_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	46.9	6.9e-10
AWZ51514.1|1523364_1524414_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.3	1.0e-109
AWZ51515.1|1524426_1524801_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	2.4e-34
AWZ51516.1|1524797_1525619_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	61.9	2.8e-83
AWZ51517.1|1525845_1526043_+	TrmB family transcriptional regulator	NA	S5MQK8	Escherichia_phage	98.5	1.8e-28
AWZ51518.1|1526193_1527252_+	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	98.0	1.7e-205
AWZ51519.1|1527846_1529793_+	DUF1737 domain-containing protein	NA	Q9EYC8	Enterobacteria_phage	99.1	0.0e+00
AWZ51520.1|1529930_1530110_+	DUF1378 domain-containing protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
AWZ51521.1|1530150_1530396_+	DUF826 domain-containing protein	NA	A0A088CE63	Shigella_phage	98.8	3.2e-19
AWZ51522.1|1530473_1530689_+|holin	holin	holin	A0A2R2Z340	Escherichia_phage	100.0	1.2e-33
AWZ51523.1|1530963_1532176_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
AWZ51524.1|1532599_1533133_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	97.2	2.1e-100
AWZ51525.1|1533431_1533899_+|lysis	lysis protein	lysis	Q7AYI6	Enterobacteria_phage	96.1	3.9e-74
AWZ51526.1|1534312_1534789_+	DUF1441 domain-containing protein	NA	Q8VNN8	Enterobacteria_phage	100.0	3.3e-84
AWZ51527.1|1534785_1536909_+|terminase	phage terminase large subunit family protein	terminase	Q9EYD1	Enterobacteria_phage	100.0	0.0e+00
AWZ51528.1|1536881_1537118_+	hypothetical protein	NA	Q687G1	Enterobacteria_phage	100.0	4.5e-34
AWZ51529.1|1537117_1538620_+|portal	phage portal protein	portal	Q9EYD2	Enterobacteria_phage	100.0	4.8e-291
AWZ55027.1|1538633_1540589_+	peptidase S14	NA	S5M7Q8	Escherichia_phage	99.8	0.0e+00
AWZ51530.1|1540676_1541003_+	DUF2190 domain-containing protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
AWZ51531.1|1540995_1541277_+	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	97.8	3.9e-45
AWZ51532.1|1541279_1541903_+|tail	phage tail protein	tail	Q9EYD6	Enterobacteria_phage	100.0	6.6e-101
AWZ51533.1|1541915_1542314_+|tail	phage tail protein	tail	Q9EYD7	Enterobacteria_phage	100.0	5.9e-71
AWZ51534.1|1542321_1543074_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
AWZ51535.1|1543087_1543510_+|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	100.0	5.1e-73
AWZ51536.1|1543536_1543845_+|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	100.0	1.3e-54
AWZ51537.1|1543888_1546534_+|tail	phage tail tape measure protein	tail	Q9EYE1	Enterobacteria_phage	99.4	0.0e+00
AWZ51538.1|1546530_1546860_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
AWZ51539.1|1547567_1548311_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	98.4	1.5e-147
AWZ51540.1|1548208_1548889_+|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	98.2	8.7e-115
AWZ51541.1|1549125_1552602_+	DUF1983 domain-containing protein	NA	Q687E8	Enterobacteria_phage	96.6	0.0e+00
AWZ51542.1|1552669_1553269_+	Ail/Lom family protein	NA	Q687E7	Enterobacteria_phage	99.0	8.8e-111
AWZ51543.1|1553333_1554647_+|tail	phage tail protein	tail	A0A0P0ZCC1	Stx2-converting_phage	97.0	3.7e-77
AWZ51544.1|1554648_1554918_+|tail	phage tail protein	tail	A0A1U9AJC2	Stx1_converting_phage	97.8	2.7e-43
AWZ51545.1|1556053_1556644_+	protein kinase	NA	NA	NA	NA	NA
AWZ51546.1|1557680_1558187_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
AWZ51547.1|1558232_1558733_-	YciE/YciF family protein	NA	NA	NA	NA	NA
AWZ51548.1|1558818_1558998_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ51549.1|1559378_1560185_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
AWZ51550.1|1560184_1561378_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
AWZ55028.1|1561389_1562748_-	bifunctional indole-3-glycerol phosphate synthase/phosphoribosylanthranilate isomerase	NA	A0A0P0IR83	Acinetobacter_phage	40.7	8.6e-37
AWZ51551.1|1562751_1564347_-	bifunctional glutamine amidotransferase/anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	3.8e-52
AWZ51552.1|1564346_1565909_-	anthranilate synthase component I	NA	NA	NA	NA	NA
AWZ55029.1|1566000_1566045_-	trp operon leader peptide	NA	NA	NA	NA	NA
AWZ51553.1|1566182_1567064_+	phosphatase	NA	NA	NA	NA	NA
AWZ51554.1|1567060_1567681_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
AWZ51555.1|1567781_1568654_+	23S rRNA pseudouridylate synthase B	NA	NA	NA	NA	NA
AWZ51556.1|1568693_1569284_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
AWZ51557.1|1569280_1570039_-	NAD(P)-dependent oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	24.5	4.4e-06
AWZ51558.1|1570258_1571308_+|protease	protease	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
AWZ51559.1|1571343_1571595_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ51560.1|1571639_1571852_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ51561.1|1571974_1574572_+	DNA topoisomerase 1	NA	A0A2K9L1Q2	Tupanvirus	34.7	1.7e-86
AWZ51562.1|1574781_1575756_+	LysR family transcriptional regulator CysB	NA	NA	NA	NA	NA
AWZ51563.1|1576050_1576215_+	YmiA family putative membrane protein	NA	NA	NA	NA	NA
AWZ51564.1|1576217_1576385_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ51565.1|1576521_1576704_+	acnA regulatory region 60-length spurious protein	NA	NA	NA	NA	NA
AWZ51566.1|1576757_1579433_+	aconitate hydratase AcnA	NA	NA	NA	NA	NA
AWZ51567.1|1579496_1580087_-	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.9	7.7e-43
AWZ51568.1|1580256_1581021_+	phosphatidylglycerophosphatase B	NA	NA	NA	NA	NA
AWZ51569.1|1581169_1581478_+	LPS assembly protein A	NA	NA	NA	NA	NA
AWZ51570.1|1581484_1582654_+	LPS assembly protein B	NA	NA	NA	NA	NA
AWZ51571.1|1582845_1583583_+	orotidine-5'-phosphate decarboxylase	NA	NA	NA	NA	NA
AWZ51572.1|1583582_1583909_+	stress response translation initiation inhibitor YciH	NA	NA	NA	NA	NA
AWZ51573.1|1584034_1584253_-	osmotically-inducible lipoprotein B	NA	NA	NA	NA	NA
AWZ51574.1|1584521_1585271_-	DeoR family transcriptional regulator	NA	NA	NA	NA	NA
AWZ51575.1|1585360_1585534_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ51576.1|1587564_1588778_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
>prophage 7
CP028429	Escherichia coli strain RM9131 chromosome, complete genome	5238870	1649162	1744923	5238870	capsid,lysis,transposase,holin,terminase,head,integrase,tRNA,tail	Escherichia_phage(40.45%)	121	1707871:1707930	1738616:1739927
AWZ55031.1|1649162_1650395_-	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
AWZ51635.1|1650649_1651633_+	zinc transporter ZntB	NA	NA	NA	NA	NA
AWZ51636.1|1651907_1652081_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ51637.1|1652110_1653484_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
AWZ51638.1|1653612_1654548_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.8	5.9e-146
AWZ51639.1|1654599_1655835_-|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	99.5	3.8e-241
AWZ51640.1|1655836_1656052_-	hypothetical protein	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
AWZ55033.1|1656151_1656340_-	DUF1187 domain-containing protein	NA	A0A0U2QL97	Escherichia_phage	98.4	5.5e-27
AWZ55032.1|1656377_1656527_-	restriction alleviation protein, Lar family	NA	A0A0U2QQP4	Escherichia_phage	95.9	2.5e-22
AWZ51641.1|1656582_1657392_-	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	4.0e-106
AWZ51642.1|1657384_1659985_-	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.5	6.1e-249
AWZ51643.1|1660086_1660362_-	hypothetical protein	NA	A0A0U2QW85	Escherichia_phage	95.6	4.0e-42
AWZ55034.1|1660436_1660607_-	hypothetical protein	NA	A0A0U2SHB5	Escherichia_phage	71.4	3.6e-17
AWZ51644.1|1660606_1660828_-	cell division protein FtsZ	NA	A0A0U2RTC4	Escherichia_phage	98.6	2.0e-36
AWZ51645.1|1660956_1661235_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ51646.1|1661269_1661758_+	superinfection exclusion protein B	NA	NA	NA	NA	NA
AWZ51647.1|1661754_1661910_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	55.3	6.1e-08
AWZ51648.1|1661920_1662100_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ51649.1|1662087_1662306_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ51650.1|1662342_1662762_-	transcriptional regulator	NA	A0A2I6PIE7	Escherichia_phage	46.5	5.5e-19
AWZ51651.1|1662841_1663096_+	hypothetical protein	NA	A0A2I6PIE5	Escherichia_phage	61.6	1.3e-18
AWZ51652.1|1663092_1663515_+	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	92.9	1.3e-68
AWZ51653.1|1663592_1664381_+	hypothetical protein	NA	G9L6A8	Escherichia_phage	64.3	2.0e-41
AWZ51654.1|1664387_1665134_+	replication protein	NA	V5UQI5	Shigella_phage	81.3	5.6e-115
AWZ51655.1|1665105_1665918_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	90.5	7.5e-121
AWZ51656.1|1665933_1666356_+	DUF977 domain-containing protein	NA	A0A0U2QQN3	Escherichia_phage	88.5	3.1e-62
AWZ51657.1|1666461_1666674_+	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	94.3	5.8e-33
AWZ51658.1|1666759_1666924_+	O-polysaccharide acetyltransferase inhibitor	NA	A0A1I9LJM2	Stx_converting_phage	90.7	2.0e-17
AWZ51659.1|1666925_1667189_+	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	72.4	8.8e-31
AWZ51660.1|1667199_1667361_+	hypothetical protein	NA	A0A192Y6F5	Salmonella_phage	89.4	3.2e-15
AWZ51661.1|1667439_1667685_+	hypothetical protein	NA	Q9G078	Enterobacteria_phage	70.7	5.9e-13
AWZ51662.1|1668116_1669268_+	DNA cytosine methyltransferase	NA	Q8JKX6	Natrialba_phage	36.9	1.0e-22
AWZ51663.1|1669235_1670225_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ51664.1|1670224_1671616_-	ATPase	NA	NA	NA	NA	NA
AWZ51665.1|1672115_1672715_+	DUF1367 domain-containing protein	NA	A0A0U2RT94	Escherichia_phage	92.0	1.1e-105
AWZ51666.1|1672714_1673005_+	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	87.5	3.3e-47
AWZ51667.1|1673001_1673556_+	antiterminator	NA	A0A0U2S606	Escherichia_phage	69.1	5.0e-68
AWZ51668.1|1674117_1674549_+	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	97.2	3.3e-67
AWZ51669.1|1675119_1676973_+	DUF1737 domain-containing protein	NA	B6DZ89	Enterobacteria_phage	96.3	0.0e+00
AWZ51670.1|1677122_1677338_+|holin	holin	holin	Q6H9V8	Enterobacteria_phage	97.2	1.3e-32
AWZ51671.1|1677342_1677687_+	DUF1327 domain-containing protein	NA	A0A0P0ZD64	Stx2-converting_phage	95.6	1.8e-55
AWZ51672.1|1677737_1678271_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	97.7	1.3e-100
AWZ51673.1|1678544_1679084_+	ant domain protein	NA	Q5MBW0	Stx1-converting_phage	99.4	3.0e-86
AWZ51674.1|1679086_1680300_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
AWZ51675.1|1680376_1680553_+	phage antirepressor protein	NA	Q5MBW0	Stx1-converting_phage	98.3	3.3e-26
AWZ55035.1|1680781_1681249_+|lysis	lysis protein	lysis	Q7AYI6	Enterobacteria_phage	93.5	2.2e-72
AWZ55036.1|1681278_1681479_+	hypothetical protein	NA	Q9T1L1	Enterobacteria_phage	71.8	7.2e-09
AWZ51676.1|1681400_1681652_+	hypothetical protein	NA	H6WZK4	Escherichia_phage	95.7	3.2e-30
AWZ51677.1|1681587_1681914_+	hypothetical protein	NA	H6WZK5	Escherichia_phage	98.1	6.3e-55
AWZ51678.1|1682045_1682246_-	DUF3950 domain-containing protein	NA	H6WZK6	Escherichia_phage	97.0	1.3e-29
AWZ51679.1|1682287_1682653_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	96.7	1.6e-62
AWZ51680.1|1682941_1683505_+|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	100.0	1.1e-89
AWZ51681.1|1683501_1685163_+|terminase	terminase large subunit	terminase	A0A0N7KZG0	Stx2-converting_phage	99.3	0.0e+00
AWZ51682.1|1685226_1687164_+|capsid	phage major capsid protein	capsid	H6WZL0	Escherichia_phage	99.7	0.0e+00
AWZ55037.1|1687208_1687430_+	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	100.0	5.8e-36
AWZ51683.1|1689794_1690121_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDE0	Stx2-converting_phage	100.0	5.4e-54
AWZ51684.1|1690130_1690481_+|head,tail	head-tail adaptor protein	head,tail	H6WZL5	Escherichia_phage	100.0	2.0e-59
AWZ51685.1|1690477_1690924_+	hypothetical protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
AWZ51686.1|1690920_1691265_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	99.1	9.4e-57
AWZ51687.1|1691333_1692050_+|tail	phage tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	97.9	1.4e-126
AWZ51688.1|1692055_1692430_+|tail	phage tail protein	tail	A0A0N7KZA2	Stx2-converting_phage	99.2	3.0e-64
AWZ51689.1|1692453_1692735_+|tail	phage tail protein	tail	A0A0P0ZDE6	Stx2-converting_phage	100.0	1.3e-45
AWZ51690.1|1692786_1696029_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	99.0	0.0e+00
AWZ51691.1|1696021_1696363_+|tail	phage tail protein	tail	A0A0P0ZCS8	Stx2-converting_phage	100.0	8.7e-63
AWZ51692.1|1696362_1697061_+|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	97.4	1.3e-129
AWZ51693.1|1697071_1697815_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	99.2	5.4e-150
AWZ51694.1|1697712_1698393_+|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	91.1	5.7e-106
AWZ51695.1|1698346_1698553_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ51696.1|1698583_1699111_-	superoxide dismutase	NA	Q9MC02	Salmonella_phage	60.5	1.8e-59
AWZ51697.1|1699244_1702718_+|tail	phage tail protein	tail	A0A0P0ZBW1	Stx2-converting_phage	89.9	0.0e+00
AWZ51698.1|1702785_1703385_+	Ail/Lom family protein	NA	Q9EV15	Enterobacteria_phage	97.0	4.1e-108
AWZ51699.1|1703536_1704841_+|tail	phage tail protein	tail	A0A0P0ZCC1	Stx2-converting_phage	95.4	1.2e-72
AWZ51700.1|1704842_1705112_+|tail	phage tail protein	tail	A0A1U9AJC2	Stx1_converting_phage	97.8	2.7e-43
AWZ55038.1|1706226_1706349_+	hypothetical protein	NA	Q687E5	Enterobacteria_phage	91.3	3.8e-05
AWZ51701.1|1706455_1707367_+	T3SS effector protein NleH	NA	A5LH48	Enterobacteria_phage	82.2	3.0e-134
1707871:1707930	attL	CTGAACCGCCCCGGGTTTCCTGGAGAGTGTTTTATCTGTGAACTCAGGCTGCCAGATCAT	NA	NA	NA	NA
AWZ51702.1|1707913_1709127_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
AWZ51703.1|1710153_1710432_-	secretion protein EspO	NA	NA	NA	NA	NA
AWZ51704.1|1710820_1711006_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ51705.1|1711142_1711790_-	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	41.1	1.6e-41
AWZ51706.1|1711973_1712564_+	bfpT-regulated chaperone	NA	NA	NA	NA	NA
AWZ55039.1|1714292_1714721_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	42.1	1.4e-22
AWZ51707.1|1715069_1715423_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ55040.1|1715513_1716233_+	TonB system transport protein TonB	NA	NA	NA	NA	NA
AWZ51708.1|1716272_1716671_-	acyl-CoA thioester hydrolase YciA	NA	NA	NA	NA	NA
AWZ51709.1|1716775_1717315_-	intracellular septation protein A	NA	NA	NA	NA	NA
AWZ51710.1|1717344_1718088_-	UPF0259 family protein	NA	NA	NA	NA	NA
AWZ51711.1|1718444_1719083_+	outer membrane protein OmpW	NA	NA	NA	NA	NA
AWZ51712.1|1719128_1720259_-|integrase	integrase	integrase	O21940	Phage_21	51.4	3.4e-103
AWZ51713.1|1720236_1720485_-	excisionase	NA	NA	NA	NA	NA
AWZ51714.1|1720549_1723021_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	57.7	5.5e-58
AWZ51715.1|1723116_1723305_-	DUF1482 domain-containing protein	NA	NA	NA	NA	NA
AWZ51716.1|1723301_1723490_-	cell division inhibitor	NA	NA	NA	NA	NA
AWZ51717.1|1723760_1724057_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ51718.1|1724050_1724284_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ51719.1|1724261_1724669_-	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	37.8	7.0e-11
AWZ51720.1|1724691_1724910_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ51721.1|1724982_1725282_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ51722.1|1725546_1725954_-	transcriptional regulator	NA	I6PD69	Cronobacter_phage	49.6	9.8e-29
AWZ51723.1|1726098_1726257_+	transcriptional regulator	NA	NA	NA	NA	NA
AWZ51724.1|1726240_1726792_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ51725.1|1727592_1728258_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	98.7	1.9e-85
AWZ51726.1|1728291_1729026_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	84.3	2.9e-108
AWZ51727.1|1729885_1730644_+	accessory colonization factor AcfC	NA	NA	NA	NA	NA
AWZ51728.1|1730922_1731135_+	Hok/Gef family protein	NA	A0A0U2QV81	Escherichia_phage	72.9	1.3e-16
AWZ51729.1|1731355_1731613_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ51730.1|1731682_1731961_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	2.8e-11
AWZ51731.1|1731962_1733018_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	47.6	2.9e-88
AWZ51732.1|1733018_1733384_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	67.5	1.6e-38
AWZ51733.1|1733380_1734070_+	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	4.0e-59
AWZ51734.1|1734100_1734247_+	antiterminator	NA	NA	NA	NA	NA
AWZ51735.1|1735420_1735549_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ51736.1|1735597_1737367_+	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	96.8	0.0e+00
AWZ51737.1|1737418_1738631_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
AWZ51738.1|1738597_1738720_+	AMP nucleosidase	NA	A0A0N7BTS3	Escherichia_phage	86.1	4.3e-09
AWZ51739.1|1738721_1738991_+|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	100.0	6.4e-45
AWZ51740.1|1739131_1740007_+	secretion protein EspS	NA	A0A0P0ZCT1	Stx2-converting_phage	100.0	1.5e-162
1738616:1739927	attR	ATGATCTGGCAGCCTGAGTTCACAGATAAAACACTCTCCAGGAAACCCGGGGCGGTTCAGGGGCTGAATGAAGTGGGCAGTGATACAGGCAGAACAGGAGAATGACATGAATATACTAAAAAAACTTATGCAGCGTCTGTGTGGTTGCGGAAAGCATGATGGCCGTGAACACGTGCAGTCGCTTACAGCACAACTGCGACTGGGGCCGGCAGACATCCTGGAGTCCGATGAGAATGGTATTATTCCGGAGCAGGACAGGGTAATCACGCAGGTGGTGATACTGGATGCGGATAAAAAGCAGATACAGTGCGTGGTAAGACCGCTGCAAATTCTGCGTGCTGACGGGAGGTGGGAAAATATTGGCGGAATGAAATAGCCGACAGCTTCACAAAAACCGGAGTCCGGCTCCGGTTTTTGTTGTCATGTCCGGTGGATGTTTGTTAGGAATGTTCAGACAGGTTTATTTTGAATTTACACAGAATCCTAAACAGGTTCGAAAATTAAGAAAGAGGTTGTATGTTTAGCATAAGAACCCTACTACCTATTAGCGCCAGCGTATCAGTTCCGACAAAACAATCTCAATCCATCCCAATAACTTTAGCAGGGAGAACAATCGAAAAAGCGCAAGAGAAAGAAGGATTACTTGTTTTTTTAGGAATGAAATCCGTTAATGACTATACTCTTAATATTCTTGGCCAAAATGTTTCAAGAGTCACAACGGGGAAAAAACCGTATGATTTATTATTCCTGAATGATGCTACAAAACAAGATTTTGATAAAAGGAAAATGGAGTTTACATATCCTGGAGCAAATAAAAGCCATCTACAATCAAGTAATAGCGATGTTGTTGCTGCTGCAGCTATAAGTATTACAGCGACAGAGATGAAAACCATCCTGCCAGATGATTTAACACTAGGAAAATACAACAAAATTTATCTGTCTGGGCATGGTTCTGCTGGTCTACCTCTTCTTAAGTGCGGAGATGAATTTTTATCACCGTCAGATATTGTCGACCGCATTGTTCAGCATAATCTTCATGAAATAGATGATATCAGATTAACATCCTGTAACTCAGCCAACATAATAAAAAACAAAGACTTCTCTCCTGATGAAATAGAAAAATCCGCAAATATGAATAACGGCTGGTTGGCCAGGGCATTATTTGGTCAAAAGAGGTCTTTAGCAGAACACGTCTATGCCGAGTTTGAACGTCGCGGAATTAACGTTTCTATATCAGGTTACCATGGCACTGGCGTTTTTTATGTACCAGAGCATGGTAAACCAACAACGCATCTACGCTCCACAACTGTGC	NA	NA	NA	NA
AWZ55041.1|1740231_1740603_-	DUF1076 domain-containing protein	NA	A0A0P0ZBX1	Stx2-converting_phage	99.2	1.7e-67
AWZ55042.1|1741477_1741792_-	DinI family protein	NA	Q687E4	Enterobacteria_phage	81.9	1.3e-25
AWZ51741.1|1741851_1743135_+	MFS transporter	NA	NA	NA	NA	NA
AWZ51742.1|1743223_1744684_+	mannitol dehydrogenase family protein	NA	G8DCZ3	Micromonas_pusilla_virus	30.3	5.6e-42
AWZ51743.1|1744719_1744923_-	protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
>prophage 8
CP028429	Escherichia coli strain RM9131 chromosome, complete genome	5238870	1943032	1995797	5238870	capsid,lysis,transposase,terminase,holin,portal,head,tail	Stx2-converting_phage(45.65%)	63	NA	NA
AWZ51905.1|1943032_1944166_+	porin OmpS2	NA	Q1MVN1	Enterobacteria_phage	58.3	1.2e-116
AWZ51906.1|1944306_1944741_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.4e-28
AWZ51907.1|1945321_1945963_-	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	100.0	6.8e-109
AWZ51908.1|1946044_1946674_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	92.2	1.3e-77
AWZ51909.1|1946746_1947322_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	88.4	5.3e-89
AWZ51910.1|1947434_1947704_-|tail	phage tail protein	tail	A0A0P0ZCV7	Stx2-converting_phage	95.5	4.2e-44
AWZ51911.1|1947705_1949019_-|tail	phage tail protein	tail	A0A0P0ZCC1	Stx2-converting_phage	97.9	7.9e-80
AWZ51912.1|1949083_1949683_-	outer membrane protein	NA	B6ETG5	Enterobacteria_phage	100.0	3.0e-111
AWZ51913.1|1949753_1953251_-|tail	phage tail protein	tail	A0A0P0ZEQ8	Stx2-converting_phage	94.8	0.0e+00
AWZ51914.1|1953593_1954274_-|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	97.8	1.0e-110
AWZ51915.1|1954171_1954915_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	97.2	1.1e-147
AWZ51916.1|1954920_1955619_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.0	7.6e-130
AWZ51917.1|1955618_1955960_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	97.3	4.7e-61
AWZ51918.1|1955952_1957395_-|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	93.3	5.1e-229
AWZ51919.1|1957413_1957779_+|transposase	transposase	transposase	NA	NA	NA	NA
AWZ51920.1|1957778_1958966_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
AWZ51921.1|1959145_1961023_-|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	91.5	5.9e-278
AWZ51922.1|1961074_1961356_-	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	98.9	3.9e-45
AWZ51923.1|1961379_1961754_-|tail	phage tail protein	tail	A0A0P0ZE84	Stx2-converting_phage	98.4	5.0e-64
AWZ51924.1|1961759_1962476_-|tail	phage tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	96.6	1.2e-125
AWZ51925.1|1962542_1962887_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	99.1	9.4e-57
AWZ51926.1|1962883_1963330_-	hypothetical protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
AWZ51927.1|1963326_1963677_-|head,tail	head-tail adaptor protein	head,tail	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
AWZ51928.1|1963686_1964013_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZBH1	Stx2-converting_phage	100.0	9.2e-54
AWZ51929.1|1964015_1966595_-|portal	phage portal protein	portal	A0A0P0ZDD0	Stx2-converting_phage	99.8	0.0e+00
AWZ51930.1|1966540_1966762_-	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
AWZ51931.1|1966806_1968744_-|capsid	phage major capsid protein	capsid	H6WZL0	Escherichia_phage	99.7	0.0e+00
AWZ51932.1|1968807_1970469_-|terminase	terminase large subunit	terminase	H6WZK9	Escherichia_phage	98.9	0.0e+00
AWZ51933.1|1970465_1971029_-|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	100.0	3.8e-79
AWZ51934.1|1971212_1971356_-	DNase	NA	NA	NA	NA	NA
AWZ51935.1|1971318_1971684_-	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	96.7	2.9e-64
AWZ51936.1|1971725_1971953_+	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
AWZ51937.1|1972321_1972546_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ51938.1|1972542_1973037_-|lysis	lysis protein	lysis	Q9ZXB6	Enterobacteria_phage	93.8	4.0e-77
AWZ51939.1|1973038_1973257_-	hypothetical protein	NA	Q687G2	Enterobacteria_phage	91.1	3.0e-16
AWZ51940.1|1973334_1973868_-	lysozyme	NA	A0A0N7KZF9	Stx2-converting_phage	98.3	2.8e-100
AWZ51941.1|1973918_1974263_-	DUF1327 domain-containing protein	NA	A0A0P0ZD64	Stx2-converting_phage	100.0	1.0e-58
AWZ51942.1|1974267_1974483_-|holin	holin	holin	Q6H9V8	Enterobacteria_phage	97.2	1.7e-32
AWZ51943.1|1974919_1976770_-	DUF1737 domain-containing protein	NA	B6DZ89	Enterobacteria_phage	98.4	0.0e+00
AWZ51944.1|1977608_1978821_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
AWZ51945.1|1979505_1980027_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ51946.1|1980010_1980238_-	transcriptional regulator	NA	NA	NA	NA	NA
AWZ51947.1|1980315_1980723_+	transcriptional regulator	NA	I6PD69	Cronobacter_phage	46.2	2.5e-24
AWZ51948.1|1980915_1981068_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	53.2	6.6e-07
AWZ55051.1|1981079_1981445_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ51949.1|1981413_1981701_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ51950.1|1982116_1982305_+	division inhibition protein DicB	NA	NA	NA	NA	NA
AWZ51951.1|1982301_1982493_+	DUF1482 domain-containing protein	NA	NA	NA	NA	NA
AWZ51952.1|1982586_1983030_+	exonuclease VIII	NA	NA	NA	NA	NA
AWZ51953.1|1983069_1984283_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
AWZ51954.1|1984346_1986371_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.1	2.7e-58
AWZ51955.1|1986443_1986695_+	DNA-binding protein	NA	S4TND0	Salmonella_phage	50.0	2.2e-15
AWZ51956.1|1986714_1988010_+	DUF3596 domain-containing protein	NA	B6DZ48	Enterobacteria_phage	62.1	1.9e-155
AWZ51957.1|1988029_1988140_-	transporter	NA	NA	NA	NA	NA
AWZ51958.1|1988197_1989217_-	starvation-sensing protein RspB	NA	E3SJ82	Synechococcus_phage	25.9	9.7e-17
AWZ51959.1|1989228_1990443_-	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
AWZ51960.1|1990423_1990612_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ51961.1|1990648_1990975_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
AWZ51962.1|1991109_1991451_+	DUF1283 domain-containing protein	NA	NA	NA	NA	NA
AWZ51963.1|1991485_1992046_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
AWZ55052.1|1992048_1992759_-	YnfC family lipoprotein	NA	NA	NA	NA	NA
AWZ51964.1|1992866_1993172_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
AWZ51965.1|1993370_1995797_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.0	2.0e-214
>prophage 9
CP028429	Escherichia coli strain RM9131 chromosome, complete genome	5238870	2131564	2169648	5238870	capsid,transposase,terminase,holin,portal,plate,tRNA,tail	Enterobacteria_phage(86.11%)	46	NA	NA
AWZ55059.1|2131564_2131843_+	DUF4761 domain-containing protein	NA	A0A0A7NV42	Enterobacteria_phage	93.4	6.2e-27
AWZ52092.1|2131853_2132132_+	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	78.3	1.5e-33
AWZ52093.1|2132143_2132386_+	DUF4754 domain-containing protein	NA	A0A0A7NQ71	Enterobacteria_phage	100.0	2.3e-38
AWZ52094.1|2132450_2133332_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	92.6	1.9e-114
AWZ52095.1|2134904_2135864_+	recombinase	NA	A0A0A7NPX4	Enterobacteria_phage	98.4	7.1e-179
AWZ52096.1|2135868_2136180_+	chromosome partitioning protein	NA	A0A0A7NPT5	Enterobacteria_phage	83.5	2.2e-41
AWZ52097.1|2136544_2136814_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ52098.1|2137376_2137901_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ52099.1|2137915_2138962_-|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	99.1	1.9e-201
AWZ52100.1|2138961_2140713_-	oxidoreductase	NA	A0A0A7NV54	Enterobacteria_phage	97.3	0.0e+00
AWZ52101.1|2140867_2141704_+|capsid	phage capsid protein	capsid	A0A0A7NRY7	Enterobacteria_phage	100.0	2.7e-150
AWZ52102.1|2141727_2142780_+|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	97.7	1.3e-194
AWZ52103.1|2142825_2143626_+|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	91.4	6.6e-130
AWZ52104.1|2143728_2144223_+|capsid	capsid assembly protein	capsid	A0A0A7NPU2	Enterobacteria_phage	99.4	2.7e-89
AWZ52105.1|2144222_2144423_+|tail	phage tail protein	tail	A0A0A7NV57	Enterobacteria_phage	100.0	3.5e-32
AWZ52106.1|2144425_2144749_+|holin	holin	holin	A0A0A7NRY9	Enterobacteria_phage	99.1	1.6e-50
AWZ52107.1|2144745_2145138_+	M15 family peptidase	NA	A0A0A7NQ86	Enterobacteria_phage	100.0	5.8e-71
AWZ52108.1|2145134_2145542_+	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	98.5	4.5e-66
AWZ55060.1|2145513_2145693_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ52109.1|2145679_2146147_+|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	99.4	1.0e-85
AWZ52110.1|2146139_2146775_+	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	99.5	3.1e-114
AWZ52111.1|2146771_2147353_+|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	96.9	1.0e-100
AWZ52112.1|2147349_2147700_+|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	100.0	9.2e-60
AWZ52113.1|2147703_2148600_+|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	98.0	1.1e-154
AWZ52114.1|2148592_2149123_+|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	99.4	1.1e-93
AWZ52115.1|2149125_2151258_+|tail	phage tail protein	tail	U5N099	Enterobacteria_phage	66.7	4.2e-131
AWZ52116.1|2151257_2151836_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	89.0	1.7e-95
AWZ55061.1|2151879_2152356_-	serine acetyltransferase	NA	NA	NA	NA	NA
AWZ52117.1|2152608_2153103_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	98.8	1.8e-85
AWZ52118.1|2153109_2155917_-|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	94.8	0.0e+00
AWZ52119.1|2155903_2156140_-|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	94.1	4.3e-21
AWZ52120.1|2156067_2156442_-|tail	phage tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	73.2	6.9e-37
AWZ52121.1|2156497_2157010_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	98.2	7.8e-92
AWZ52122.1|2157009_2158194_-|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	99.0	8.1e-225
AWZ52123.1|2158351_2159461_+	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	98.6	9.6e-204
AWZ52124.1|2159686_2161189_+	DNA-binding protein	NA	NA	NA	NA	NA
AWZ52125.1|2161432_2161693_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ52126.1|2161883_2162024_+	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	95.7	4.5e-18
AWZ52127.1|2162330_2162630_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
AWZ52128.1|2162634_2165022_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
AWZ52129.1|2165036_2166020_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.4e-33
AWZ55062.1|2166303_2166348_-|tRNA	phenylalanyl--tRNA ligase operon leader peptide	tRNA	NA	NA	NA	NA
AWZ52130.1|2166470_2166827_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
AWZ52131.1|2166879_2167077_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
AWZ52132.1|2167173_2167716_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.9	6.3e-15
AWZ52133.1|2167719_2169648_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.4	3.2e-130
>prophage 10
CP028429	Escherichia coli strain RM9131 chromosome, complete genome	5238870	2389271	2476130	5238870	capsid,lysis,transposase,terminase,holin,portal,head,tail	Enterobacteria_phage(35.48%)	108	NA	NA
AWZ52350.1|2389271_2390485_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
AWZ52351.1|2393006_2393804_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AWZ52352.1|2393813_2394365_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
AWZ52353.1|2394533_2394866_-	multidrug SMR transporter	NA	NA	NA	NA	NA
AWZ52354.1|2395199_2395514_-	flagellar hook-basal body complex protein FliE	NA	NA	NA	NA	NA
AWZ52355.1|2395727_2397386_+	flagellar basal body M-ring protein FliF	NA	NA	NA	NA	NA
AWZ52356.1|2397378_2398374_+	flagellar motor switch protein FliG	NA	NA	NA	NA	NA
AWZ52357.1|2398366_2399053_+	flagellar assembly protein FliH	NA	NA	NA	NA	NA
AWZ52358.1|2399052_2400426_+	flagellum-specific ATP synthase FliI	NA	NA	NA	NA	NA
AWZ52359.1|2400444_2400888_+	flagellar protein FliJ	NA	NA	NA	NA	NA
AWZ52360.1|2400884_2402012_+	flagellar hook length control protein FliK	NA	NA	NA	NA	NA
AWZ52361.1|2402116_2402581_+	flagellar basal body-associated protein FliL	NA	NA	NA	NA	NA
AWZ52362.1|2402585_2403590_+	flagellar motor switch protein FliM	NA	NA	NA	NA	NA
AWZ52363.1|2403586_2404000_+	flagellar motor switch protein FliN	NA	NA	NA	NA	NA
AWZ52364.1|2404002_2404368_+	flagellar protein FliO	NA	NA	NA	NA	NA
AWZ52365.1|2404367_2405105_+	flagellar biosynthetic protein FliP	NA	NA	NA	NA	NA
AWZ52366.1|2405114_2405384_+	flagellar biosynthetic protein FliQ	NA	NA	NA	NA	NA
AWZ52367.1|2405391_2406177_+	flagellar type III secretion system protein FliR	NA	NA	NA	NA	NA
AWZ52368.1|2406466_2407090_+	transcriptional regulator RcsA	NA	NA	NA	NA	NA
AWZ52369.1|2407133_2407376_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ52370.1|2407484_2407712_+	DUF2525 domain-containing protein	NA	NA	NA	NA	NA
AWZ52371.1|2408009_2408825_+	mannosyl-3-phosphoglycerate phosphatase-related protein	NA	NA	NA	NA	NA
AWZ52372.1|2408821_2410516_-	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	35.6	1.3e-18
AWZ52373.1|2410436_2410625_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ52374.1|2410686_2410869_-	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
AWZ52375.1|2410947_2411865_-	DUF808 domain-containing protein	NA	NA	NA	NA	NA
AWZ52376.1|2412037_2412958_+	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
AWZ52377.1|2412946_2413417_-	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	47.6	1.5e-33
AWZ52378.1|2413397_2414816_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	55.3	1.8e-101
AWZ52379.1|2414882_2415578_-	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	28.0	2.1e-07
AWZ52380.1|2415617_2415983_-	permease	NA	NA	NA	NA	NA
AWZ52381.1|2417397_2418611_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
AWZ52382.1|2419616_2420468_+	Molecular chaperone Hsp31 and glyoxalase 3	NA	NA	NA	NA	NA
AWZ52383.1|2420575_2421934_-	HAMP domain-containing protein	NA	NA	NA	NA	NA
AWZ55073.1|2421933_2422605_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	35.2	5.4e-32
AWZ52384.1|2422737_2423151_+	hydroxyisourate hydrolase	NA	NA	NA	NA	NA
AWZ52385.1|2423259_2424264_+	mononuclear molybdenum enzyme YedY	NA	NA	NA	NA	NA
AWZ52386.1|2424264_2424900_+	sulfoxide reductase heme-binding subunit YedZ	NA	NA	NA	NA	NA
AWZ52387.1|2425156_2425807_+	metal-binding protein ZinT	NA	NA	NA	NA	NA
AWZ52388.1|2426149_2426680_+	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	100.0	1.9e-56
AWZ52389.1|2426702_2426945_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ52390.1|2427914_2428901_-	peptidase M85	NA	NA	NA	NA	NA
AWZ52391.1|2429333_2429603_-|tail	phage tail protein	tail	A0A1U9AJC2	Stx1_converting_phage	97.8	2.7e-43
AWZ52392.1|2429604_2430918_-|tail	phage tail protein	tail	A0A0P0ZCC1	Stx2-converting_phage	97.0	3.7e-77
AWZ52393.1|2430982_2431582_-	Ail/Lom family protein	NA	Q687E7	Enterobacteria_phage	99.0	8.8e-111
AWZ52394.1|2431649_2435126_-	host specificity protein J	NA	Q687E8	Enterobacteria_phage	96.7	0.0e+00
AWZ52395.1|2435372_2436053_-|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	98.2	8.7e-115
AWZ52396.1|2435950_2436694_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	98.0	3.3e-147
AWZ52397.1|2436699_2437398_-|tail	phage minor tail protein L	tail	Q687F1	Enterobacteria_phage	99.1	4.7e-132
AWZ52398.1|2437397_2437727_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
AWZ52399.1|2437723_2440336_-|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	96.0	0.0e+00
AWZ52400.1|2440316_2440730_-|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	83.2	3.2e-43
AWZ52401.1|2440756_2441179_-|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	98.6	1.7e-71
AWZ52402.1|2441192_2441945_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	99.2	4.9e-135
AWZ52403.1|2441952_2442348_-|tail	phage tail protein	tail	A0A2R9YJI2	Escherichia_phage	82.4	1.5e-58
AWZ52404.1|2442893_2443247_-|tail	phage tail protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	1.5e-41
AWZ52405.1|2443239_2443623_-	DNA-packaging protein FI	NA	NA	NA	NA	NA
AWZ52406.1|2443674_2444703_-|capsid	minor capsid protein E	capsid	C6ZCY2	Enterobacteria_phage	61.0	3.6e-112
AWZ52407.1|2444760_2445108_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	8.9e-23
AWZ52408.1|2445144_2446650_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.5	3.0e-99
AWZ52409.1|2446639_2448232_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.9	7.1e-184
AWZ52410.1|2448228_2448435_-|tail	phage tail protein	tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
AWZ52411.1|2448418_2450347_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.4	3.6e-262
AWZ55074.1|2450318_2450825_-	DNA-packaging protein	NA	O64316	Escherichia_phage	47.3	7.4e-34
AWZ52412.1|2451251_2451476_+	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	90.6	1.3e-19
AWZ52413.1|2451557_2451872_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
AWZ52414.1|2452112_2452253_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ52415.1|2452335_2452803_-|lysis	lysis protein	lysis	Q7AYI6	Enterobacteria_phage	89.0	5.5e-68
AWZ52416.1|2452804_2453023_-	hypothetical protein	NA	Q687G2	Enterobacteria_phage	93.3	1.0e-16
AWZ52417.1|2453100_2453634_-	lysozyme	NA	Q6H9V6	Enterobacteria_phage	96.0	1.9e-101
AWZ52418.1|2453676_2454081_-	hypothetical protein	NA	Q08JA0	Stx2-converting_phage	83.5	8.2e-52
AWZ52419.1|2454064_2455278_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
AWZ52420.1|2455509_2455725_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	97.2	7.7e-33
AWZ52421.1|2455801_2456074_-	DUF826 domain-containing protein	NA	A0A0P0ZBB8	Stx2-converting_phage	100.0	2.2e-21
AWZ52422.1|2456114_2456294_-	DUF1378 domain-containing protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
AWZ52423.1|2456431_2458369_-	DUF1737 domain-containing protein	NA	Q6H9W1	Enterobacteria_phage	96.4	0.0e+00
AWZ52424.1|2458417_2458546_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ52425.1|2458847_2459279_-	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	97.2	3.3e-67
AWZ52426.1|2459366_2459792_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
AWZ52427.1|2459788_2460139_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBY2	Stx2-converting_phage	65.5	3.1e-39
AWZ52428.1|2460169_2461783_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	64.0	4.4e-181
AWZ52429.1|2462268_2462982_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AWZ52430.1|2463116_2463314_-	TrmB family transcriptional regulator	NA	S5MQK8	Escherichia_phage	98.5	6.8e-28
AWZ52431.1|2463537_2464092_-	antiterminator	NA	A0A0U2S606	Escherichia_phage	67.4	8.0e-66
AWZ52432.1|2464100_2464460_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.5	5.0e-37
AWZ52433.1|2464472_2465522_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	1.2e-110
AWZ52434.1|2465523_2465796_-	hypothetical protein	NA	S4TNP0	Salmonella_phage	53.0	1.1e-12
AWZ52435.1|2465917_2466262_-	TIGR00156 family protein	NA	A0A1I9LJU6	Stx_converting_phage	99.1	6.1e-56
AWZ52436.1|2466381_2466594_-	Hok/Gef family protein	NA	A0A0P0ZAX5	Stx2-converting_phage	100.0	6.0e-30
AWZ52437.1|2466827_2467385_-	DUF551 domain-containing protein	NA	A0A0N7KZV3	Escherichia_phage	41.7	2.8e-34
AWZ52438.1|2467386_2467605_-	sugar acetyltransferase inhibitor	NA	A0A2R2Z311	Escherichia_phage	72.2	2.3e-21
AWZ52439.1|2467732_2468044_-	hypothetical protein	NA	A0A0U2QV73	Escherichia_phage	91.3	1.6e-55
AWZ52440.1|2468036_2468264_-	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	49.3	5.1e-11
AWZ55075.1|2468260_2468542_-	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	73.6	1.0e-29
AWZ52441.1|2468574_2469291_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.6	2.1e-71
AWZ52442.1|2469312_2470059_-	DNA replication protein DnaC	NA	A0A088CBP4	Shigella_phage	83.2	3.6e-114
AWZ52443.1|2470065_2471136_-	phage replisome organizer	NA	A0A088CD36	Shigella_phage	65.7	1.7e-64
AWZ52444.1|2471207_2471633_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
AWZ52445.1|2471616_2471898_-	Cro/Cl family transcriptional regulator	NA	K7PHA1	Enterobacteria_phage	72.6	8.5e-24
AWZ52446.1|2471997_2472417_+	hypothetical protein	NA	K7PK07	Enterobacteria_phage	65.1	4.0e-25
AWZ55076.1|2472682_2472835_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	53.2	1.7e-07
AWZ52447.1|2472846_2473485_+	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	41.9	2.5e-07
AWZ55078.1|2473485_2473695_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ55077.1|2473743_2474004_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ52448.1|2474265_2474454_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
AWZ52449.1|2474450_2474642_+	DUF1482 domain-containing protein	NA	NA	NA	NA	NA
AWZ52450.1|2474734_2475730_+	exonuclease	NA	NA	NA	NA	NA
AWZ52451.1|2475764_2476130_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 11
CP028429	Escherichia coli strain RM9131 chromosome, complete genome	5238870	2714031	2775556	5238870	capsid,lysis,transposase,holin,terminase,integrase	Enterobacteria_phage(23.08%)	57	2744610:2744645	2776496:2776531
AWZ52657.1|2714031_2714520_+|terminase	terminase small subunit	terminase	A0A0P0ZCQ9	Stx2-converting_phage	41.7	3.9e-24
AWZ55091.1|2714682_2715606_+|capsid	phage major capsid protein	capsid	A0A0R6PHC6	Moraxella_phage	24.9	1.2e-13
AWZ52658.1|2716070_2716295_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
AWZ52659.1|2718691_2718949_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ52660.1|2718980_2719628_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AWZ52661.1|2719662_2720715_-	cytochrome c biogenesis protein CcmH	NA	NA	NA	NA	NA
AWZ52662.1|2720711_2721269_-	thiol:disulfide interchange protein	NA	NA	NA	NA	NA
AWZ52663.1|2721265_2723209_-	heme lyase CcmF/NrfE family subunit	NA	NA	NA	NA	NA
AWZ52664.1|2723205_2723685_-	cytochrome c-type biogenesis protein CcmE	NA	NA	NA	NA	NA
AWZ52665.1|2723681_2723891_-	heme exporter protein D	NA	NA	NA	NA	NA
AWZ52666.1|2723887_2724625_-	heme exporter protein C	NA	NA	NA	NA	NA
AWZ52667.1|2724666_2725329_-	heme exporter protein CcmB	NA	NA	NA	NA	NA
AWZ52668.1|2725325_2725949_-	cytochrome c biogenesis ATP-binding export protein CcmA	NA	G3M9Y6	Bacillus_virus	25.5	2.0e-12
AWZ52669.1|2725961_2726564_-	cytochrome c-type protein NapC	NA	NA	NA	NA	NA
AWZ52670.1|2726573_2727023_-	nitrate reductase	NA	NA	NA	NA	NA
AWZ52671.1|2727019_2727883_-	quinol dehydrogenase ferredoxin subunit NapH	NA	NA	NA	NA	NA
AWZ52672.1|2727869_2728565_-	ferredoxin-type protein NapG	NA	NA	NA	NA	NA
AWZ52673.1|2728571_2731058_-	periplasmic nitrate reductase subunit alpha	NA	NA	NA	NA	NA
AWZ52674.1|2731054_2731318_-	protein NapD	NA	NA	NA	NA	NA
AWZ52675.1|2731307_2731802_-	ferredoxin-type protein NapF	NA	NA	NA	NA	NA
AWZ52676.1|2731901_2732075_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ52677.1|2732210_2732699_+	ecotin	NA	NA	NA	NA	NA
AWZ52678.1|2732847_2734494_-	malate dehydrogenase (quinone)	NA	NA	NA	NA	NA
AWZ52679.1|2734711_2736355_-	microcin J25 efflux ABC transporter YojI	NA	W8CYL7	Bacillus_phage	24.0	9.5e-14
AWZ52680.1|2736430_2737081_-	DNA oxidative demethylase AlkB	NA	A0A2K9L3R7	Tupanvirus	31.7	1.4e-05
AWZ52681.1|2737080_2738145_-	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	50.5	1.8e-18
AWZ52682.1|2738218_2739274_-	FAD:protein FMN transferase ApbE	NA	NA	NA	NA	NA
AWZ52683.1|2739385_2740477_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.1	9.4e-119
AWZ52684.1|2740757_2740985_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ52685.1|2740959_2741199_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ52686.1|2741215_2743888_+	phosphotransferase RcsD	NA	NA	NA	NA	NA
AWZ52687.1|2743904_2744555_+	DNA-binding response regulator	NA	NA	NA	NA	NA
2744610:2744645	attL	TGCCGGATGCGGCGTAAACGCCTTATCCGGCCTACG	NA	NA	NA	NA
AWZ52688.1|2744754_2747604_-	hybrid sensor histidine kinase/response regulator	NA	A0A1V0SGX0	Hokovirus	27.2	1.4e-41
AWZ52689.1|2747878_2748655_-	DUF2135 domain-containing protein	NA	NA	NA	NA	NA
AWZ52690.1|2748659_2750309_-	DUF2300 domain-containing protein	NA	NA	NA	NA	NA
AWZ52691.1|2750309_2754824_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ52692.1|2755505_2756828_+	type III secretion system effector NleA	NA	H6WZN2	Escherichia_phage	85.5	9.7e-227
AWZ52693.1|2757521_2758055_-	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	42.0	6.4e-28
AWZ52694.1|2758197_2759410_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
AWZ52695.1|2759450_2759975_-	hypothetical protein	NA	A0A0N7CEE8	Salmonella_phage	89.7	1.2e-84
AWZ52696.1|2760124_2760562_-|lysis	lysis protein	lysis	A0A0P0ZBQ9	Stx2-converting_phage	97.9	5.0e-71
AWZ52697.1|2760558_2761056_-	lysozyme	NA	A0A1B5FP97	Escherichia_phage	98.2	1.9e-90
AWZ55092.1|2761055_2761271_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
AWZ52698.1|2761892_2762051_-	DUF3927 domain-containing protein	NA	NA	NA	NA	NA
AWZ52699.1|2763143_2763767_-	antitermination protein	NA	K7PM87	Enterobacteria_phage	98.6	9.8e-113
AWZ52700.1|2763763_2764429_-	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
AWZ52701.1|2764425_2765028_-	recombination protein NinG	NA	A0A1U9AJF8	Stx1_converting_phage	94.6	1.6e-91
AWZ52702.1|2765002_2765569_-	endonuclease	NA	A0A1U9AJK5	Stx1_converting_phage	99.5	6.6e-108
AWZ52703.1|2766116_2767049_+	hypothetical protein	NA	A0A1U9AJG3	Stx1_converting_phage	99.7	6.1e-151
AWZ52704.1|2767087_2767915_+	hypothetical protein	NA	A0A1U9AJG3	Stx1_converting_phage	99.6	1.6e-150
AWZ55093.1|2768418_2768601_-	NinE family protein	NA	A0A1U9AJF6	Stx1_converting_phage	100.0	1.1e-29
AWZ52705.1|2768757_2769102_+	hypothetical protein	NA	K7PJY7	Enterobacterial_phage	100.0	5.3e-60
AWZ52706.1|2769207_2769426_+	excisionase	NA	K7PKU2	Enterobacteria_phage	98.6	2.4e-34
AWZ52707.1|2769403_2770474_+|integrase	integrase	integrase	K7PHK0	Enterobacteria_phage	98.0	1.1e-196
AWZ52708.1|2770468_2771095_-	DUF1175 domain-containing protein	NA	NA	NA	NA	NA
AWZ52709.1|2771091_2772780_-	DUF2138 domain-containing protein	NA	NA	NA	NA	NA
AWZ52710.1|2772928_2775556_-	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	30.4	8.1e-92
2776496:2776531	attR	CGTAGGCCGGATAAGGCGTTTACGCCGCATCCGGCA	NA	NA	NA	NA
>prophage 12
CP028429	Escherichia coli strain RM9131 chromosome, complete genome	5238870	3125282	3209907	5238870	lysis,transposase,terminase,portal,integrase,tRNA,tail	Enterobacteria_phage(68.52%)	90	3193264:3193279	3216711:3216726
AWZ53024.1|3125282_3126020_-|tRNA	tRNA (adenosine(37)-N6)-methyltransferase TrmM	tRNA	NA	NA	NA	NA
AWZ53025.1|3126151_3127486_+	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	2.9e-45
AWZ53026.1|3127695_3128577_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AWZ53027.1|3128680_3129268_+	cysteine/O-acetylserine efflux protein	NA	NA	NA	NA	NA
AWZ53028.1|3129323_3129707_-	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	72.0	1.4e-32
AWZ53029.1|3130010_3130700_+	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	48.8	7.1e-56
AWZ53030.1|3130747_3131785_-	methyltransferase	NA	NA	NA	NA	NA
AWZ53031.1|3131774_3131978_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ53032.1|3131991_3132411_+	thiol disulfide reductase thioredoxin	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
AWZ55103.1|3132479_3133178_+	DTW domain-containing protein	NA	NA	NA	NA	NA
AWZ53033.1|3133209_3135870_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
AWZ53034.1|3135983_3137339_+	phosphatidylserine synthase	NA	NA	NA	NA	NA
AWZ53035.1|3137384_3137708_+	lipoprotein	NA	NA	NA	NA	NA
AWZ53036.1|3137704_3139003_-	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	32.2	1.3e-45
AWZ53037.1|3138984_3139098_-	alpha-ketoglutarate permease	NA	NA	NA	NA	NA
AWZ53038.1|3144855_3147429_-	chaperone protein ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	2.6e-127
AWZ53039.1|3147558_3148290_-	peptidoglycan editing factor PgeF	NA	NA	NA	NA	NA
AWZ53040.1|3148286_3149267_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
AWZ53041.1|3149401_3150139_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
AWZ53042.1|3150168_3150375_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ53043.1|3150409_3150751_+	ribosome-associated inhibitor A	NA	NA	NA	NA	NA
AWZ55104.1|3150854_3150902_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ53044.1|3151000_3152161_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
AWZ53045.1|3152203_3153325_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
AWZ53046.1|3153335_3154406_-	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	5.3e-90
AWZ53047.1|3154615_3154981_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ53048.1|3155130_3155649_+	DUF4154 domain-containing protein	NA	NA	NA	NA	NA
AWZ53049.1|3155638_3156865_+	GGDEF domain-containing protein	NA	NA	NA	NA	NA
AWZ53050.1|3156880_3157363_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ53051.1|3157439_3157787_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
AWZ53052.1|3157828_3158596_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
AWZ53053.1|3158626_3159175_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
AWZ53054.1|3159193_3159442_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
AWZ53055.1|3159690_3161052_-	signal recognition particle protein	NA	NA	NA	NA	NA
AWZ55105.1|3161218_3162010_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
AWZ55106.1|3162075_3163317_+	DUF21 domain-containing protein	NA	NA	NA	NA	NA
AWZ53056.1|3163371_3163965_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
AWZ53057.1|3163961_3164156_-	molecular chaperone GrpE	NA	NA	NA	NA	NA
AWZ53058.1|3164087_3164966_+	NAD(+) kinase	NA	NA	NA	NA	NA
AWZ53059.1|3165051_3166713_+	DNA repair protein RecN	NA	NA	NA	NA	NA
AWZ53060.1|3166861_3167203_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
AWZ53061.1|3167264_3167555_-	RnfH family protein	NA	NA	NA	NA	NA
AWZ53062.1|3167544_3168021_-	ubiquinone-binding protein	NA	NA	NA	NA	NA
AWZ53063.1|3168152_3168635_+	SsrA-binding protein	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
AWZ53064.1|3169483_3169732_+	DNA damage-inducible protein DinI	NA	Q687E4	Enterobacteria_phage	100.0	2.4e-38
AWZ53065.1|3170099_3170369_-|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	100.0	6.4e-45
AWZ53066.1|3170370_3171693_-|tail	phage tail protein	tail	Q687E6	Enterobacteria_phage	99.1	3.7e-77
AWZ53067.1|3171757_3172357_-	Ail/Lom family protein	NA	Q687E7	Enterobacteria_phage	99.0	8.8e-111
AWZ53068.1|3172424_3175901_-	host specificity protein J	NA	Q687E8	Enterobacteria_phage	96.7	0.0e+00
AWZ53069.1|3176147_3176828_-|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	98.2	8.7e-115
AWZ53070.1|3176725_3177469_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	98.0	3.3e-147
AWZ53071.1|3177474_3178173_-|tail	phage minor tail protein L	tail	Q687F1	Enterobacteria_phage	99.1	4.7e-132
AWZ53072.1|3178172_3178502_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
AWZ53073.1|3181050_3182263_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
AWZ53074.1|3182266_3182413_-|tail	phage tail protein	tail	Q687G0	Enterobacteria_phage	100.0	3.5e-21
AWZ53075.1|3182425_3183049_-|tail	phage tail protein	tail	Q8VNN3	Enterobacteria_phage	100.0	8.9e-106
AWZ53076.1|3183051_3183333_-	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	100.0	2.1e-46
AWZ53077.1|3183325_3183652_-	DUF2190 domain-containing protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
AWZ55107.1|3183739_3185695_-	peptidase S14	NA	S5M7Q8	Escherichia_phage	99.8	0.0e+00
AWZ53078.1|3185708_3187211_-|portal	phage portal protein	portal	Q9EYD2	Enterobacteria_phage	100.0	4.8e-291
AWZ53079.1|3187210_3187447_-	hypothetical protein	NA	Q687G1	Enterobacteria_phage	100.0	4.5e-34
AWZ53080.1|3187419_3189543_-|terminase	phage terminase large subunit family protein	terminase	Q9EYD1	Enterobacteria_phage	100.0	0.0e+00
AWZ53081.1|3189539_3190016_-	DUF1441 domain-containing protein	NA	Q8VNN8	Enterobacteria_phage	100.0	3.3e-84
AWZ53082.1|3190428_3190896_-|lysis	lysis protein	lysis	Q7AYI6	Enterobacteria_phage	100.0	7.7e-78
AWZ53083.1|3191679_3191949_-	Shiga toxin Stx1 subunit B	NA	Q7AYI7	Enterobacteria_phage	100.0	1.6e-43
AWZ53084.1|3191958_3192906_-	Shiga toxin Stx1 subunit A	NA	Q777W4	Enterobacteria_phage	99.7	1.6e-170
AWZ53085.1|3193178_3193424_+	hypothetical protein	NA	A0A0P0ZGS0	Escherichia_phage	100.0	5.0e-36
3193264:3193279	attL	TTTTTAAGATTTTGTT	NA	NA	NA	NA
AWZ53086.1|3193412_3193847_-	antitermination protein	NA	Q8VNP1	Enterobacteria_phage	100.0	4.3e-83
AWZ53087.1|3193839_3194034_-	protein ninH	NA	G9L694	Escherichia_phage	100.0	1.9e-30
AWZ53088.1|3194030_3194636_-	recombination protein NinG	NA	Q8VNP2	Enterobacteria_phage	100.0	1.9e-97
AWZ53089.1|3195433_3196138_-	phage antirepressor Ant	NA	Q8VNP5	Enterobacteria_phage	100.0	9.6e-133
AWZ53090.1|3196412_3196595_-	NinE family protein	NA	A0A0N7C1X3	Escherichia_phage	100.0	5.7e-29
AWZ53091.1|3196591_3197119_-	phage N-6-adenine-methyltransferase	NA	Q9EYC2	Enterobacteria_phage	100.0	1.6e-100
AWZ53092.1|3197115_3197562_-	recombination protein NinB	NA	Q8VNP6	Enterobacteria_phage	100.0	2.4e-81
AWZ53093.1|3197518_3197944_-	restriction alleviation protein, Lar family	NA	Q687G3	Enterobacteria_phage	100.0	1.4e-78
AWZ53094.1|3198113_3198392_-	hypothetical protein	NA	Q9EYB9	Enterobacteria_phage	100.0	4.4e-49
AWZ53095.1|3198461_3198731_-	hypothetical protein	NA	Q687G4	Enterobacteria_phage	100.0	8.4e-45
AWZ53096.1|3198730_3200182_-	helicase DnaB	NA	Q08J37	Stx2-converting_phage	100.0	7.7e-278
AWZ53097.1|3200156_3201056_-	DNA replication protein	NA	Q8VNP8	Enterobacteria_phage	100.0	1.6e-164
AWZ53098.1|3201048_3201195_-	DUF2740 domain-containing protein	NA	Q687G5	Enterobacteria_phage	100.0	1.1e-19
AWZ53099.1|3201229_3201508_-	hypothetical protein	NA	Q8VNP9	Enterobacteria_phage	100.0	3.6e-43
AWZ53100.1|3201600_3202813_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
AWZ53101.1|3203044_3203557_+	single-stranded DNA-binding protein	NA	Q8VNQ1	Enterobacteria_phage	100.0	1.8e-75
AWZ53102.1|3203570_3203864_+	RecBCD nuclease inhibitor	NA	Q687G7	Enterobacteria_phage	100.0	8.5e-51
AWZ55108.1|3203874_3204042_+	DUF2737 domain-containing protein	NA	Q687G8	Enterobacteria_phage	100.0	3.0e-24
AWZ53103.1|3204038_3204638_+	hypothetical protein	NA	Q8VNQ2	Enterobacteria_phage	100.0	1.8e-111
AWZ53104.1|3204639_3205911_+|integrase	integrase	integrase	A0A1B5FPC6	Escherichia_phage	100.0	7.0e-182
AWZ53105.1|3205949_3206366_+	hypothetical protein	NA	A0A1B5FPM5	Escherichia_phage	100.0	1.1e-72
AWZ53106.1|3206438_3208187_-	hypothetical protein	NA	A0A1B5FPH1	Escherichia_phage	99.8	0.0e+00
AWZ55109.1|3208188_3209907_-	ATP-binding protein	NA	A0A1B5FPD5	Escherichia_phage	99.7	5.5e-307
3216711:3216726	attR	TTTTTAAGATTTTGTT	NA	NA	NA	NA
>prophage 13
CP028429	Escherichia coli strain RM9131 chromosome, complete genome	5238870	3281435	3288575	5238870		Escherichia_phage(83.33%)	6	NA	NA
AWZ53174.1|3281435_3283997_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.7e-30
AWZ53175.1|3284102_3284759_+	serine/threonine protein phosphatase	NA	A0A222YWF0	Escherichia_phage	47.2	5.6e-50
AWZ53176.1|3284809_3285577_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	3.3e-70
AWZ53177.1|3285772_3286681_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
AWZ53178.1|3286677_3287940_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.4	3.7e-135
AWZ53179.1|3287936_3288575_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
>prophage 14
CP028429	Escherichia coli strain RM9131 chromosome, complete genome	5238870	4830867	4881238	5238870	capsid,lysis,terminase,holin,head,integrase,tRNA,tail	Enterobacteria_phage(38.89%)	55	4872436:4872450	4885180:4885194
AWZ54582.1|4830867_4830990_+|tRNA	tRNA-dihydrouridine synthase	tRNA	NA	NA	NA	NA
AWZ54583.1|4831118_4831652_+	hypothetical protein	NA	K7PKJ4	Enterobacteria_phage	100.0	1.1e-99
AWZ54584.1|4832069_4832330_-	pyocin activator protein PrtN	NA	K7PGU0	Enterobacteria_phage	98.8	4.2e-41
AWZ54585.1|4833787_4834540_+	antitermination protein	NA	K7PGU5	Enterobacteria_phage	99.2	5.3e-137
AWZ54586.1|4834625_4834835_-	hypothetical protein	NA	A0A0P0ZGS0	Escherichia_phage	98.4	2.6e-25
AWZ54587.1|4834849_4835002_+	DNA methylase	NA	A0A2R2Z327	Escherichia_phage	98.0	3.4e-19
AWZ54588.1|4835819_4837670_+	DUF1737 domain-containing protein	NA	B6DZ89	Enterobacteria_phage	96.9	0.0e+00
AWZ54589.1|4837964_4838111_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ54590.1|4838109_4838325_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	7.7e-33
AWZ54591.1|4838324_4838822_+	lysozyme	NA	A0A0N7KZA0	Stx2-converting_phage	100.0	2.6e-92
AWZ54592.1|4838818_4839286_+|lysis	lysis protein	lysis	Q7AYI6	Enterobacteria_phage	80.1	4.0e-58
AWZ54593.1|4839368_4839509_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ54594.1|4839751_4840066_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
AWZ54595.1|4840966_4841530_+|terminase	terminase small subunit	terminase	B6DZ97	Enterobacteria_phage	94.1	7.3e-83
AWZ54596.1|4841526_4843188_+|terminase	terminase large subunit	terminase	A0A0N7KZG0	Stx2-converting_phage	98.7	0.0e+00
AWZ54597.1|4843251_4845189_+|capsid	phage major capsid protein	capsid	H6WZL0	Escherichia_phage	98.4	0.0e+00
AWZ55168.1|4845233_4845455_+	hypothetical protein	NA	H6WZL1	Escherichia_phage	100.0	3.4e-36
AWZ54598.1|4847818_4848145_+|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
AWZ54599.1|4848154_4848505_+|head,tail	head-tail adaptor protein	head,tail	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
AWZ54600.1|4848501_4848948_+	hypothetical protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
AWZ54601.1|4848944_4849289_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
AWZ54602.1|4849355_4850072_+|tail	phage tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	98.3	2.1e-127
AWZ54603.1|4850077_4850452_+|tail	phage tail protein	tail	A0A0P0ZE84	Stx2-converting_phage	99.2	1.7e-64
AWZ54604.1|4850475_4850757_+|tail	phage tail protein	tail	A0A0P0ZDE6	Stx2-converting_phage	100.0	1.3e-45
AWZ54605.1|4850808_4854051_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	93.2	0.0e+00
AWZ54606.1|4854043_4854385_+|tail	phage tail protein	tail	A0A0P0ZCS8	Stx2-converting_phage	100.0	8.7e-63
AWZ54607.1|4854384_4855083_+|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	98.3	3.1e-131
AWZ54608.1|4855093_4855837_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	99.2	5.4e-150
AWZ54609.1|4855734_4856415_+|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	91.2	2.0e-106
AWZ54610.1|4856368_4856581_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ54611.1|4856650_4860127_+|tail	phage tail protein	tail	Q6H9T2	Enterobacteria_phage	96.0	0.0e+00
AWZ55169.1|4860195_4860819_+	hypothetical protein	NA	A0A1U8QHD6	Enterobacteria_phage	60.4	1.1e-68
AWZ54612.1|4860883_4862197_+|tail	phage tail protein	tail	A0A0P0ZD68	Stx2-converting_phage	99.1	3.3e-78
AWZ54613.1|4862198_4862468_+|tail	phage tail protein	tail	B6DZB8	Enterobacteria_phage	98.9	2.4e-44
AWZ54614.1|4862628_4863051_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	97.0	5.7e-72
AWZ54615.1|4863181_4864240_-	type III effector	NA	NA	NA	NA	NA
AWZ54616.1|4864318_4864969_-	DUF1076 domain-containing protein	NA	B6DZZ5	Stx2-converting_phage	37.2	2.8e-25
AWZ54617.1|4865151_4865742_+	bfpT-regulated chaperone	NA	NA	NA	NA	NA
AWZ55170.1|4865728_4865848_-	ferredoxin	NA	NA	NA	NA	NA
AWZ54618.1|4866243_4866492_-	DNA damage-inducible protein DinI	NA	A5LH55	Enterobacteria_phage	98.8	3.1e-38
AWZ54619.1|4867740_4868778_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
AWZ54620.1|4868911_4869154_+	envelope stress response protein PspG	NA	NA	NA	NA	NA
AWZ54621.1|4869319_4870303_-	quinone oxidoreductase	NA	NA	NA	NA	NA
AWZ54622.1|4870385_4871801_+	replicative DNA helicase	NA	O80281	Escherichia_phage	78.3	4.8e-200
AWZ54623.1|4871853_4872933_+	alanine racemase biosynthetic	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	27.9	5.2e-29
4872436:4872450	attL	GGTGGCATTCTGCTG	NA	NA	NA	NA
AWZ54624.1|4873185_4874379_+	aromatic amino acid transaminase	NA	NA	NA	NA	NA
AWZ54625.1|4874600_4875143_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ54626.1|4875505_4876219_+	acid phosphatase AphA	NA	NA	NA	NA	NA
AWZ54627.1|4876329_4876746_+	thiamine phosphate synthase	NA	NA	NA	NA	NA
AWZ54628.1|4876749_4877106_+	MmcQ/YjbR family DNA-binding protein	NA	NA	NA	NA	NA
AWZ54629.1|4877140_4879963_-	excinuclease ABC subunit A	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	56.1	0.0e+00
AWZ54630.1|4879913_4880096_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ54631.1|4880216_4880753_+	ssDNA-binding protein	NA	A0A0A0P1Q9	Enterobacteria_phage	78.7	1.1e-56
AWZ54632.1|4880851_4881133_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ54633.1|4881091_4881238_+|integrase	integrase	integrase	NA	NA	NA	NA
4885180:4885194	attR	GGTGGCATTCTGCTG	NA	NA	NA	NA
>prophage 1
CP028430	Escherichia coli strain RM9131 plasmid pRM9131-1, complete sequence	117123	0	15963	117123	transposase	Salmonella_phage(71.43%)	14	NA	NA
AWZ55186.1|0_1056_+	replication protein RepA	NA	J9Q7H0	Salmonella_phage	91.0	5.4e-172
AWZ55187.1|1402_2615_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
AWZ55188.1|3027_3294_-	hypothetical protein	NA	J9Q7G8	Salmonella_phage	77.3	2.6e-30
AWZ55189.1|4049_5262_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
AWZ55190.1|5611_6652_-	regulator	NA	J9Q7Z3	Salmonella_phage	89.9	4.9e-117
AWZ55191.1|6769_7201_-	hypothetical protein	NA	J9Q6I8	Salmonella_phage	83.9	9.9e-64
AWZ55192.1|7455_7680_+	hypothetical protein	NA	J9Q735	Salmonella_phage	56.9	2.2e-14
AWZ55193.1|7740_8304_+	DNA-binding protein	NA	J9Q7G7	Salmonella_phage	67.7	1.3e-66
AWZ55194.1|8633_8849_+	RNA chaperone/antiterminator CspA	NA	A0A1W6JNX5	Morganella_phage	77.1	2.9e-24
AWZ55195.1|9152_12722_-	DNA polymerase III subunit alpha	NA	J9Q7Z2	Salmonella_phage	93.0	0.0e+00
AWZ55196.1|12705_13919_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
AWZ55197.1|13880_14651_+	hypothetical protein	NA	J9Q741	Salmonella_phage	81.4	2.1e-101
AWZ55198.1|14640_15384_+	hypothetical protein	NA	J9Q6J5	Salmonella_phage	47.2	1.5e-51
AWZ55199.1|15393_15963_+	hypothetical protein	NA	J9Q7Z7	Salmonella_phage	86.8	1.1e-91
>prophage 2
CP028430	Escherichia coli strain RM9131 plasmid pRM9131-1, complete sequence	117123	20286	78973	117123	terminase,tRNA,tail,capsid,transposase	Salmonella_phage(84.13%)	72	NA	NA
AWZ55202.1|20286_21429_+	ribonucleotide-diphosphate reductase subunit beta	NA	J9Q7H3	Salmonella_phage	88.7	2.6e-196
AWZ55203.1|21506_22376_+	phosphoribosyl-ATP pyrophosphohydrolase	NA	J9Q742	Salmonella_phage	80.6	5.3e-133
AWZ55302.1|22523_23651_+	thymidylate synthase	NA	J9Q6J6	Salmonella_phage	86.6	1.9e-191
AWZ55204.1|23652_24066_+	hypothetical protein	NA	J9Q7Z8	Salmonella_phage	84.7	2.3e-62
AWZ55205.1|24062_24539_+	dihydrofolate reductase	NA	J9Q7T1	Salmonella_phage	90.5	2.0e-81
AWZ55206.1|24538_25183_+	hypothetical protein	NA	J9Q7H4	Salmonella_phage	81.3	7.8e-97
AWZ55207.1|25244_25664_+	hypothetical protein	NA	J9Q743	Salmonella_phage	71.9	3.2e-51
AWZ55208.1|25673_26231_+	3'-5' exonuclease	NA	J9Q6J8	Salmonella_phage	83.1	1.7e-87
AWZ55209.1|26389_27199_+	hypothetical protein	NA	J9Q7Z9	Salmonella_phage	53.2	1.3e-64
AWZ55210.1|27382_27976_+	phage N-6-adenine-methyltransferase	NA	J9Q7T2	Salmonella_phage	86.3	2.0e-99
AWZ55211.1|28161_28392_+	hypothetical protein	NA	J9Q7H5	Salmonella_phage	85.5	2.0e-31
AWZ55212.1|28976_29570_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	83.8	1.7e-93
AWZ55213.1|29971_30223_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ55214.1|30219_30417_+	hypothetical protein	NA	J9Q800	Salmonella_phage	56.9	2.6e-11
AWZ55215.1|30510_30936_+	tellurite/colicin resistance protein	NA	Q71TK7	Escherichia_phage	83.0	2.8e-58
AWZ55216.1|30935_31094_+	DUF3927 domain-containing protein	NA	NA	NA	NA	NA
AWZ55217.1|31233_31803_+	hypothetical protein	NA	J9Q7H6	Salmonella_phage	61.4	1.4e-52
AWZ55218.1|31858_32140_+	hypothetical protein	NA	A0A0E3JPT1	Enterobacteria_phage	76.3	3.2e-39
AWZ55219.1|32142_32757_+	hypothetical protein	NA	A0A0E3GMH9	Enterobacteria_phage	82.8	1.2e-99
AWZ55220.1|32860_34546_+	DUF4942 domain-containing protein	NA	J9Q747	Salmonella_phage	92.3	0.0e+00
AWZ55221.1|34607_35312_+	hypothetical protein	NA	J9Q6K2	Salmonella_phage	76.9	7.2e-88
AWZ55222.1|35311_35692_+	hypothetical protein	NA	J9Q801	Salmonella_phage	69.8	5.9e-28
AWZ55223.1|35830_36286_+	hypothetical protein	NA	A0A222YY85	Escherichia_phage	60.2	1.2e-19
AWZ55224.1|36282_36849_+	hypothetical protein	NA	A0A222YWM9	Escherichia_phage	59.5	1.7e-42
AWZ55225.1|36823_37009_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ55226.1|37008_37926_+	DUF551 domain-containing protein	NA	K7P7E4	Enterobacteria_phage	44.2	2.3e-46
AWZ55227.1|38302_38929_+	hypothetical protein	NA	C6ZR26	Salmonella_phage	71.1	3.3e-07
AWZ55228.1|39397_39640_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ55229.1|39730_40120_+	DNA repair protein	NA	A0A077SK24	Escherichia_phage	93.0	8.6e-67
AWZ55230.1|40157_41258_-	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
AWZ55231.1|41415_43449_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SEZ7	Hokovirus	24.1	2.2e-44
AWZ55303.1|43688_43910_+	hypothetical protein	NA	J9Q750	Salmonella_phage	58.2	1.9e-18
AWZ55232.1|43946_44132_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ55233.1|45787_46132_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ55234.1|46385_46715_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ55235.1|46868_47180_+	hypothetical protein	NA	J9Q7T7	Salmonella_phage	63.1	5.7e-29
AWZ55236.1|47306_47702_+	hypothetical protein	NA	J9Q7I1	Salmonella_phage	53.8	1.2e-31
AWZ55237.1|48540_48828_+	ABC transporter	NA	J9Q753	Salmonella_phage	77.4	1.5e-36
AWZ55238.1|49032_49515_+	hypothetical protein	NA	J9Q805	Salmonella_phage	69.8	7.9e-62
AWZ55239.1|50124_50352_-	hypothetical protein	NA	A0A1S6KV93	Providencia_phage	41.3	2.5e-05
AWZ55240.1|50372_50576_-	hypothetical protein	NA	J9Q7I3	Salmonella_phage	91.0	5.9e-27
AWZ55241.1|50625_51276_-	hypothetical protein	NA	J9Q754	Salmonella_phage	84.7	1.1e-98
AWZ55242.1|51571_52093_-	transcriptional regulator	NA	J9Q6L0	Salmonella_phage	79.7	1.2e-66
AWZ55243.1|52195_52996_+	hypothetical protein	NA	A0A0M4QWT0	Salmonella_phage	31.3	6.0e-06
AWZ55244.1|53381_53981_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ55245.1|54013_54292_-	hypothetical protein	NA	J9Q7T9	Salmonella_phage	58.2	4.6e-22
AWZ55246.1|54294_55854_-	ATP-dependent helicase	NA	J9Q7I4	Salmonella_phage	92.9	1.3e-278
AWZ55247.1|55918_56617_+	chromosome partitioning protein ParB	NA	J9Q756	Salmonella_phage	87.1	5.1e-110
AWZ55248.1|56616_57285_+	chromosome partitioning protein ParB	NA	J9Q6L1	Salmonella_phage	89.6	5.6e-106
AWZ55249.1|57281_57947_+	adenylyl-sulfate kinase	NA	J9Q807	Salmonella_phage	98.6	2.8e-110
AWZ55250.1|57943_58834_+	hypothetical protein	NA	J9Q7I6	Salmonella_phage	98.6	2.6e-167
AWZ55251.1|58843_59110_+	hypothetical protein	NA	J9Q757	Salmonella_phage	88.6	1.4e-36
AWZ55252.1|59308_59941_+	DNA-binding protein	NA	J9Q6D4	Salmonella_phage	83.3	1.2e-89
AWZ55253.1|59940_61197_+|terminase	terminase	terminase	J9Q7Y2	Salmonella_phage	96.4	7.5e-245
AWZ55254.1|61223_62798_+	hypothetical protein	NA	J9Q7R1	Salmonella_phage	92.9	2.4e-285
AWZ55255.1|62819_63707_+	hypothetical protein	NA	J9Q7F4	Salmonella_phage	87.9	1.1e-130
AWZ55256.1|63732_64608_+|capsid	phage major capsid protein	capsid	J9Q710	Salmonella_phage	93.8	1.5e-154
AWZ55257.1|64681_65602_+	hypothetical protein	NA	J9Q6D6	Salmonella_phage	83.9	1.3e-132
AWZ55258.1|65646_66081_+	hypothetical protein	NA	J9Q7Y3	Salmonella_phage	81.2	9.7e-59
AWZ55259.1|66080_66914_+	hypothetical protein	NA	J9Q7R2	Salmonella_phage	92.4	2.7e-142
AWZ55260.1|66993_67338_+	hypothetical protein	NA	J9Q7F6	Salmonella_phage	95.6	2.3e-55
AWZ55261.1|67328_67802_+	hypothetical protein	NA	J9Q711	Salmonella_phage	90.4	3.3e-76
AWZ55262.1|67803_68187_+	hypothetical protein	NA	J9Q6D8	Salmonella_phage	82.7	1.2e-57
AWZ55263.1|68261_69008_+	hypothetical protein	NA	J9Q7Y4	Salmonella_phage	92.7	2.4e-121
AWZ55264.1|69063_69381_+	hypothetical protein	NA	J9Q7R3	Salmonella_phage	96.2	8.6e-49
AWZ55265.1|69461_69731_+	hypothetical protein	NA	J9Q7F7	Salmonella_phage	94.8	1.7e-34
AWZ55266.1|69738_74298_+|tail	phage tail tape measure protein	tail	J9Q712	Salmonella_phage	80.0	0.0e+00
AWZ55267.1|74340_74676_+|tail	phage tail protein	tail	J9Q6E1	Salmonella_phage	86.4	1.8e-52
AWZ55268.1|74725_75457_+|tail	phage minor tail protein L	tail	J9Q7Y5	Salmonella_phage	96.6	1.5e-133
AWZ55269.1|75449_76247_+|tail	phage tail protein	tail	J9Q7R4	Salmonella_phage	93.2	1.9e-153
AWZ55304.1|76234_76828_+|tail	tail assembly protein	tail	J9Q7F8	Salmonella_phage	90.9	3.4e-99
AWZ55270.1|77760_78973_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
>prophage 3
CP028430	Escherichia coli strain RM9131 plasmid pRM9131-1, complete sequence	117123	84341	104640	117123	tail,transposase	Salmonella_phage(88.89%)	23	NA	NA
AWZ55271.1|84341_87005_+|tail	phage tail protein	tail	J9Q6E3	Salmonella_phage	39.2	2.2e-68
AWZ55272.1|87207_87531_+	hypothetical protein	NA	J9Q6E7	Salmonella_phage	88.8	2.9e-44
AWZ55273.1|87544_88237_+	hypothetical protein	NA	J9Q7Y7	Salmonella_phage	93.9	1.8e-123
AWZ55274.1|88238_88490_+	hypothetical protein	NA	J9Q7R6	Salmonella_phage	75.6	2.0e-24
AWZ55275.1|88440_88626_+	hypothetical protein	NA	J9Q7G2	Salmonella_phage	75.0	4.9e-20
AWZ55276.1|88658_89180_-	N-acetyltransferase	NA	NA	NA	NA	NA
AWZ55306.1|89187_89457_-	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
AWZ55277.1|89699_90913_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
AWZ55278.1|91088_91757_+	plasmid stability protein	NA	J9Q7R7	Salmonella_phage	91.4	1.7e-110
AWZ55279.1|91756_92116_+	hypothetical protein	NA	J9Q7G3	Salmonella_phage	97.9	1.5e-44
AWZ55280.1|92168_92936_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ55281.1|93218_93959_+	hypothetical protein	NA	J9Q7R8	Salmonella_phage	89.6	2.2e-127
AWZ55282.1|94002_95343_+	DNA helicase	NA	J9Q7G4	Salmonella_phage	93.3	9.8e-235
AWZ55283.1|95424_96606_+	DNA primase	NA	J9Q720	Salmonella_phage	91.4	3.5e-204
AWZ55284.1|96597_97743_-	sel1 repeat family protein	NA	NA	NA	NA	NA
AWZ55285.1|97973_98387_+	hypothetical protein	NA	A0A0M4QWT0	Salmonella_phage	48.1	3.9e-25
AWZ55286.1|98512_99295_+	hypothetical protein	NA	J9Q7Z0	Salmonella_phage	43.4	3.0e-58
AWZ55287.1|99575_99833_+	hypothetical protein	NA	J9Q7R9	Salmonella_phage	56.6	5.6e-14
AWZ55288.1|99829_101152_+	DNA ligase	NA	J9Q7G5	Salmonella_phage	91.1	3.4e-240
AWZ55289.1|101148_101364_+	hypothetical protein	NA	J9Q6I3	Salmonella_phage	72.1	9.7e-20
AWZ55290.1|101509_101800_+	C-type natriuretic protein	NA	J9Q7S1	Salmonella_phage	79.2	2.4e-37
AWZ55291.1|103312_104221_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ55292.1|104394_104640_+	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	44.9	3.5e-13
>prophage 4
CP028430	Escherichia coli strain RM9131 plasmid pRM9131-1, complete sequence	117123	107984	116380	117123	transposase	Salmonella_phage(83.33%)	6	NA	NA
AWZ55297.1|107984_110093_+	cobalamin biosynthesis protein CobT	NA	J9Q7G6	Salmonella_phage	67.2	2.5e-229
AWZ55298.1|110188_111424_+	porphyrin biosynthesis protein	NA	J9Q733	Salmonella_phage	80.8	2.0e-197
AWZ55299.1|111668_112881_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
AWZ55308.1|114162_114354_-	hypothetical protein	NA	J9Q7H1	Salmonella_phage	76.2	3.7e-23
AWZ55300.1|114395_115481_-	exonuclease	NA	J9Q7S9	Salmonella_phage	87.5	8.0e-187
AWZ55301.1|115735_116380_-	hypothetical protein	NA	J9Q739	Salmonella_phage	86.3	2.9e-107
>prophage 1
CP028431	Escherichia coli strain RM9131 plasmid pRM9131-2, complete sequence	76698	2288	38062	76698	transposase	Escherichia_phage(36.36%)	49	NA	NA
AWZ55314.1|2288_3476_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
AWZ55315.1|3475_3841_-|transposase	transposase	transposase	NA	NA	NA	NA
AWZ55316.1|3979_4234_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ55317.1|4244_4436_-	hypothetical protein	NA	K7PLX1	Enterobacteria_phage	41.3	3.5e-05
AWZ55318.1|4740_8706_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	Q9LA58	Enterobacterial_phage	39.9	1.1e-230
AWZ55319.1|8850_9060_-	hypothetical protein	NA	A0A0N7BTS3	Escherichia_phage	96.2	7.8e-06
AWZ55320.1|9025_10239_-|transposase	IS3 family transposase	transposase	A0A0N7C035	Escherichia_phage	100.0	2.2e-169
AWZ55321.1|10878_11274_-	plasmid stabilization protein	NA	NA	NA	NA	NA
AWZ55322.1|11273_12233_-	plasmid stabilization protein	NA	A0A222YXF2	Escherichia_phage	40.6	6.0e-61
AWZ55380.1|12505_13408_+	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
AWZ55323.1|13411_13717_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ55324.1|13792_14164_+	DNA modification methylase	NA	A0A2I7RE86	Vibrio_phage	33.9	1.4e-10
AWZ55325.1|14270_15458_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
AWZ55326.1|15457_15823_-|transposase	transposase	transposase	NA	NA	NA	NA
AWZ55327.1|15750_15936_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ55328.1|16072_16498_+	antirestriction protein	NA	NA	NA	NA	NA
AWZ55329.1|16544_16967_+	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
AWZ55330.1|16963_17155_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ55331.1|17523_17772_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ55381.1|17854_17974_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
AWZ55332.1|18192_18423_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ55333.1|18474_19836_+	DUF3560 domain-containing protein	NA	NA	NA	NA	NA
AWZ55334.1|20444_20687_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ55383.1|20596_20857_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ55335.1|20760_20985_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ55382.1|20907_21102_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ55336.1|21028_21265_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ55337.1|21329_21857_+	single-stranded DNA-binding protein	NA	A0A1B0VAF5	Salmonella_phage	54.1	4.6e-47
AWZ55338.1|21912_22146_+	DUF905 domain-containing protein	NA	A0A096XUX0	Cronobacter_phage	51.1	3.9e-06
AWZ55339.1|22204_24163_+	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	29.9	6.6e-22
AWZ55340.1|24217_24652_+	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
AWZ55341.1|24648_25368_+	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
AWZ55342.1|25647_25806_+	protein hok	NA	NA	NA	NA	NA
AWZ55343.1|26025_26256_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ55384.1|26306_26495_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ55344.1|26496_26703_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
AWZ55345.1|26727_27015_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ55346.1|27024_27957_+	DUF945 domain-containing protein	NA	A0A2C9CYF8	Yersinia_phage	38.2	3.8e-44
AWZ55347.1|29176_29560_+	conjugal transfer protein TraM	NA	NA	NA	NA	NA
AWZ55348.1|29746_30436_+	conjugal transfer protein TraJ	NA	NA	NA	NA	NA
AWZ55385.1|30534_30930_+	relaxosome protein TraY	NA	NA	NA	NA	NA
AWZ55349.1|30962_31322_+	pilin	NA	NA	NA	NA	NA
AWZ55350.1|31336_31648_+	type IV conjugative transfer system protein TraL	NA	NA	NA	NA	NA
AWZ55351.1|31669_32236_+	type IV conjugative transfer system protein TraE	NA	NA	NA	NA	NA
AWZ55386.1|32279_32951_+	type-F conjugative transfer system secretin TraK	NA	NA	NA	NA	NA
AWZ55352.1|32950_34378_+	conjugal transfer protein TraB	NA	NA	NA	NA	NA
AWZ55353.1|34367_34958_+	conjugal transfer protein TraP	NA	NA	NA	NA	NA
AWZ55354.1|34944_35067_+	conjugal transfer protein TrbD	NA	NA	NA	NA	NA
AWZ55355.1|36848_38062_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
