The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP022208	Rhodococcus biphenylivorans strain TG9 chromosome, complete genome	5034221	2415	45161	5034221	integrase,transposase	Mycobacterium_phage(28.57%)	31	25407:25421	48026:48040
AWZ26740.1|2415_2613_-|transposase	transposase	transposase	NA	NA	NA	NA
AWZ22785.1|2814_4209_-|transposase	IS1380 family transposase	transposase	A0A222ZN33	Mycobacterium_phage	54.4	1.5e-121
AWZ22786.1|4371_4677_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ22787.1|4673_6596_-|integrase	integrase	integrase	G8C7K6	Escherichia_phage	25.2	2.6e-07
AWZ22788.1|6561_7644_-|integrase	integrase	integrase	A0A0K1Y646	Mycobacterium_phage	31.4	1.2e-09
AWZ26741.1|8399_8693_-|transposase	transposase	transposase	A0A1B3AZF8	Gordonia_phage	36.1	1.5e-07
AWZ26742.1|10013_10211_-	4-oxalocrotonate tautomerase	NA	NA	NA	NA	NA
AWZ22789.1|10213_11002_-	4-oxalocrotonate decarboxylase	NA	NA	NA	NA	NA
AWZ22790.1|10998_11793_-	2-keto-4-pentenoate hydratase	NA	NA	NA	NA	NA
AWZ26743.1|11828_12653_-	IclR family transcriptional regulator	NA	NA	NA	NA	NA
AWZ26744.1|13830_14334_+	glycine zipper family protein	NA	NA	NA	NA	NA
AWZ22791.1|14337_16218_+	molecular chaperone DnaK	NA	G8DDB7	Micromonas_pusilla_virus	48.1	6.7e-149
AWZ22792.1|16226_16751_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
AWZ22793.1|16757_17696_+	molecular chaperone DnaJ	NA	M1PC06	Moumouvirus	51.4	3.5e-13
AWZ22794.1|17692_18022_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
AWZ22795.1|20645_21098_+	thiol reductase thioredoxin	NA	A0A1V0SD63	Indivirus	41.9	4.0e-07
AWZ22796.1|21094_21361_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ22797.1|21338_23066_+	cyclic nucleotide-binding protein	NA	G3MA85	Bacillus_virus	28.3	1.7e-29
AWZ22798.1|23070_23520_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ26745.1|23698_24864_-	hypothetical protein	NA	U5P429	Shigella_phage	36.2	4.3e-29
25407:25421	attL	TTTCTTGATCGCGGA	NA	NA	NA	NA
AWZ22799.1|27690_29085_-|transposase	IS1380 family transposase	transposase	A0A222ZN33	Mycobacterium_phage	54.4	1.5e-121
AWZ22800.1|29893_30670_-	glyoxalase	NA	NA	NA	NA	NA
AWZ22801.1|34470_35001_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AWZ22802.1|35447_36062_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AWZ22803.1|36955_38044_-	CdaR family transcriptional regulator	NA	NA	NA	NA	NA
AWZ22804.1|38058_38955_-	lipase	NA	NA	NA	NA	NA
AWZ22805.1|39202_40384_+	1,4-butanediol diacrylate esterase	NA	A0A2D2W367	Mycobacterium_phage	25.4	1.4e-06
AWZ22806.1|40710_40905_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ22807.1|40976_42086_+|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	41.2	6.3e-62
AWZ22808.1|42153_43209_+|integrase	integrase	integrase	A0A166YH27	Gordonia_phage	28.5	1.8e-10
AWZ22809.1|43205_45161_+|integrase	integrase	integrase	A0A1B1P7C7	Bacillus_phage	26.0	3.0e-06
48026:48040	attR	TCCGCGATCAAGAAA	NA	NA	NA	NA
>prophage 2
CP022208	Rhodococcus biphenylivorans strain TG9 chromosome, complete genome	5034221	250883	392881	5034221	integrase,transposase	Mycobacterium_phage(25.93%)	109	246950:246966	393218:394324
246950:246966	attL	CGGTCGCCGAGCGTGGC	NA	NA	NA	NA
AWZ22979.1|250883_252197_+|transposase	IS256 family transposase	transposase	A0A2P1JQX9	Mycobacterium_phage	82.1	6.3e-202
246950:246966	attL	CGGTCGCCGAGCGTGGC	NA	NA	NA	NA
AWZ22980.1|252645_253740_+|integrase	integrase	integrase	NA	NA	NA	NA
AWZ22981.1|253723_254068_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AWZ22982.1|254340_255348_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ22983.1|255410_256805_-|transposase	IS1380 family transposase	transposase	A0A222ZN33	Mycobacterium_phage	54.4	1.5e-121
AWZ22984.1|257733_258978_+|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	44.7	6.1e-82
AWZ22985.1|259565_260555_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ22986.1|260551_261526_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ22987.1|263026_264790_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ22988.1|265316_265679_+	penicillinase repressor	NA	NA	NA	NA	NA
AWZ22989.1|265675_266623_+	peptidase M48	NA	NA	NA	NA	NA
AWZ22990.1|266735_268514_+	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
AWZ22991.1|268553_269084_+	hypothetical protein	NA	NA	NA	NA	NA
268888:268904	attR	CGGTCGCCGAGCGTGGC	NA	NA	NA	NA
AWZ22992.1|269836_270562_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
268888:268904	attR	CGGTCGCCGAGCGTGGC	NA	NA	NA	NA
AWZ22993.1|270729_271575_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ22994.1|271732_272419_-	TVP38/TMEM64 family protein	NA	NA	NA	NA	NA
AWZ26761.1|272662_273256_+	thiol-disulfide oxidoreductase	NA	NA	NA	NA	NA
AWZ22995.1|273252_273885_+	protein disulfide reductase	NA	NA	NA	NA	NA
AWZ26762.1|273884_274706_+	cytochrome C biogenesis protein CcdA	NA	NA	NA	NA	NA
AWZ22996.1|274702_276325_+	cytochrome c biogenesis protein	NA	NA	NA	NA	NA
AWZ22997.1|276328_277294_+	c-type cytochrome biogenesis protein CcsB	NA	NA	NA	NA	NA
AWZ22998.1|277440_278928_+	apolipoprotein N-acyltransferase	NA	NA	NA	NA	NA
AWZ22999.1|279203_279971_+	peptidase M24	NA	G8I8L5	Mycobacterium_phage	51.6	9.5e-25
AWZ23000.1|280326_281649_-	MFS transporter	NA	NA	NA	NA	NA
AWZ26763.1|281645_282758_-	pyridoxal-5'-phosphate-dependent protein subunit beta	NA	NA	NA	NA	NA
AWZ23001.1|282866_283286_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ26764.1|283580_284408_-	peptidase M48	NA	NA	NA	NA	NA
AWZ23002.1|284506_284869_-	penicillinase repressor	NA	NA	NA	NA	NA
AWZ23003.1|285130_286198_-	glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
AWZ23004.1|286254_288696_-	copper-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	35.4	1.1e-90
AWZ23005.1|288779_289058_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ23006.1|289054_289180_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ26765.1|289473_292755_-	beta-phosphoglucomutase family hydrolase	NA	NA	NA	NA	NA
AWZ23007.1|292718_295142_-	phosphoketolase	NA	NA	NA	NA	NA
AWZ26766.1|296001_296271_-	copper chaperone	NA	NA	NA	NA	NA
AWZ23008.1|296683_297799_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ23009.1|298719_299049_-	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
AWZ26767.1|299141_300191_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AWZ23010.1|300388_300766_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ23011.1|301219_302164_+	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
AWZ23012.1|302775_303672_+	6-phosphogluconate dehydrogenase (decarboxylating)	NA	M4SJX8	Cyanophage	41.0	3.8e-57
AWZ23013.1|304151_304559_-	four-helix bundle copper-binding protein	NA	NA	NA	NA	NA
AWZ23014.1|304796_305708_-	EamA family transporter	NA	NA	NA	NA	NA
AWZ23015.1|306220_306334_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ23016.1|306577_308239_+	ABC transporter	NA	E5ES62	Bathycoccus_sp._RCC1105_virus	29.1	8.9e-36
AWZ23017.1|308476_310582_-	amidohydrolase	NA	NA	NA	NA	NA
AWZ23018.1|310774_312448_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ23019.1|312564_312798_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ23020.1|312867_313977_+|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	41.2	6.3e-62
AWZ23021.1|314044_315100_+|integrase	integrase	integrase	A0A166YH27	Gordonia_phage	28.5	1.8e-10
AWZ23022.1|315096_317052_+|integrase	integrase	integrase	A0A1B1P7C7	Bacillus_phage	26.0	3.0e-06
AWZ23023.1|317094_317328_+	hypothetical protein	NA	A0A220NQR7	Corynebacterium_phage	65.2	3.8e-09
AWZ23024.1|317388_317622_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ23025.1|317795_318941_-	two-component sensor histidine kinase	NA	NA	NA	NA	NA
AWZ26768.1|318937_319630_-	DNA-binding response regulator	NA	A0A1J0GWE0	Alteromonas_phage	28.7	1.2e-07
AWZ23026.1|319845_320133_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ23027.1|320125_321643_+	copper oxidase	NA	NA	NA	NA	NA
AWZ23028.1|321721_322390_+	DUF305 domain-containing protein	NA	A0A218MND9	uncultured_virus	32.9	2.4e-08
AWZ23029.1|322436_324626_+	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	30.7	3.4e-59
AWZ23030.1|324664_325522_+	glycosyl hydrolase	NA	NA	NA	NA	NA
AWZ23031.1|325506_325755_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ23032.1|326022_327630_+	oxidase	NA	NA	NA	NA	NA
AWZ23033.1|327617_328031_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ23034.1|328374_328590_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ23035.1|328746_328953_+	cation-transporting ATPase	NA	NA	NA	NA	NA
AWZ23036.1|328987_329185_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ23037.1|329219_331481_+	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	34.6	1.8e-84
AWZ26769.1|331770_332121_+	transcriptional regulator	NA	NA	NA	NA	NA
AWZ23038.1|332692_333700_-	recombinase	NA	NA	NA	NA	NA
AWZ23039.1|333831_334182_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ23040.1|334227_335151_-	fatty acid hydroxylase	NA	NA	NA	NA	NA
AWZ26770.1|336145_337402_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ23041.1|337427_338264_-	DNA-binding protein	NA	NA	NA	NA	NA
AWZ23042.1|338291_338882_-	cadmium transporter	NA	NA	NA	NA	NA
AWZ23043.1|338975_340553_-	MFS transporter	NA	NA	NA	NA	NA
AWZ23044.1|340503_341034_-	signal peptidase II	NA	NA	NA	NA	NA
AWZ23045.1|341030_342995_-	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	39.8	9.3e-101
AWZ23046.1|342991_343381_-	transcriptional regulator	NA	NA	NA	NA	NA
AWZ23047.1|346040_349052_-|transposase	DDE transposase	transposase	A0A1B0V7H9	Salmonella_phage	31.7	1.8e-127
AWZ23048.1|349697_350585_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
AWZ23049.1|350638_353836_-	carbamoyl-phosphate-synthetase	NA	NA	NA	NA	NA
AWZ23050.1|353839_355543_-	acyl-CoA synthetase	NA	A0A2K9L3I8	Tupanvirus	22.5	3.6e-16
AWZ26771.1|355545_356214_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AWZ23051.1|356243_357632_-	MFS transporter	NA	NA	NA	NA	NA
AWZ23052.1|357845_358829_-	alcohol dehydrogenase	NA	NA	NA	NA	NA
AWZ26772.1|359009_360086_-	phosphotransferase family protein	NA	NA	NA	NA	NA
AWZ23053.1|360045_360828_-	3-oxoacyl-ACP reductase	NA	A0A0M4JSW6	Mollivirus	33.9	2.4e-07
AWZ23054.1|360830_362057_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
AWZ23055.1|362122_362938_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
AWZ23056.1|363167_363644_+	enoyl-CoA hydratase	NA	NA	NA	NA	NA
AWZ23057.1|363887_365387_+	AMP-dependent synthetase	NA	A0A2H4PQM9	Staphylococcus_phage	30.9	1.2e-31
AWZ26773.1|365530_366781_-	alpha-hydroxy-acid oxidizing enzyme	NA	NA	NA	NA	NA
AWZ23058.1|368239_369637_+|transposase	IS1380 family transposase	transposase	NA	NA	NA	NA
AWZ23059.1|369777_370362_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ26774.1|370318_371275_-	2-hydroxyacid dehydrogenase	NA	A0A1B1IVB5	uncultured_Mediterranean_phage	29.1	1.7e-15
AWZ23060.1|371298_374829_-	indolepyruvate ferredoxin oxidoreductase	NA	NA	NA	NA	NA
AWZ23061.1|375078_375411_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
AWZ23062.1|375404_376118_+|transposase	transposase	transposase	NA	NA	NA	NA
AWZ23063.1|377497_378811_-|transposase	IS256 family transposase	transposase	A0A2P1JQX9	Mycobacterium_phage	82.1	6.3e-202
AWZ23064.1|379015_380329_-|transposase	IS256 family transposase	transposase	A0A2P1JQX9	Mycobacterium_phage	82.1	6.3e-202
AWZ23065.1|382367_383450_+|integrase	integrase	integrase	A0A0K1Y646	Mycobacterium_phage	31.4	1.2e-09
AWZ23066.1|383415_385338_+|integrase	integrase	integrase	G8C7K6	Escherichia_phage	25.2	2.6e-07
AWZ23067.1|385334_385640_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ23068.1|386138_386990_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ23069.1|387010_388396_-	MFS transporter	NA	NA	NA	NA	NA
AWZ23070.1|388815_389121_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ23071.1|389117_391040_-|integrase	integrase	integrase	G8C7K6	Escherichia_phage	25.2	2.6e-07
AWZ23072.1|391005_392088_-|integrase	integrase	integrase	A0A0K1Y646	Mycobacterium_phage	31.4	1.2e-09
AWZ23073.1|392170_392881_-|transposase	transposase	transposase	NA	NA	NA	NA
393218:394324	attR	TTCTCGCTTCCCCCAGCAGTGTGCTGGATTCCACGTGTCCAAGATCAGGGGTCAAGCTCCGGTGTCTGTTATGGTTATTTTGTCCGGCTCTGTGTCATGTGAAGGTTCAACCGCGCCGGAACACCGGCGTCGCGGAAGCTGCGAAGTCCGCGATCAGTTGCCCGATCTCGTCGGGAAACTCGTCTACAAGGAAGTGACCGGCACCGGCAACCTCACCACCGGTCACCAACTCTGGTCGACGGGAGAGTTCGCGCCAGACGTCCACCGGAGAATGACCGGCACGCGCAATCATTCCGTTCGCTCCCCAAGCAACGTGGCAGGGGCAGTCGATGAGCCGTCCAGCCTCTCGACTCTGCGCATCGTGTTGCAAGTCGATCGTGGCCGCCGCACGGTAGTCCTCGATCGTTGCCAGACGACGCATCGGATCAGCGAACAATCGTTCGTATTCGGCCAACGCGGACGGATGGTAAGCGTCGCCTTTGGCCCCGACGGCACTGTGGCCGCCGACACCCAGCACCGAATGCAGGTAGCCGATCGGATCGGCTTCGAGGAACTTCTCCGGCAGCCCATCGGGCTGGGGAAACATGAACCAGTGGTAATAGGCAAGGGCGAGTTCGGCATCAACGTTCGCGTAGACCCATTCCGTCGGCATGATGTCCAACAGAACGATCCCGGAAACCGCGTCGCTGAAGTCCAGGGCCATACGATGTGCGGCGCGGGCACCGCGGTCGTGCCCGACAACGACGAATCTGTCGAATCCGAGTCGCTGCATCACCGCCGCCTGGTCTGCTGCCATAGCACGAAAGGAATGTGGCGAGTGCGTGGAATCGACGTCGGGCAGGGTGGAATCACCGTACCCGCGTAGATCCGTCACCACGACAGTGAAGCGTTCGGCCAAAACCGGAGCGACCCGATGCCACATCACATGTGACTGCGGAAACCCGTGCAGAAGAAGAATCGGCATACCCGTGCCGGCCCTCATCCCATGGATGGTAATGCCGTCACCGGTCATCGAATCGAAGGGCTCGAATCCCGGAAAGAGTTCCTGTGCCACCGTGCTCACTGACATCTCCTTTGTCGGATACCCACCCCCGCGATGTGACGTGC	NA	NA	NA	NA
>prophage 3
CP022208	Rhodococcus biphenylivorans strain TG9 chromosome, complete genome	5034221	2127572	2137686	5034221	integrase,transposase	Corynebacterium_phage(33.33%)	7	2123962:2123988	2137144:2137170
2123962:2123988	attL	GAGAACGGTTCGGGCAAGTCCACGCTC	NA	NA	NA	NA
AWZ24471.1|2127572_2128793_+	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	M4QPK3	Synechococcus_phage	41.2	5.5e-35
AWZ24472.1|2128923_2129982_+	DNA polymerase IV	NA	NA	NA	NA	NA
AWZ24473.1|2130536_2131646_+|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	41.2	6.3e-62
AWZ24474.1|2131713_2132769_+|integrase	integrase	integrase	A0A166YH27	Gordonia_phage	28.5	1.8e-10
AWZ24475.1|2132765_2134721_+|integrase	integrase	integrase	A0A1B1P7C7	Bacillus_phage	26.0	3.0e-06
AWZ24476.1|2134763_2134997_+	hypothetical protein	NA	A0A220NQR7	Corynebacterium_phage	65.2	3.8e-09
AWZ24477.1|2135760_2137686_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.9	4.1e-08
2137144:2137170	attR	GAGAACGGTTCGGGCAAGTCCACGCTC	NA	NA	NA	NA
>prophage 4
CP022208	Rhodococcus biphenylivorans strain TG9 chromosome, complete genome	5034221	3039582	3165867	5034221	integrase,transposase	Bacillus_phage(21.05%)	112	3066984:3067002	3142193:3142211
AWZ25197.1|3039582_3040866_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	37.9	9.0e-36
AWZ26999.1|3041648_3042444_+|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
AWZ25198.1|3042603_3043305_-	SIMPL domain-containing protein	NA	NA	NA	NA	NA
AWZ25199.1|3043477_3043771_+	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
AWZ25200.1|3043840_3044260_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ25201.1|3044491_3045100_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
AWZ25202.1|3045308_3045917_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ25203.1|3045977_3046877_+	phosphatidylinositol mannoside acyltransferase	NA	NA	NA	NA	NA
AWZ27000.1|3046911_3047502_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ27001.1|3047940_3048627_+	ZIP family metal transporter	NA	NA	NA	NA	NA
AWZ25204.1|3048677_3049478_-	HAD family hydrolase	NA	NA	NA	NA	NA
AWZ25205.1|3049527_3049782_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ25206.1|3050567_3051167_+	ANTAR domain-containing protein	NA	NA	NA	NA	NA
AWZ25207.1|3051258_3052449_-	flavin reductase	NA	NA	NA	NA	NA
AWZ25208.1|3052489_3053923_-	MFS transporter	NA	NA	NA	NA	NA
AWZ25209.1|3054113_3055406_+	amidase	NA	NA	NA	NA	NA
AWZ27002.1|3055446_3055731_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ25210.1|3055732_3056389_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AWZ25211.1|3056399_3057350_-	oxidoreductase	NA	NA	NA	NA	NA
AWZ25212.1|3057401_3058154_-	short-chain dehydrogenase	NA	NA	NA	NA	NA
AWZ25213.1|3058163_3058658_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ27003.1|3058650_3059931_-	Rieske (2Fe-2S) protein	NA	S4S2K9	Puniceispirillum_phage	26.3	3.5e-08
AWZ25214.1|3059972_3060470_-	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
AWZ25215.1|3060472_3060853_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ27004.1|3060888_3062061_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
AWZ25216.1|3062254_3063715_+	PAS domain-containing sensor histidine kinase	NA	NA	NA	NA	NA
AWZ27005.1|3063757_3064192_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ25217.1|3064951_3066406_+	ethanolamine permease	NA	NA	NA	NA	NA
AWZ25218.1|3066436_3067333_-	sucrase ferredoxin	NA	NA	NA	NA	NA
3066984:3067002	attL	TCGAGGGCGGTGACGATCT	NA	NA	NA	NA
AWZ27006.1|3067342_3068527_-	cupin	NA	NA	NA	NA	NA
3066984:3067002	attL	TCGAGGGCGGTGACGATCT	NA	NA	NA	NA
AWZ25219.1|3068549_3068855_-	BatC protein	NA	NA	NA	NA	NA
AWZ25220.1|3069085_3069337_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ25221.1|3069820_3070111_+	hypothetical protein	NA	Q6H9S6	Enterobacteria_phage	49.4	1.4e-13
AWZ27007.1|3071131_3072751_-	hypothetical protein	NA	W8CYL7	Bacillus_phage	27.7	4.9e-23
AWZ27008.1|3072816_3074460_-	hypothetical protein	NA	W8CYL7	Bacillus_phage	25.2	8.3e-18
AWZ25222.1|3074459_3075335_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ25223.1|3075546_3076971_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ25224.1|3076987_3077971_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ25225.1|3077967_3078819_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ25226.1|3079111_3080308_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ25227.1|3080311_3082060_+	S9 family peptidase	NA	NA	NA	NA	NA
AWZ25228.1|3082209_3083280_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
AWZ27009.1|3083366_3084356_+	ABC transporter permease	NA	NA	NA	NA	NA
AWZ25229.1|3086216_3087158_+	zinc ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AWZ25230.1|3087727_3088168_+	glyoxalase	NA	NA	NA	NA	NA
AWZ25231.1|3088225_3089293_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ25232.1|3089909_3090632_+	aspartate racemase	NA	NA	NA	NA	NA
AWZ25233.1|3091882_3092314_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
AWZ25234.1|3092305_3093874_+	hypothetical protein	NA	Q8W6R2	Burkholderia_virus	50.2	1.6e-42
AWZ25235.1|3093983_3094277_+|transposase	IS3 family transposase	transposase	A0A1B3AZF8	Gordonia_phage	39.2	1.5e-07
AWZ25236.1|3094276_3094963_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ25237.1|3095045_3096128_+|integrase	integrase	integrase	A0A0K1Y646	Mycobacterium_phage	31.4	1.2e-09
AWZ25238.1|3096093_3098016_+|integrase	integrase	integrase	G8C7K6	Escherichia_phage	25.2	2.6e-07
AWZ25239.1|3098012_3098318_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ25240.1|3098385_3098583_+|transposase	transposase	transposase	NA	NA	NA	NA
AWZ27010.1|3099869_3102362_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	25.9	2.6e-47
AWZ25241.1|3102358_3103489_+|integrase	integrase	integrase	NA	NA	NA	NA
AWZ25242.1|3103617_3104319_+	DNA alkylation repair protein	NA	NA	NA	NA	NA
AWZ25243.1|3104320_3105022_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ25244.1|3105187_3107554_+	phosphoketolase	NA	NA	NA	NA	NA
AWZ25245.1|3107557_3108322_-	HAD family hydrolase	NA	NA	NA	NA	NA
AWZ25246.1|3108338_3110825_-	trehalose 6-phosphate phosphorylase	NA	NA	NA	NA	NA
3110260:3110278	attR	TCGAGGGCGGTGACGATCT	NA	NA	NA	NA
AWZ27011.1|3110821_3111637_-	trehalose-phosphatase	NA	NA	NA	NA	NA
3110260:3110278	attR	TCGAGGGCGGTGACGATCT	NA	NA	NA	NA
AWZ27012.1|3111745_3112813_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ25247.1|3112933_3113395_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	36.4	6.5e-13
AWZ27013.1|3113952_3114660_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ25248.1|3114811_3115957_-	MFS transporter	NA	NA	NA	NA	NA
AWZ25249.1|3115953_3116853_-	PAC2 family protein	NA	NA	NA	NA	NA
AWZ25250.1|3116904_3120474_+	methionine synthase	NA	NA	NA	NA	NA
AWZ25251.1|3120478_3121174_+	HAD family hydrolase	NA	NA	NA	NA	NA
AWZ25252.1|3121175_3122036_+	rhodanese domain-containing protein	NA	NA	NA	NA	NA
AWZ25253.1|3122040_3122928_+	pseudouridine synthase	NA	NA	NA	NA	NA
AWZ25254.1|3122986_3123250_+	phosphoribosyl-ATP diphosphatase	NA	NA	NA	NA	NA
AWZ25255.1|3123343_3124207_+	ATP phosphoribosyltransferase	NA	NA	NA	NA	NA
AWZ25256.1|3124248_3125088_-	thioesterase family protein	NA	NA	NA	NA	NA
AWZ25257.1|3125084_3125972_-	recombinase RecB	NA	NA	NA	NA	NA
AWZ25258.1|3126061_3126913_+	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AWZ25259.1|3126934_3127414_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ25260.1|3127601_3129371_+	proteasome ATPase	NA	A0A0K1L651	Scale_drop_disease_virus	40.9	2.2e-32
AWZ25261.1|3129465_3129852_+	nitroreductase family deazaflavin-dependent oxidoreductase	NA	NA	NA	NA	NA
AWZ25262.1|3129907_3131401_+	proteasome accessory factor PafA2	NA	NA	NA	NA	NA
AWZ25263.1|3131567_3131759_+	ubiquitin-like protein Pup	NA	NA	NA	NA	NA
AWZ25264.1|3131755_3132610_+	proteasome subunit beta	NA	NA	NA	NA	NA
AWZ25265.1|3132606_3133419_+	proteasome subunit alpha	NA	NA	NA	NA	NA
AWZ25266.1|3133319_3134918_-	diacylglycerol kinase	NA	NA	NA	NA	NA
AWZ25267.1|3134949_3136308_+	Pup--protein ligase	NA	NA	NA	NA	NA
AWZ25268.1|3136396_3137392_+	WYL domain-containing protein	NA	NA	NA	NA	NA
AWZ25269.1|3137388_3138420_+	protein pafC	NA	NA	NA	NA	NA
AWZ25270.1|3138547_3138802_+	twin-arginine translocase TatA/TatE family subunit	NA	NA	NA	NA	NA
AWZ25271.1|3138906_3139869_+	twin-arginine translocase subunit TatC	NA	NA	NA	NA	NA
AWZ25272.1|3139865_3142622_+	DEAD/DEAH box helicase	NA	M1I8L9	Paramecium_bursaria_Chlorella_virus	33.0	1.1e-62
AWZ27014.1|3143343_3143610_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ25273.1|3143620_3144598_-	5'-3' exonuclease	NA	F8WQ40	Bacillus_phage	28.6	2.3e-15
AWZ25274.1|3144633_3145764_+	peptidase M24 family protein	NA	NA	NA	NA	NA
AWZ25275.1|3145809_3146556_+	oxidoreductase	NA	NA	NA	NA	NA
AWZ25276.1|3146869_3147679_-	ATP-binding protein	NA	NA	NA	NA	NA
AWZ25277.1|3147678_3149064_-|transposase	transposase	transposase	NA	NA	NA	NA
AWZ25278.1|3149065_3149668_-	invertase	NA	A0A219YB42	Aeromonas_phage	46.2	7.9e-35
AWZ25279.1|3150009_3150549_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ25280.1|3150652_3151387_-	VIT family protein	NA	NA	NA	NA	NA
AWZ27015.1|3151637_3152951_+	oxidoreductase	NA	NA	NA	NA	NA
AWZ25281.1|3152947_3153454_+	FMN-binding protein	NA	NA	NA	NA	NA
AWZ27016.1|3153480_3154215_+	thiamine biosynthesis protein	NA	NA	NA	NA	NA
AWZ27017.1|3154268_3154919_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	33.8	1.3e-22
AWZ25282.1|3154915_3156169_+	two-component sensor histidine kinase	NA	NA	NA	NA	NA
AWZ25283.1|3156571_3157885_+|transposase	IS256 family transposase	transposase	A0A2P1JQX9	Mycobacterium_phage	82.1	6.3e-202
AWZ25284.1|3158044_3159115_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
AWZ25285.1|3159605_3160865_-	acyl-CoA desaturase	NA	NA	NA	NA	NA
AWZ25286.1|3161546_3161999_+	response regulator	NA	NA	NA	NA	NA
AWZ27018.1|3162038_3162239_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	47.0	1.4e-07
AWZ25287.1|3162706_3163450_-	antitermination regulator	NA	NA	NA	NA	NA
AWZ25288.1|3164553_3165867_-|transposase	IS256 family transposase	transposase	A0A2P1JQX9	Mycobacterium_phage	82.1	6.3e-202
>prophage 5
CP022208	Rhodococcus biphenylivorans strain TG9 chromosome, complete genome	5034221	3588882	3634521	5034221	integrase,transposase	Aeromonas_phage(16.67%)	38	3582566:3582581	3635098:3635113
3582566:3582581	attL	CTGCTCGGCCACCTCG	NA	NA	NA	NA
AWZ25617.1|3588882_3589851_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
AWZ25618.1|3589942_3590329_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ25619.1|3590318_3590975_-	DUF433 domain-containing protein	NA	NA	NA	NA	NA
AWZ25620.1|3591376_3591679_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ25621.1|3595273_3595537_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ25622.1|3596405_3597026_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ25623.1|3596853_3597378_+	thioesterase	NA	NA	NA	NA	NA
AWZ25624.1|3597527_3598529_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AWZ27051.1|3598647_3598968_+	2Fe-2S ferredoxin	NA	NA	NA	NA	NA
AWZ25625.1|3599008_3600397_+	cytochrome P450	NA	NA	NA	NA	NA
AWZ25626.1|3600393_3601614_+	pyridine nucleotide-disulfide oxidoreductase	NA	NA	NA	NA	NA
AWZ25627.1|3601734_3602796_+	PRTRC system protein E	NA	NA	NA	NA	NA
AWZ25628.1|3602967_3603654_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AWZ25629.1|3603772_3605350_+	MFS transporter	NA	NA	NA	NA	NA
AWZ25630.1|3605493_3606075_-|transposase	transposase	transposase	A0A219YB42	Aeromonas_phage	41.5	6.5e-26
AWZ27052.1|3606251_3606524_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ25631.1|3606569_3607640_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
AWZ25632.1|3607818_3608574_+	hypothetical protein	NA	A0A2H4J9M0	uncultured_Caudovirales_phage	34.2	2.0e-11
AWZ25633.1|3608737_3610147_-|transposase	IS1380 family transposase	transposase	NA	NA	NA	NA
AWZ25634.1|3610411_3610606_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ25635.1|3611176_3611395_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ25636.1|3611442_3611898_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ25637.1|3612694_3613159_-	peroxiredoxin	NA	NA	NA	NA	NA
AWZ25638.1|3613190_3613613_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ25639.1|3613938_3616788_+	pyruvate dehydrogenase (acetyl-transferring), homodimeric type	NA	NA	NA	NA	NA
AWZ27053.1|3616947_3618168_+	PucR family transcriptional regulator	NA	NA	NA	NA	NA
AWZ27054.1|3618296_3619214_+	ACP S-malonyltransferase	NA	NA	NA	NA	NA
AWZ25640.1|3619334_3619613_+	acyl carrier protein	NA	E3SMK8	Prochlorococcus_phage	35.8	5.1e-05
AWZ25641.1|3619621_3620866_+	beta-ketoacyl-[acyl-carrier-protein] synthase II	NA	NA	NA	NA	NA
AWZ25642.1|3620957_3622391_+	propionyl-CoA carboxylase subunit beta	NA	NA	NA	NA	NA
AWZ25643.1|3622504_3623011_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ25644.1|3623134_3623947_-	serine hydrolase	NA	NA	NA	NA	NA
AWZ25645.1|3623999_3625127_-	NDMA-dependent alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	28.1	8.2e-33
AWZ25646.1|3625294_3626947_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
AWZ25647.1|3630457_3631855_+|transposase	IS1380 family transposase	transposase	NA	NA	NA	NA
AWZ25648.1|3632001_3632211_-	hypothetical protein	NA	A0A1B3AZE5	Gordonia_phage	53.3	4.5e-14
AWZ25649.1|3632296_3632602_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ25650.1|3632598_3634521_-|integrase	integrase	integrase	G8C7K6	Escherichia_phage	25.2	2.6e-07
3635098:3635113	attR	CGAGGTGGCCGAGCAG	NA	NA	NA	NA
>prophage 6
CP022208	Rhodococcus biphenylivorans strain TG9 chromosome, complete genome	5034221	4673232	4681643	5034221	integrase,transposase	Bacillus_phage(28.57%)	7	4668347:4668364	4691969:4691986
4668347:4668364	attL	TGTCTCCTCCCCGAGACA	NA	NA	NA	NA
AWZ26461.1|4673232_4674258_+	SGNH/GDSL hydrolase family protein	NA	A0A0A0RS52	Bacillus_phage	31.0	5.7e-25
AWZ26462.1|4674403_4675513_+|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	41.2	6.3e-62
AWZ26463.1|4675580_4676636_+|integrase	integrase	integrase	A0A166YH27	Gordonia_phage	28.5	1.8e-10
AWZ26464.1|4676632_4678588_+|integrase	integrase	integrase	A0A1B1P7C7	Bacillus_phage	26.0	3.0e-06
AWZ26465.1|4678630_4678864_+	hypothetical protein	NA	A0A220NQR7	Corynebacterium_phage	65.2	3.8e-09
AWZ26466.1|4679105_4680236_-	hypothetical protein	NA	A0A142KBN9	Gordonia_phage	73.5	2.3e-152
AWZ26467.1|4680722_4681643_-	NAD(P)-dependent oxidoreductase	NA	A0A2N9QUX2	Trichoplusia_ni_ascovirus	46.0	3.9e-65
4691969:4691986	attR	TGTCTCCTCCCCGAGACA	NA	NA	NA	NA
>prophage 7
CP022208	Rhodococcus biphenylivorans strain TG9 chromosome, complete genome	5034221	4979218	5030772	5034221	transposase	Mycobacterium_phage(30.77%)	41	NA	NA
AWZ26701.1|4979218_4980532_-|transposase	IS256 family transposase	transposase	A0A2P1JQX9	Mycobacterium_phage	82.1	6.3e-202
AWZ26702.1|4980736_4982050_-|transposase	IS256 family transposase	transposase	A0A2P1JQX9	Mycobacterium_phage	82.1	6.3e-202
AWZ26703.1|4982254_4983568_-|transposase	IS256 family transposase	transposase	A0A2P1JQX9	Mycobacterium_phage	82.1	6.3e-202
AWZ26704.1|4983678_4984392_+	transporter	NA	A0A2H4IY97	uncultured_Caudovirales_phage	36.9	1.8e-41
AWZ26705.1|4984453_4985389_+	enterobactin ABC transporter permease	NA	NA	NA	NA	NA
AWZ26706.1|4985385_4986144_+	iron ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	30.2	6.3e-13
AWZ26707.1|4986156_4986687_-	ribonuclease HI	NA	C7U0K0	Ostreococcus_tauri_virus	45.7	1.4e-22
AWZ26708.1|4986828_4987791_+	DNA-3-methyladenine glycosylase 2 family protein	NA	NA	NA	NA	NA
AWZ26709.1|4987834_4988314_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AWZ27172.1|4988377_4988887_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
AWZ26710.1|4989082_4989682_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AWZ26711.1|4989757_4990597_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
AWZ26712.1|4990627_4991779_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
AWZ26713.1|4991819_4993337_-	acyl-CoA synthetase	NA	A0A1V0SBX8	Catovirus	21.7	1.4e-16
AWZ26714.1|4993394_4994210_-	enoyl-CoA hydratase	NA	NA	NA	NA	NA
AWZ26715.1|4994236_4995085_-	nmra family transcriptional regulator	NA	NA	NA	NA	NA
AWZ26716.1|4995084_4997037_-	hydantoinase	NA	NA	NA	NA	NA
AWZ26717.1|4997033_4999136_-	5-oxoprolinase	NA	NA	NA	NA	NA
AWZ26718.1|4999332_5000010_-	carbon monoxide dehydrogenase	NA	NA	NA	NA	NA
AWZ27173.1|5000006_5002460_-	xanthine dehydrogenase	NA	NA	NA	NA	NA
AWZ26719.1|5002531_5003203_-	ferredoxin	NA	A0A0P0IVM8	Acinetobacter_phage	40.4	2.8e-25
AWZ26720.1|5003199_5004114_-	molybdopterin dehydrogenase	NA	NA	NA	NA	NA
AWZ26721.1|5004201_5005650_-	nitrate reductase	NA	Q9KX94	Enterobacteria_phage	42.1	9.7e-79
AWZ26722.1|5005827_5007552_-	PucR family transcriptional regulator	NA	NA	NA	NA	NA
AWZ26723.1|5007606_5008710_-	XshC-Cox1 family protein	NA	NA	NA	NA	NA
AWZ26724.1|5008731_5010129_-	amidase	NA	NA	NA	NA	NA
AWZ26725.1|5010270_5011446_+	MFS transporter	NA	NA	NA	NA	NA
AWZ27174.1|5011415_5012363_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
AWZ27175.1|5012451_5013423_-	LLM class F420-dependent oxidoreductase	NA	NA	NA	NA	NA
AWZ26726.1|5014615_5015755_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
AWZ27176.1|5016841_5018056_+	cytochrome P450	NA	NA	NA	NA	NA
AWZ26727.1|5018153_5019194_+	oxidoreductase	NA	NA	NA	NA	NA
AWZ26728.1|5019542_5020937_+|transposase	IS1380 family transposase	transposase	A0A222ZN33	Mycobacterium_phage	54.4	1.5e-121
AWZ26729.1|5022070_5023165_-	catechol 2,3-dioxygenase	NA	NA	NA	NA	NA
AWZ26730.1|5023387_5024266_+	acetaldehyde dehydrogenase (acetylating)	NA	G9E526	Ostreococcus_lucimarinus_virus	34.3	3.3e-37
AWZ26731.1|5024262_5025318_+	4-hydroxy-2-oxovalerate aldolase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	33.3	9.0e-42
AWZ26732.1|5025332_5026811_+	5-carboxymethyl-2-hydroxymuconate semialdehyde dehydrogenase	NA	NA	NA	NA	NA
AWZ26733.1|5026898_5027651_+	short-chain dehydrogenase	NA	NA	NA	NA	NA
AWZ26734.1|5027676_5028102_+	4-oxalocrotonate tautomerase	NA	NA	NA	NA	NA
AWZ27177.1|5028169_5028649_-	flavin reductase	NA	NA	NA	NA	NA
AWZ26735.1|5029662_5030772_+|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	41.2	6.3e-62
