The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP021773	Streptococcus agalactiae strain B105 chromosome, complete genome	2273717	373554	385050	2273717	transposase	Streptococcus_phage(90.91%)	15	NA	NA
AWZ35648.1|373554_374265_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.1	5.2e-17
AWZ35649.1|374283_374943_+	CBS domain-containing protein	NA	M1NSC5	Streptococcus_phage	56.0	8.0e-65
AWZ35650.1|375207_376374_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
AWZ35651.1|376582_377218_+	thymidylate kinase	NA	M1PSC7	Streptococcus_phage	61.1	2.8e-67
AWZ35652.1|377237_378101_+	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	49.0	3.1e-72
AWZ35653.1|378130_378457_+	initiation-control protein YabA	NA	M1PFV3	Streptococcus_phage	61.1	3.2e-30
AWZ37350.1|378462_379326_+	rRNA (cytidine-2'-O-)-methyltransferase	NA	M1PLC5	Streptococcus_phage	70.4	3.7e-110
AWZ35654.1|379301_379463_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ35655.1|379447_379552_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ35656.1|379595_380231_-	copper homeostasis protein CutC	NA	NA	NA	NA	NA
AWZ35657.1|380363_381455_+	phosphoserine transaminase	NA	M1Q1P2	Streptococcus_phage	77.1	1.3e-163
AWZ35658.1|381522_382071_+	acetyltransferase	NA	M1PSC3	Streptococcus_phage	58.4	1.1e-54
AWZ35659.1|383348_383825_+	cysteine methyltransferase	NA	M1PFU9	Streptococcus_phage	50.9	7.1e-39
AWZ35660.1|383826_384183_+	arsenate reductase family protein	NA	M1PLC0	Streptococcus_phage	72.6	5.2e-42
AWZ35661.1|384222_385050_-	exodeoxyribonuclease	NA	M1PSC0	Streptococcus_phage	78.0	4.3e-124
>prophage 2
CP021773	Streptococcus agalactiae strain B105 chromosome, complete genome	2273717	646321	708977	2273717	transposase,integrase,protease	Streptococcus_phage(47.83%)	58	703502:703517	712456:712471
AWZ35898.1|646321_648430_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	H6X3M6	Enterobacteria_phage	37.6	4.8e-119
AWZ35899.1|648862_649363_+	50S ribosomal protein L10	NA	NA	NA	NA	NA
AWZ35900.1|649426_649792_+	50S ribosomal protein L7/L12	NA	NA	NA	NA	NA
AWZ37364.1|650051_650225_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ35901.1|650221_651046_+	replication initiator protein	NA	A0A286QNA4	Streptococcus_phage	37.6	5.8e-12
AWZ35902.1|651203_652559_+	DNA (cytosine-5-)-methyltransferase	NA	A0A141E1L1	Streptococcus_phage	55.9	5.8e-126
AWZ35903.1|652542_652971_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ35904.1|652980_653364_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ35905.1|653373_653607_+	transcriptional regulator	NA	NA	NA	NA	NA
AWZ35906.1|653609_654191_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
AWZ35907.1|654267_654756_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ35908.1|654755_656576_+	conjugal transfer protein TraG	NA	NA	NA	NA	NA
AWZ35909.1|656593_656836_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ35910.1|656852_657707_+	conjugal transfer protein TrbL	NA	NA	NA	NA	NA
AWZ35911.1|657768_658122_+	PrgI family protein	NA	NA	NA	NA	NA
AWZ37365.1|658099_660430_+	AAA family ATPase	NA	NA	NA	NA	NA
AWZ35912.1|660426_663231_+	CHAP domain-containing protein	NA	NA	NA	NA	NA
AWZ35913.1|663475_664069_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ35914.1|664312_669217_+	glucan-binding protein	NA	NA	NA	NA	NA
AWZ35915.1|669217_669409_+	calcium-binding protein	NA	NA	NA	NA	NA
AWZ35916.1|669392_669944_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ35917.1|669993_675453_+	hypothetical protein	NA	A0A248SL14	Klebsiella_phage	30.5	8.2e-147
AWZ37366.1|675950_677729_+	reverse transcriptase	NA	A0A0U4J920	Pseudomonas_phage	28.6	8.9e-26
AWZ35918.1|677866_679210_+	helicase	NA	H2DE57	Erwinia_phage	32.5	2.1e-56
AWZ35919.1|679279_679579_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ35920.1|679593_679884_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ35921.1|679994_680633_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
AWZ35922.1|680672_681761_+	DNA primase	NA	NA	NA	NA	NA
AWZ35923.1|681814_682030_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ35924.1|682045_682441_+	chemotaxis protein	NA	NA	NA	NA	NA
AWZ35925.1|682484_682772_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ35926.1|682798_683098_-	hypothetical protein	NA	M1PG86	Streptococcus_phage	59.6	1.5e-26
AWZ35927.1|683084_683453_-	hypothetical protein	NA	A0A1B0RXA8	Streptococcus_phage	63.1	3.7e-35
AWZ37367.1|683449_684865_-	DNA polymerase	NA	M1Q231	Streptococcus_phage	78.1	1.1e-215
AWZ35928.1|685006_685699_-	XRE family transcriptional regulator	NA	A0A1B0RXB1	Streptococcus_phage	74.2	6.0e-95
AWZ37368.1|687722_688562_-|transposase	transposase	transposase	A0A1P8CWQ3	Bacillus_phage	41.1	4.6e-49
AWZ35929.1|688573_688834_-|transposase	IS3 family transposase	transposase	A0A1P8CWP5	Bacillus_phage	38.8	1.7e-10
AWZ37369.1|688864_689653_+	ATP-binding protein	NA	A0A1B1IUG5	uncultured_Mediterranean_phage	29.0	3.4e-09
AWZ35930.1|689852_690053_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ35931.1|690071_690431_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ35932.1|690440_690806_+	plasmid mobilization relaxosome protein MobC	NA	NA	NA	NA	NA
AWZ35933.1|690792_692655_+	relaxase	NA	NA	NA	NA	NA
AWZ35934.1|693435_693606_+	DNA recombinase	NA	A0A1X9I6E4	Streptococcus_phage	98.2	3.7e-22
AWZ35935.1|693991_695209_+	macrolide efflux MFS transporter Mef(A)	NA	A0A2K5B2B5	Erysipelothrix_phage	90.6	5.1e-198
AWZ35936.1|695328_696792_+	ABC-F type ribosomal protection protein Msr(D)	NA	A0A1B0RXA0	Streptococcus_phage	97.3	3.7e-251
AWZ35937.1|697194_697563_-	hypothetical protein	NA	A0A1B0RXA8	Streptococcus_phage	97.5	1.1e-58
AWZ35938.1|697575_697911_-	imsC-like protein	NA	NA	NA	NA	NA
AWZ35939.1|697907_698153_-	hypothetical protein	NA	A0A1B0RXA7	Streptococcus_phage	98.8	2.6e-37
AWZ35940.1|698149_698338_-	type VI secretion protein ImpB	NA	Q6DMX4	Streptococcus_phage	90.7	1.5e-13
AWZ35941.1|699117_699588_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AWZ35942.1|699571_700597_+	aminoglycoside phosphotransferase	NA	NA	NA	NA	NA
AWZ35943.1|700593_702339_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	25.6	1.3e-37
AWZ35944.1|702319_704059_+	ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	28.1	5.1e-18
703502:703517	attL	AATGACGGTCAAATTT	NA	NA	NA	NA
AWZ35945.1|704170_704422_-|transposase	transposase	transposase	NA	NA	NA	NA
AWZ35946.1|704455_704950_+	peptidase	NA	NA	NA	NA	NA
AWZ35947.1|707031_707250_+	transcriptional regulator	NA	A0A1L2BY72	Clostridium_phage	52.5	2.7e-09
AWZ35948.1|707520_707769_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ35949.1|707771_708977_+|integrase	site-specific integrase	integrase	U3PJ31	Staphylococcus_phage	21.4	2.6e-08
712456:712471	attR	AAATTTGACCGTCATT	NA	NA	NA	NA
>prophage 3
CP021773	Streptococcus agalactiae strain B105 chromosome, complete genome	2273717	717542	767381	2273717	transposase,tRNA,integrase,tail	Bacillus_phage(42.86%)	37	712867:712883	775903:775919
712867:712883	attL	TTACGAAATTTTTAAAT	NA	NA	NA	NA
AWZ35958.1|717542_718745_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
AWZ37370.1|718924_720142_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ35959.1|720284_721390_-|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	48.9	6.3e-70
AWZ35960.1|722001_722379_+	chromosome partitioning protein ParA	NA	NA	NA	NA	NA
AWZ35961.1|722447_722678_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ35962.1|722774_723323_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ35963.1|723430_724765_+|transposase	transposase	transposase	NA	NA	NA	NA
AWZ35964.1|725418_728871_+	peptidase C5	NA	A0A218KC60	Bacillus_phage	39.4	7.6e-05
AWZ37371.1|729452_730730_+	group II intron reverse transcriptase/maturase	NA	NA	NA	NA	NA
AWZ35965.1|730963_731884_+	adhesion protein	NA	NA	NA	NA	NA
AWZ35966.1|731896_734365_+	histidine triad (HIT) protein	NA	NA	NA	NA	NA
AWZ35967.1|734563_734797_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ35968.1|736198_737304_-|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	48.9	6.3e-70
AWZ35969.1|737492_738089_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ35970.1|738310_738808_+|tail	phage tail protein	tail	NA	NA	NA	NA
AWZ37372.1|738817_739228_+	VOC family protein	NA	NA	NA	NA	NA
AWZ35971.1|739327_740668_+	MATE family efflux transporter	NA	NA	NA	NA	NA
AWZ35972.1|740726_741494_-	DNA integration/recombination/inversion protein	NA	NA	NA	NA	NA
AWZ35973.1|741652_743434_+	excinuclease ABC subunit C	NA	NA	NA	NA	NA
AWZ35974.1|743508_744853_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	50.4	7.4e-65
AWZ35975.1|746861_747464_+	nitroreductase family protein	NA	NA	NA	NA	NA
AWZ35976.1|747510_748917_+	dipeptidase PepV	NA	NA	NA	NA	NA
AWZ35977.1|749013_749598_+	uracil-DNA glycosylase	NA	NA	NA	NA	NA
AWZ35978.1|749612_750347_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ35979.1|750515_754274_+	pullulanase	NA	NA	NA	NA	NA
AWZ35980.1|755363_755540_-	DUF3042 domain-containing protein	NA	NA	NA	NA	NA
AWZ35981.1|755650_756541_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
AWZ35982.1|756631_757870_+	GTPase HflX	NA	NA	NA	NA	NA
AWZ35983.1|757862_758510_+	cystathionine beta-lyase	NA	NA	NA	NA	NA
AWZ35984.1|758551_759481_+	ribonuclease Z	NA	NA	NA	NA	NA
AWZ35985.1|759482_760244_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
AWZ35986.1|760240_762439_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	29.1	1.2e-72
AWZ35987.1|762508_762607_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ35988.1|762590_765155_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ35989.1|765277_765796_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	44.1	4.6e-31
AWZ35990.1|765913_766594_+	DNA replication protein DnaD	NA	Q938N2	Temperate_phage	31.8	1.9e-08
AWZ35991.1|766697_767381_+|tRNA	tRNA (adenine-N(1))-methyltransferase	tRNA	NA	NA	NA	NA
775903:775919	attR	TTACGAAATTTTTAAAT	NA	NA	NA	NA
>prophage 4
CP021773	Streptococcus agalactiae strain B105 chromosome, complete genome	2273717	1245265	1347227	2273717	terminase,transposase,tRNA,holin,head,portal,protease,tail,capsid	Streptococcus_phage(70.0%)	95	NA	NA
AWZ36413.1|1245265_1245739_+|tRNA	aminoacyl-tRNA deacylase	tRNA	NA	NA	NA	NA
AWZ36414.1|1245760_1246402_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
AWZ36415.1|1246437_1247340_-	HAD family hydrolase	NA	NA	NA	NA	NA
AWZ36416.1|1247514_1249005_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	38.5	7.6e-87
AWZ36417.1|1249079_1249550_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	52.7	1.3e-40
AWZ36418.1|1249564_1250758_-	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	51.0	3.5e-111
AWZ36419.1|1250775_1251426_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	39.9	8.6e-35
AWZ36420.1|1251406_1252516_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase	NA	A0A1V0SE20	Indivirus	37.2	1.2e-55
AWZ36421.1|1253243_1254584_+	divalent metal cation transporter	NA	NA	NA	NA	NA
AWZ36422.1|1254685_1255483_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ36423.1|1255606_1255819_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ36424.1|1255945_1257232_-|protease	collagenase-like protease	protease	Q6DW11	Phage_TP	32.4	1.9e-41
AWZ36425.1|1257361_1258288_-	peptidase U32	NA	NA	NA	NA	NA
AWZ36426.1|1258630_1258906_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ36427.1|1258946_1259378_-	YtxH domain-containing protein	NA	NA	NA	NA	NA
AWZ36428.1|1259374_1259773_-	DUF948 domain containing protein	NA	NA	NA	NA	NA
AWZ36429.1|1259787_1260561_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
AWZ36430.1|1260553_1261489_-	HPr kinase/phosphorylase	NA	NA	NA	NA	NA
AWZ36431.1|1261604_1261739_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ36432.1|1261716_1261980_-	phage shock protein C	NA	NA	NA	NA	NA
AWZ37384.1|1262060_1262489_-	M48 family peptidase	NA	U5J9G1	Bacillus_phage	26.2	2.7e-05
AWZ37385.1|1262481_1264644_-	RNA-binding transcriptional accessory protein	NA	NA	NA	NA	NA
AWZ36433.1|1264747_1265791_-	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
AWZ36434.1|1265923_1266052_+	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
AWZ36435.1|1266057_1266960_+	ABC transporter permease	NA	NA	NA	NA	NA
AWZ36436.1|1266959_1267772_+	TIGR03943 family protein	NA	NA	NA	NA	NA
AWZ36437.1|1269664_1271242_-	signal recognition particle-docking protein FtsY	NA	NA	NA	NA	NA
AWZ36438.1|1271241_1272066_-	HAD family phosphatase	NA	NA	NA	NA	NA
AWZ37386.1|1272065_1272863_-	HAD family hydrolase	NA	NA	NA	NA	NA
AWZ36439.1|1272982_1274548_-	recombinase family protein	NA	Q6DMS5	Streptococcus_phage	61.5	8.0e-180
AWZ36440.1|1274550_1275759_-	recombinase family protein	NA	Q6DMS6	Streptococcus_phage	49.7	1.8e-102
AWZ36441.1|1275973_1276375_-	RNA polymerase subunit sigma-70	NA	NA	NA	NA	NA
AWZ36442.1|1276484_1277954_-	peptidoglycan-binding protein LysM	NA	A0A1X9I678	Streptococcus_phage	78.9	1.8e-226
AWZ36443.1|1277955_1278360_-|holin	holin	holin	D0R0E9	Streptococcus_phage	74.8	3.0e-46
AWZ36444.1|1278377_1280234_-	hypothetical protein	NA	Q6DMS9	Streptococcus_phage	73.3	2.5e-257
AWZ36445.1|1280246_1283162_-	carbamoylsarcosine amidase	NA	Q6DMT0	Streptococcus_phage	64.8	0.0e+00
AWZ36446.1|1283161_1283887_-|tail	phage tail protein	tail	Q6DMT1	Streptococcus_phage	57.9	1.4e-81
AWZ36447.1|1283883_1287003_-|tail	phage tail tape measure protein	tail	Q6DMT2	Streptococcus_phage	76.7	2.0e-254
AWZ36448.1|1287185_1287605_-	hypothetical protein	NA	A0A1X9I691	Streptococcus_phage	76.3	1.3e-55
AWZ36449.1|1287616_1288186_-|tail	phage tail protein	tail	A0A1B0RXE2	Streptococcus_phage	93.6	1.5e-96
AWZ36450.1|1288188_1288515_-	hypothetical protein	NA	M1Q1Z4	Streptococcus_phage	69.4	8.3e-39
AWZ36451.1|1288523_1288892_-	hypothetical protein	NA	Q6DMT7	Streptococcus_phage	62.9	7.0e-34
AWZ36452.1|1288884_1289223_-|head,tail	head-tail adaptor protein	head,tail	A0A1B0RXJ6	Streptococcus_phage	70.5	4.3e-38
AWZ36453.1|1289222_1289480_-|head,tail	phage gp6-like head-tail connector protein	head,tail	D0R0D7	Streptococcus_phage	78.8	9.5e-30
AWZ36454.1|1289476_1290685_-|capsid	phage major capsid protein	capsid	E4ZFM5	Streptococcus_phage	91.3	1.0e-211
AWZ36455.1|1290697_1291396_-	peptidase	NA	A0A1B0RXE1	Streptococcus_phage	83.6	5.8e-106
AWZ36456.1|1291388_1292684_-|portal	phage portal protein	portal	A0A1B0RXD8	Streptococcus_phage	89.3	8.0e-226
AWZ36457.1|1292752_1292956_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ36458.1|1293025_1293364_-	RelE/ParE family toxin	NA	NA	NA	NA	NA
AWZ36459.1|1293356_1293650_-	antitoxin	NA	NA	NA	NA	NA
AWZ36460.1|1293716_1295309_-|terminase	terminase	terminase	A0A1B0RXJ8	Streptococcus_phage	95.8	6.0e-308
AWZ36461.1|1295305_1295779_-|terminase	terminase	terminase	A0A1X9I6K0	Streptococcus_phage	96.8	1.5e-84
AWZ36462.1|1295827_1296277_-	DUF4314 domain-containing protein	NA	A0A1X9I6A3	Streptococcus_phage	67.1	4.1e-20
AWZ36463.1|1296278_1296530_-	hypothetical protein	NA	M1PG57	Streptococcus_phage	59.3	5.8e-16
AWZ36464.1|1296591_1297872_-	DNA (cytosine-5-)-methyltransferase	NA	M1NSK8	Streptococcus_phage	92.3	2.2e-231
AWZ36465.1|1297868_1299125_-	DNA modification methylase	NA	A0A1B0RXE5	Streptococcus_phage	90.9	3.0e-225
AWZ36466.1|1299096_1299552_-	hypothetical protein	NA	M1Q209	Streptococcus_phage	50.3	1.0e-42
AWZ37387.1|1299840_1300206_-	HNH endonuclease	NA	A0A1B0RXJ3	Streptococcus_phage	88.4	3.2e-63
AWZ36467.1|1301292_1301475_-	hypothetical protein	NA	A0A1B0RXC3	Streptococcus_phage	86.7	1.7e-20
AWZ36468.1|1301669_1302146_-	hypothetical protein	NA	A0A1B0RXB9	Streptococcus_phage	84.2	3.2e-71
AWZ36469.1|1302138_1303515_-	ATP-dependent helicase	NA	A0A1X9I6B0	Streptococcus_phage	86.7	1.6e-232
AWZ36470.1|1303495_1303777_-	nuclease	NA	M1PFY8	Streptococcus_phage	83.9	1.1e-39
AWZ36471.1|1304057_1306346_-	DNA primase	NA	A0A1B0RXC5	Streptococcus_phage	87.9	0.0e+00
AWZ36472.1|1306704_1307028_+	hypothetical protein	NA	D0R0B4	Streptococcus_phage	72.9	8.8e-33
AWZ36473.1|1307020_1308142_+	DUF2800 domain-containing protein	NA	M1Q218	Streptococcus_phage	90.9	3.5e-201
AWZ36474.1|1308146_1308710_+	hypothetical protein	NA	A0A1B0RXA9	Streptococcus_phage	92.8	1.5e-91
AWZ37388.1|1308944_1310900_+	hypothetical protein	NA	E4ZFK1	Streptococcus_phage	86.0	0.0e+00
AWZ36475.1|1310961_1311504_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ36476.1|1311665_1312262_-	hypothetical protein	NA	A0A1B0RXB3	Streptococcus_phage	27.9	4.6e-11
AWZ36477.1|1312694_1313819_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ36478.1|1313818_1314043_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ37389.1|1314813_1315692_+	ATPase	NA	NA	NA	NA	NA
AWZ36479.1|1315681_1315891_+	transcriptional regulator	NA	A0A2K5B263	Erysipelothrix_phage	58.5	4.8e-16
AWZ36480.1|1316149_1316500_+|transposase	transposase	transposase	NA	NA	NA	NA
AWZ36481.1|1316553_1316739_+|transposase	transposase	transposase	NA	NA	NA	NA
AWZ36482.1|1316710_1317982_+|transposase	transposase	transposase	NA	NA	NA	NA
AWZ36483.1|1318262_1325591_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ36484.1|1325824_1327075_+	YSIRK-targeted surface antigen transcriptional regulator	NA	NA	NA	NA	NA
AWZ36485.1|1327383_1328016_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ36486.1|1328583_1329885_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ36487.1|1330141_1330660_-	ClbS/DfsB family four-helix bundle protein	NA	NA	NA	NA	NA
AWZ36488.1|1331538_1335078_-	chromosome segregation protein SMC	NA	NA	NA	NA	NA
AWZ36489.1|1335085_1335772_-	ribonuclease 3	NA	A0A167RGU4	Powai_lake_megavirus	29.9	3.3e-21
AWZ36490.1|1335946_1336315_-	DUF454 domain-containing protein	NA	NA	NA	NA	NA
AWZ36491.1|1336317_1337127_-	MBL fold metallo-hydrolase	NA	A0A0C5AJ83	Bacteriophage	37.6	2.5e-39
AWZ36492.1|1337130_1338480_-	cell wall metabolism sensor histidine kinase VicK	NA	W8CYF6	Bacillus_phage	33.8	2.7e-35
AWZ36493.1|1338472_1339183_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	38.5	3.1e-38
AWZ36494.1|1339522_1340278_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	41.7	5.6e-38
AWZ36495.1|1340289_1341090_+	glutamine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AWZ36496.1|1341102_1341798_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
AWZ36497.1|1341809_1342460_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
AWZ36498.1|1342508_1343075_-	peptidase	NA	NA	NA	NA	NA
AWZ36499.1|1343241_1344261_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ36500.1|1344358_1345063_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	33.6	1.3e-31
AWZ36501.1|1345283_1347227_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.9	7.5e-119
>prophage 5
CP021773	Streptococcus agalactiae strain B105 chromosome, complete genome	2273717	1434172	1446550	2273717	transposase	Streptococcus_phage(92.86%)	18	NA	NA
AWZ36575.1|1434172_1435039_-	aminoglycoside 6-adenylyltransferase AadE	NA	E4ZFP8	Streptococcus_phage	63.7	7.5e-103
AWZ36576.1|1435214_1435760_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ36577.1|1435811_1435970_-	zeta-toxin	NA	NA	NA	NA	NA
AWZ36578.1|1435971_1436244_-	antitoxin	NA	A0A1X9I6E5	Streptococcus_phage	100.0	5.0e-05
AWZ36579.1|1436261_1436477_-	peptide-binding protein	NA	A0A1X9I6D5	Streptococcus_phage	97.1	4.2e-31
AWZ36580.1|1436568_1437465_-	chromosome partitioning protein ParA	NA	A0A1X9I765	Streptococcus_phage	99.3	1.9e-154
AWZ37395.1|1437553_1437838_-	topoisomerase	NA	A0A1X9I6W8	Streptococcus_phage	93.0	2.3e-40
AWZ36581.1|1437847_1437979_-	hypothetical protein	NA	E4ZFP9	Streptococcus_phage	90.7	8.2e-14
AWZ36582.1|1437983_1438721_-	23S rRNA (adenine(2058)-N(6))-methyltransferase Erm(B)	NA	E4ZFQ0	Streptococcus_phage	99.6	1.4e-134
AWZ36583.1|1438845_1438929_-	23S rRNA methyltransferase attenuator leader peptide ErmL	NA	NA	NA	NA	NA
AWZ36584.1|1439470_1440265_-	aminoglycoside O-phosphotransferase APH(3')-IIIa	NA	E4ZFP6	Streptococcus_phage	100.0	2.3e-154
AWZ36585.1|1440767_1441930_-|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	53.7	9.2e-80
AWZ36586.1|1442003_1442210_-	streptothricin acetyltransferase	NA	A0A1B0RXL7	Streptococcus_phage	100.0	4.8e-24
AWZ36587.1|1442206_1443115_-	aminoglycoside nucleotidyltransferase ANT(6)-Ia	NA	E4ZFP8	Streptococcus_phage	100.0	2.8e-177
AWZ36588.1|1443147_1443882_-	methyltransferase	NA	A0A1X9I6N4	Streptococcus_phage	100.0	1.5e-141
AWZ36589.1|1443862_1444732_-	hypothetical protein	NA	A0A1X9I6C9	Streptococcus_phage	90.7	6.7e-152
AWZ36590.1|1444746_1444971_-	transcriptional regulator	NA	NA	NA	NA	NA
AWZ36591.1|1445470_1446550_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	33.5	1.6e-38
>prophage 6
CP021773	Streptococcus agalactiae strain B105 chromosome, complete genome	2273717	1449782	1467874	2273717		Streptococcus_phage(50.0%)	19	NA	NA
AWZ37397.1|1449782_1450361_-	DNA recombinase	NA	A0A2K5B2B4	Erysipelothrix_phage	31.4	5.3e-20
AWZ36594.1|1450428_1450887_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ37398.1|1450937_1451189_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ36595.1|1452346_1452874_-	adenine phosphoribosyltransferase	NA	A0A1X9I6E2	Streptococcus_phage	100.0	1.9e-93
AWZ36596.1|1452917_1453781_-	aminoglycoside nucleotidyltransferase ANT(6)-Ia	NA	A0A1X9I6F2	Streptococcus_phage	100.0	8.7e-168
AWZ36597.1|1453813_1454548_-	methyltransferase	NA	A0A1X9I6N4	Streptococcus_phage	100.0	1.5e-141
AWZ36598.1|1454528_1455398_-	hypothetical protein	NA	A0A1X9I6C9	Streptococcus_phage	92.0	1.2e-153
AWZ36599.1|1455412_1455637_-	transcriptional regulator	NA	NA	NA	NA	NA
AWZ37399.1|1455779_1457324_-	recombinase family protein	NA	A0A2K5B2B4	Erysipelothrix_phage	88.7	2.3e-256
AWZ36600.1|1457343_1457760_-	recombinase	NA	A0A2K5B2B3	Erysipelothrix_phage	98.6	1.2e-71
AWZ37400.1|1457760_1458057_-	DNA recombinase	NA	A0A2K5B2B2	Erysipelothrix_phage	91.8	4.6e-44
AWZ36601.1|1459261_1459864_-	Pin-related site-specific recombinase/DNA invertase	NA	A0A219YA40	Aeromonas_phage	38.3	5.7e-17
AWZ36602.1|1460250_1460424_-	conjugal transfer protein	NA	D0R0F6	Streptococcus_phage	100.0	4.6e-28
AWZ36603.1|1460475_1462395_-	tetracycline resistance ribosomal protection protein Tet(O)	NA	A0A1B0RXH7	Streptococcus_phage	99.7	0.0e+00
AWZ36604.1|1462761_1463136_-	TnpV protein	NA	D0R0F4	Streptococcus_phage	99.2	1.3e-67
AWZ36605.1|1463940_1464231_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ36606.1|1464244_1464544_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ36607.1|1464614_1465958_-	ATP-dependent helicase	NA	H2DE57	Erwinia_phage	31.6	8.2e-56
AWZ37401.1|1466095_1467874_-	reverse transcriptase	NA	A0A0U4J920	Pseudomonas_phage	28.6	8.9e-26
>prophage 7
CP021773	Streptococcus agalactiae strain B105 chromosome, complete genome	2273717	1793873	1846116	2273717	transposase,tRNA,holin,integrase,bacteriocin	Paramecium_bursaria_Chlorella_virus(12.5%)	47	1837608:1837624	1841184:1841200
AWZ36902.1|1793873_1794179_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
AWZ36903.1|1794390_1796376_-	transketolase	NA	NA	NA	NA	NA
AWZ36904.1|1796500_1797931_-	trans-acting positive regulator	NA	NA	NA	NA	NA
AWZ36905.1|1797921_1799259_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
AWZ36906.1|1799346_1800045_-	aquaporin family protein	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	35.9	3.9e-33
AWZ36907.1|1800056_1801886_-	glycerol-3-phosphate dehydrogenase/oxidase	NA	NA	NA	NA	NA
AWZ36908.1|1801898_1803407_-	glycerol kinase	NA	NA	NA	NA	NA
AWZ36909.1|1803521_1803785_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ36910.1|1803873_1804131_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ36911.1|1804142_1806182_-|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
AWZ36912.1|1806185_1806827_-	FMN-dependent NADH-azoreductase	NA	NA	NA	NA	NA
AWZ36913.1|1806826_1807741_-|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
AWZ36914.1|1808053_1808596_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ36915.1|1808713_1809862_-	N-acetylglucosamine-6-phosphate deacetylase	NA	NA	NA	NA	NA
AWZ36916.1|1810139_1810847_-	peptidase	NA	NA	NA	NA	NA
AWZ36917.1|1811037_1811349_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
AWZ37409.1|1811525_1812053_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ36918.1|1812316_1813033_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	32.0	1.2e-26
AWZ36919.1|1813035_1814133_+	ABC transporter permease	NA	NA	NA	NA	NA
AWZ36920.1|1814156_1814765_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AWZ36921.1|1814899_1815061_-	lipoprotein	NA	NA	NA	NA	NA
AWZ36922.1|1815344_1815836_+	RNA polymerase sigma factor	NA	NA	NA	NA	NA
AWZ36923.1|1815832_1816780_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ37410.1|1817039_1817720_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AWZ36924.1|1818445_1819006_-	acetyltransferase	NA	NA	NA	NA	NA
AWZ36925.1|1819453_1819804_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ36926.1|1819813_1820086_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ36927.1|1820104_1821739_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ36928.1|1821802_1822261_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ36929.1|1828946_1830092_+	glycine/betaine ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	31.7	1.9e-13
AWZ36930.1|1830091_1830727_+|holin	choline ABC transporter permease	holin	NA	NA	NA	NA
AWZ36931.1|1830729_1831656_+	osmoprotectant ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AWZ37411.1|1831665_1832307_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
AWZ36932.1|1832368_1833550_-	MFS transporter	NA	NA	NA	NA	NA
AWZ37412.1|1833622_1834246_-	MutR family transcriptional regulator	NA	NA	NA	NA	NA
AWZ36933.1|1834254_1834476_-	transcriptional regulator	NA	NA	NA	NA	NA
AWZ36934.1|1834475_1834601_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ36935.1|1834597_1834702_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ36936.1|1835338_1836775_-	ATP-dependent DNA helicase	NA	A0A1B3AYT3	Gordonia_phage	34.8	9.3e-66
AWZ36937.1|1836816_1837503_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	100.0	4.1e-128
1837608:1837624	attL	TTGGTTCCTCAAGACCC	NA	NA	NA	NA
AWZ37413.1|1838262_1838793_-	restriction endonuclease	NA	A0A1V0SLK8	Klosneuvirus	34.6	1.1e-16
AWZ36938.1|1838875_1839673_-|integrase	integrase	integrase	A0A0H4TI16	Erysipelothrix_phage	29.2	1.2e-19
AWZ36939.1|1839721_1841254_-	type I restriction endonuclease	NA	NA	NA	NA	NA
1841184:1841200	attR	GGGTCTTGAGGAACCAA	NA	NA	NA	NA
AWZ36940.1|1841253_1842717_-	SAM-dependent DNA methyltransferase	NA	NA	NA	NA	NA
AWZ36941.1|1842729_1845054_-	restriction endonuclease subunit R	NA	Q5YA94	Bacillus_phage	28.2	6.4e-24
AWZ36942.1|1845397_1845754_-|transposase	transposase	transposase	NA	NA	NA	NA
AWZ36943.1|1845750_1846116_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 8
CP021773	Streptococcus agalactiae strain B105 chromosome, complete genome	2273717	2033643	2045707	2273717		Streptomyces_phage(14.29%)	8	NA	NA
AWZ37124.1|2033643_2034948_-	peptigoglycan-binding protein LysM	NA	A0A2D1GNZ3	Streptomyces_phage	40.5	1.7e-05
AWZ37125.1|2035094_2035994_-	zoocin A	NA	A0A221J6U0	Arthrobacter_phage	45.9	4.1e-19
AWZ37126.1|2036186_2037734_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/inosine monophosphate cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	48.9	2.5e-77
AWZ37127.1|2037753_2038506_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AWZ37128.1|2038528_2039077_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	35.6	4.0e-25
AWZ37129.1|2039243_2040266_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	42.7	2.0e-62
AWZ37130.1|2040293_2041748_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	32.7	3.7e-54
AWZ37131.1|2041981_2045707_-	phosphoribosylformylglycinamidine synthase	NA	A6N228	Microbacterium_phage	26.0	4.3e-38
>prophage 9
CP021773	Streptococcus agalactiae strain B105 chromosome, complete genome	2273717	2121230	2137401	2273717	integrase	Streptococcus_phage(71.43%)	27	2123809:2123828	2138216:2138235
AWZ37188.1|2121230_2122586_+	replicative DNA helicase	NA	A0A1P8VVQ6	Streptococcus_phage	62.6	1.2e-152
AWZ37189.1|2122597_2122885_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ37190.1|2123214_2123826_+	30S ribosomal protein S4	NA	NA	NA	NA	NA
2123809:2123828	attL	TACAACAAAATGCTTTAATT	NA	NA	NA	NA
AWZ37191.1|2123932_2125105_-|integrase	site-specific integrase	integrase	A0A1X9I5Y5	Streptococcus_phage	70.1	5.7e-154
AWZ37192.1|2125436_2126402_-	hypothetical protein	NA	A0A0N9RUA4	Staphylococcus_phage	51.1	7.1e-86
AWZ37193.1|2126428_2126770_-	hypothetical protein	NA	A0A1S5SDB5	Streptococcus_phage	59.7	2.2e-13
AWZ37194.1|2126781_2126967_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ37195.1|2127480_2127768_-	hypothetical protein	NA	A0A286QMZ8	Streptococcus_phage	61.4	1.9e-10
AWZ37196.1|2127779_2128394_-	transcriptional regulator	NA	A0A1X9I723	Streptococcus_phage	68.7	2.6e-17
AWZ37197.1|2128599_2128800_+	transcriptional regulator	NA	NA	NA	NA	NA
AWZ37198.1|2128823_2129444_+	phage repressor protein	NA	A0A1W6JPC3	Staphylococcus_phage	43.8	2.2e-40
AWZ37199.1|2129443_2129713_+	phage antirepressor protein	NA	NA	NA	NA	NA
AWZ37200.1|2129935_2130574_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ37201.1|2130672_2130846_+	CopG family transcriptional regulator	NA	NA	NA	NA	NA
AWZ37202.1|2130934_2131441_+	hypothetical protein	NA	A0A1X9I5V7	Streptococcus_phage	34.4	2.2e-06
AWZ37203.1|2131529_2131862_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ37423.1|2131861_2132053_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ37204.1|2132064_2132427_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ37205.1|2132423_2132765_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ37206.1|2132757_2133030_+	transcriptional regulator	NA	A0A1X9I5U9	Streptococcus_phage	69.8	2.5e-28
AWZ37424.1|2133198_2134020_+	DNA replication protein DnaD	NA	R9QM95	Lactococcus_phage	68.7	1.2e-30
AWZ37207.1|2134100_2134706_+	hypothetical protein	NA	A0A1X9I5U4	Streptococcus_phage	47.3	1.4e-39
AWZ37208.1|2134790_2135279_+	hypothetical protein	NA	A0A1X9I5V2	Streptococcus_phage	56.2	7.3e-47
AWZ37209.1|2135474_2135654_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ37210.1|2135677_2136040_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ37211.1|2136014_2136401_+	ArpU family transcriptional regulator	NA	A0A141E173	Streptococcus_phage	32.8	1.8e-08
AWZ37212.1|2136894_2137401_+	hypothetical protein	NA	D7RWK7	Brochothrix_phage	48.8	3.0e-35
2138216:2138235	attR	TACAACAAAATGCTTTAATT	NA	NA	NA	NA
