The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	0	2283	4614212		Escherichia_phage(100.0%)	1	NA	NA
AWY88095.1|0_2283_+	replication endonuclease	NA	M1SV59	Escherichia_phage	91.3	0.0e+00
>prophage 2
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	8231	22991	4614212	plate,tail	Escherichia_phage(41.67%)	14	NA	NA
AWY88099.1|8231_8867_+|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	98.1	2.9e-112
AWY88100.1|8863_9211_+|plate	baseplate assembly protein	plate	A0A0F7LDQ1	Escherichia_phage	99.1	1.1e-57
AWY88101.1|9215_10124_+|plate	baseplate assembly protein	plate	U5N3T9	Enterobacteria_phage	99.3	8.3e-161
AWY88102.1|10116_10647_+|tail	phage tail protein I	tail	Q858V5	Yersinia_virus	99.4	1.3e-102
AWY88103.1|10657_13516_+	hypothetical protein	NA	A0A0A0YPY9	Escherichia_phage	76.7	0.0e+00
AWY88104.1|13727_14840_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
AWY88105.1|16081_16264_-	hypothetical protein	NA	A0A0F7LCJ0	Escherichia_phage	81.6	2.4e-11
AWY88106.1|16283_17474_+|tail	phage tail protein	tail	Q858V1	Yersinia_virus	98.2	2.6e-223
AWY88107.1|17486_18266_+	hypothetical protein	NA	A0A0F7LDR0	Escherichia_phage	98.8	1.9e-73
AWY88108.1|18311_18566_+	DNA-binding transcriptional regulator	NA	A0A0F7LDQ9	Escherichia_phage	100.0	6.1e-45
AWY88109.1|18838_20200_-	peptidase	NA	Q6DW11	Phage_TP	99.7	1.9e-217
AWY88110.1|20345_20678_-	DUF1508 domain-containing protein	NA	NA	NA	NA	NA
AWY88111.1|20868_21591_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	33.6	3.7e-31
AWY88112.1|21587_22991_-	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	29.0	3.0e-32
>prophage 3
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	36762	38115	4614212		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
AWY88120.1|36762_38115_-	molecular chaperone	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	21.1	1.9e-07
>prophage 4
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	42832	53223	4614212		Catovirus(20.0%)	8	NA	NA
AWY88123.1|42832_43474_+	uridine kinase	NA	A0A1V0SAA3	Catovirus	36.9	3.2e-34
AWY88124.1|43565_44147_+	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	42.1	1.8e-31
AWY88125.1|44168_46022_+	outer membrane assembly protein AsmA	NA	NA	NA	NA	NA
AWY88126.1|46295_47879_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	42.6	7.2e-35
AWY88127.1|48537_49677_+	lipoprotein	NA	NA	NA	NA	NA
AWY88128.1|49682_50126_+	protein-tyrosine-phosphatase	NA	NA	NA	NA	NA
AWY88129.1|50128_52291_+	tyrosine-protein kinase Wzc	NA	A0A1X9I5D6	Streptococcus_phage	30.3	1.9e-17
AWY88130.1|52383_53223_+	colanic acid biosynthesis glycosyltransferase WcaA	NA	A0A0F7L2F7	uncultured_marine_virus	34.8	4.4e-07
>prophage 5
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	57467	64261	4614212		Synechococcus_phage(25.0%)	6	NA	NA
AWY88136.1|57467_58589_+	GDP-mannose 4,6-dehydratase	NA	M4QRT5	Synechococcus_phage	64.9	1.5e-132
AWY88137.1|58591_59557_+	GDP-fucose synthetase	NA	D1LW79	Prochlorococcus_phage	51.1	1.3e-87
AWY88138.1|59559_60039_+	GDP-mannose mannosyl hydrolase	NA	NA	NA	NA	NA
AWY88139.1|60035_61259_+	colanic acid biosynthesis glycosyltransferase WcaI	NA	NA	NA	NA	NA
AWY88140.1|61261_62698_+	mannose-1-phosphate guanyltransferase	NA	A0A1V0SH58	Hokovirus	29.2	7.4e-47
AWY88141.1|62890_64261_+	phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	27.5	2.2e-32
>prophage 6
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	69859	78716	4614212		Enterobacteria_phage(42.86%)	8	NA	NA
AWY88146.1|69859_71254_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	33.5	1.3e-19
AWY88147.1|71428_72322_+	UTP--glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	42.0	1.0e-46
AWY88148.1|72694_73780_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	3.9e-101
AWY88149.1|73779_74679_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.5	8.2e-28
AWY88150.1|74737_75616_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.1	8.7e-107
AWY88151.1|75620_76166_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	53.9	1.6e-47
AWY88152.1|76169_77594_+	lipopolysaccharide biosynthesis protein	NA	NA	NA	NA	NA
AWY88153.1|77603_78716_+	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	A0A0P0YLZ6	Yellowstone_lake_phycodnavirus	25.7	1.3e-14
>prophage 7
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	84731	90538	4614212		Hokovirus(25.0%)	4	NA	NA
AWY88160.1|84731_86156_+	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	31.7	8.4e-59
AWY88161.1|86189_87554_+	phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	27.8	2.9e-32
AWY88162.1|87717_89124_+	phosphogluconate dehydrogenase (NADP(+)-dependent, decarboxylating)	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.6	2.8e-38
AWY88163.1|89371_90538_+	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	52.2	1.7e-110
>prophage 8
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	97893	98793	4614212		Cellulophaga_phage(100.0%)	1	NA	NA
AWY88171.1|97893_98793_-	ATP phosphoribosyltransferase	NA	A0A0F7Q4B0	Cellulophaga_phage	92.1	7.0e-11
>prophage 9
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	105996	107163	4614212		Stx2-converting_phage(100.0%)	1	NA	NA
AWY88178.1|105996_107163_+	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	98.7	5.5e-226
>prophage 10
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	138089	138620	4614212		Escherichia_phage(100.0%)	1	NA	NA
AWY88200.1|138089_138620_-	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	100.0	1.9e-56
>prophage 11
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	142164	142836	4614212		Bacillus_phage(100.0%)	1	NA	NA
AWY92306.1|142164_142836_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	35.2	5.4e-32
>prophage 12
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	155923	157438	4614212		Cedratvirus(100.0%)	1	NA	NA
AWY88219.1|155923_157438_+	arabinose import ATP-binding protein AraG	NA	A0A285PWH2	Cedratvirus	29.7	1.3e-12
>prophage 13
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	167525	173169	4614212		uncultured_Caudovirales_phage(50.0%)	5	NA	NA
AWY88230.1|167525_169187_+	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.3	1.7e-10
AWY88231.1|169232_170834_+	methyl-accepting chemotaxis protein IV	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.7	8.3e-15
AWY88232.1|170852_171713_+	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
AWY88233.1|171715_172765_+	chemotaxis response regulator protein-glutamate methylesterase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	1.0e-05
AWY88234.1|172779_173169_+	two-component system response regulator	NA	A0A2K9L4R0	Tupanvirus	32.0	1.3e-06
>prophage 14
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	178421	180155	4614212	tRNA	Tupanvirus(100.0%)	1	NA	NA
AWY88240.1|178421_180155_-|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.5	3.4e-86
>prophage 15
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	186771	188822	4614212		Synechococcus_phage(50.0%)	3	NA	NA
AWY88246.1|186771_187515_-	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.6e-24
AWY88247.1|187555_187951_-	hypothetical protein	NA	NA	NA	NA	NA
AWY88248.1|188003_188822_-	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	99.2	6.5e-72
>prophage 16
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	192840	200098	4614212		Bacillus_virus(50.0%)	9	NA	NA
AWY88253.1|192840_193362_+	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.0e-10
AWY88254.1|193363_193966_-	hypothetical protein	NA	NA	NA	NA	NA
AWY92307.1|194036_194102_+	hypothetical protein	NA	NA	NA	NA	NA
AWY88255.1|194240_194852_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
AWY88256.1|194860_195871_+	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.5	5.6e-09
AWY88257.1|196211_196997_-	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
AWY88258.1|196993_197749_-	zinc ABC transporter ATP-binding protein ZnuC	NA	G3M9Y6	Bacillus_virus	28.3	1.3e-18
AWY92308.1|197827_198760_+	zinc ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AWY88259.1|198775_200098_+	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	40.9	1.2e-14
>prophage 17
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	204096	205572	4614212		Cyanophage(100.0%)	1	NA	NA
AWY88263.1|204096_205572_+	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	37.3	9.9e-79
>prophage 18
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	213628	218097	4614212		Klebsiella_phage(33.33%)	7	NA	NA
AWY88271.1|213628_214291_-	DNA polymerase III subunit epsilon	NA	Q6UAU3	Klebsiella_phage	41.6	2.0e-07
AWY88272.1|214314_214971_-	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
AWY88273.1|215072_215303_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	1.3e-14
AWY88274.1|215441_215816_+	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
AWY88275.1|215819_216692_+	hypothetical protein	NA	NA	NA	NA	NA
AWY88276.1|216704_217046_+	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
AWY88277.1|217440_218097_+	serine/threonine-protein phosphatase 1	NA	A0A222YWF0	Escherichia_phage	50.2	3.1e-56
>prophage 19
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	225593	227642	4614212		Moraxella_phage(100.0%)	1	NA	NA
AWY88283.1|225593_227642_+	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.5	6.8e-86
>prophage 20
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	232972	233182	4614212		Morganella_phage(100.0%)	1	NA	NA
AWY88291.1|232972_233182_+	cold-shock protein CspC	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
>prophage 21
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	238822	240379	4614212		Moraxella_phage(100.0%)	1	NA	NA
AWY88300.1|238822_240379_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	45.4	1.7e-41
>prophage 22
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	244241	252348	4614212	tRNA	Pandoravirus(33.33%)	9	NA	NA
AWY88304.1|244241_245603_-	aminodeoxychorismate synthase component 1	NA	S4VT78	Pandoravirus	33.4	3.4e-41
AWY88305.1|245676_245856_+	YoaH family protein	NA	NA	NA	NA	NA
AWY88306.1|245975_246335_-	DUF1889 domain-containing protein	NA	NA	NA	NA	NA
AWY88307.1|246525_246720_+	hypothetical protein	NA	NA	NA	NA	NA
AWY92313.1|246697_247042_-	hypothetical protein	NA	NA	NA	NA	NA
AWY88308.1|247173_249084_+	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	31.9	4.5e-92
AWY88309.1|249141_249837_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
AWY88310.1|249876_250458_+	hypothetical protein	NA	NA	NA	NA	NA
AWY88311.1|250662_252348_+	long-chain-fatty-acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	26.0	1.5e-35
>prophage 23
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	268226	272803	4614212		Bacillus_phage(100.0%)	3	NA	NA
AWY88330.1|268226_269717_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	30.6	4.9e-09
AWY88331.1|269897_271373_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
AWY88332.1|271519_272803_-	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	36.3	7.6e-11
>prophage 24
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	276121	276976	4614212		Indivirus(100.0%)	1	NA	NA
AWY88334.1|276121_276976_+	aldo/keto reductase	NA	A0A1V0SDE7	Indivirus	24.6	2.5e-10
>prophage 25
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	285786	289872	4614212		Staphylococcus_phage(50.0%)	4	NA	NA
AWY88344.1|285786_286767_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	22.0	7.9e-08
AWY88345.1|286903_287662_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
AWY88346.1|287779_289138_+	MFS transporter	NA	NA	NA	NA	NA
AWY88347.1|289230_289872_-	bifunctional pyrazinamidase/nicotinamidase	NA	A0A2K9L2K0	Tupanvirus	34.9	2.2e-19
>prophage 26
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	294798	296760	4614212		Streptococcus_phage(100.0%)	1	NA	NA
AWY88354.1|294798_296760_+	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	29.2	3.2e-40
>prophage 27
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	302358	303012	4614212		Bacillus_phage(100.0%)	1	NA	NA
AWY88361.1|302358_303012_-	sulfate ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	31.0	5.1e-11
>prophage 28
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	309739	310960	4614212		Klosneuvirus(100.0%)	1	NA	NA
AWY88369.1|309739_310960_+	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	27.1	5.5e-27
>prophage 29
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	318436	319264	4614212		Bacillus_virus(100.0%)	1	NA	NA
AWY88377.1|318436_319264_-	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	54.9	2.0e-73
>prophage 30
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	325593	327855	4614212		Tupanvirus(100.0%)	1	NA	NA
AWY88385.1|325593_327855_-	catalase HPII	NA	A0A2K9L572	Tupanvirus	48.5	2.3e-143
>prophage 31
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	339149	358688	4614212	tRNA	Tupanvirus(22.22%)	19	NA	NA
AWY88399.1|339149_341078_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.3	9.4e-130
AWY88400.1|341081_341624_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.9	6.3e-15
AWY88401.1|341720_341918_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
AWY88402.1|341970_342327_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
AWY92319.1|342449_342494_+|tRNA	phenylalanyl--tRNA ligase operon leader peptide	tRNA	NA	NA	NA	NA
AWY88403.1|342777_343761_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.4e-33
AWY88404.1|343775_346163_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
AWY88405.1|346167_346467_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
AWY88406.1|346567_347548_+	vitamin B12 import system permease BtuC	NA	NA	NA	NA	NA
AWY88407.1|347610_348162_+	glutathione peroxidase	NA	NA	NA	NA	NA
AWY88408.1|348161_348911_+	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	28.2	1.2e-08
AWY88409.1|348988_349453_+	endopeptidase	NA	S5MM68	Bacillus_phage	36.9	2.1e-11
AWY88410.1|350474_351911_+	YdiU family protein	NA	NA	NA	NA	NA
AWY88411.1|351914_352106_-	hemin uptake protein HemP	NA	NA	NA	NA	NA
AWY88412.1|352237_353284_-	phospho-2-dehydro-3-deoxyheptonate aldolase Trp-sensitive	NA	S4W5F1	Pandoravirus	47.7	3.2e-84
AWY88413.1|353440_354274_-	phosphoenolpyruvate synthase regulatory protein	NA	NA	NA	NA	NA
AWY88414.1|354385_354553_+	hypothetical protein	NA	NA	NA	NA	NA
AWY88415.1|354606_356985_+	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	36.7	1.2e-171
AWY92320.1|357041_358688_-	cyclohexanecarboxylate-CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	25.3	7.7e-32
>prophage 32
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	378109	383193	4614212		Lake_Baikal_phage(33.33%)	5	NA	NA
AWY88431.1|378109_378478_+	iron-sulfur cluster assembly accessory protein	NA	A0A2H4N7N5	Lake_Baikal_phage	39.4	4.3e-15
AWY88432.1|378486_379974_+	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
AWY88433.1|379983_380730_+	Fe-S cluster assembly ATPase SufC	NA	A0A1V0SE00	Indivirus	24.0	1.1e-06
AWY88434.1|380704_381976_+	signal peptide peptidase SppA	NA	NA	NA	NA	NA
AWY88435.1|381972_383193_+	cysteine desulfurase	NA	Q2XUY6	environmental_halophage	41.2	1.1e-91
>prophage 33
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	391482	393749	4614212		Escherichia_phage(50.0%)	3	NA	NA
AWY92321.1|391482_392151_+	thiosulfate reductase electron transport protein PhsB	NA	A0A077SL61	Escherichia_phage	37.2	1.0e-22
AWY88444.1|392147_392933_+	protein PhsC	NA	NA	NA	NA	NA
AWY88445.1|392936_393749_+	hypothetical protein	NA	A0A077K9W7	Edwardsiella_phage	35.9	5.0e-08
>prophage 34
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	399253	408134	4614212		Orpheovirus(20.0%)	10	NA	NA
AWY88450.1|399253_399895_+	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	35.2	7.4e-23
AWY88451.1|399934_401083_-	cyclopropane-fatty-acyl-phospholipid synthase	NA	A0A2K9L4K8	Tupanvirus	45.4	9.3e-85
AWY88452.1|401373_402585_-	Bcr/CflA family multidrug efflux MFS transporter	NA	NA	NA	NA	NA
AWY88453.1|402697_403630_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AWY88454.1|403626_404652_-	PurR family transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	31.6	3.7e-32
AWY88455.1|404639_404864_-	hypothetical protein	NA	NA	NA	NA	NA
AWY88456.1|404950_405040_+	YnhF family membrane protein	NA	NA	NA	NA	NA
AWY88457.1|405205_406375_+	MFS transporter	NA	NA	NA	NA	NA
AWY88458.1|406609_407191_-	superoxide dismutase [Fe]	NA	Q56AR7	Bacillus_thuringiensis_phage	46.0	2.6e-43
AWY88459.1|407318_408134_-	murein DD-endopeptidase MepH	NA	A0A2H5BM69	Streptomyces_phage	42.7	1.7e-19
>prophage 35
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	416936	418435	4614212		Indivirus(50.0%)	2	NA	NA
AWY88467.1|416936_417833_+	oxidoreductase	NA	A0A1V0SDE7	Indivirus	30.8	4.7e-07
AWY92322.1|417913_418435_+	superoxide dismutase [Cu-Zn] SodC2	NA	Q9MC02	Salmonella_phage	55.7	7.8e-47
>prophage 36
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	425346	426621	4614212	tRNA	Cronobacter_phage(100.0%)	1	NA	NA
AWY88475.1|425346_426621_+|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	41.1	3.3e-83
>prophage 37
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	446496	448308	4614212		Vaccinia_virus(100.0%)	1	NA	NA
AWY88497.1|446496_448308_+	beta-glucuronidase	NA	B9U1V4	Vaccinia_virus	99.5	0.0e+00
>prophage 38
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	477447	515229	4614212	transposase,tail	Escherichia_phage(32.14%)	45	NA	NA
AWY88525.1|477447_478062_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
AWY88526.1|478104_478959_-	dimethylsulfoxide reductase	NA	NA	NA	NA	NA
AWY88527.1|478960_479578_-	dimethylsulfoxide reductase	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
AWY92326.1|479588_482012_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	1.7e-208
AWY88528.1|482072_484499_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.0	5.0e-213
AWY88529.1|484697_485003_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
AWY92327.1|485110_485821_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
AWY88530.1|485823_486384_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
AWY88531.1|486418_486760_-	DUF1283 domain-containing protein	NA	NA	NA	NA	NA
AWY88532.1|486894_487221_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
AWY88533.1|487257_487446_+	hypothetical protein	NA	NA	NA	NA	NA
AWY88534.1|487426_488641_+	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
AWY88535.1|488652_489672_+	starvation-sensing protein RspB	NA	E3SJ82	Synechococcus_phage	26.2	4.3e-17
AWY88536.1|489729_489834_+	transporter	NA	NA	NA	NA	NA
AWY88537.1|491173_491425_-	DNA-binding protein	NA	S4TND0	Salmonella_phage	50.0	2.2e-15
AWY88538.1|491497_493969_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	57.2	5.0e-59
AWY88539.1|494062_494254_-	DUF1482 domain-containing protein	NA	NA	NA	NA	NA
AWY88540.1|494250_494439_-	division inhibition protein DicB	NA	NA	NA	NA	NA
AWY88541.1|494941_495142_+	hypothetical protein	NA	NA	NA	NA	NA
AWY92328.1|495110_495476_-	hypothetical protein	NA	NA	NA	NA	NA
AWY88542.1|495487_495640_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	53.2	6.6e-07
AWY88543.1|495808_496216_-	transcriptional regulator	NA	I6PD69	Cronobacter_phage	51.9	7.2e-32
AWY88544.1|496296_496524_+	transcriptional regulator	NA	NA	NA	NA	NA
AWY88545.1|496507_497029_+	hypothetical protein	NA	NA	NA	NA	NA
AWY88546.1|496955_497975_+	hypothetical protein	NA	U5P0A0	Shigella_phage	60.2	5.2e-55
AWY88547.1|498015_498438_+	DUF977 domain-containing protein	NA	A0A0U2QQN3	Escherichia_phage	92.8	2.3e-65
AWY88548.1|498434_498668_+	methyltransferase	NA	I6S1S6	Salmonella_phage	67.9	2.9e-17
AWY88549.1|498721_499387_+	hypothetical protein	NA	NA	NA	NA	NA
AWY88550.1|499942_500155_+	Hok/Gef family protein	NA	A0A0U2QV81	Escherichia_phage	97.1	1.7e-29
AWY88551.1|500371_500623_+	hypothetical protein	NA	NA	NA	NA	NA
AWY88552.1|500689_500968_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
AWY88553.1|500969_501620_+	DUF968 domain-containing protein	NA	Q8SBE5	Shigella_phage	70.3	2.6e-68
AWY88554.1|501637_502015_+	antitermination protein	NA	Q777W5	Enterobacteria_phage	82.5	1.8e-53
AWY88555.1|502170_502695_-	hypothetical protein	NA	A0A1W6JNX6	Morganella_phage	52.9	1.0e-46
AWY88556.1|503064_504227_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	4.0e-51
AWY88557.1|505662_506262_+	Ail/Lom family protein	NA	A0A291AWV3	Escherichia_phage	96.0	4.5e-107
AWY88558.1|506326_508705_+|tail	phage tail protein	tail	A0A0E3M194	Enterobacteria_phage	55.8	3.4e-137
AWY88559.1|508704_508986_+	hypothetical protein	NA	A0A1X7QHA1	Escherichia_phage	47.8	4.5e-17
AWY88560.1|508995_509700_+	chaperone of endosialidase	NA	A0A1X7QGH6	Escherichia_phage	62.3	5.4e-59
AWY88561.1|509710_510004_+	hypothetical protein	NA	NA	NA	NA	NA
AWY88562.1|510231_510822_-	DNA invertase	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
AWY88563.1|511138_511372_-	hypothetical protein	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
AWY88564.1|512157_513441_+	MFS transporter	NA	NA	NA	NA	NA
AWY88565.1|513529_514990_+	mannitol dehydrogenase family protein	NA	G8DCZ3	Micromonas_pusilla_virus	29.3	2.8e-41
AWY88566.1|515025_515229_-	protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
>prophage 39
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	520593	521484	4614212		Bacillus_phage(100.0%)	1	NA	NA
AWY88572.1|520593_521484_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	37.7	6.2e-20
>prophage 40
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	524486	525864	4614212		Streptococcus_phage(50.0%)	3	NA	NA
AWY88577.1|524486_524870_-	MDR efflux pump AcrAB transcriptional activator MarA	NA	D0R0F8	Streptococcus_phage	32.3	4.7e-09
AWY88578.1|524889_525324_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AWY88579.1|525543_525864_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	Q6UAT3	Klebsiella_phage	42.3	7.2e-19
>prophage 41
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	533810	534758	4614212		Bacillus_phage(100.0%)	1	NA	NA
AWY92330.1|533810_534758_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	36.1	9.6e-19
>prophage 42
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	541577	542978	4614212		Escherichia_phage(100.0%)	1	NA	NA
AWY92331.1|541577_542978_+	outer membrane autotransporter barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	49.2	4.0e-106
>prophage 43
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	558916	565852	4614212		Bacillus_phage(50.0%)	3	NA	NA
AWY88610.1|558916_560602_+	ABC transporter ATP-binding protein/permease	NA	W8CYL7	Bacillus_phage	23.6	7.7e-11
AWY88611.1|560639_563012_+	TonB-dependent receptor	NA	NA	NA	NA	NA
AWY88612.1|563056_565852_+	insulinase family protein	NA	A0A167R9K4	Powai_lake_megavirus	24.0	3.4e-19
>prophage 44
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	571131	574938	4614212		Bacillus_virus(50.0%)	2	NA	NA
AWY88616.1|571131_572514_+	diguanylate cyclase	NA	G3MA91	Bacillus_virus	31.5	2.0e-17
AWY88617.1|572514_574938_+	oxygen-sensing cyclic-di-GMP phosphodiesterase	NA	A0A1V0SL97	Klosneuvirus	22.0	1.6e-09
>prophage 45
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	579254	581160	4614212		Planktothrix_phage(100.0%)	2	NA	NA
AWY88622.1|579254_580241_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.1	2.9e-18
AWY88623.1|580233_581160_+	peptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.2	7.0e-14
>prophage 46
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	584433	585874	4614212		Tupanvirus(50.0%)	2	NA	NA
AWY88628.1|584433_585444_+	zinc-dependent alcohol dehydrogenase	NA	A0A2K9L339	Tupanvirus	25.3	9.6e-25
AWY88629.1|585589_585874_+	transcriptional regulator	NA	A0A2L1IV52	Escherichia_phage	51.1	1.2e-20
>prophage 47
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	592030	592321	4614212		Enterobacteria_phage(100.0%)	1	NA	NA
AWY88634.1|592030_592321_+	lipoprotein	NA	Q1MVN1	Enterobacteria_phage	65.1	2.1e-25
>prophage 48
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	599205	600750	4614212		Escherichia_phage(100.0%)	1	NA	NA
AWY88637.1|599205_600750_+	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	39.2	4.9e-20
>prophage 49
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	611999	614126	4614212		Ralstonia_phage(100.0%)	1	NA	NA
AWY88645.1|611999_614126_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.2	7.7e-24
>prophage 50
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	619034	621137	4614212		Salmonella_phage(100.0%)	1	NA	NA
AWY88652.1|619034_621137_+	TonB-dependent receptor	NA	A0A1B0VCF0	Salmonella_phage	65.0	3.4e-133
>prophage 51
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	628269	638443	4614212	protease,transposase	Mycoplasma_phage(20.0%)	10	NA	NA
AWY88662.1|628269_629283_-	polyamine ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	37.9	2.1e-27
AWY88663.1|629300_630446_-	spermidine/putrescine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AWY88664.1|630690_632097_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AWY88665.1|632175_632592_-	antitoxin HicB	NA	F1C593	Cronobacter_phage	57.8	6.3e-31
AWY88666.1|632637_632814_-	mRNA interferase HicA	NA	A0A0M3LQ86	Mannheimia_phage	57.9	3.6e-12
AWY88667.1|633035_633266_+	DUF2554 domain-containing protein	NA	NA	NA	NA	NA
AWY88668.1|633357_635319_-|protease	collagenase-like protease	protease	Q6DW11	Phage_TP	28.3	2.7e-23
AWY88669.1|635391_635928_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AWY88670.1|635980_637195_+	BenE family transporter YdcO	NA	NA	NA	NA	NA
AWY88671.1|637234_638443_-|transposase	transposase	transposase	A0A077SL42	Escherichia_phage	93.0	1.7e-206
>prophage 52
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	650250	651199	4614212		Moraxella_phage(50.0%)	2	NA	NA
AWY88684.1|650250_650424_-	hypothetical protein	NA	A0A0R6PKG1	Moraxella_phage	67.4	4.4e-07
AWY88685.1|650668_651199_-	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	44.9	3.1e-19
>prophage 53
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	655915	659818	4614212		Klosneuvirus(100.0%)	1	NA	NA
AWY88689.1|655915_659818_-	ATP-dependent RNA helicase HrpA	NA	A0A1V0SIV3	Klosneuvirus	29.4	8.4e-53
>prophage 54
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	668346	669509	4614212	transposase	Acinetobacter_phage(100.0%)	1	NA	NA
AWY88695.1|668346_669509_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
>prophage 55
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	677760	678750	4614212		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
AWY88701.1|677760_678750_+	D-lactate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	44.0	2.5e-70
>prophage 56
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	683710	708478	4614212	holin,tRNA,integrase,tail	Escherichia_phage(40.0%)	33	691467:691482	714079:714094
AWY88706.1|683710_684844_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	58.8	8.3e-118
AWY88707.1|684984_685419_+	universal stress protein F	NA	A0A1W6JNV4	Morganella_phage	52.8	1.8e-28
AWY88708.1|686379_686613_+	hypothetical protein	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
AWY88709.1|686929_687520_+	DNA invertase	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
AWY88710.1|687747_688041_-	hypothetical protein	NA	NA	NA	NA	NA
AWY88711.1|688053_688332_-	hypothetical protein	NA	A0A0E3JSQ1	Enterobacteria_phage	55.4	2.9e-24
AWY92335.1|688328_690353_-|tail	phage tail protein	tail	A0A0E3M0V5	Enterobacteria_phage	72.3	3.2e-181
AWY88712.1|690652_691417_-	hypothetical protein	NA	G8C7P6	Escherichia_phage	66.5	3.9e-87
691467:691482	attL	ATCGCAGCAATAAAAA	NA	NA	NA	NA
AWY88713.1|691521_691953_-	chromosome partitioning protein ParB	NA	A0A0R6PD10	Moraxella_phage	58.7	3.3e-19
AWY88714.1|691870_692152_-	hypothetical protein	NA	NA	NA	NA	NA
AWY88715.1|693745_693931_-	Spanin from lambdoid prophage Rac, outer membrane subunit	NA	K7PHU6	Enterobacteria_phage	98.2	2.8e-15
AWY88716.1|694147_694681_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	96.0	4.8e-100
AWY88717.1|694786_695059_+	hypothetical protein	NA	NA	NA	NA	NA
AWY88718.1|695024_695369_-	DUF1327 domain-containing protein	NA	K7PGU6	Enterobacteria_phage	94.0	1.4e-36
AWY88719.1|695373_695586_-|holin	holin	holin	A5LH82	Enterobacteria_phage	96.9	3.0e-29
AWY88720.1|695584_695719_+	hypothetical protein	NA	NA	NA	NA	NA
AWY88721.1|695729_695885_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	55.3	6.1e-08
AWY88722.1|695881_696370_-	superinfection exclusion protein B	NA	NA	NA	NA	NA
AWY88723.1|696404_696683_-	hypothetical protein	NA	NA	NA	NA	NA
AWY88724.1|696811_697033_+	cell division protein FtsZ	NA	A0A0U2RTC4	Escherichia_phage	98.6	2.0e-36
AWY92336.1|697032_697203_+	hypothetical protein	NA	A0A0U2SHB5	Escherichia_phage	71.4	3.6e-17
AWY88725.1|697277_697553_+	protein RacC	NA	A0A0U2QW85	Escherichia_phage	96.7	1.4e-42
AWY88726.1|697654_700255_+	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.6	7.9e-249
AWY88727.1|700247_701057_+	DNA recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	8.8e-106
AWY88728.1|701113_701308_+	restriction alleviation and modification enhancement protein	NA	A0A0U2QQP4	Escherichia_phage	96.9	5.8e-32
AWY88729.1|701300_701510_+	DUF1187 domain-containing protein	NA	A0A0U2QL97	Escherichia_phage	96.8	1.8e-26
AWY88730.1|701588_701804_+	hypothetical protein	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
AWY88731.1|701805_703041_+|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	98.5	1.6e-239
AWY88732.1|703092_704028_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.8	5.9e-146
AWY88733.1|704156_705530_-	ATP-dependent RNA helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
AWY88734.1|705559_705733_-	hypothetical protein	NA	NA	NA	NA	NA
AWY88735.1|706007_706991_-	zinc transporter ZntB	NA	NA	NA	NA	NA
AWY92337.1|707245_708478_+	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	35.0	3.1e-17
714079:714094	attR	TTTTTATTGCTGCGAT	NA	NA	NA	NA
>prophage 57
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	714804	715320	4614212		Streptococcus_phage(100.0%)	1	NA	NA
AWY88741.1|714804_715320_+	methylated-DNA--protein-cysteine methyltransferase	NA	M1PFU9	Streptococcus_phage	42.8	2.4e-24
>prophage 58
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	731939	733022	4614212		Indivirus(100.0%)	1	NA	NA
AWY88758.1|731939_733022_-	ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	29.4	4.0e-13
>prophage 59
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	747027	748293	4614212		Klosneuvirus(100.0%)	1	NA	NA
AWY88773.1|747027_748293_-	4-aminobutyrate aminotransferase PuuE	NA	A0A1V0SKB7	Klosneuvirus	27.0	2.0e-24
>prophage 60
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	761207	766864	4614212		Bacillus_virus(50.0%)	5	NA	NA
AWY88787.1|761207_762014_+	peptide ABC transporter ATP-binding protein SapF	NA	G3M9Y6	Bacillus_virus	28.6	7.2e-15
AWY88788.1|762081_762435_+	DUF559 domain-containing protein	NA	NA	NA	NA	NA
AWY88789.1|762802_763591_+	enoyl-[acyl-carrier-protein] reductase FabI	NA	NA	NA	NA	NA
AWY88790.1|763734_764862_+	CMD domain-containing protein	NA	NA	NA	NA	NA
AWY88791.1|764929_766864_+	exoribonuclease II	NA	Q0GXV6	Lactococcus_phage	27.6	6.9e-32
>prophage 61
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	774678	775269	4614212		Staphylococcus_phage(100.0%)	1	NA	NA
AWY88802.1|774678_775269_+	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.9	7.7e-43
>prophage 62
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	780193	785485	4614212	protease	Tupanvirus(33.33%)	5	NA	NA
AWY88808.1|780193_782791_-	DNA topoisomerase 1	NA	A0A2K9L1Q2	Tupanvirus	34.7	1.7e-86
AWY88809.1|782913_783126_-	hypothetical protein	NA	NA	NA	NA	NA
AWY88810.1|783170_783422_+	hypothetical protein	NA	NA	NA	NA	NA
AWY88811.1|783457_784507_-|protease	protease	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
AWY88812.1|784726_785485_+	NAD(P)-dependent oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.9	4.4e-06
>prophage 63
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	793232	796190	4614212		Acinetobacter_phage(100.0%)	2	NA	NA
AWY88818.1|793232_794828_+	bifunctional glutamine amidotransferase/anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	3.8e-52
AWY92341.1|794831_796190_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.7	8.6e-37
>prophage 64
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	807848	809863	4614212		Bacillus_virus(50.0%)	2	NA	NA
AWY88833.1|807848_808853_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.7	2.3e-15
AWY88834.1|808849_809863_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.7	2.0e-14
>prophage 65
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	818273	828457	4614212		Citrobacter_phage(25.0%)	10	NA	NA
AWY88840.1|818273_818891_-	thymidine kinase	NA	A0A0A0YP64	Citrobacter_phage	53.6	1.7e-53
AWY88841.1|819494_819908_+	DNA-binding protein H-NS	NA	NA	NA	NA	NA
AWY88842.1|820051_820960_-	UTP--glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	46.8	1.4e-59
AWY88843.1|821161_822175_-	two-component system response regulator RssB	NA	NA	NA	NA	NA
AWY88844.1|822266_823172_-	patatin family protein	NA	NA	NA	NA	NA
AWY88845.1|823284_823743_+	hypothetical protein	NA	NA	NA	NA	NA
AWY88846.1|823792_824635_+	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	47.6	1.1e-13
AWY88847.1|825534_826212_-	respiratory nitrate reductase subunit gamma	NA	NA	NA	NA	NA
AWY88848.1|826211_826922_-	nitrate reductase molybdenum cofactor assembly chaperone	NA	NA	NA	NA	NA
AWY88849.1|826918_828457_-	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	40.8	6.3e-20
>prophage 66
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	839712	839943	4614212		Spodoptera_litura_granulovirus(100.0%)	1	NA	NA
AWY88857.1|839712_839943_-	cation transport regulator ChaB	NA	A5IZT6	Spodoptera_litura_granulovirus	40.0	8.5e-06
>prophage 67
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	843041	847049	4614212		Cafeteria_roenbergensis_virus(50.0%)	5	NA	NA
AWY88862.1|843041_843896_-	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	39.0	8.3e-46
AWY88863.1|843931_844741_-	protein sirB1	NA	NA	NA	NA	NA
AWY88864.1|844744_845137_-	hypothetical protein	NA	NA	NA	NA	NA
AWY88865.1|845133_845967_-	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
AWY88866.1|845966_847049_-	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	41.6	1.5e-07
>prophage 68
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	850185	852937	4614212		Tupanvirus(50.0%)	2	NA	NA
AWY88870.1|850185_851133_+	ribose-phosphate pyrophosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.8	3.9e-44
AWY88871.1|851257_852937_+	sodium-independent anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.6	1.3e-23
>prophage 69
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	879606	881294	4614212		Salmonella_phage(50.0%)	2	NA	NA
AWY88894.1|879606_880875_-	protein UmuC	NA	I6RSM4	Salmonella_phage	83.4	7.9e-210
AWY88895.1|880874_881294_-	protein UmuD	NA	A0A1W6JNS2	Morganella_phage	62.1	6.9e-38
>prophage 70
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	897990	901719	4614212		Enterobacteria_phage(66.67%)	4	NA	NA
AWY88917.1|897990_898722_+	helix-turn-helix-type transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	50.5	2.7e-53
AWY88918.1|898942_899347_+	DUF1398 domain-containing protein	NA	NA	NA	NA	NA
AWY88919.1|900042_900366_+	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	65.4	8.0e-42
AWY88920.1|900468_901719_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
>prophage 71
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	904855	906226	4614212		Bodo_saltans_virus(100.0%)	1	NA	NA
AWY88924.1|904855_906226_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	4.2e-108
>prophage 72
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	911246	913224	4614212		Mycoplasma_phage(100.0%)	2	NA	NA
AWY88929.1|911246_912383_+	Fe3+/spermidine/putrescine ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	39.8	9.4e-29
AWY88930.1|912366_913224_+	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
>prophage 73
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	916479	920220	4614212		Vibrio_phage(50.0%)	4	NA	NA
AWY88934.1|916479_917319_-	NAD-dependent deacylase	NA	A0A2I7S9Y2	Vibrio_phage	35.6	5.7e-23
AWY88935.1|917334_918246_-	N-acetylglucosamine kinase	NA	NA	NA	NA	NA
AWY88936.1|918274_919519_-	lipoprotein-releasing ABC transporter permease subunit LolE	NA	NA	NA	NA	NA
AWY88937.1|919518_920220_-	lipoprotein-releasing system ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	40.3	1.9e-35
>prophage 74
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	927509	927767	4614212		Erwinia_phage(100.0%)	1	NA	NA
AWY88942.1|927509_927767_-	multiple stress resistance protein BhsA	NA	A0A1B2IFR9	Erwinia_phage	37.1	9.6e-06
>prophage 75
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	940098	941741	4614212		Streptococcus_virus(50.0%)	2	NA	NA
AWY88955.1|940098_941103_-	DNA polymerase III subunit delta'	NA	A0A1U9WR94	Streptococcus_virus	30.9	8.4e-05
AWY88956.1|941099_941741_-	thymidylate kinase	NA	Q2Z0N0	Pseudomonas_phage	36.9	4.5e-28
>prophage 76
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	945013	945250	4614212		Ralstonia_phage(100.0%)	1	NA	NA
AWY88960.1|945013_945250_-	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	45.2	1.5e-10
>prophage 77
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	958552	959494	4614212		Brevibacillus_phage(100.0%)	1	NA	NA
AWY88973.1|958552_959494_-	flagellar assembly peptidoglycan hydrolase FlgJ	NA	S5M633	Brevibacillus_phage	31.3	3.6e-10
>prophage 78
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	975374	975620	4614212		Salmonella_phage(100.0%)	1	NA	NA
AWY88993.1|975374_975620_+	DNA-damage-inducible protein I	NA	H6WRY5	Salmonella_phage	48.7	7.7e-13
>prophage 79
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	980282	981203	4614212		Morganella_phage(100.0%)	1	NA	NA
AWY89000.1|980282_981203_+	lipid A biosynthesis lauroyltransferase	NA	A0A1W6JP29	Morganella_phage	41.5	8.6e-57
>prophage 80
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	990511	991045	4614212		Red_sea_bream_iridovirus(100.0%)	1	NA	NA
AWY89008.1|990511_991045_-	O-acetyl-ADP-ribose deacetylase	NA	Q71G61	Red_sea_bream_iridovirus	40.2	5.9e-26
>prophage 81
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	995180	996014	4614212		Pelagibacter_phage(100.0%)	1	NA	NA
AWY89017.1|995180_996014_+	curli production assembly/transport component CsgG	NA	M1ICK2	Pelagibacter_phage	40.1	5.1e-40
>prophage 82
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	999711	1002273	4614212	transposase	Acinetobacter_phage(50.0%)	2	NA	NA
AWY89021.1|999711_1000873_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
AWY89022.1|1000914_1002273_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	33.2	1.9e-20
>prophage 83
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	1009092	1010157	4614212		Cronobacter_phage(100.0%)	1	NA	NA
AWY89027.1|1009092_1010157_-	phosphate starvation protein PhoH	NA	R4II13	Cronobacter_phage	76.7	1.1e-90
>prophage 84
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	1024795	1027070	4614212		Enterobacteria_phage(100.0%)	3	NA	NA
AWY89041.1|1024795_1025290_+	FMN reductase	NA	Q9KX93	Enterobacteria_phage	97.9	5.0e-51
AWY89042.1|1025310_1026639_+	pyrimidine utilization transport protein G	NA	Q9KX94	Enterobacteria_phage	99.1	1.3e-234
AWY89043.1|1026896_1027070_-	stress-induced protein	NA	Q9KX95	Enterobacteria_phage	96.3	4.9e-06
>prophage 85
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	1031368	1043682	4614212		Klosneuvirus(20.0%)	13	NA	NA
AWY89049.1|1031368_1032289_+	curved DNA-binding protein	NA	A0A1V0SIM1	Klosneuvirus	43.0	4.2e-11
AWY89050.1|1032288_1032594_+	chaperone modulatory protein CbpM	NA	NA	NA	NA	NA
AWY89051.1|1032745_1033345_-	molecular chaperone TorD	NA	NA	NA	NA	NA
AWY89052.1|1033341_1035888_-	trimethylamine-N-oxide reductase TorA	NA	A0A077SK27	Escherichia_phage	29.3	2.0e-71
AWY89053.1|1035887_1037060_-	pentaheme c-type cytochrome TorC	NA	NA	NA	NA	NA
AWY89054.1|1037189_1037882_+	two-component system response regulator TorR	NA	W8CYM9	Bacillus_phage	28.0	4.5e-18
AWY89055.1|1037854_1038883_-	TMAO reductase system periplasmic protein TorT	NA	NA	NA	NA	NA
AWY89056.1|1038965_1041710_+	hybrid sensor histidine kinase/response regulator	NA	A0A1V0SGX0	Hokovirus	32.2	2.7e-37
AWY89057.1|1041781_1042855_+	electron transporter YccM	NA	NA	NA	NA	NA
AWY89058.1|1042902_1043076_-	protein GnsA	NA	NA	NA	NA	NA
AWY89059.1|1043065_1043296_-	cold-shock protein	NA	NA	NA	NA	NA
AWY92357.1|1043270_1043459_-	cold-shock protein	NA	NA	NA	NA	NA
AWY89060.1|1043469_1043682_-	cold-shock protein CspG	NA	A0A1W6JNX5	Morganella_phage	71.4	7.8e-22
>prophage 86
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	1062924	1063584	4614212		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
AWY89077.1|1062924_1063584_+	BAX inhibitor protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	6.8e-48
>prophage 87
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	1067817	1069872	4614212		Bacillus_phage(100.0%)	1	NA	NA
AWY89085.1|1067817_1069872_-	helicase IV	NA	A7KV33	Bacillus_phage	27.9	5.9e-21
>prophage 88
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	1082471	1084379	4614212		Tupanvirus(100.0%)	1	NA	NA
AWY89097.1|1082471_1084379_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.9e-54
>prophage 89
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	1100298	1111268	4614212	tRNA	Bacillus_virus(20.0%)	9	NA	NA
AWY89113.1|1100298_1101066_+	aliphatic sulfonate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.0	5.7e-30
AWY89114.1|1101108_1103721_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.8	7.0e-19
AWY89115.1|1103986_1105189_+	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
AWY89116.1|1105357_1106758_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	36.1	5.3e-82
AWY89117.1|1107360_1108449_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	54.3	1.8e-98
AWY89118.1|1108464_1108647_-	hypothetical protein	NA	NA	NA	NA	NA
AWY89119.1|1108633_1109824_+	aspartate aminotransferase	NA	NA	NA	NA	NA
AWY89120.1|1110045_1110693_-	hypothetical protein	NA	NA	NA	NA	NA
AWY92362.1|1110719_1111268_-	DUF882 domain-containing protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	7.0e-06
>prophage 90
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	1125973	1130515	4614212		Bacillus_phage(100.0%)	3	NA	NA
AWY89132.1|1125973_1127722_-	lipid A export ATP-binding/permease MsbA	NA	W8CYL7	Bacillus_phage	29.8	2.5e-57
AWY89133.1|1127758_1130023_-	ComEC family protein	NA	NA	NA	NA	NA
AWY89134.1|1130230_1130515_-	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	3.2e-10
>prophage 91
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	1135601	1136690	4614212		Streptococcus_phage(100.0%)	1	NA	NA
AWY89139.1|1135601_1136690_-	3-phosphoserine/phosphohydroxythreonine aminotransferase	NA	M1Q1P2	Streptococcus_phage	46.8	3.5e-81
>prophage 92
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	1140787	1144002	4614212		Tetraselmis_virus(100.0%)	2	NA	NA
AWY89143.1|1140787_1143070_+	formate acetyltransferase 1	NA	A0A2P0VNR5	Tetraselmis_virus	41.5	1.0e-162
AWY89144.1|1143261_1144002_+	pyruvate formate lyase-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.5	8.0e-21
>prophage 93
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	1150310	1230304	4614212	integrase,tRNA,capsid,lysis,portal,protease,plate,tail	Salmonella_phage(44.68%)	82	1146584:1146599	1233391:1233406
1146584:1146599	attL	GTTACCGCCATCGCCA	NA	NA	NA	NA
AWY89151.1|1150310_1150928_-	dimethyl sulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.6	5.0e-77
AWY89152.1|1150938_1153383_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.8	6.6e-221
AWY89153.1|1153621_1154914_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
AWY89154.1|1155004_1156348_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.8	2.1e-80
AWY89155.1|1156358_1156970_-	outer membrane lipoprotein carrier protein LolA	NA	NA	NA	NA	NA
AWY89156.1|1157124_1161153_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
AWY89157.1|1161287_1161782_-	leucine-responsive regulatory protein	NA	NA	NA	NA	NA
AWY89158.1|1162326_1163292_+	thioredoxin reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	8.5e-63
AWY89159.1|1163414_1165181_+	thiol reductant ABC exporter subunit CydD	NA	W8CYL7	Bacillus_phage	24.3	7.0e-23
AWY89160.1|1165181_1166903_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.2	2.9e-21
AWY89161.1|1166944_1167649_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
AWY89162.1|1167933_1168152_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
AWY89163.1|1169189_1171466_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	2.5e-166
AWY89164.1|1171496_1171817_-|protease	ATP-dependent Clp protease adaptor ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
AWY89165.1|1172139_1172364_+	cold-shock protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
AWY89166.1|1172436_1174383_-	macrolide ABC transporter permease/ATP-binding protein MacB	NA	G9BWD6	Planktothrix_phage	40.1	1.1e-37
AWY89167.1|1174379_1175495_-	MacA family efflux pump subunit	NA	NA	NA	NA	NA
AWY89168.1|1175609_1176602_+	DUF535 domain-containing protein	NA	NA	NA	NA	NA
AWY89169.1|1176598_1178257_-	DUF2813 domain-containing protein	NA	NA	NA	NA	NA
AWY89170.1|1178681_1179377_+	aquaporin	NA	NA	NA	NA	NA
AWY89171.1|1179871_1180771_+	transporter	NA	NA	NA	NA	NA
AWY89172.1|1180914_1182567_+	hydroxylamine reductase	NA	NA	NA	NA	NA
AWY89173.1|1182578_1183547_+	hybrid-cluster NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
AWY89174.1|1183679_1185398_+	pyruvate dehydrogenase [ubiquinone]	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.0	2.3e-31
AWY89175.1|1185434_1186436_+	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
AWY89176.1|1186446_1187877_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
AWY92363.1|1187975_1188989_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
AWY89177.1|1188985_1189816_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	30.0	5.7e-07
AWY89178.1|1189812_1190136_-	hypothetical protein	NA	NA	NA	NA	NA
AWY89179.1|1190261_1190777_+	lipoprotein	NA	NA	NA	NA	NA
AWY89180.1|1190994_1191723_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.7	6.0e-29
AWY89181.1|1191740_1192472_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AWY89182.1|1192478_1193195_+	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
AWY89183.1|1193194_1193863_+	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
AWY89184.1|1194153_1194885_+	arginine/ornithine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AWY89185.1|1195083_1196211_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	27.0	6.0e-28
AWY89186.1|1196251_1196740_-	DUF2593 domain-containing protein	NA	NA	NA	NA	NA
AWY89187.1|1196799_1197645_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
AWY89188.1|1197641_1198595_-	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
AWY89189.1|1198604_1199738_-	putrescine transport ATP-binding protein PotG	NA	G3M9Y6	Bacillus_virus	34.0	1.4e-29
AWY89190.1|1199832_1200945_-	putrescine-binding periplasmic protein	NA	NA	NA	NA	NA
AWY89191.1|1200928_1201090_-	putrescine/spermidine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AWY89192.1|1201295_1201772_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
AWY89193.1|1201859_1202762_-	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	34.4	2.6e-37
AWY89194.1|1202822_1203545_-	NADPH-dependent oxidoreductase	NA	NA	NA	NA	NA
AWY89195.1|1203528_1203816_-	DUF1418 domain-containing protein	NA	NA	NA	NA	NA
AWY89196.1|1203975_1204233_+	glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	61.9	8.6e-23
AWY89197.1|1204262_1204640_-	hypothetical protein	NA	NA	NA	NA	NA
AWY89198.1|1204909_1206595_+	transporter	NA	NA	NA	NA	NA
AWY89199.1|1206830_1207049_-	transcriptional regulator	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
AWY92364.1|1207810_1208350_+|tail	phage tail protein	tail	A0A0F7LCR3	Escherichia_phage	62.5	1.5e-56
AWY89200.1|1208349_1208952_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	89.5	2.3e-98
AWY89201.1|1208923_1209361_-|tail	tail assembly chaperone	tail	A0A0F7LDZ0	Escherichia_phage	75.0	1.7e-55
AWY89202.1|1209362_1210985_-	hypothetical protein	NA	M1TAS6	Escherichia_phage	78.5	6.2e-151
AWY89203.1|1210981_1211587_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	93.0	2.3e-111
AWY89204.1|1211579_1212488_-|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	91.1	4.1e-144
AWY89205.1|1212474_1212834_-|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	85.7	8.0e-51
AWY89206.1|1212830_1213409_-|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	85.9	3.6e-93
AWY89207.1|1213512_1214319_+	hypothetical protein	NA	NA	NA	NA	NA
AWY89208.1|1214260_1214707_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	83.7	7.6e-59
AWY89209.1|1214699_1215131_-|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	93.0	3.8e-71
AWY92365.1|1215093_1215339_-	hypothetical protein	NA	A0A1S6KZX6	Salmonella_phage	76.5	1.4e-30
AWY89210.1|1215226_1215655_-|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	88.7	8.1e-58
AWY89211.1|1215791_1216544_-|capsid	capsid protein	capsid	A0A1S6KZW9	Salmonella_phage	94.7	3.1e-113
AWY89212.1|1216686_1218453_+	oxidoreductase	NA	A0A1S6KZW3	Salmonella_phage	99.1	0.0e+00
AWY89213.1|1218452_1219478_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	86.7	7.6e-171
AWY89214.1|1219495_1220458_-	RNA-directed DNA polymerase	NA	NA	NA	NA	NA
AWY89215.1|1220620_1221544_-	hypothetical protein	NA	NA	NA	NA	NA
AWY89216.1|1222016_1222352_+	hypothetical protein	NA	NA	NA	NA	NA
AWY89217.1|1222544_1222850_-	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
AWY89218.1|1222788_1222977_-	hypothetical protein	NA	E5G6M0	Salmonella_phage	96.8	1.6e-26
AWY89219.1|1223129_1225544_-	replication endonuclease	NA	E5G6L9	Salmonella_phage	96.3	0.0e+00
AWY89220.1|1225540_1226398_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	92.6	5.4e-154
AWY89221.1|1226394_1226622_-	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	98.7	3.5e-36
AWY89222.1|1226621_1226855_-	DUF2732 domain-containing protein	NA	E5G6L6	Salmonella_phage	97.4	1.1e-32
AWY89223.1|1226922_1227264_-	hypothetical protein	NA	E5G6L5	Salmonella_phage	98.2	1.3e-55
AWY89224.1|1227227_1227428_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	98.5	7.1e-33
AWY89225.1|1227435_1227945_-	hypothetical protein	NA	E5G6L3	Salmonella_phage	98.8	5.8e-87
AWY89226.1|1227977_1228199_-	regulator	NA	NA	NA	NA	NA
AWY89227.1|1228324_1228894_+	phage repressor protein	NA	A0A1S6KZZ7	Salmonella_phage	43.4	3.8e-39
AWY89228.1|1228909_1229101_+	hypothetical protein	NA	A0A0R6PIH8	Moraxella_phage	68.2	4.0e-09
AWY89229.1|1229287_1230304_+|integrase	integrase	integrase	A0A218M4I3	Erwinia_phage	56.7	3.2e-105
1233391:1233406	attR	TGGCGATGGCGGTAAC	NA	NA	NA	NA
>prophage 94
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	1236954	1238157	4614212		Stx2-converting_phage(100.0%)	1	NA	NA
AWY92366.1|1236954_1238157_-	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	48.0	1.1e-99
>prophage 95
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	1249492	1251364	4614212		Planktothrix_phage(100.0%)	1	NA	NA
AWY89246.1|1249492_1251364_-	glutathione import ATP-binding protein GsiA	NA	G9BWD6	Planktothrix_phage	29.7	5.2e-16
>prophage 96
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	1254579	1262848	4614212		Synechococcus_phage(33.33%)	6	NA	NA
AWY89250.1|1254579_1255242_-	fructose-6-phosphate aldolase	NA	C7BV14	Synechococcus_phage	32.2	8.2e-25
AWY89251.1|1255372_1256272_+	glycyl-radical enzyme activating protein	NA	NA	NA	NA	NA
AWY89252.1|1256277_1258710_+	formate C-acetyltransferase/glycerol dehydratase family glycyl radical enzyme	NA	A0A076YHZ7	Citrobacter_phage	44.9	1.6e-09
AWY89253.1|1258855_1259671_+	sugar phosphatase YbiV	NA	NA	NA	NA	NA
AWY89254.1|1259822_1261088_+	DUF1479 domain-containing protein	NA	NA	NA	NA	NA
AWY89255.1|1261255_1262848_-	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.7	6.9e-62
>prophage 97
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	1267845	1273070	4614212		Escherichia_phage(33.33%)	7	NA	NA
AWY89261.1|1267845_1268361_-	outer membrane protein X	NA	H6WZM8	Escherichia_phage	33.8	1.1e-16
AWY89262.1|1268713_1269601_+	threonine/homoserine exporter RhtA	NA	NA	NA	NA	NA
AWY89263.1|1269899_1270403_+	DNA starvation/stationary phase protection protein	NA	A0A222YYG6	Streptomyces_phage	29.0	4.9e-06
AWY89264.1|1270688_1270880_+	hypothetical protein	NA	NA	NA	NA	NA
AWY89265.1|1270806_1271553_+	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AWY89266.1|1271691_1272351_+	glutamine ABC transporter permease	NA	NA	NA	NA	NA
AWY89267.1|1272347_1273070_+	glutamine transport ATP-binding protein GlnQ	NA	G9BWD6	Planktothrix_phage	42.7	5.6e-35
>prophage 98
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	1276610	1291566	4614212		Erwinia_phage(14.29%)	13	NA	NA
AWY89270.1|1276610_1277015_+	DUF1471 domain-containing protein	NA	A0A1B2ICL8	Erwinia_phage	51.0	2.6e-05
AWY89271.1|1277279_1279562_+	catecholate siderophore receptor Fiu	NA	NA	NA	NA	NA
AWY89272.1|1279603_1280281_+	PKHD-type hydroxylase	NA	Q5GQB0	Synechococcus_phage	30.1	1.2e-18
AWY89273.1|1280354_1280621_+	DksA/TraR family C4-type zinc finger protein	NA	E5G6L7	Salmonella_phage	45.6	6.9e-07
AWY89274.1|1280885_1281146_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
AWY89275.1|1281374_1282460_-	dehydrogenase	NA	NA	NA	NA	NA
AWY89276.1|1282600_1283563_-	DNA-binding protein YbiB	NA	NA	NA	NA	NA
AWY89277.1|1283590_1285741_-	ATP-dependent helicase DinG	NA	A0A127AW80	Bacillus_phage	26.1	3.7e-42
AWY89278.1|1285860_1286343_+	swarming motility protein YbiA	NA	A0A0H3TLU0	Faustovirus	52.0	9.8e-36
AWY89279.1|1286574_1287939_-	ATP-dependent RNA helicase RhlE	NA	A0A1V0SBR7	Catovirus	31.8	1.5e-52
AWY92367.1|1288167_1288839_+	transcriptional regulator	NA	NA	NA	NA	NA
AWY89280.1|1288838_1289837_+	secretion protein HlyD	NA	NA	NA	NA	NA
AWY89281.1|1289829_1291566_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.8	2.3e-18
>prophage 99
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	1302162	1303071	4614212		Streptococcus_phage(100.0%)	1	NA	NA
AWY89295.1|1302162_1303071_+	hypothetical protein	NA	A1IMD5	Streptococcus_phage	31.5	8.3e-28
>prophage 100
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	1309552	1323484	4614212	terminase,tail,integrase	Escherichia_phage(41.67%)	16	1311468:1311482	1323558:1323572
AWY89301.1|1309552_1310842_+	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.1	3.4e-19
AWY89302.1|1310900_1311377_+	kinase inhibitor	NA	NA	NA	NA	NA
AWY89303.1|1311291_1311471_+	hypothetical protein	NA	NA	NA	NA	NA
1311468:1311482	attL	TTAGTATAAAAAAGC	NA	NA	NA	NA
AWY89304.1|1312160_1313306_+	acyltransferase	NA	A0A2H4JA46	uncultured_Caudovirales_phage	29.9	1.6e-20
AWY89305.1|1313343_1314681_-	hypothetical protein	NA	A0A2D2W3A0	Escherichia_phage	56.4	5.5e-145
AWY89306.1|1315073_1316099_+	acyltransferase	NA	G9L6E5	Escherichia_phage	28.9	2.4e-15
AWY89307.1|1316140_1316536_-|tail	tail fiber assembly protein	tail	A0A0M4S6V4	Salmonella_phage	36.6	1.6e-12
AWY89308.1|1317804_1319427_-	TerL protein	NA	A0A0M5M1R6	Salmonella_phage	95.4	0.0e+00
AWY89309.1|1319429_1319981_-|terminase	terminase small subunit	terminase	G0ZND3	Cronobacter_phage	69.8	7.2e-67
AWY89310.1|1319934_1320549_+	hypothetical protein	NA	NA	NA	NA	NA
AWY89311.1|1320681_1320867_-	hypothetical protein	NA	NA	NA	NA	NA
AWY89312.1|1321376_1321661_+	DUF4752 domain-containing protein	NA	G9L657	Escherichia_phage	94.7	3.2e-47
AWY89313.1|1321653_1321938_+	ASCH domain-containing protein	NA	A0A2D1GLL3	Escherichia_phage	100.0	1.8e-50
AWY89314.1|1322010_1322178_+	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	96.4	2.9e-27
AWY89315.1|1322217_1322436_+	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
AWY89316.1|1322413_1323484_+|integrase	integrase	integrase	K7P6P6	Enterobacteria_phage	100.0	3.9e-202
1323558:1323572	attR	TTAGTATAAAAAAGC	NA	NA	NA	NA
>prophage 101
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	1333194	1339768	4614212		Planktothrix_phage(33.33%)	8	NA	NA
AWY89324.1|1333194_1334253_-	molybdenum import ATP-binding protein ModC	NA	G9BWD6	Planktothrix_phage	35.9	1.5e-20
AWY89325.1|1334255_1334945_-	molybdenum ABC transporter permease	NA	NA	NA	NA	NA
AWY89326.1|1334944_1335718_-	molybdate-binding periplasmic protein	NA	NA	NA	NA	NA
AWY89327.1|1335739_1335949_-	hypothetical protein	NA	NA	NA	NA	NA
AWY89328.1|1335884_1336034_-	multidrug efflux pump accessory protein AcrZ	NA	NA	NA	NA	NA
AWY89329.1|1336162_1336951_+	molybdenum-dependent transcriptional regulator	NA	NA	NA	NA	NA
AWY89330.1|1337018_1338491_+	molybdate ABC transporter ATP-binding protein ModF	NA	A0A1M7XV31	Cedratvirus	28.3	7.2e-13
AWY89331.1|1338751_1339768_+	UDP-glucose 4-epimerase	NA	A0A2K9L1R4	Tupanvirus	46.0	6.1e-80
>prophage 102
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	1344121	1347641	4614212		Klebsiella_phage(33.33%)	4	NA	NA
AWY89336.1|1344121_1345174_-	phospho-2-dehydro-3-deoxyheptonate aldolase Phe-sensitive	NA	A0A2I6UFP9	Klebsiella_phage	49.4	3.4e-81
AWY89337.1|1345489_1345870_+	hypothetical protein	NA	NA	NA	NA	NA
AWY89338.1|1345983_1346925_+	zinc transporter ZitB	NA	A0A1V0SED0	Indivirus	28.2	3.7e-23
AWY89339.1|1346921_1347641_-	nicotinamide riboside transporter PnuC	NA	A0A126HGA3	Vibrio_phage	32.7	9.2e-22
>prophage 103
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	1383924	1384716	4614212		Kaumoebavirus(100.0%)	1	NA	NA
AWY89370.1|1383924_1384716_-	endonuclease VIII	NA	A0A1V0CNR6	Kaumoebavirus	31.5	2.2e-08
>prophage 104
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	1388094	1391036	4614212		Acinetobacter_phage(50.0%)	2	NA	NA
AWY89375.1|1388094_1389576_+	dipeptide permease D	NA	A0A0P0IY73	Acinetobacter_phage	28.2	2.5e-45
AWY89376.1|1389614_1391036_-	deoxyribodipyrimidine photo-lyase	NA	A0A1V0SGL1	Hokovirus	32.6	2.3e-61
>prophage 105
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	1402304	1408285	4614212		Paramecium_bursaria_Chlorella_virus(33.33%)	4	NA	NA
AWY89386.1|1402304_1404353_+	K(+)-transporting ATPase subunit B	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	23.1	6.4e-28
AWY89387.1|1404361_1404934_+	potassium-transporting ATPase subunit C	NA	NA	NA	NA	NA
AWY89388.1|1404926_1407611_+	two-component system sensor histidine kinase KdbD	NA	A0A1V0SGX0	Hokovirus	26.8	5.0e-12
AWY89389.1|1407607_1408285_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	30.1	3.4e-26
>prophage 106
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	1416538	1417303	4614212		Mycobacterium_phage(100.0%)	1	NA	NA
AWY89396.1|1416538_1417303_+	esterase	NA	A0A1J0GVH7	Mycobacterium_phage	35.4	4.4e-06
>prophage 107
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	1421583	1425397	4614212	tRNA	Escherichia_phage(50.0%)	2	NA	NA
AWY89402.1|1421583_1423248_-|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	99.1	0.0e+00
AWY89403.1|1423450_1425397_-	PTS N-acetyl glucosamine transporter subunit IIABC	NA	A0A2I7SAJ6	Vibrio_phage	47.3	1.2e-07
>prophage 108
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	1430163	1431828	4614212		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
AWY89409.1|1430163_1431828_+	asparagine synthetase B	NA	A9YVS6	Ostreococcus_tauri_virus	39.5	7.9e-85
>prophage 109
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	1435923	1437003	4614212		Pseudomonas_phage(100.0%)	1	NA	NA
AWY89413.1|1435923_1437003_+	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	46.6	4.3e-47
>prophage 110
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	1444948	1449927	4614212	transposase	Planktothrix_phage(33.33%)	4	NA	NA
AWY89421.1|1444948_1445335_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.4	2.1e-09
AWY89422.1|1445331_1446701_-|transposase	IS3-like element IS150 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	100.0	1.3e-112
AWY89423.1|1447237_1448173_+	pyrimidine-specific ribonucleoside hydrolase RihA	NA	NA	NA	NA	NA
AWY89424.1|1448256_1449927_+	molecular chaperone HscC	NA	E5ESM6	Bathycoccus_sp._RCC1105_virus	32.7	8.0e-77
>prophage 111
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	1454068	1456651	4614212	tRNA	Staphylococcus_phage(100.0%)	1	NA	NA
AWY89427.1|1454068_1456651_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	42.2	2.3e-184
>prophage 112
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	1463661	1466101	4614212		Synechococcus_phage(50.0%)	2	NA	NA
AWY89436.1|1463661_1464750_+	endolytic peptidoglycan transglycosylase RlpA	NA	F5B3X9	Synechococcus_phage	53.2	3.6e-09
AWY89437.1|1464889_1466101_+	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	47.4	1.2e-101
>prophage 113
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	1470915	1471563	4614212		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
AWY89446.1|1470915_1471299_+	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	53.6	6.8e-24
AWY89447.1|1471353_1471563_-	cold-shock protein CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	2.7e-22
>prophage 114
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	1486981	1493456	4614212		Morganella_phage(25.0%)	6	NA	NA
AWY89464.1|1486981_1487410_+	universal stress protein G	NA	A0A1W6JNV4	Morganella_phage	39.2	1.1e-19
AWY89465.1|1487530_1489096_-	alkyl hydroperoxide reductase subunit F	NA	G3MA85	Bacillus_virus	34.3	2.2e-44
AWY89466.1|1489340_1489904_-	peroxiredoxin	NA	NA	NA	NA	NA
AWY89467.1|1490275_1491037_+	thiol:disulfide interchange protein DsbG	NA	NA	NA	NA	NA
AWY89468.1|1491792_1492854_+	DUF3440 domain-containing protein	NA	L0P6Z6	Lactobacillus_phage	31.9	2.7e-46
AWY89469.1|1492826_1493456_+	hypothetical protein	NA	A0A0F7L444	uncultured_marine_virus	52.8	3.8e-56
>prophage 115
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	1507992	1514035	4614212		Klosneuvirus(50.0%)	3	NA	NA
AWY89483.1|1507992_1508808_+	ferric enterobactin transport ATP-binding protein FepC	NA	A0A1V0SJ29	Klosneuvirus	22.0	7.3e-07
AWY89484.1|1508804_1509938_-	LPS O-antigen length regulator	NA	NA	NA	NA	NA
AWY89485.1|1510153_1514035_-	enterobactin non-ribosomal peptide synthetase EntF	NA	A0A2K9KZV5	Tupanvirus	29.0	1.6e-59
>prophage 116
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	1519015	1573194	4614212	integrase,lysis,protease,transposase,tail	Enterobacteria_phage(48.15%)	59	1549446:1549492	1573208:1573254
AWY89489.1|1519015_1520128_-|transposase	IS4-like element IS421 family transposase	transposase	NA	NA	NA	NA
AWY89490.1|1520204_1520357_-	protein HokE	NA	NA	NA	NA	NA
AWY92375.1|1520454_1520583_-	hypothetical protein	NA	A0A2I6AZV9	Macacine_betaherpesvirus	100.0	3.3e-15
AWY89491.1|1522465_1522615_-	hypothetical protein	NA	NA	NA	NA	NA
AWY89492.1|1522626_1523745_+	glutamate--cysteine ligase	NA	NA	NA	NA	NA
AWY89493.1|1523810_1524059_+	DUF1158 domain-containing protein	NA	NA	NA	NA	NA
AWY89494.1|1524123_1524492_+	MmcQ/YjbR family DNA-binding protein	NA	NA	NA	NA	NA
AWY89495.1|1524585_1525239_+	oxygen-insensitive NAD(P)H nitroreductase	NA	NA	NA	NA	NA
AWY89496.1|1525346_1526594_+	miniconductance mechanosensitive channel YbdG	NA	NA	NA	NA	NA
AWY89497.1|1526661_1528038_-	phenylalanine-specific permease	NA	NA	NA	NA	NA
AWY89498.1|1528139_1531283_-	Cu(+)/Ag(+) efflux RND transporter permease subunit CusA	NA	S5VTK5	Leptospira_phage	22.1	1.7e-59
AWY89499.1|1531294_1532518_-	Cu(+)/Ag(+) efflux RND transporter periplasmic adaptor subunit CusB	NA	NA	NA	NA	NA
AWY89500.1|1532533_1532866_-	Cu(+)/Ag(+) efflux RND transporter periplasmic metallochaperone	NA	NA	NA	NA	NA
AWY89501.1|1533023_1534397_-	Cu(I)/Ag(I) efflux RND transporter outer membrane protein	NA	NA	NA	NA	NA
AWY89502.1|1534351_1534507_-	copper transporter	NA	NA	NA	NA	NA
AWY89503.1|1534553_1535237_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	34.7	2.3e-30
AWY89504.1|1535226_1536675_+	Cu(+)/Ag(+) sensor histidine kinase CusS	NA	NA	NA	NA	NA
AWY89505.1|1538972_1539419_+	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	37.2	7.2e-17
AWY89506.1|1539451_1539712_+	hypothetical protein	NA	NA	NA	NA	NA
AWY92376.1|1539837_1539999_+	rhs core protein	NA	NA	NA	NA	NA
AWY89507.1|1540289_1540487_+	hypothetical protein	NA	NA	NA	NA	NA
AWY92377.1|1540432_1540765_+	hypothetical protein	NA	NA	NA	NA	NA
AWY89508.1|1540963_1542100_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
AWY89509.1|1544594_1547567_+	phage receptor	NA	NA	NA	NA	NA
AWY89510.1|1547567_1548458_+	DUF4434 domain-containing protein	NA	NA	NA	NA	NA
AWY89511.1|1548371_1548584_-	hypothetical protein	NA	NA	NA	NA	NA
AWY89512.1|1548640_1549402_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AWY89513.1|1549395_1549512_+	hypothetical protein	NA	NA	NA	NA	NA
1549446:1549492	attL	AATGGCGCGCCCTGCAGGATTCGAACCTGCGGCCCACGACTTAGAAG	NA	NA	NA	NA
AWY89514.1|1549915_1550869_+|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
AWY89515.1|1551117_1551867_-	transcriptional regulator	NA	NA	NA	NA	NA
AWY89516.1|1552542_1552836_-	hypothetical protein	NA	NA	NA	NA	NA
AWY89517.1|1552846_1553551_-	chaperone of endosialidase	NA	A0A1X7QGH6	Escherichia_phage	61.7	9.2e-59
AWY89518.1|1553560_1553842_-	hypothetical protein	NA	A0A1X7QHA1	Escherichia_phage	50.0	4.1e-18
AWY89519.1|1553838_1556184_-|tail	phage tail protein	tail	A0A0E3M0V5	Enterobacteria_phage	45.4	9.5e-92
AWY89520.1|1556242_1559074_-	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	87.5	0.0e+00
AWY89521.1|1559733_1559835_-	hypothetical protein	NA	NA	NA	NA	NA
AWY89522.1|1559982_1560177_+	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	96.9	4.3e-27
AWY89523.1|1560537_1560831_+	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	91.8	2.0e-44
AWY89524.1|1560862_1561324_-|lysis	lysis protein	lysis	A0A0K2FJD0	Enterobacteria_phage	98.0	2.7e-75
AWY89525.1|1561320_1561818_-	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	97.6	1.1e-90
AWY89526.1|1561817_1562033_-|lysis	lysis protein S	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
AWY89527.1|1562621_1563704_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	80.1	1.6e-166
AWY89528.1|1563893_1564277_-	antitermination protein	NA	A0A088CD47	Shigella_phage	84.2	4.0e-56
AWY89529.1|1564362_1564503_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	2.5e-08
AWY89530.1|1564499_1564862_-	RusA family crossover junction endodeoxyribonuclease	NA	K7PM48	Enterobacteria_phage	97.4	7.3e-60
AWY89531.1|1564858_1565149_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	95.8	2.3e-48
AWY89532.1|1565141_1565312_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	5.3e-13
AWY89533.1|1565311_1565767_-	hypothetical protein	NA	I6PD71	Cronobacter_phage	66.9	4.1e-60
AWY89534.1|1565763_1565865_-	hypothetical protein	NA	NA	NA	NA	NA
AWY89535.1|1565981_1566779_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AWY89536.1|1566788_1567340_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
AWY89537.1|1567804_1569331_-	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	27.8	7.9e-31
AWY89538.1|1569585_1569918_-	multidrug SMR transporter	NA	NA	NA	NA	NA
AWY89539.1|1569985_1570288_-	protein ren	NA	A0A0N6WES4	Escherichia_phage	95.7	1.1e-42
AWY89540.1|1570907_1571189_+	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	5.5e-47
AWY89541.1|1571287_1571506_+	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	95.8	1.8e-34
AWY89542.1|1571553_1571832_+	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	98.9	1.7e-48
AWY89543.1|1571803_1572175_+	DNA-binding protein	NA	M1FJ59	Enterobacteria_phage	81.0	2.1e-46
AWY89544.1|1572030_1573194_+|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.0	1.3e-198
1573208:1573254	attR	AATGGCGCGCCCTGCAGGATTCGAACCTGCGGCCCACGACTTAGAAG	NA	NA	NA	NA
>prophage 117
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	1580273	1583404	4614212	tRNA	Enterococcus_phage(50.0%)	4	NA	NA
AWY89550.1|1580273_1581140_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
AWY89551.1|1581141_1581354_+	hypothetical protein	NA	NA	NA	NA	NA
AWY89552.1|1581461_1581983_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
AWY89553.1|1582018_1583404_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.9e-45
>prophage 118
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	1594923	1596069	4614212		Streptococcus_phage(100.0%)	1	NA	NA
AWY89565.1|1594923_1596069_-	glycerate 3-kinase	NA	W6LM47	Streptococcus_phage	41.9	1.8e-48
>prophage 119
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	1602259	1604041	4614212		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
AWY89571.1|1602259_1604041_-	glyoxylate carboligase	NA	E4WLQ6	Ostreococcus_tauri_virus	27.0	3.5e-38
>prophage 120
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	1610414	1618222	4614212		uncultured_Caudovirales_phage(50.0%)	3	NA	NA
AWY89579.1|1610414_1614695_-	RHS repeat family protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.1	1.7e-22
AWY89580.1|1615124_1617539_-	ABC transporter permease	NA	NA	NA	NA	NA
AWY89581.1|1617535_1618222_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.6	2.9e-33
>prophage 121
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	1621358	1622036	4614212		Bacillus_virus(100.0%)	1	NA	NA
AWY89585.1|1621358_1622036_-	iron export ATP-binding protein FetA	NA	G3M9Y6	Bacillus_virus	34.3	2.4e-27
>prophage 122
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	1626575	1629838	4614212		uncultured_virus(50.0%)	2	NA	NA
AWY89591.1|1626575_1629080_+	copper-exporting P-type ATPase A	NA	A0A218MNH6	uncultured_virus	38.4	2.9e-115
AWY89592.1|1629496_1629838_-	transcriptional regulator	NA	A0A222YWD7	Escherichia_phage	75.5	3.2e-41
>prophage 123
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	1638082	1646644	4614212		Acanthamoeba_polyphaga_moumouvirus(25.0%)	8	NA	NA
AWY89601.1|1638082_1639042_+	acetyl esterase	NA	L7RDF8	Acanthamoeba_polyphaga_moumouvirus	24.7	2.2e-15
AWY89602.1|1639038_1640001_-	ferrochelatase	NA	NA	NA	NA	NA
AWY89603.1|1640236_1640881_-	adenylate kinase	NA	NA	NA	NA	NA
AWY89604.1|1641061_1642936_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	38.0	1.0e-117
AWY89605.1|1643045_1643651_-	recombination protein RecR	NA	NA	NA	NA	NA
AWY89606.1|1643650_1643980_-	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
AWY89607.1|1644032_1645964_-	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	41.5	5.1e-43
AWY89608.1|1646092_1646644_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	47.3	3.7e-31
>prophage 124
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	1653652	1656802	4614212		Leptospira_phage(100.0%)	1	NA	NA
AWY89617.1|1653652_1656802_+	multidrug efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	23.9	6.2e-54
>prophage 125
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	1665638	1669185	4614212		Bacillus_phage(100.0%)	2	NA	NA
AWY89628.1|1665638_1667420_-	multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.1	1.4e-42
AWY89629.1|1667412_1669185_-	multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.1	3.4e-49
>prophage 126
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	1672508	1673204	4614212		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
AWY89633.1|1672508_1673204_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	68.0	8.4e-89
>prophage 127
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	1676344	1681391	4614212	protease	Bacillus_phage(25.0%)	4	NA	NA
AWY89637.1|1676344_1676617_-	DNA-binding protein HU-beta	NA	A7KV42	Bacillus_phage	58.4	1.1e-20
AWY89638.1|1676825_1679180_-|protease	Lon protease	protease	A0A0R6PGP8	Moraxella_phage	52.4	1.6e-224
AWY89639.1|1679367_1680642_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	56.4	8.7e-132
AWY89640.1|1680767_1681391_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	63.9	2.9e-64
>prophage 128
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	1705233	1714213	4614212	tRNA	uncultured_Mediterranean_phage(60.0%)	10	NA	NA
AWY89668.1|1705233_1705704_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	47.4	1.3e-29
AWY89669.1|1705792_1706896_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	35.8	1.7e-54
AWY89670.1|1706899_1707349_-	transcriptional regulator NrdR	NA	NA	NA	NA	NA
AWY89671.1|1707499_1708039_+	DUF3251 domain-containing protein	NA	NA	NA	NA	NA
AWY89672.1|1708337_1709222_+	nucleoside-specific channel-forming protein Tsx	NA	NA	NA	NA	NA
AWY89673.1|1709398_1709746_-	HNH endonuclease	NA	NA	NA	NA	NA
AWY89674.1|1709873_1710845_-	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	37.9	1.0e-44
AWY89675.1|1710855_1712703_-	protein translocase subunit SecD	NA	NA	NA	NA	NA
AWY89676.1|1712730_1713063_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	33.0	2.8e-10
AWY89677.1|1713085_1714213_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	46.1	2.1e-89
>prophage 129
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	1721165	1731242	4614212		Bacillus_phage(60.0%)	7	NA	NA
AWY89683.1|1721165_1722461_-	two-component system sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	30.8	2.9e-26
AWY89684.1|1722518_1723208_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	38.0	4.4e-37
AWY89685.1|1723397_1724600_+	exonuclease sbcCD subunit D	NA	R4JGS2	Bacillus_phage	32.4	2.4e-06
AWY89686.1|1724596_1727743_+	exonuclease subunit SbcC	NA	G3MAB6	Bacillus_virus	26.9	5.8e-12
AWY92381.1|1727868_1729053_+	MFS transporter AraJ	NA	NA	NA	NA	NA
AWY89687.1|1729297_1730206_-	fructokinase	NA	NA	NA	NA	NA
AWY92382.1|1730330_1731242_+	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	63.6	2.7e-103
>prophage 130
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	1737085	1738201	4614212		Bacillus_phage(100.0%)	1	NA	NA
AWY89696.1|1737085_1738201_-	diguanylate cyclase AdrA	NA	A0A127AWB9	Bacillus_phage	34.5	1.1e-18
>prophage 131
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	1745616	1746774	4614212		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
AWY89708.1|1745616_1746774_+	D-alanyl-D-alanine- carboxypeptidase/endopeptidase AmpH	NA	A0A2H4JAN9	uncultured_Caudovirales_phage	22.1	3.9e-06
>prophage 132
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	1753667	1754435	4614212		Planktothrix_phage(100.0%)	1	NA	NA
AWY89715.1|1753667_1754435_-	taurine ABC transporter ATP-binding subunit	NA	G9BWD6	Planktothrix_phage	40.3	1.1e-25
>prophage 133
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	1757621	1758731	4614212		Prochlorococcus_phage(100.0%)	1	NA	NA
AWY89719.1|1757621_1758731_+	S-(hydroxymethyl)glutathione dehydrogenase	NA	A0A0K0KVL7	Prochlorococcus_phage	28.6	1.2e-31
>prophage 134
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	1762112	1764073	4614212		Micromonas_sp._RCC1109_virus(50.0%)	2	NA	NA
AWY89724.1|1762112_1763126_-	4-hydroxy-2-oxovalerate aldolase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	31.1	9.2e-44
AWY89725.1|1763122_1764073_-	acetaldehyde dehydrogenase	NA	G9E526	Ostreococcus_lucimarinus_virus	35.2	8.7e-36
>prophage 135
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	1769483	1773763	4614212		Enterobacteria_phage(50.0%)	2	NA	NA
AWY89731.1|1769483_1770566_+	lactose operon repressor	NA	C6ZCU4	Enterobacteria_phage	100.0	7.5e-193
AWY89732.1|1770688_1773763_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	100.0	0.0e+00
>prophage 136
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	1778303	1779203	4614212		Lactobacillus_phage(100.0%)	1	NA	NA
AWY89737.1|1778303_1779203_+	transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	27.3	4.2e-16
>prophage 137
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	1782307	1784194	4614212		Staphylococcus_phage(100.0%)	1	NA	NA
AWY89740.1|1782307_1784194_-	propionate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	29.4	1.6e-52
>prophage 138
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	1792967	1794017	4614212		Acanthamoeba_polyphaga_mimivirus(100.0%)	1	NA	NA
AWY89749.1|1792967_1794017_-	aldehyde reductase YahK	NA	A0A0G2YAX3	Acanthamoeba_polyphaga_mimivirus	42.6	2.8e-72
>prophage 139
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	1805404	1811324	4614212	holin	Vibrio_phage(50.0%)	5	NA	NA
AWY89762.1|1805404_1807438_-|holin	choline transporter	holin	A0A2I7QNT1	Vibrio_phage	27.4	3.4e-21
AWY92384.1|1807434_1807650_-	hypothetical protein	NA	NA	NA	NA	NA
AWY89763.1|1807566_1808154_+	transcriptional regulator BetI	NA	NA	NA	NA	NA
AWY89764.1|1808167_1809640_+	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
AWY89765.1|1809653_1811324_+|holin	oxygen-dependent choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.4	3.6e-61
>prophage 140
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	1816899	1818225	4614212		Erysipelothrix_phage(100.0%)	1	NA	NA
AWY89773.1|1816899_1818225_+	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.4	1.2e-112
>prophage 141
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	1838431	1845995	4614212		Streptococcus_phage(50.0%)	6	NA	NA
AWY89795.1|1838431_1840630_+	xanthine dehydrogenase family protein molybdopterin-binding subunit	NA	A0A0P0I429	Acinetobacter_phage	25.8	1.5e-38
AWY89796.1|1840639_1841596_+	XdhC family protein	NA	NA	NA	NA	NA
AWY89797.1|1841574_1841985_+	hypothetical protein	NA	NA	NA	NA	NA
AWY89798.1|1842301_1843555_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	7.5e-96
AWY89799.1|1843566_1844670_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
AWY89800.1|1844957_1845995_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.1	4.3e-113
>prophage 142
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	1857517	1861436	4614212		Clostridioides_phage(50.0%)	6	NA	NA
AWY89813.1|1857517_1858267_-	peptidoglycan endopeptidase	NA	A0A1V0DZX6	Clostridioides_phage	37.7	1.2e-19
AWY89814.1|1858476_1858737_+	type II toxin-antitoxin system antitoxin DinJ	NA	NA	NA	NA	NA
AWY89815.1|1858739_1859018_+	type II toxin-antitoxin system mRNA interferase toxin YafQ	NA	NA	NA	NA	NA
AWY89816.1|1859173_1859914_+	transpeptidase	NA	NA	NA	NA	NA
AWY89817.1|1859884_1860652_-	class II glutamine amidotransferase	NA	NA	NA	NA	NA
AWY89818.1|1860857_1861436_-	phosphoheptose isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
>prophage 143
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	1869827	1877459	4614212		Bradyrhizobium_phage(25.0%)	9	NA	NA
AWY92386.1|1869827_1870559_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	38.1	1.3e-39
AWY89826.1|1870623_1871091_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
AWY89827.1|1871087_1871810_-	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AWY89828.1|1871843_1872599_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
AWY89829.1|1872670_1874029_+	lytic transglycosylase	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
AWY89830.1|1874076_1874700_-	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AWY89831.1|1874703_1875504_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
AWY89832.1|1875744_1876659_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AWY89833.1|1876655_1877459_-	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.6	1.4e-39
>prophage 144
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	1884064	1885096	4614212		Planktothrix_phage(100.0%)	1	NA	NA
AWY89835.1|1884064_1885096_+	methionine import ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
>prophage 145
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	1898099	1902215	4614212		Saccharomonospora_phage(50.0%)	2	NA	NA
AWY89850.1|1898099_1901582_-	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.9	2.2e-209
AWY89851.1|1901618_1902215_-	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.3	6.0e-27
>prophage 146
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	1911043	1911802	4614212		Flavobacterium_phage(100.0%)	1	NA	NA
AWY89860.1|1911043_1911802_-	(2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase	NA	R9W0U9	Flavobacterium_phage	44.4	7.7e-27
>prophage 147
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	1924399	1925824	4614212	protease	uncultured_Mediterranean_phage(100.0%)	1	NA	NA
AWY89874.1|1924399_1925824_-|protease	periplasmic serine endoprotease DegP	protease	A0A1B1IT49	uncultured_Mediterranean_phage	28.8	1.9e-26
>prophage 148
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	1929753	1930098	4614212		Lake_Baikal_phage(100.0%)	1	NA	NA
AWY89879.1|1929753_1930098_-	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	51.4	4.5e-27
>prophage 149
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	1936132	1936930	4614212		Planktothrix_phage(100.0%)	1	NA	NA
AWY89884.1|1936132_1936930_-	iron(3+)-hydroxamate import ATP-binding protein FhuC	NA	G9BWD6	Planktothrix_phage	26.9	6.0e-14
>prophage 150
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	1942164	1948970	4614212	tRNA	Acanthamoeba_polyphaga_mimivirus(50.0%)	6	NA	NA
AWY89888.1|1942164_1944594_-	ATP-dependent helicase HrpB	NA	A0A0G2Y9F4	Acanthamoeba_polyphaga_mimivirus	28.8	1.3e-40
AWY89889.1|1944667_1945198_+	RNA 2',3'-cyclic phosphodiesterase	NA	NA	NA	NA	NA
AWY89890.1|1945212_1945917_+	DNA/RNA nuclease SfsA	NA	NA	NA	NA	NA
AWY89891.1|1946094_1946550_+	RNA polymerase-binding transcription factor DksA	NA	NA	NA	NA	NA
AWY89892.1|1946586_1947513_+|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
AWY89893.1|1947551_1948970_+	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	37.9	3.2e-26
>prophage 151
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	1958876	1959779	4614212	transposase	Sodalis_phage(100.0%)	1	NA	NA
AWY89904.1|1958876_1959779_-|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	49.2	7.4e-61
>prophage 152
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	1963041	1969664	4614212		Anomala_cuprea_entomopoxvirus(33.33%)	5	NA	NA
AWY89911.1|1963041_1963968_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	34.0	1.2e-21
AWY89912.1|1964076_1964739_+	carbonic anhydrase	NA	NA	NA	NA	NA
AWY89913.1|1964779_1965316_-	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	33.1	5.1e-17
AWY89914.1|1965521_1967912_+	membrane-bound PQQ-dependent dehydrogenase, glucose/quinate/shikimate family	NA	NA	NA	NA	NA
AWY89915.1|1968113_1969664_-	multicopper oxidase CueO	NA	A0A0C6DWA2	Mamastrovirus	55.4	2.7e-18
>prophage 153
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	1977409	1978834	4614212		Erysipelothrix_phage(100.0%)	1	NA	NA
AWY92388.1|1977409_1978834_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.8	4.2e-42
>prophage 154
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	1987461	1988013	4614212		Sphingobium_phage(100.0%)	1	NA	NA
AWY89928.1|1987461_1988013_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1W6DX33	Sphingobium_phage	32.3	3.0e-12
>prophage 155
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	1992258	1993302	4614212		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
AWY89933.1|1992258_1993302_-	guanosine monophosphate reductase	NA	A0A0N9Q9A5	Chrysochromulina_ericina_virus	56.0	6.3e-104
>prophage 156
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	2019391	2021116	4614212		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
AWY89960.1|2019391_2021116_-	acetolactate synthase 3 large subunit	NA	E5ERI2	Ostreococcus_lucimarinus_virus	26.9	1.4e-36
>prophage 157
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	2033818	2034517	4614212		Planktothrix_phage(100.0%)	1	NA	NA
AWY89972.1|2033818_2034517_+	thiamine import ATP-binding protein ThiQ	NA	G9BWD6	Planktothrix_phage	37.2	2.8e-23
>prophage 158
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	2040965	2046388	4614212		Yellowstone_lake_phycodnavirus(50.0%)	2	NA	NA
AWY89977.1|2040965_2043317_+	DNA polymerase II	NA	A0A0P0YM26	Yellowstone_lake_phycodnavirus	25.2	3.0e-37
AWY89978.1|2043481_2046388_+	RNA polymerase-associated protein RapA	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	37.9	5.7e-22
>prophage 159
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	2054132	2055532	4614212		Microcystis_phage(50.0%)	2	NA	NA
AWY89986.1|2054132_2054975_+	diadenosine tetraphosphatase	NA	A0A075BTY6	Microcystis_phage	42.0	1.0e-08
AWY89987.1|2055052_2055532_-	type 3 dihydrofolate reductase	NA	A0A219UQN5	Bacillus_phage	46.4	1.0e-29
>prophage 160
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	2063425	2069085	4614212		Vibrio_phage(50.0%)	3	NA	NA
AWY89995.1|2063425_2064940_+	L-carnitine/gamma-butyrobetaine antiporter	NA	A0A2I7QNT1	Vibrio_phage	21.1	1.6e-07
AWY89996.1|2064970_2066113_+	crotonobetainyl-CoA dehydrogenase	NA	NA	NA	NA	NA
AWY89997.1|2067531_2069085_+	crotonobetaine/carnitine-CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	27.1	2.0e-34
>prophage 161
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	2074679	2075828	4614212		Halovirus(100.0%)	1	NA	NA
AWY90003.1|2074679_2075828_-	carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	32.6	1.7e-49
>prophage 162
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	2080271	2083088	4614212	tRNA	Tupanvirus(100.0%)	1	NA	NA
AWY90009.1|2080271_2083088_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A2K9L260	Tupanvirus	26.1	1.2e-77
>prophage 163
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	2090896	2101315	4614212	transposase	uncultured_Caudovirales_phage(20.0%)	10	NA	NA
AWY90017.1|2090896_2092063_-	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	50.3	7.5e-90
AWY92392.1|2092592_2092802_+	type I toxin-antitoxin system hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	73.9	8.0e-19
AWY90018.1|2092995_2094108_-|transposase	IS4-like element IS421 family transposase	transposase	NA	NA	NA	NA
AWY90019.1|2094254_2095385_-	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	34.6	4.6e-28
AWY90020.1|2095473_2097390_-	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	51.1	6.9e-149
AWY90021.1|2097766_2098171_+	DUF2541 domain-containing protein	NA	NA	NA	NA	NA
AWY90022.1|2098196_2098910_+	DUF3944 domain-containing protein	NA	NA	NA	NA	NA
AWY90023.1|2099058_2099625_+	succinate-acetate/proton symporter SatP	NA	NA	NA	NA	NA
AWY90024.1|2099659_2100247_-	molybdopterin adenylyltransferase	NA	NA	NA	NA	NA
AWY90025.1|2100361_2101315_-	transaldolase	NA	A0A127KNC6	Cyanophage	30.9	4.8e-10
>prophage 164
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	2113082	2115196	4614212		Ectocarpus_siliculosus_virus(50.0%)	2	NA	NA
AWY90036.1|2113082_2114507_-	two-component system sensor histidine kinase CreC	NA	Q8QKV7	Ectocarpus_siliculosus_virus	20.4	1.6e-09
AWY90037.1|2114506_2115196_-	two-component system response regulator CreB	NA	W8CYM9	Bacillus_phage	35.3	1.1e-29
>prophage 165
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	2118479	2123834	4614212		Bacillus_phage(33.33%)	4	NA	NA
AWY92395.1|2118479_2120417_-	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	34.8	4.0e-11
AWY92396.1|2120525_2120654_-	methionine aminopeptidase	NA	NA	NA	NA	NA
AWY90042.1|2120627_2122295_+	energy-dependent translational throttle protein EttA	NA	A0A1V0SKJ1	Klosneuvirus	26.4	3.7e-42
AWY90043.1|2122601_2123834_-	trifunctional nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase/transcriptional regulator NadR	NA	A0A0C5K935	Enterococcus_phage	42.6	1.6e-82
>prophage 166
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	2130577	2131900	4614212		Geobacillus_virus(100.0%)	1	NA	NA
AWY90051.1|2130577_2131900_-	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	39.8	2.3e-79
>prophage 167
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	2137839	2140715	4614212		Salmonella_phage(50.0%)	3	NA	NA
AWY90057.1|2137839_2138019_-	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	64.2	2.0e-10
AWY90058.1|2138127_2138733_-	molecular chaperone OsmY	NA	NA	NA	NA	NA
AWY90059.1|2139125_2140715_-	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	25.2	2.4e-30
>prophage 168
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	2148611	2149891	4614212		Salmonella_phage(50.0%)	2	NA	NA
AWY90070.1|2148611_2149151_+	primosomal protein 1	NA	T1SA92	Salmonella_phage	62.8	2.9e-28
AWY90071.1|2149153_2149891_+	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	50.8	7.6e-64
>prophage 169
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	2153116	2158471	4614212		Tupanvirus(50.0%)	3	NA	NA
AWY90073.1|2153116_2154139_-	L-galactonate-5-dehydrogenase	NA	A0A2K9L7I1	Tupanvirus	26.3	2.7e-11
AWY90074.1|2155405_2156767_+	L-galactonate transporter	NA	NA	NA	NA	NA
AWY90075.1|2156815_2158471_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	39.6	6.2e-13
>prophage 170
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	2196964	2197519	4614212		Clostridioides_phage(100.0%)	1	NA	NA
AWY90105.1|2196964_2197519_-	RNA 2'-phosphotransferase	NA	A0A2R2ZGT8	Clostridioides_phage	45.6	2.7e-37
>prophage 171
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	2204087	2205548	4614212		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
AWY90115.1|2204087_2205548_-	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	31.9	6.2e-49
>prophage 172
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	2216965	2235994	4614212	holin,transposase,integrase	uncultured_Caudovirales_phage(14.29%)	20	2224768:2224782	2245915:2245929
AWY90126.1|2216965_2217922_+	iron-dicitrate transporter subunit FecD	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.1	1.1e-17
AWY90127.1|2217922_2218690_+	Fe(3+) dicitrate transport ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	24.8	6.4e-13
AWY90128.1|2219246_2219660_-	hypothetical protein	NA	NA	NA	NA	NA
AWY90129.1|2220437_2221593_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
AWY90130.1|2221741_2223745_+|holin	high-affinity choline transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	25.9	7.5e-21
AWY90131.1|2223689_2223848_+|holin	choline transporter	holin	NA	NA	NA	NA
AWY90132.1|2223807_2224221_+	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
AWY90133.1|2224155_2225323_-|transposase	IS3-like element IS911 family transposase	transposase	Q716C2	Shigella_phage	99.3	1.8e-184
2224768:2224782	attL	CCCCAGCTCTTTCAT	NA	NA	NA	NA
AWY90134.1|2225636_2225894_+	hypothetical protein	NA	NA	NA	NA	NA
AWY90135.1|2225946_2226072_-	hypothetical protein	NA	NA	NA	NA	NA
AWY92399.1|2226114_2227233_-	oxidoreductase	NA	NA	NA	NA	NA
AWY90136.1|2227244_2228462_-	MFS transporter	NA	NA	NA	NA	NA
AWY90137.1|2229088_2230417_+|transposase	IS4 family transposase IS4	transposase	NA	NA	NA	NA
AWY90138.1|2230444_2230588_-	hypothetical protein	NA	NA	NA	NA	NA
AWY90139.1|2231291_2231486_-	hypothetical protein	NA	NA	NA	NA	NA
AWY90140.1|2231501_2231732_+	hypothetical protein	NA	NA	NA	NA	NA
AWY90141.1|2231620_2232088_+	hypothetical protein	NA	NA	NA	NA	NA
AWY92400.1|2233243_2234434_-|integrase	integrase	integrase	B7SYF8	Stenotrophomonas_phage	40.1	9.4e-72
AWY90142.1|2234462_2234657_-	hypothetical protein	NA	NA	NA	NA	NA
AWY90143.1|2234974_2235994_+	aldehyde reductase Ahr	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	30.7	1.4e-44
2245915:2245929	attR	ATGAAAGAGCTGGGG	NA	NA	NA	NA
>prophage 173
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	2241121	2250397	4614212	tRNA	Klebsiella_phage(33.33%)	6	NA	NA
AWY90149.1|2241121_2242624_+	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	44.2	4.6e-84
AWY90150.1|2242784_2243867_-	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
AWY90151.1|2243866_2244967_-	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
AWY90152.1|2245233_2246745_+	cytosol aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.0	6.0e-47
AWY90153.1|2247098_2247542_+	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
AWY90154.1|2247541_2250397_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.7	1.3e-140
>prophage 174
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	2258739	2264836	4614212		Paramecium_bursaria_Chlorella_virus(66.67%)	6	NA	NA
AWY90165.1|2258739_2259675_+	aspartate carbamoyltransferase catalytic subunit	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	40.2	2.9e-52
AWY90166.1|2259687_2260149_+	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
AWY90167.1|2260221_2260608_+	reactive intermediate/imine deaminase	NA	NA	NA	NA	NA
AWY90168.1|2260813_2263510_-	magnesium-translocating P-type ATPase	NA	M1HLC0	Paramecium_bursaria_Chlorella_virus	27.4	9.0e-46
AWY92402.1|2263650_2263704_-	mgtA regulatory leader peptide MgtL	NA	NA	NA	NA	NA
AWY90169.1|2263888_2264836_+	HTH-type transcriptional regulator TreR	NA	C6ZCU4	Enterobacteria_phage	21.8	7.9e-13
>prophage 175
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	2268474	2271236	4614212		Vibrio_phage(50.0%)	2	NA	NA
AWY90172.1|2268474_2270613_+	anaerobic ribonucleoside triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.5	1.5e-266
AWY90173.1|2270771_2271236_+	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	K4F9T1	Cronobacter_phage	57.1	1.1e-52
>prophage 176
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	2275552	2282040	4614212		Klosneuvirus(33.33%)	6	NA	NA
AWY90178.1|2275552_2276551_+	fructose 1,6-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.7	5.7e-70
AWY90179.1|2276583_2277579_-	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
AWY90180.1|2277565_2278591_-	ABC transporter permease	NA	NA	NA	NA	NA
AWY90181.1|2278601_2280104_-	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.3	1.8e-11
AWY90182.1|2280243_2281200_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AWY90183.1|2281509_2282040_+	inorganic pyrophosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.9	9.4e-56
>prophage 177
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	2322059	2323223	4614212		Ralstonia_phage(100.0%)	1	NA	NA
AWY90226.1|2322059_2323223_-	hypothetical protein	NA	B2ZXR7	Ralstonia_phage	43.8	4.9e-81
>prophage 178
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	2327155	2340186	4614212	protease,tRNA	Lactococcus_phage(20.0%)	11	NA	NA
AWY90233.1|2327155_2329597_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.1	3.8e-67
AWY90234.1|2329635_2330061_-	transcriptional regulator	NA	NA	NA	NA	NA
AWY90235.1|2330265_2331564_-	adenylosuccinate synthetase	NA	W5S5V7	Pithovirus	35.9	2.2e-66
AWY90236.1|2331667_2331865_-	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
AWY90237.1|2331946_2332951_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
AWY90238.1|2332953_2334213_-|protease	protease modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
AWY90239.1|2334298_2335579_-	GTPase HflX	NA	NA	NA	NA	NA
AWY90240.1|2335654_2335963_-	RNA-binding protein Hfq	NA	NA	NA	NA	NA
AWY90241.1|2336048_2336999_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
AWY90242.1|2336991_2338839_-	DNA mismatch repair protein MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.3	4.4e-60
AWY90243.1|2338848_2340186_-	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	31.0	8.8e-18
>prophage 179
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	2344101	2344647	4614212		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
AWY90247.1|2344101_2344647_-	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	40.4	2.2e-28
>prophage 180
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	2352074	2353052	4614212		Tupanvirus(100.0%)	1	NA	NA
AWY90252.1|2352074_2353052_-	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	28.2	6.8e-28
>prophage 181
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	2357972	2358509	4614212		Morganella_phage(100.0%)	1	NA	NA
AWY90258.1|2357972_2358509_+	hypothetical protein	NA	A0A1W6JNX6	Morganella_phage	55.0	3.6e-47
>prophage 182
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	2363013	2364997	4614212		Vibrio_phage(50.0%)	2	NA	NA
AWY90266.1|2363013_2364660_-	molecular chaperone GroEL	NA	A0A2I7SAK5	Vibrio_phage	68.9	5.3e-190
AWY90267.1|2364703_2364997_-	co-chaperone GroES	NA	K4F9I2	Cronobacter_phage	45.4	9.2e-13
>prophage 183
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	2379274	2382486	4614212	tRNA	Acinetobacter_phage(50.0%)	2	NA	NA
AWY90280.1|2379274_2380732_+	dipeptide and tripeptide permease C	NA	A0A0P0IY73	Acinetobacter_phage	29.4	8.9e-48
AWY90281.1|2380968_2382486_+|tRNA	lysine--tRNA ligase heat inducible	tRNA	A0A1V0SAC0	Catovirus	38.0	2.0e-87
>prophage 184
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	2403682	2405185	4614212		Burkholderia_virus(100.0%)	1	NA	NA
AWY90300.1|2403682_2405185_-	proline/betaine transporter	NA	Q6JIH2	Burkholderia_virus	31.2	2.4e-56
>prophage 185
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	2410421	2411210	4614212		Cedratvirus(100.0%)	1	NA	NA
AWY90304.1|2410421_2411210_+	phosphonates import ATP-binding protein PhnC	NA	A0A285PWH2	Cedratvirus	30.1	4.2e-12
>prophage 186
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	2416814	2418364	4614212		Bacillus_virus(50.0%)	2	NA	NA
AWY90311.1|2416814_2417573_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.2	3.6e-16
AWY90312.1|2417683_2418364_+	alpha-D-ribose 1-methylphosphonate 5-triphosphate synthase subunit PhnL	NA	F2Y2R6	Organic_Lake_phycodnavirus	29.5	7.1e-08
>prophage 187
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	2424598	2430967	4614212		Bacillus_virus(50.0%)	5	NA	NA
AWY90321.1|2424598_2426131_+	D-allose import ATP-binding protein AlsA	NA	G3M9Y6	Bacillus_virus	27.4	4.4e-13
AWY90322.1|2426109_2427090_+	D-allose ABC transporter permease	NA	NA	NA	NA	NA
AWY90323.1|2427100_2427796_+	D-allulose-6-phosphate 3-epimerase	NA	NA	NA	NA	NA
AWY90324.1|2427779_2428709_+	allose kinase	NA	NA	NA	NA	NA
AWY90325.1|2428981_2430967_+	alkyl/aryl-sulfatase	NA	A0A2P0VMX1	Tetraselmis_virus	44.5	1.6e-148
>prophage 188
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	2436212	2438360	4614212		Escherichia_phage(100.0%)	1	NA	NA
AWY90330.1|2436212_2438360_+	formate dehydrogenase H subunit alpha, selenocysteine-containing	NA	A0A077SK27	Escherichia_phage	25.2	4.7e-29
>prophage 189
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	2447982	2449941	4614212		Staphylococcus_phage(100.0%)	1	NA	NA
AWY90341.1|2447982_2449941_+	acetyl-coenzyme A synthetase	NA	A0A2H4PQU7	Staphylococcus_phage	40.4	1.9e-90
>prophage 190
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	2455527	2456877	4614212		Moraxella_phage(100.0%)	1	NA	NA
AWY90345.1|2455527_2456877_-	guanine/hypoxanthine permease GhxP	NA	A0A0R6PHV4	Moraxella_phage	71.6	1.8e-159
>prophage 191
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	2460694	2464308	4614212		Enterobacteria_phage(50.0%)	2	NA	NA
AWY90354.1|2460694_2461231_-	ssDNA-binding protein	NA	A0A0A0P1Q9	Enterobacteria_phage	78.7	1.1e-56
AWY90355.1|2461485_2464308_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	56.0	0.0e+00
>prophage 192
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	2468495	2471043	4614212		Yellowstone_lake_mimivirus(50.0%)	2	NA	NA
AWY90361.1|2468495_2469575_-	alanine racemase biosynthetic	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	27.9	5.2e-29
AWY90362.1|2469627_2471043_-	replicative DNA helicase	NA	O80281	Escherichia_phage	78.3	4.8e-200
>prophage 193
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	2477670	2478279	4614212		Lactococcus_phage(100.0%)	1	NA	NA
AWY90370.1|2477670_2478279_-	LexA repressor	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
>prophage 194
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	2502653	2506337	4614212		Dickeya_phage(100.0%)	1	NA	NA
AWY92411.1|2502653_2506337_-	methionine synthase	NA	A0A140XBC7	Dickeya_phage	90.2	1.3e-26
>prophage 195
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	2521978	2523568	4614212		Prochlorococcus_phage(100.0%)	1	NA	NA
AWY90398.1|2521978_2523568_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/inosine monophosphate cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	47.7	2.9e-68
>prophage 196
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	2528930	2530694	4614212		Bacillus_phage(50.0%)	3	NA	NA
AWY90404.1|2528930_2529203_-	DNA-binding protein HU-alpha	NA	A7KV42	Bacillus_phage	58.9	3.2e-20
AWY90405.1|2529389_2529980_-	DUF416 domain-containing protein	NA	NA	NA	NA	NA
AWY90406.1|2530022_2530694_-	endonuclease V	NA	A0A1V0SJW5	Klosneuvirus	28.7	6.1e-20
>prophage 197
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	2539911	2548240	4614212		Vibrio_phage(50.0%)	2	NA	NA
AWY90417.1|2539911_2544135_-	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	26.5	2.5e-66
AWY90418.1|2544211_2548240_-	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	29.0	9.4e-23
>prophage 198
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	2552356	2555409	4614212		Tupanvirus(50.0%)	4	NA	NA
AWY90425.1|2552356_2553541_-	translation elongation factor EF-Tu 2	NA	A0A2K9L516	Tupanvirus	26.1	4.4e-13
AWY90426.1|2554116_2554272_+	hypothetical protein	NA	NA	NA	NA	NA
AWY90427.1|2554281_2554476_-	hypothetical protein	NA	NA	NA	NA	NA
AWY90428.1|2554458_2555409_+	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	32.0	8.7e-28
>prophage 199
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	2582694	2589941	4614212		Serratia_phage(33.33%)	5	NA	NA
AWY90446.1|2582694_2584992_-	formate C-acetyltransferase	NA	A0A1S6UAD4	Serratia_phage	48.1	4.6e-06
AWY90447.1|2585042_2585363_-	fructose-like phosphotransferase enzyme IIB component 2	NA	NA	NA	NA	NA
AWY90448.1|2585377_2586457_-	fructose-like permease IIC component 2	NA	NA	NA	NA	NA
AWY90449.1|2586765_2589267_+	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	26.9	1.0e-11
AWY90450.1|2589278_2589941_+	fructose-6-phosphate aldolase 2	NA	A0A0E3F0E2	Synechococcus_phage	34.6	4.2e-29
>prophage 200
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	2607863	2612367	4614212		Erwinia_phage(50.0%)	5	NA	NA
AWY90466.1|2607863_2609195_+	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	29.9	1.7e-45
AWY90467.1|2609261_2610188_+	prenyltransferase	NA	NA	NA	NA	NA
AWY90468.1|2610280_2610766_+	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
AWY90469.1|2610850_2611096_-	cell division protein ZapB	NA	NA	NA	NA	NA
AWY90470.1|2611521_2612367_+	aquaporin	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.0	4.4e-15
>prophage 201
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	2623941	2628802	4614212		Feldmannia_irregularis_virus(33.33%)	6	NA	NA
AWY90483.1|2623941_2624640_+	DNA-binding response regulator	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
AWY90484.1|2624636_2626010_+	two-component system sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.9	3.8e-16
AWY90485.1|2626115_2626790_-	MOSC domain-containing protein	NA	NA	NA	NA	NA
AWY90486.1|2626938_2627922_-	2-keto-3-deoxygluconate permease	NA	NA	NA	NA	NA
AWY90487.1|2627899_2628007_-	2-keto-3-deoxygluconate permease	NA	NA	NA	NA	NA
AWY90488.1|2628181_2628802_-	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	59.8	4.9e-64
>prophage 202
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	2655492	2658272	4614212		Escherichia_phage(50.0%)	3	NA	NA
AWY90514.1|2655492_2656278_-	DeoR family transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.9	8.2e-24
AWY90515.1|2656311_2657208_-	ribokinase	NA	NA	NA	NA	NA
AWY90516.1|2657375_2658272_+	sulfolactaldehyde 3-reductase	NA	D2K0C8	Staphylococcus_phage	90.7	1.3e-60
>prophage 203
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	2674496	2676967	4614212		Ectocarpus_siliculosus_virus(50.0%)	2	NA	NA
AWY90528.1|2674496_2675546_+	two-component system sensor histidine kinase NtrB	NA	Q8QKV7	Ectocarpus_siliculosus_virus	26.1	2.5e-07
AWY92418.1|2675557_2676967_+	nitrogen regulation protein NR(I)	NA	Q56AR1	Bacillus_thuringiensis_phage	28.7	2.4e-05
>prophage 204
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	2681044	2683831	4614212		uncultured_virus(100.0%)	1	NA	NA
AWY90533.1|2681044_2683831_-	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	32.1	1.7e-71
>prophage 205
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	2697616	2698231	4614212		Streptococcus_phage(100.0%)	1	NA	NA
AWY90544.1|2697616_2698231_-	IMPACT family member YigZ	NA	A0A1X9I5T8	Streptococcus_phage	33.0	2.8e-19
>prophage 206
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	2707112	2710399	4614212		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
AWY90552.1|2707112_2707889_-	twin-arginine translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	32.6	5.1e-26
AWY90553.1|2707891_2708407_-	twin-arginine translocase subunit TatB	NA	NA	NA	NA	NA
AWY90554.1|2708410_2708680_-	twin-arginine translocase subunit TatA	NA	NA	NA	NA	NA
AWY90555.1|2708758_2710399_-	ubiquinone biosynthesis protein UbiB	NA	M4R0M8	Ostreococcus_lucimarinus_virus	29.0	8.2e-42
>prophage 207
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	2736975	2738805	4614212		Catovirus(100.0%)	1	NA	NA
AWY92419.1|2736975_2738805_-	DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	37.8	9.7e-84
>prophage 208
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	2747113	2750972	4614212		Bacillus_phage(100.0%)	3	NA	NA
AWY90591.1|2747113_2749276_-	DNA helicase II	NA	A7KV33	Bacillus_phage	37.2	4.6e-117
AWY90592.1|2749359_2750076_-	flavin mononucleotide phosphatase YigB	NA	NA	NA	NA	NA
AWY90593.1|2750075_2750972_-	tyrosine recombinase XerC	NA	A0A142F1N9	Bacillus_phage	29.6	1.1e-24
>prophage 209
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	2761289	2762945	4614212		Tetraselmis_virus(100.0%)	1	NA	NA
AWY90605.1|2761289_2762945_+	arylsulfatase	NA	A0A2P0VMN7	Tetraselmis_virus	29.7	1.0e-44
>prophage 210
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	2771019	2777163	4614212		Enterobacteria_phage(40.0%)	6	NA	NA
AWY90612.1|2771019_2772150_-	dTDP-4-amino-4,6-dideoxygalactose aminotransferase	NA	A0A0F7LAY0	uncultured_marine_virus	41.7	2.0e-18
AWY90613.1|2772154_2772829_-	dTDP-fucosamine acetyltransferase	NA	NA	NA	NA	NA
AWY90614.1|2772806_2773688_-	glucose-1-phosphate thymidylyltransferase 2	NA	I7I009	Enterobacteria_phage	66.3	8.7e-107
AWY90615.1|2773706_2774774_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.4	3.0e-101
AWY90616.1|2774773_2776036_-	UDP-N-acetyl-D-mannosamine dehydrogenase	NA	M1HNJ7	Paramecium_bursaria_Chlorella_virus	27.0	1.0e-23
AWY90617.1|2776032_2777163_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	32.8	3.0e-27
>prophage 211
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	2781205	2786617	4614212		Indivirus(33.33%)	5	NA	NA
AWY90623.1|2781205_2781535_-	thiol reductase thioredoxin	NA	A0A1V0SD63	Indivirus	38.5	4.2e-14
AWY90624.1|2781665_2782931_+	ATP-dependent RNA helicase RhlB	NA	E3T5E1	Cafeteria_roenbergensis_virus	31.2	3.1e-41
AWY90625.1|2782936_2783059_+	addiction module toxin RelE	NA	NA	NA	NA	NA
AWY90626.1|2783064_2784549_+	guanosine-5'-triphosphate,3'-diphosphate diphosphatase	NA	NA	NA	NA	NA
AWY90627.1|2784595_2786617_-	DNA helicase Rep	NA	A7KV33	Bacillus_phage	37.6	3.8e-113
>prophage 212
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	2795089	2796736	4614212		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
AWY90634.1|2795089_2796736_-	acetolactate synthase 2 catalytic subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	31.8	2.5e-67
>prophage 213
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	2810120	2817419	4614212	transposase	Enterobacteria_phage(25.0%)	5	NA	NA
AWY90642.1|2810120_2811011_-	ribose ABC transporter substrate-binding protein RbsB	NA	C6ZCU4	Enterobacteria_phage	23.4	4.3e-05
AWY90643.1|2811035_2812001_-	ribose ABC transporter permease	NA	NA	NA	NA	NA
AWY90644.1|2812005_2813511_-	ribose import ATP-binding protein RbsA	NA	A0A2H4PQG7	Staphylococcus_phage	27.1	6.0e-15
AWY90645.1|2813797_2815166_+|transposase	IS3-like element IS150 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	100.0	1.3e-112
AWY90646.1|2815550_2817419_-	low affinity potassium transport system protein kup	NA	M1I6H8	Paramecium_bursaria_Chlorella_virus	30.6	6.0e-65
>prophage 214
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	2820587	2821580	4614212		Heterosigma_akashiwo_virus(100.0%)	1	NA	NA
AWY90649.1|2820587_2821580_-	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	37.7	1.3e-50
>prophage 215
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	2833534	2841141	4614212		Chrysochromulina_ericina_virus(25.0%)	6	NA	NA
AWY90663.1|2833534_2834905_+	bifunctional N-acetylglucosamine-1-phosphate uridyltransferase/glucosamine-1-phosphate acetyltransferase	NA	A0A0N7G7I9	Chrysochromulina_ericina_virus	36.7	3.1e-34
AWY90664.1|2835066_2836896_+	glutamine--fructose-6-phosphate aminotransferase	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	43.4	1.9e-132
AWY90665.1|2837209_2838250_+	phosphate-binding protein	NA	A0A1D7SRJ6	Cyanophage	38.3	2.7e-51
AWY90666.1|2838335_2839295_+	phosphate ABC transporter permease	NA	NA	NA	NA	NA
AWY90667.1|2839294_2840185_+	phosphate ABC transporter permease PtsA	NA	NA	NA	NA	NA
AWY90668.1|2840367_2841141_+	phosphate ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	31.7	4.0e-15
>prophage 216
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	2852130	2853468	4614212		Moraxella_phage(100.0%)	1	NA	NA
AWY90679.1|2852130_2853468_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	35.7	2.6e-62
>prophage 217
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	2863666	2871035	4614212		Staphylococcus_phage(33.33%)	8	NA	NA
AWY90688.1|2863666_2863924_-	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	56.7	5.4e-17
AWY90689.1|2863887_2864247_-	ribonuclease P protein component	NA	NA	NA	NA	NA
AWY90690.1|2864263_2864404_-	50S ribosomal protein L34	NA	NA	NA	NA	NA
AWY90691.1|2864516_2864717_+	hypothetical protein	NA	NA	NA	NA	NA
AWY90692.1|2865010_2866414_+	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
AWY90693.1|2866418_2867519_+	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	35.0	4.1e-53
AWY90694.1|2867518_2868592_+	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
AWY90695.1|2868620_2871035_+	DNA gyrase subunit B	NA	G3M9Z3	Bacillus_virus	34.6	3.7e-115
>prophage 218
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	2875741	2876890	4614212		Oenococcus_phage(100.0%)	1	NA	NA
AWY90701.1|2875741_2876890_+	D-galactonate dehydratase 2	NA	Q6A202	Oenococcus_phage	32.8	3.6e-52
>prophage 219
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	2881317	2882271	4614212		Cyanophage(50.0%)	2	NA	NA
AWY90705.1|2881317_2881731_+	heat-shock protein IbpA	NA	A0A1D7SU06	Cyanophage	36.2	1.0e-17
AWY90706.1|2881842_2882271_+	heat-shock protein IbpB	NA	A0A1D8KPX5	Synechococcus_phage	36.4	2.1e-13
>prophage 220
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	2889052	2898074	4614212		Aeromonas_phage(25.0%)	14	NA	NA
AWY90711.1|2889052_2890768_+	solute:sodium symporter family transporter	NA	A0A240F3J2	Aeromonas_phage	29.6	5.6e-41
AWY90712.1|2890764_2892258_+	hypothetical protein	NA	A0A2K9L1A5	Tupanvirus	25.6	2.3e-30
AWY90713.1|2892304_2892754_-	hypothetical protein	NA	NA	NA	NA	NA
AWY90714.1|2892862_2893210_+	DUF202 domain-containing protein	NA	NA	NA	NA	NA
AWY90715.1|2893199_2893562_+	hypothetical protein	NA	NA	NA	NA	NA
AWY90716.1|2893558_2894056_+	radical SAM protein	NA	NA	NA	NA	NA
AWY90717.1|2894063_2895248_-	multidrug transporter EmrD	NA	S4TR35	Salmonella_phage	23.5	8.9e-14
AWY90718.1|2895287_2895470_-	hypothetical protein	NA	NA	NA	NA	NA
AWY90719.1|2895527_2895617_-	type I toxin-antitoxin system toxin TisB	NA	NA	NA	NA	NA
AWY90720.1|2895613_2895727_-	LexA family transcriptional regulator	NA	NA	NA	NA	NA
AWY90721.1|2895749_2895908_-	hypothetical protein	NA	NA	NA	NA	NA
AWY90722.1|2895904_2896195_-	hypothetical protein	NA	NA	NA	NA	NA
AWY90723.1|2896181_2896280_+	ilvB operon leader peptide IvbL	NA	NA	NA	NA	NA
AWY90724.1|2896385_2898074_+	acetolactate synthase isozyme 1 large subunit	NA	E5EQ70	Micromonas_sp._RCC1109_virus	29.7	3.2e-57
>prophage 221
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	2905379	2906714	4614212		Moraxella_phage(100.0%)	1	NA	NA
AWY92427.1|2905379_2906714_+	adenine permease PurP	NA	A0A0R6PHV4	Moraxella_phage	37.2	8.6e-66
>prophage 222
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	2915973	2920860	4614212	transposase	Shigella_phage(50.0%)	4	NA	NA
AWY90742.1|2915973_2916330_-|transposase	IS3 family transposase	transposase	U5P4I9	Shigella_phage	92.5	2.6e-33
AWY90743.1|2916356_2916503_+	addiction module toxin RelE	NA	NA	NA	NA	NA
AWY90744.1|2916792_2916993_-	DUF839 domain-containing protein	NA	NA	NA	NA	NA
AWY90745.1|2917362_2920860_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	34.8	3.5e-98
>prophage 223
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	2924244	2924730	4614212		Enterobacteria_phage(100.0%)	1	NA	NA
AWY90748.1|2924244_2924730_-	single-stranded DNA-binding protein	NA	Q1MVN2	Enterobacteria_phage	63.8	4.4e-52
>prophage 224
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	2932258	2933443	4614212		Enterobacteria_phage(100.0%)	1	NA	NA
AWY90753.1|2932258_2933443_-	DUF4102 domain-containing protein	NA	Q7M297	Enterobacteria_phage	69.9	2.6e-162
>prophage 225
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	2939722	2941114	4614212		environmental_Halophage(100.0%)	1	NA	NA
AWY90757.1|2939722_2941114_-	xanthine permease XanP	NA	H9YQ34	environmental_Halophage	100.0	1.4e-71
>prophage 226
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	2946235	2952985	4614212		Bordetella_phage(25.0%)	6	NA	NA
AWY90762.1|2946235_2948344_-	bifunctional GTP diphosphokinase/guanosine-3',5'-bis(diphosphate) 3'-diphosphatase	NA	A0A291L9W9	Bordetella_phage	34.5	4.8e-10
AWY90763.1|2948362_2948638_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
AWY90764.1|2948692_2949316_-	guanylate kinase	NA	K4JYM5	Abalone_herpesvirus	34.5	4.1e-18
AWY90765.1|2949573_2951256_+	DNA ligase B	NA	F8SJM3	Pseudomonas_phage	22.3	1.5e-22
AWY90766.1|2951252_2951870_-	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
AWY90767.1|2952160_2952985_-	DNA damage-inducible protein D	NA	A0A1W6JPJ7	Morganella_phage	76.6	2.4e-90
>prophage 227
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	2956358	2960921	4614212		Xanthomonas_phage(25.0%)	7	NA	NA
AWY92432.1|2956358_2956814_-	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	59.5	7.3e-49
AWY90772.1|2956794_2958015_-	bifunctional phosphopantothenoylcysteine decarboxylase CoaC/phosphopantothenate--cysteine ligase CoaB	NA	Q9HH70	Methanothermobacter_phage	33.9	6.5e-44
AWY90773.1|2958186_2958855_+	DNA repair protein RadC	NA	NA	NA	NA	NA
AWY90774.1|2959071_2959308_+	50S ribosomal protein L28	NA	NA	NA	NA	NA
AWY90775.1|2959328_2959496_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
AWY90776.1|2959593_2960403_+	formamidopyrimidine-DNA glycosylase	NA	F8WPX6	Bacillus_phage	32.2	2.6e-25
AWY90777.1|2960441_2960921_-	phosphopantetheine adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	42.0	4.8e-27
>prophage 228
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	2968359	2970453	4614212		Archaeal_BJ1_virus(50.0%)	2	NA	NA
AWY90784.1|2968359_2969385_+	UDP-galactose--(galactosyl) LPS alpha1,2-galactosyltransferase	NA	A0ZYL4	Archaeal_BJ1_virus	26.1	7.2e-12
AWY90785.1|2969469_2970453_+	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	38.5	2.4e-12
>prophage 229
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	2973861	2983368	4614212		Synechococcus_phage(16.67%)	9	NA	NA
AWY90789.1|2973861_2974794_-	ADP-L-glycero-D-mannoheptose-6-epimerase	NA	E3SL51	Synechococcus_phage	39.3	1.1e-35
AWY90790.1|2975007_2976204_+	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	29.4	1.1e-35
AWY90791.1|2976213_2977239_+	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	84.6	2.1e-19
AWY90792.1|2977477_2978512_+	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	28.7	5.8e-09
AWY90793.1|2978498_2979458_-	divergent polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
AWY90794.1|2979461_2980745_-	murein hydrolase activator EnvC	NA	G9BW84	Planktothrix_phage	34.3	1.0e-07
AWY90795.1|2980754_2982299_-	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
AWY90796.1|2982543_2982975_+	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
AWY90797.1|2983116_2983368_+	glutaredoxin	NA	V9QKN6	Rhizobium_phage	54.8	2.0e-16
>prophage 230
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	3007314	3015615	4614212	tRNA	uncultured_Caudovirales_phage(50.0%)	4	NA	NA
AWY90819.1|3007314_3011448_-	RHS element protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	33.3	9.3e-26
AWY90820.1|3011676_3012285_+	glutathione S-transferase	NA	NA	NA	NA	NA
AWY90821.1|3012382_3013774_+|tRNA	L-selenocysteinyl-tRNA(Sec) synthase	tRNA	NA	NA	NA	NA
AWY90822.1|3013770_3015615_+|tRNA	selenocysteinyl-tRNA-specific translation elongation factor SelB	tRNA	A0A2K9KZ60	Tupanvirus	27.2	1.9e-15
>prophage 231
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	3050984	3051980	4614212		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
AWY90854.1|3050984_3051980_-	acyltransferase	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	25.8	3.5e-11
>prophage 232
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	3055817	3057818	4614212	transposase	Macacine_betaherpesvirus(50.0%)	3	NA	NA
AWY90858.1|3055817_3057187_-|transposase	IS3-like element IS150 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	100.0	1.3e-112
AWY90859.1|3057266_3057419_+	protein HokA	NA	NA	NA	NA	NA
AWY90860.1|3057605_3057818_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	72.9	2.7e-22
>prophage 233
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	3061472	3063806	4614212		Escherichia_phage(100.0%)	1	NA	NA
AWY90865.1|3061472_3063806_+	molybdopterin guanine dinucleotide-containing S/N-oxide reductase	NA	A0A077SK27	Escherichia_phage	29.8	3.1e-71
>prophage 234
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	3074018	3076003	4614212		Planktothrix_phage(50.0%)	2	NA	NA
AWY90875.1|3074018_3075002_+	dipeptide transport ATP-binding protein DppD	NA	G9BWD6	Planktothrix_phage	28.8	3.9e-15
AWY90876.1|3074998_3076003_+	dipeptide transport ATP-binding protein DppF	NA	G3M9Y6	Bacillus_virus	29.9	1.1e-17
>prophage 235
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	3123707	3124355	4614212		Bacillus_virus(100.0%)	1	NA	NA
AWY92437.1|3123707_3124355_+	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	38.5	6.1e-17
>prophage 236
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	3127748	3129883	4614212		uncultured_Caudovirales_phage(100.0%)	3	NA	NA
AWY90919.1|3127748_3128174_-	arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.7	1.5e-51
AWY90920.1|3128186_3129476_-	arsenical efflux pump membrane protein ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	73.5	4.6e-173
AWY90921.1|3129529_3129883_-	transcriptional regulator	NA	A0A2H4J145	uncultured_Caudovirales_phage	50.9	9.7e-25
>prophage 237
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	3133228	3135271	4614212		Indivirus(100.0%)	1	NA	NA
AWY90926.1|3133228_3135271_+	oligopeptidase A	NA	A0A1V0SD92	Indivirus	22.9	3.4e-45
>prophage 238
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	3148874	3151610	4614212		Staphylococcus_phage(100.0%)	1	NA	NA
AWY90937.1|3148874_3151610_+	ABC transporter ATP-binding protein/permease	NA	A0A2H4PQG7	Staphylococcus_phage	30.6	5.4e-22
>prophage 239
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	3154985	3160637	4614212		uncultured_Caudovirales_phage(50.0%)	3	NA	NA
AWY90942.1|3154985_3159221_-	RHS element protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.3	9.6e-26
AWY90943.1|3159423_3159825_-	nickel-responsive transcriptional regulator NikR	NA	NA	NA	NA	NA
AWY90944.1|3159830_3160637_-	nickel import ATP-binding protein NikE	NA	G3M9Y6	Bacillus_virus	29.1	4.5e-17
>prophage 240
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	3168530	3172662	4614212		Dickeya_phage(50.0%)	4	NA	NA
AWY90953.1|3168530_3169196_-	7-cyano-7-deazaguanine/7-aminomethyl-7- deazaguanine transporter	NA	A0A2I7SAW6	Vibrio_phage	53.1	2.8e-57
AWY90954.1|3169416_3169662_+	sulfurtransferase TusA	NA	A0A140XB86	Dickeya_phage	83.3	8.0e-10
AWY90955.1|3169763_3171962_-	zinc/cadmium/mercury/lead-transporting ATPase	NA	E4ZFI9	Streptococcus_phage	38.1	2.5e-118
AWY90956.1|3172035_3172662_-	lysoplasmalogenase	NA	A0A140XAH6	Dickeya_phage	61.9	1.2e-30
>prophage 241
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	3175668	3178487	4614212		Staphylococcus_phage(50.0%)	3	NA	NA
AWY90961.1|3175668_3176337_+	cell division ATP-binding protein FtsE	NA	A0A2H4PQG7	Staphylococcus_phage	25.6	3.8e-14
AWY90962.1|3176329_3177388_+	ABC transporter permease	NA	NA	NA	NA	NA
AWY90963.1|3177632_3178487_+	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	41.9	3.5e-44
>prophage 242
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	3184220	3185703	4614212		Anomala_cuprea_entomopoxvirus(50.0%)	2	NA	NA
AWY90969.1|3184220_3184988_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.6	4.9e-13
AWY90970.1|3184989_3185703_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.1	9.1e-14
>prophage 243
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	3189244	3191055	4614212		Planktothrix_phage(50.0%)	2	NA	NA
AWY90974.1|3189244_3190315_+	sn-glycerol-3-phosphate import ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	33.7	1.7e-19
AWY90975.1|3190311_3191055_+	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	25.0	2.9e-10
>prophage 244
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	3211065	3213513	4614212		Dickeya_phage(100.0%)	1	NA	NA
AWY90992.1|3211065_3213513_+	glycogen phosphorylase	NA	A0A140XAG6	Dickeya_phage	81.0	2.1e-33
>prophage 245
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	3222421	3223648	4614212		Ralstonia_phage(100.0%)	1	NA	NA
AWY91001.1|3222421_3223648_+	RtcB family protein	NA	A0A1L7N133	Ralstonia_phage	59.5	4.9e-132
>prophage 246
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	3228027	3230421	4614212		Iris_mild_mosaic_virus(100.0%)	1	NA	NA
AWY91004.1|3228027_3230421_+	maltodextrin phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	42.5	4.3e-15
>prophage 247
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	3236390	3237269	4614212	transposase	Sodalis_phage(100.0%)	1	NA	NA
AWY91010.1|3236390_3237269_-|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	52.8	1.9e-69
>prophage 248
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	3243832	3247599	4614212		Bacillus_phage(66.67%)	3	NA	NA
AWY91018.1|3243832_3244552_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	34.7	3.5e-29
AWY91019.1|3244548_3245901_+	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	23.8	3.6e-11
AWY91020.1|3245976_3247599_-	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	52.5	5.3e-142
>prophage 249
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	3264505	3265342	4614212		Vibrio_phage(100.0%)	1	NA	NA
AWY91035.1|3264505_3265342_+	DNA adenine methylase	NA	A0A1S6L1V5	Vibrio_phage	49.1	4.9e-67
>prophage 250
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	3290366	3299907	4614212		Acinetobacter_phage(25.0%)	10	NA	NA
AWY91062.1|3290366_3290930_+	glutamine amidotransferase	NA	A0A0P0IKJ1	Acinetobacter_phage	55.8	1.2e-61
AWY91063.1|3291015_3292236_+	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
AWY91064.1|3292302_3294405_-	hypothetical protein	NA	H9YQA8	environmental_Halophage	100.0	1.7e-76
AWY91065.1|3294443_3295076_-	cAMP-activated global transcriptional regulator CRP	NA	NA	NA	NA	NA
AWY91066.1|3295082_3295298_-	hypothetical protein	NA	NA	NA	NA	NA
AWY91067.1|3295377_3295782_+	OsmC family protein	NA	NA	NA	NA	NA
AWY91068.1|3295836_3296706_-	phosphoribulokinase	NA	NA	NA	NA	NA
AWY91069.1|3296759_3296978_-	YheU family protein	NA	A0A2H4J8A7	uncultured_Caudovirales_phage	40.3	3.1e-05
AWY91070.1|3296971_3297994_-	hydrolase	NA	NA	NA	NA	NA
AWY91071.1|3297993_3299907_-	ABC transporter ATP-binding protein	NA	A0A2K9L0W2	Tupanvirus	33.5	4.3e-74
>prophage 251
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	3305477	3314036	4614212		uncultured_Caudovirales_phage(25.0%)	8	NA	NA
AWY91080.1|3305477_3305864_+	sulfurtransferase TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	38.3	5.6e-18
AWY91081.1|3305863_3306223_+	sulfurtransferase TusC	NA	NA	NA	NA	NA
AWY91082.1|3306230_3306518_+	sulfurtransferase TusB	NA	NA	NA	NA	NA
AWY91083.1|3306643_3307018_+	30S ribosomal protein S12	NA	NA	NA	NA	NA
AWY91084.1|3307114_3307585_+	30S ribosomal protein S7	NA	NA	NA	NA	NA
AWY91085.1|3307681_3309796_+	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.5	5.2e-57
AWY91086.1|3309866_3311051_+	translation elongation factor EF-Tu 1	NA	A0A2K9L516	Tupanvirus	26.1	4.4e-13
AWY91087.1|3311342_3314036_+	lysozyme	NA	M1HC48	Acanthocystis_turfacea_Chlorella_virus	35.7	3.3e-40
>prophage 252
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	3322866	3324819	4614212		Vibrio_phage(100.0%)	1	NA	NA
AWY91100.1|3322866_3324819_-	type II secretion system protein GspD	NA	R9TEZ5	Vibrio_phage	30.9	9.2e-32
>prophage 253
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	3346034	3347506	4614212	tRNA	Prochlorococcus_phage(50.0%)	2	NA	NA
AWY91138.1|3346034_3346982_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	35.7	1.4e-06
AWY91139.1|3346996_3347506_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	41.9	3.9e-19
>prophage 254
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	3358012	3362166	4614212		Bacillus_virus(50.0%)	4	NA	NA
AWY91147.1|3358012_3358771_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	9.1e-20
AWY91148.1|3358778_3359882_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
AWY91149.1|3359891_3361073_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
AWY91150.1|3361140_3362166_-	amino acid ABC transporter substrate-binding protein	NA	A0A1B1IT51	uncultured_Mediterranean_phage	39.8	1.8e-71
>prophage 255
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	3368670	3369555	4614212		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
AWY91158.1|3368670_3369555_-	adenine-specific DNA-methyltransferase	NA	M4QNN5	Ostreococcus_lucimarinus_virus	30.5	6.4e-25
>prophage 256
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	3380120	3381164	4614212		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
AWY91170.1|3380120_3381164_+	rod shape-determining protein	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
>prophage 257
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	3397933	3400458	4614212	protease	uncultured_archaeal_virus(50.0%)	2	NA	NA
AWY91185.1|3397933_3399001_-|protease	serine endoprotease DegS	protease	A0A1S5Y2X3	uncultured_archaeal_virus	24.2	6.8e-05
AWY91186.1|3399090_3400458_-|protease	periplasmic pH-dependent serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	25.6	2.3e-21
>prophage 258
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	3404424	3404922	4614212		Pseudomonas_phage(100.0%)	1	NA	NA
AWY91192.1|3404424_3404922_+	stringent starvation protein B	NA	A0A1S5R3H3	Pseudomonas_phage	42.9	3.3e-26
>prophage 259
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	3408626	3410117	4614212		Burkholderia_virus(100.0%)	1	NA	NA
AWY91196.1|3408626_3410117_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	23.6	4.9e-09
>prophage 260
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	3419813	3434608	4614212		Staphylococcus_phage(25.0%)	17	NA	NA
AWY92445.1|3419813_3420743_+	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	35.0	8.8e-17
AWY91205.1|3420838_3423175_+	hybrid sensor histidine kinase/response regulator	NA	A0A1V0SGX0	Hokovirus	31.2	1.7e-40
AWY91206.1|3423404_3424058_+	glutamine amidotransferase	NA	NA	NA	NA	NA
AWY91207.1|3424054_3424783_+	monofunctional biosynthetic peptidoglycan transglycosylase	NA	NA	NA	NA	NA
AWY91208.1|3424779_3425412_-	protein YrbL	NA	NA	NA	NA	NA
AWY91209.1|3425625_3425898_-	phosphocarrier protein NPr	NA	NA	NA	NA	NA
AWY91210.1|3425894_3426749_-	RNase adaptor protein RapZ	NA	A0A0R8VB27	Thermobifida_phage	28.4	1.1e-05
AWY91211.1|3426794_3427286_-	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
AWY91212.1|3427403_3427691_-	ribosome hibernation promoting factor	NA	A0A0M7QCF2	Escherichia_phage	44.3	2.5e-10
AWY91213.1|3427713_3429147_-	RNA polymerase sigma-54 factor	NA	NA	NA	NA	NA
AWY91214.1|3429194_3429920_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	3.2e-22
AWY91215.1|3429926_3430484_-	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
AWY91216.1|3430452_3431028_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
AWY91217.1|3431024_3431591_-	3-deoxy-D-manno-octulosonate 8-phosphate phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	75.7	1.4e-54
AWY91218.1|3431611_3432598_-	arabinose 5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	31.5	1.9e-38
AWY91219.1|3432611_3433589_-	calcium/sodium antiporter	NA	NA	NA	NA	NA
AWY91220.1|3433798_3434608_+	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	29.3	2.2e-19
>prophage 261
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	3438676	3440155	4614212		Vibrio_phage(50.0%)	2	NA	NA
AWY91225.1|3438676_3438955_-	sugar fermentation stimulation protein B	NA	A0A2I7S995	Vibrio_phage	71.4	2.6e-17
AWY91226.1|3439183_3440155_-	octaprenyl-diphosphate synthase	NA	A0A1V0SE37	Indivirus	25.8	6.0e-08
>prophage 262
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	3446929	3449802	4614212	protease	Micromonas_pusilla_virus(50.0%)	2	NA	NA
AWY91235.1|3446929_3448864_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	G8DDJ2	Micromonas_pusilla_virus	43.6	6.3e-118
AWY91236.1|3448953_3449802_+	dihydropteroate synthase	NA	S4W084	Pandoravirus	29.9	3.4e-23
>prophage 263
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	3453884	3460523	4614212		Dickeya_phage(50.0%)	4	NA	NA
AWY91240.1|3453884_3455228_-	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	92.1	3.1e-63
AWY92448.1|3455858_3456311_+	ribosome maturation factor	NA	NA	NA	NA	NA
AWY91241.1|3456338_3457826_+	transcription termination protein NusA	NA	NA	NA	NA	NA
AWY91242.1|3457850_3460523_+	translation initiation factor IF-2	NA	E3T4N3	Cafeteria_roenbergensis_virus	26.3	2.5e-24
>prophage 264
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	3466004	3467894	4614212		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
AWY91249.1|3466004_3467894_+	DEAD/DEAH box family ATP-dependent RNA helicase	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	30.8	2.0e-52
>prophage 265
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	3473596	3481390	4614212		Diadromus_pulchellus_ascovirus(25.0%)	10	NA	NA
AWY91256.1|3473596_3473899_-	GIY-YIG nuclease family protein	NA	F2NZ06	Diadromus_pulchellus_ascovirus	52.5	3.9e-14
AWY91257.1|3473949_3474393_+	hypothetical protein	NA	NA	NA	NA	NA
AWY91258.1|3474372_3474891_-	glutamine amidotransferase	NA	A0A0N7KVR4	Yellowstone_lake_phycodnavirus	27.0	4.4e-10
AWY91259.1|3475018_3475654_+	hypothetical protein	NA	NA	NA	NA	NA
AWY91260.1|3475726_3476767_+	permease	NA	NA	NA	NA	NA
AWY91261.1|3476880_3477456_-	osmotically-inducible protein OsmY	NA	NA	NA	NA	NA
AWY91262.1|3477465_3478056_-	phosphoheptose isomerase	NA	A0A067XQR2	Caulobacter_phage	31.1	5.4e-12
AWY91263.1|3478075_3478471_-	YraN family protein	NA	NA	NA	NA	NA
AWY91264.1|3478428_3480465_-	penicillin-binding protein activator	NA	NA	NA	NA	NA
AWY91265.1|3480529_3481390_+	rRNA (cytidine-2'-O-)-methyltransferase	NA	M1PLC5	Streptococcus_phage	43.6	9.5e-50
>prophage 266
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	3504399	3505545	4614212		Streptococcus_phage(100.0%)	1	NA	NA
AWY91288.1|3504399_3505545_+	glycerate 2-kinase	NA	W6LM47	Streptococcus_phage	41.3	1.7e-49
>prophage 267
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	3513646	3515941	4614212		Tetraselmis_virus(100.0%)	1	NA	NA
AWY91297.1|3513646_3515941_+	PFL-like enzyme TdcE	NA	A0A2P0VNR5	Tetraselmis_virus	41.0	7.4e-158
>prophage 268
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	3536736	3537702	4614212		Escherichia_phage(100.0%)	1	NA	NA
AWY91321.1|3536736_3537702_-	TerC family protein	NA	A0A291LBC5	Escherichia_phage	33.8	5.2e-36
>prophage 269
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	3550556	3566752	4614212	tRNA	Herpes_simplex_virus(16.67%)	16	NA	NA
AWY91333.1|3550556_3553649_-	beta-galactosidase subunit alpha	NA	L0N6M2	Herpes_simplex_virus	34.1	6.5e-157
AWY91334.1|3553832_3554816_-	transcriptional regulator	NA	NA	NA	NA	NA
AWY91335.1|3554745_3554928_-	hypothetical protein	NA	NA	NA	NA	NA
AWY91336.1|3555034_3555367_+|tRNA	tRNA-binding protein	tRNA	NA	NA	NA	NA
AWY92452.1|3555408_3556788_-	putrescine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	28.6	2.0e-33
AWY92453.1|3556723_3556930_-	hypothetical protein	NA	NA	NA	NA	NA
AWY91337.1|3557205_3558726_+	aerotaxis receptor	NA	A0A1B0V854	Salmonella_phage	51.5	3.1e-35
AWY91338.1|3558879_3559503_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
AWY91339.1|3559790_3560555_+	siderophore-interacting protein	NA	NA	NA	NA	NA
AWY91340.1|3560808_3561315_+	mismatch-specific DNA-glycosylase	NA	NA	NA	NA	NA
AWY91341.1|3561393_3563235_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.3e-35
AWY91342.1|3563293_3563416_-	RNA polymerase subunit sigma	NA	NA	NA	NA	NA
AWY91343.1|3563429_3565175_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.4	1.1e-76
AWY91344.1|3565285_3565501_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
AWY91345.1|3565499_3565730_+	hypothetical protein	NA	NA	NA	NA	NA
AWY91346.1|3565738_3566752_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.2	6.3e-109
>prophage 270
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	3573135	3574374	4614212	tRNA	Sinorhizobium_phage(100.0%)	1	NA	NA
AWY91354.1|3573135_3574374_-|tRNA	multifunctional CCA tRNA nucleotidyl transferase/2'3'-cyclic phosphodiesterase/2'nucleotidase/phosphatase	tRNA	A0A0F6YPT7	Sinorhizobium_phage	51.9	3.5e-93
>prophage 271
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	3579511	3580945	4614212		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
AWY91358.1|3579511_3580945_+	bifunctional heptose 7-phosphate kinase/heptose 1-phosphate adenyltransferase	NA	A0A1B1IUK5	uncultured_Mediterranean_phage	29.4	3.0e-40
>prophage 272
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	3590460	3601423	4614212		Staphylococcus_phage(20.0%)	13	NA	NA
AWY91369.1|3590460_3591114_+	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	44.3	4.9e-46
AWY91370.1|3591375_3591546_+	DUF4051 domain-containing protein	NA	NA	NA	NA	NA
AWY91371.1|3591603_3592377_-	zinc transporter ZupT	NA	NA	NA	NA	NA
AWY91372.1|3592519_3593308_+	4,5-DOPA dioxygenase extradiol	NA	NA	NA	NA	NA
AWY91373.1|3593345_3594506_-	hypothetical protein	NA	B2ZXR7	Ralstonia_phage	43.1	3.5e-87
AWY91374.1|3594511_3595183_-	DUF1190 domain-containing protein	NA	A0A173GEW8	Erwinia_phage	44.3	4.8e-33
AWY91375.1|3595070_3595331_-	hypothetical protein	NA	NA	NA	NA	NA
AWY91376.1|3595330_3596812_-	outer membrane protein TolC	NA	NA	NA	NA	NA
AWY91377.1|3597016_3597646_+	ADP-ribose diphosphatase	NA	A0A1S6L1P8	Vibrio_phage	32.5	9.2e-18
AWY91378.1|3597646_3598069_+	DUF1249 domain-containing protein	NA	NA	NA	NA	NA
AWY91379.1|3598093_3598921_+	3',5'-cyclic-AMP phosphodiesterase	NA	NA	NA	NA	NA
AWY91380.1|3598920_3599502_+	esterase YqiA	NA	NA	NA	NA	NA
AWY91381.1|3599530_3601423_+	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	35.1	3.4e-92
>prophage 273
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	3605250	3605643	4614212		Stx_converting_phage(100.0%)	1	NA	NA
AWY91387.1|3605250_3605643_+	TIGR00156 family protein	NA	A0A1I9LJU6	Stx_converting_phage	49.1	9.4e-21
>prophage 274
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	3608953	3618304	4614212		Bacillus_virus(33.33%)	7	NA	NA
AWY91393.1|3608953_3611212_+	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	35.1	1.4e-84
AWY91394.1|3611445_3612183_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
AWY91395.1|3612257_3613670_+	cell division protein FtsP	NA	NA	NA	NA	NA
AWY91396.1|3613780_3616000_+	YgiQ family radical SAM protein	NA	M1QSD9	Pseudomonas_phage	70.4	7.8e-104
AWY91397.1|3616042_3616300_-	hypothetical protein	NA	NA	NA	NA	NA
AWY91398.1|3616350_3617277_-	DUF3828 domain-containing protein	NA	NA	NA	NA	NA
AWY91399.1|3617476_3618304_-	2,5-diketo-D-gluconic acid reductase A	NA	A0A2H4PQR8	Staphylococcus_phage	45.2	7.2e-63
>prophage 275
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	3624380	3625265	4614212		Diadromus_pulchellus_ascovirus(100.0%)	1	NA	NA
AWY91407.1|3624380_3625265_-	NAD(P)-dependent oxidoreductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	47.1	1.7e-65
>prophage 276
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	3647478	3648651	4614212		Emiliania_huxleyi_virus(100.0%)	1	NA	NA
AWY91432.1|3647478_3648651_-	aminotransferase class V-fold PLP-dependent enzyme	NA	D2TEZ5	Emiliania_huxleyi_virus	30.7	5.5e-40
>prophage 277
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	3695680	3696700	4614212		Tetraselmis_virus(100.0%)	1	NA	NA
AWY91468.1|3695680_3696700_-	KpsF/GutQ family sugar-phosphate isomerase	NA	A0A2P0VNK5	Tetraselmis_virus	31.4	1.4e-36
>prophage 278
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	3700891	3703026	4614212		Klebsiella_phage(33.33%)	4	NA	NA
AWY91474.1|3700891_3701113_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.1e-10
AWY91475.1|3701175_3701622_-	DNA repair protein RadC	NA	NA	NA	NA	NA
AWY91476.1|3701667_3702153_-	antirestriction protein	NA	A0A2D0W9W4	Bordetella_phage	34.4	2.0e-12
AWY91477.1|3702207_3703026_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	37.3	7.4e-44
>prophage 279
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	3711763	3712210	4614212	integrase	Enterobacteria_phage(100.0%)	1	3705799:3705813	3712653:3712667
3705799:3705813	attL	GCTCCGTCAGTGAGT	NA	NA	NA	NA
AWY91485.1|3711763_3712210_-|integrase	integrase	integrase	Q7M297	Enterobacteria_phage	39.5	4.5e-19
AWY91485.1|3711763_3712210_-|integrase	integrase	integrase	Q7M297	Enterobacteria_phage	39.5	4.5e-19
3712653:3712667	attR	GCTCCGTCAGTGAGT	NA	NA	NA	NA
>prophage 280
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	3735405	3736560	4614212		Staphylococcus_phage(100.0%)	1	NA	NA
AWY91512.1|3735405_3736560_-	S-adenosylmethionine synthase	NA	A0A2H4PQS6	Staphylococcus_phage	63.2	4.0e-128
>prophage 281
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	3764855	3766088	4614212		Catovirus(100.0%)	1	NA	NA
AWY91540.1|3764855_3766088_+	D-3-phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	48.4	1.9e-104
>prophage 282
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	3774223	3779602	4614212		Prochlorococcus_phage(50.0%)	3	NA	NA
AWY91550.1|3774223_3777097_+	glycine dehydrogenase	NA	E3SN07	Prochlorococcus_phage	52.0	3.7e-263
AWY91551.1|3777362_3778106_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
AWY91552.1|3778162_3779602_-	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	26.1	4.4e-31
>prophage 283
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	3783520	3798912	4614212	tRNA	Brevibacillus_phage(14.29%)	14	NA	NA
AWY91559.1|3783520_3784417_+	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	28.6	6.7e-30
AWY91560.1|3784441_3785152_+	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
AWY91561.1|3785157_3786891_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	28.5	3.2e-60
AWY91562.1|3786981_3788079_+	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	39.0	1.8e-05
AWY91563.1|3788089_3789607_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.7	5.9e-87
AWY91564.1|3789649_3790198_-	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
AWY91565.1|3790320_3790446_-	hypothetical protein	NA	NA	NA	NA	NA
AWY91566.1|3790447_3791896_-	uric acid transporter UacT	NA	Q9KX94	Enterobacteria_phage	26.8	7.3e-26
AWY91567.1|3791942_3792029_-	purine permease YgfU	NA	NA	NA	NA	NA
AWY91568.1|3792331_3794251_+	oxidoreductase (Fe-S)-binding subunit	NA	NA	NA	NA	NA
AWY91569.1|3794250_3794739_+	electron transport protein HydN	NA	NA	NA	NA	NA
AWY91570.1|3794774_3796142_-	guanine/hypoxanthine permease GhxQ	NA	A0A0R6PHV4	Moraxella_phage	73.1	2.1e-160
AWY91571.1|3796177_3797497_-	guanine deaminase	NA	NA	NA	NA	NA
AWY91572.1|3797511_3798912_-	xanthine permease XanP	NA	H9YQ34	environmental_Halophage	46.1	1.7e-19
>prophage 284
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	3823370	3826243	4614212	transposase	Clostridium_phage(50.0%)	3	NA	NA
AWY91590.1|3823370_3824126_+	hypothetical protein	NA	I2E8W3	Clostridium_phage	36.8	1.1e-12
AWY91591.1|3824473_3825067_+	hypothetical protein	NA	NA	NA	NA	NA
AWY91592.1|3825080_3826243_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	4.0e-51
>prophage 285
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	3831137	3833632	4614212		Trichoplusia_ni_ascovirus(50.0%)	2	NA	NA
AWY91596.1|3831137_3831899_+	2-deoxy-D-gluconate 3-dehydrogenase	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.7	7.7e-19
AWY92462.1|3832213_3833632_+	sugar porter family MFS transporter	NA	O13311	Aichi_virus	26.9	1.0e-24
>prophage 286
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	3843263	3850036	4614212		Moraxella_phage(33.33%)	6	NA	NA
AWY91605.1|3843263_3843977_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	47.3	2.6e-45
AWY91606.1|3844045_3844735_-	DNA mismatch repair protein MutH	NA	NA	NA	NA	NA
AWY91607.1|3845419_3845950_+	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
AWY91608.1|3845962_3848209_+	phosphoenolpyruvate-protein phosphotransferase PtsP	NA	A0A1V0SGR7	Hokovirus	26.2	4.6e-11
AWY91609.1|3848359_3849235_+	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
AWY91610.1|3849241_3850036_+	thymidylate synthase	NA	A6M9A2	Geobacillus_virus	70.8	7.6e-118
>prophage 287
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	3855513	3871061	4614212	protease,tRNA	Bacillus_phage(33.33%)	9	NA	NA
AWY91616.1|3855513_3858402_+|protease	protease 3	protease	A0A1V0SJA4	Klosneuvirus	25.7	5.3e-68
AWY91617.1|3858394_3861937_+	exodeoxyribonuclease V subunit beta	NA	A7KV33	Bacillus_phage	20.9	1.5e-08
AWY91618.1|3861936_3863763_+	RecBCD enzyme subunit RecD	NA	A0A1P8DII4	Virus_Rctr197k	26.7	3.5e-25
AWY91619.1|3863824_3865156_-	N-acetylglutamate synthase	NA	NA	NA	NA	NA
AWY91620.1|3865387_3866641_+	N-acetylmuramoyl-L-alanine amidase	NA	Q5YA51	Bacillus_phage	28.6	2.2e-15
AWY91621.1|3867219_3868317_+	murein transglycosylase A	NA	NA	NA	NA	NA
AWY91622.1|3868555_3869362_+|tRNA	tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA	tRNA	S4VW33	Pandoravirus	33.3	2.2e-16
AWY91623.1|3869412_3869856_-	sulfur acceptor protein CsdE	NA	NA	NA	NA	NA
AWY91624.1|3869855_3871061_-	cysteine desulfurase CsdA	NA	Q2XUY6	environmental_halophage	36.8	3.0e-73
>prophage 288
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	3879283	3880783	4614212		Bacillus_virus(100.0%)	1	NA	NA
AWY91633.1|3879283_3880783_+	sugar ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	25.8	3.9e-14
>prophage 289
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	3887500	3888256	4614212		Bacillus_phage(100.0%)	1	NA	NA
AWY91640.1|3887500_3888256_-	flap endonuclease Xni	NA	F8WQ40	Bacillus_phage	33.5	5.0e-10
>prophage 290
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	3893114	3893963	4614212		Vibrio_phage(100.0%)	1	NA	NA
AWY91644.1|3893114_3893963_-	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	37.1	8.0e-41
>prophage 291
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	3901498	3905613	4614212		Hokovirus(50.0%)	2	NA	NA
AWY91652.1|3901498_3904255_-	two-component sensor histidine kinase BarA	NA	A0A1V0SGX0	Hokovirus	30.6	1.9e-54
AWY91653.1|3904311_3905613_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	27.9	3.9e-39
>prophage 292
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	3909645	3914565	4614212		Only_Syngen_Nebraska_virus(33.33%)	5	NA	NA
AWY91658.1|3909645_3911283_+	CTP synthetase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	50.4	1.8e-153
AWY91659.1|3911370_3912669_+	enolase	NA	A0A1X9I5Z8	Streptococcus_phage	58.8	2.0e-131
AWY91660.1|3912728_3913601_-	TPM domain protein phosphatase	NA	NA	NA	NA	NA
AWY91661.1|3913614_3913755_-	hypothetical protein	NA	NA	NA	NA	NA
AWY91662.1|3913893_3914565_+	7-carboxy-7-deazaguanine synthase QueE	NA	A0A2I7S8X1	Vibrio_phage	25.0	1.7e-14
>prophage 293
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	3919466	3920252	4614212		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
AWY91665.1|3919466_3920252_+	KR domain-containing protein	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.1	6.5e-21
>prophage 294
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	3936513	3938546	4614212		Hokovirus(50.0%)	2	NA	NA
AWY91681.1|3936513_3937941_+	sulfate adenylyltransferase	NA	A0A1V0SGC3	Hokovirus	31.1	1.1e-29
AWY91682.1|3937940_3938546_+	adenylyl-sulfate kinase	NA	A0A2K9L4R9	Tupanvirus	38.1	4.2e-28
>prophage 295
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	3941658	3954841	4614212		Escherichia_phage(50.0%)	12	NA	NA
AWY91688.1|3941658_3942420_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
AWY91689.1|3942413_3943040_+	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
AWY91690.1|3943179_3944319_+	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
AWY91691.1|3944381_3945374_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
AWY91692.1|3945467_3946832_-	permease	NA	NA	NA	NA	NA
AWY91693.1|3946920_3947697_-	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
AWY91694.1|3947701_3948340_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
AWY91695.1|3948336_3949599_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.4	4.9e-135
AWY91696.1|3949595_3950504_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.5	5.1e-118
AWY91697.1|3950699_3951467_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	2.5e-70
AWY91698.1|3951517_3952174_-	protein-serine/threonine phosphatase	NA	A0A077SLQ6	Escherichia_phage	46.6	8.6e-51
AWY91699.1|3952279_3954841_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	3.0e-30
>prophage 296
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	3972669	3973680	4614212		Enterobacteria_phage(100.0%)	1	NA	NA
AWY92465.1|3972669_3973680_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	28.6	3.5e-27
>prophage 297
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	3981155	3982121	4614212		Tetraselmis_virus(100.0%)	1	NA	NA
AWY91720.1|3981155_3982121_-	arabinose 5-phosphate isomerase GutQ	NA	A0A2P0VNK5	Tetraselmis_virus	33.9	2.3e-36
>prophage 298
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	3987588	3992974	4614212	tRNA	Pseudomonas_phage(25.0%)	5	NA	NA
AWY91728.1|3987588_3988086_+	nicotinamide-nucleotide amidohydrolase PncC	NA	B5TK85	Pseudomonas_phage	49.7	4.4e-31
AWY91729.1|3988165_3989227_+	DNA recombination/repair protein RecA	NA	A0A2D1GPX2	Mycobacterium_phage	63.4	1.2e-113
AWY91730.1|3989295_3989796_+	regulatory protein RecX	NA	NA	NA	NA	NA
AWY91731.1|3989923_3992554_+|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	38.6	5.5e-80
AWY91732.1|3992788_3992974_+	carbon storage regulator	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
>prophage 299
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	4006022	4011317	4614212		Bacillus_virus(20.0%)	5	NA	NA
AWY91746.1|4006022_4007225_-	glycine betaine/L-proline ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	39.4	4.9e-28
AWY91747.1|4007578_4008538_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	71.5	1.0e-132
AWY91748.1|4008547_4010692_-	ribonucleotide-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	48.5	1.7e-196
AWY91749.1|4010664_4011075_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	44.4	4.6e-18
AWY91750.1|4011071_4011317_-	NrdH-redoxin	NA	Q5K5J3	Oenococcus_phage	35.3	1.8e-06
>prophage 300
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	4015252	4019377	4614212		Clostridium_phage(50.0%)	4	NA	NA
AWY91758.1|4015252_4015702_+	peptidoglycan-binding protein LysM	NA	A0A090DBR9	Clostridium_phage	39.5	2.0e-06
AWY91759.1|4015702_4016365_-	transcriptional regulator	NA	NA	NA	NA	NA
AWY91760.1|4016385_4017786_-	GABA permease	NA	NA	NA	NA	NA
AWY91761.1|4018096_4019377_-	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	30.1	4.2e-33
>prophage 301
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	4026306	4030601	4614212		Clostridium_phage(33.33%)	3	NA	NA
AWY91767.1|4026306_4027863_-	recombinase family protein	NA	A0A0A7RTP8	Clostridium_phage	30.0	3.2e-19
AWY91768.1|4028145_4029375_-	DUF4102 domain-containing protein	NA	A0A1B5FPC6	Escherichia_phage	86.6	4.6e-207
AWY91769.1|4030118_4030601_-	SsrA-binding protein	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
>prophage 302
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	4044234	4045305	4614212		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
AWY91785.1|4044234_4045305_+	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	4.0e-90
>prophage 303
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	4051210	4053784	4614212		Enterobacteria_phage(100.0%)	1	NA	NA
AWY91793.1|4051210_4053784_+	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.2	5.8e-127
>prophage 304
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	4059552	4060851	4614212		Burkholderia_virus(100.0%)	1	NA	NA
AWY91795.1|4059552_4060851_+	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	32.2	1.3e-45
>prophage 305
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	4066144	4072403	4614212		Achromobacter_phage(25.0%)	8	NA	NA
AWY91800.1|4066144_4066564_-	thiol disulfide reductase thioredoxin	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
AWY91801.1|4066577_4066781_+	hypothetical protein	NA	NA	NA	NA	NA
AWY91802.1|4066770_4067808_+	methyltransferase	NA	NA	NA	NA	NA
AWY91803.1|4067855_4068545_-	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	48.8	9.3e-56
AWY91804.1|4068849_4069233_+	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	72.0	1.4e-32
AWY91805.1|4069288_4069876_-	cysteine/O-acetylserine efflux protein	NA	NA	NA	NA	NA
AWY91806.1|4069978_4070860_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AWY91807.1|4071068_4072403_-	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	2.9e-45
>prophage 306
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	4078174	4081917	4614212		Tupanvirus(50.0%)	4	NA	NA
AWY91814.1|4078174_4079974_+	elongation factor 4	NA	A0A2K9L6L3	Tupanvirus	41.9	4.2e-23
AWY91815.1|4079989_4080964_+	S26 family signal peptidase	NA	NA	NA	NA	NA
AWY91816.1|4081014_4081293_-	hypothetical protein	NA	NA	NA	NA	NA
AWY91817.1|4081236_4081917_+	ribonuclease 3	NA	A0A2P0VNZ5	Tetraselmis_virus	39.6	5.6e-21
>prophage 307
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	4085376	4101822	4614212	tRNA	Bacillus_phage(33.33%)	14	NA	NA
AWY91824.1|4085376_4085637_-	ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	52.3	1.1e-17
AWY91825.1|4085692_4086541_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
AWY91826.1|4086749_4087385_+	phosphatidylglycerophosphatase C	NA	NA	NA	NA	NA
AWY91827.1|4087409_4087946_+|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
AWY91828.1|4087930_4088077_+	aldehyde dehydrogenase	NA	A0A2L1IV26	Escherichia_phage	96.4	9.8e-08
AWY91829.1|4088742_4090275_-	membrane-bound lytic murein transglycosylase MltF	NA	NA	NA	NA	NA
AWY91830.1|4090368_4090518_+	phosphoribosylglycinamide synthetase	NA	NA	NA	NA	NA
AWY91831.1|4090532_4094420_+	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	59.2	5.9e-131
AWY91832.1|4094977_4096405_+	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	24.9	3.0e-16
AWY91833.1|4096569_4097283_+	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
AWY91834.1|4097272_4098607_+	transcriptional regulator	NA	W8CYM9	Bacillus_phage	37.3	3.9e-10
AWY91835.1|4098667_4099006_+	nitrogen regulatory protein P-II 1	NA	NA	NA	NA	NA
AWY91836.1|4099050_4100241_-	flavohemoprotein	NA	NA	NA	NA	NA
AWY91837.1|4100568_4101822_+	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	52.7	7.8e-101
>prophage 308
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	4107714	4109226	4614212		Staphylococcus_phage(100.0%)	1	NA	NA
AWY91841.1|4107714_4109226_+	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	23.7	1.8e-11
>prophage 309
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	4124544	4130881	4614212		Faustovirus(20.0%)	8	NA	NA
AWY91857.1|4124544_4125759_+	IscS subfamily cysteine desulfurase	NA	A0A1X7C038	Faustovirus	31.8	8.8e-33
AWY91858.1|4125786_4126173_+	iron-sulfur cluster scaffold-like protein	NA	A0A218MKD1	uncultured_virus	78.9	1.4e-53
AWY91859.1|4126189_4126513_+	iron-sulfur cluster assembly accessory protein	NA	A0A2H4N7N5	Lake_Baikal_phage	48.6	5.4e-22
AWY91860.1|4126608_4127124_+	co-chaperone protein HscB	NA	NA	NA	NA	NA
AWY91861.1|4127140_4128991_+	molecular chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	41.6	5.5e-103
AWY91862.1|4128992_4129328_+	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
AWY91863.1|4129339_4129540_+	Fe-S assembly protein IscX	NA	NA	NA	NA	NA
AWY91864.1|4129597_4130881_+	peptidase B	NA	Q6GYZ8	Mycoplasma_phage	37.8	3.8e-34
>prophage 310
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	4141091	4141523	4614212		Powai_lake_megavirus(100.0%)	1	NA	NA
AWY91869.1|4141091_4141523_+	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	37.9	3.7e-18
>prophage 311
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	4150353	4157613	4614212		Escherichia_phage(60.0%)	7	NA	NA
AWY91878.1|4150353_4151724_-	exodeoxyribonuclease VII large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	35.3	2.4e-42
AWY91879.1|4151885_4153352_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	39.1	2.3e-88
AWY91880.1|4153420_4154998_+	GMP synthase (glutamine-hydrolyzing)	NA	NA	NA	NA	NA
AWY91881.1|4155090_4155630_-	hypothetical protein	NA	G9L6F0	Escherichia_phage	100.0	3.4e-45
AWY91882.1|4157043_4157190_-	succinate dehydrogenase	NA	NA	NA	NA	NA
AWY91883.1|4157251_4157443_-	DUF2633 domain-containing protein	NA	G9L6F2	Escherichia_phage	100.0	7.3e-27
AWY91884.1|4157460_4157613_+	hypothetical protein	NA	G9L6F3	Escherichia_phage	96.0	1.7e-18
>prophage 312
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	4163859	4167861	4614212		Prochlorococcus_phage(33.33%)	5	NA	NA
AWY91888.1|4163859_4164498_-	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	42.9	2.4e-29
AWY91889.1|4164497_4165535_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	43.3	1.1e-71
AWY91890.1|4165553_4165739_-	hypothetical protein	NA	NA	NA	NA	NA
AWY91891.1|4165859_4166486_+	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
AWY91892.1|4166571_4167861_+	uracil/xanthine transporter	NA	Q9KX94	Enterobacteria_phage	37.4	5.1e-63
>prophage 313
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	4189105	4189819	4614212		Synechococcus_phage(100.0%)	1	NA	NA
AWY91913.1|4189105_4189819_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3FGF0	Synechococcus_phage	36.1	6.9e-38
>prophage 314
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	4207107	4208058	4614212		Cyanophage(100.0%)	1	NA	NA
AWY91926.1|4207107_4208058_-	transaldolase	NA	A0A127KNC6	Cyanophage	31.3	5.7e-11
>prophage 315
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	4226811	4230533	4614212		Deep-sea_thermophilic_phage(50.0%)	5	NA	NA
AWY91945.1|4226811_4227681_-	N-acetylmuramoyl-L-alanine amidase	NA	E5DV68	Deep-sea_thermophilic_phage	27.4	4.2e-13
AWY91946.1|4227894_4228320_+	acetyltransferase YpeA	NA	NA	NA	NA	NA
AWY91947.1|4228306_4228756_+	DUF2919 domain-containing protein	NA	NA	NA	NA	NA
AWY91948.1|4228962_4229538_+	RpoE-regulated lipoprotein	NA	NA	NA	NA	NA
AWY91949.1|4229633_4230533_+	deferrochelatase/peroxidase	NA	S4VVJ7	Pandoravirus	32.6	4.5e-26
>prophage 316
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	4234186	4234978	4614212		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
AWY91953.1|4234186_4234978_+	NAD(P)-dependent oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.6	1.2e-17
>prophage 317
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	4237995	4250665	4614212		Streptococcus_phage(40.0%)	13	NA	NA
AWY91958.1|4237995_4239093_+	sulfate/thiosulfate ABC transporter ATP-binding protein CysA	NA	G9BWD6	Planktothrix_phage	38.9	1.4e-29
AWY91959.1|4239226_4240138_+	cysteine synthase B	NA	A0A1X9I5F1	Streptococcus_phage	41.9	7.7e-58
AWY91960.1|4240134_4240374_-	hypothetical protein	NA	NA	NA	NA	NA
AWY91961.1|4240342_4241077_-	WGR domain-containing protein	NA	NA	NA	NA	NA
AWY91962.1|4241109_4241484_-	hypothetical protein	NA	NA	NA	NA	NA
AWY91963.1|4241588_4242440_+	pyridoxine kinase	NA	NA	NA	NA	NA
AWY91964.1|4242482_4242992_-	glucose-specific phosphotransferase enzyme IIA component	NA	NA	NA	NA	NA
AWY91965.1|4243032_4244760_-	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	31.1	9.6e-17
AWY91966.1|4244804_4245062_-	phosphocarrier protein HPr	NA	NA	NA	NA	NA
AWY91967.1|4245445_4246417_-	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	51.0	2.8e-74
AWY91968.1|4246601_4247363_-	sulfate transporter CysZ	NA	NA	NA	NA	NA
AWY91969.1|4247592_4248579_+	cell division protein ZipA	NA	NA	NA	NA	NA
AWY91970.1|4248649_4250665_+	DNA ligase (NAD(+)) LigA	NA	A0A0K2QQN8	Ralstonia_phage	43.5	5.9e-151
>prophage 318
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	4272211	4272946	4614212		Clostridioides_phage(100.0%)	1	NA	NA
AWY91990.1|4272211_4272946_-	DNA-binding response regulator	NA	A0A2R2ZGH8	Clostridioides_phage	25.4	3.6e-13
>prophage 319
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	4276764	4277685	4614212		Morganella_phage(100.0%)	1	NA	NA
AWY91993.1|4276764_4277685_-	lipid A biosynthesis palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	54.8	4.9e-76
>prophage 320
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	4281376	4288953	4614212		Ostreococcus_lucimarinus_virus(50.0%)	4	NA	NA
AWY91998.1|4281376_4283071_+	oxalyl-CoA decarboxylase	NA	E5ERI2	Ostreococcus_lucimarinus_virus	23.6	1.4e-23
AWY91999.1|4283140_4284085_+	transporter YfdV	NA	NA	NA	NA	NA
AWY92000.1|4284158_4285304_+	acetyl-CoA--oxalate CoA-transferase	NA	NA	NA	NA	NA
AWY92001.1|4285359_4288953_-	sensor protein EvgS	NA	W8CYM9	Bacillus_phage	40.0	1.1e-09
>prophage 321
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	4296816	4309194	4614212		Enterobacteria_phage(50.0%)	12	NA	NA
AWY92008.1|4296816_4297017_-	transcriptional regulator	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
AWY92476.1|4297140_4297485_-	hypothetical protein	NA	A0A0P0ZB93	Stx2-converting_phage	97.4	1.1e-57
AWY92009.1|4297930_4299769_+	DNA transfer protein	NA	A0A192Y934	Salmonella_phage	74.6	4.0e-247
AWY92010.1|4299793_4300183_-	hypothetical protein	NA	I6S5X4	Salmonella_phage	88.4	3.0e-59
AWY92011.1|4300198_4300534_-	hypothetical protein	NA	NA	NA	NA	NA
AWY92012.1|4300530_4300785_-	Arc family DNA-binding protein	NA	A5VW60	Enterobacteria_phage	91.2	1.4e-33
AWY92013.1|4300875_4301037_+	Arc family DNA-binding protein	NA	A8CG91	Salmonella_phage	98.1	2.7e-22
AWY92014.1|4301105_4301984_+	phage repressor protein/antirepressor Ant	NA	I6R977	Salmonella_phage	78.9	1.1e-96
AWY92015.1|4302085_4304734_+	hypothetical protein	NA	A5VW57	Enterobacteria_phage	76.5	8.3e-60
AWY92016.1|4304780_4306106_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
AWY92017.1|4306792_4307950_-	DUF4102 domain-containing protein	NA	A5VW56	Enterobacteria_phage	99.5	2.8e-222
AWY92018.1|4308261_4309194_-	hypothetical protein	NA	E7DYY8	Enterobacteria_phage	99.4	2.3e-166
>prophage 322
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	4327871	4328957	4614212		Pandoravirus(100.0%)	1	NA	NA
AWY92037.1|4327871_4328957_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	47.8	7.0e-90
>prophage 323
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	4337493	4338630	4614212		Brazilian_cedratvirus(100.0%)	1	NA	NA
AWY92046.1|4337493_4338630_+	erythronate-4-phosphate dehydrogenase	NA	A0A2R8FDS8	Brazilian_cedratvirus	28.8	5.9e-23
>prophage 324
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	4345106	4346624	4614212		Mollivirus(100.0%)	1	NA	NA
AWY92054.1|4345106_4346624_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	44.0	5.9e-87
>prophage 325
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	4350835	4352696	4614212	transposase	Acanthocystis_turfacea_Chlorella_virus(50.0%)	2	NA	NA
AWY92060.1|4350835_4351609_+	histidine transport ATP-binding protein HisP	NA	M1I0T9	Acanthocystis_turfacea_Chlorella_virus	28.2	2.1e-08
AWY92061.1|4351805_4352696_+|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	44.2	5.2e-67
>prophage 326
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	4363256	4366484	4614212		Acanthocystis_turfacea_Chlorella_virus(50.0%)	3	NA	NA
AWY92073.1|4363256_4363907_+	sugar phosphatase YfbT	NA	M1IMD4	Acanthocystis_turfacea_Chlorella_virus	35.4	3.1e-08
AWY92074.1|4363993_4365826_+	transporter	NA	NA	NA	NA	NA
AWY92075.1|4365884_4366484_-	5'-deoxynucleotidase	NA	A0A2L0V156	Salmonella_phage	38.6	7.0e-07
>prophage 327
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	4385432	4386790	4614212	transposase	Bacillus_phage(100.0%)	1	NA	NA
AWY92092.1|4385432_4386790_-|transposase	IS3-like element ISEcB1 family transposase	transposase	A0A1B1P773	Bacillus_phage	51.9	2.5e-76
>prophage 328
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	4402402	4407406	4614212		Tupanvirus(50.0%)	4	NA	NA
AWY92108.1|4402402_4404385_-	bifunctional UDP-glucuronic acid oxidase/UDP-4-amino-4-deoxy-L-arabinose formyltransferase	NA	A0A2K9KZK0	Tupanvirus	25.8	1.8e-19
AWY92109.1|4404384_4405353_-	undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase	NA	F1C5B0	Cronobacter_phage	31.5	8.8e-36
AWY92480.1|4405356_4406496_-	UDP-4-amino-4-deoxy-L-arabinose-oxoglutarate aminotransferase	NA	A0A2K9L470	Tupanvirus	29.8	1.5e-29
AWY92110.1|4406803_4407406_+	histidine phosphatase family protein	NA	A0A2L1IV13	Escherichia_phage	42.9	2.6e-09
>prophage 329
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	4411009	4415325	4614212	transposase	Oenococcus_phage(50.0%)	4	NA	NA
AWY92481.1|4411009_4412215_+	L-rhamnonate dehydratase	NA	Q6A202	Oenococcus_phage	28.3	1.2e-26
AWY92115.1|4412271_4413561_+	MFS transporter	NA	NA	NA	NA	NA
AWY92116.1|4413578_4414382_+	2-keto-3-deoxy-L-rhamnonate aldolase	NA	NA	NA	NA	NA
AWY92117.1|4414422_4415325_-|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	54.4	2.1e-68
>prophage 330
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	4421217	4427372	4614212		Pseudomonas_phage(50.0%)	6	NA	NA
AWY92122.1|4421217_4422294_+	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	46.0	3.0e-08
AWY92123.1|4422335_4422542_-	hypothetical protein	NA	NA	NA	NA	NA
AWY92124.1|4422756_4423407_+	protein InaA	NA	NA	NA	NA	NA
AWY92125.1|4423460_4423715_-	ferredoxin	NA	G9IAA2	Pseudomonas_phage	73.1	2.6e-24
AWY92482.1|4423714_4424845_-	ribonucleotide-diphosphate reductase subunit beta	NA	G9IAA3	Pseudomonas_phage	78.9	2.5e-175
AWY92126.1|4425086_4427372_-	ribonucleoside-diphosphate reductase 1 subunit alpha	NA	A0A2D1GNB1	Pseudoalteromonas_phage	63.6	2.5e-283
>prophage 331
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	4432816	4435444	4614212		Bacillus_virus(100.0%)	1	NA	NA
AWY92129.1|4432816_4435444_+	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	31.4	1.4e-88
>prophage 332
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	4450367	4455210	4614212		Bacillus_phage(50.0%)	2	NA	NA
AWY92140.1|4450367_4452194_-	two-component system sensor histidine kinase AtoS	NA	W8CYF6	Bacillus_phage	27.3	1.5e-20
AWY92141.1|4452360_4455210_+	hybrid sensor histidine kinase/response regulator	NA	A0A1V0SGX0	Hokovirus	27.2	2.4e-41
>prophage 333
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	4461830	4465264	4614212		Acanthamoeba_polyphaga_mimivirus(33.33%)	3	NA	NA
AWY92147.1|4461830_4462895_+	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	49.5	2.4e-18
AWY92148.1|4462894_4463545_+	DNA oxidative demethylase AlkB	NA	A0A2K9L3R7	Tupanvirus	32.7	2.9e-06
AWY92149.1|4463620_4465264_+	microcin J25 efflux ABC transporter YojI	NA	W8CYL7	Bacillus_phage	24.0	1.2e-13
>prophage 334
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	4474706	4475330	4614212		Bacillus_virus(100.0%)	1	NA	NA
AWY92160.1|4474706_4475330_+	cytochrome c biogenesis ATP-binding export protein CcmA	NA	G3M9Y6	Bacillus_virus	25.5	2.0e-12
>prophage 335
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	4487204	4494852	4614212		Vibrio_phage(50.0%)	8	NA	NA
AWY92173.1|4487204_4488212_+	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	48.6	6.9e-84
AWY92174.1|4488350_4488635_-	50S ribosomal protein L25	NA	NA	NA	NA	NA
AWY92175.1|4488759_4490520_-	ATP-dependent helicase	NA	M4Q3N1	Vibrio_phage	41.8	2.4e-100
AWY92176.1|4490545_4490668_-	aldose epimerase	NA	NA	NA	NA	NA
AWY92177.1|4490668_4491364_+	16S rRNA pseudouridine(516) synthase	NA	NA	NA	NA	NA
AWY92178.1|4491391_4492582_+	Bcr/CflA family drug resistance efflux transporter	NA	S4TR35	Salmonella_phage	23.7	2.2e-20
AWY92179.1|4492914_4493259_+	hypothetical protein	NA	NA	NA	NA	NA
AWY92180.1|4493262_4494852_-	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	34.0	3.2e-19
>prophage 336
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	4500606	4504907	4614212		Clostridioides_phage(50.0%)	4	NA	NA
AWY92185.1|4500606_4501173_-	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A1V0DZX6	Clostridioides_phage	40.7	4.2e-14
AWY92186.1|4501584_4502298_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
AWY92187.1|4502336_4503323_-	GTP-binding protein	NA	NA	NA	NA	NA
AWY92188.1|4503440_4504907_-	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	29.4	2.3e-43
>prophage 337
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	4519404	4520262	4614212		Catovirus(100.0%)	1	NA	NA
AWY92202.1|4519404_4520262_-	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	35.0	3.1e-24
>prophage 338
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	4524332	4528118	4614212	tRNA	Acinetobacter_phage(50.0%)	5	NA	NA
AWY92207.1|4524332_4526324_+	colicin I receptor	NA	A0A0P0I887	Acinetobacter_phage	36.6	2.0e-13
AWY92208.1|4526355_4527192_-	S-formylglutathione hydrolase YeiG	NA	NA	NA	NA	NA
AWY92209.1|4527119_4527296_-	hypothetical protein	NA	NA	NA	NA	NA
AWY92210.1|4527352_4527466_+|tRNA	phenylalanyl-tRNA synthetase subunit beta	tRNA	NA	NA	NA	NA
AWY92211.1|4527449_4528118_+	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	56.3	9.0e-56
>prophage 339
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	4531812	4533333	4614212		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
AWY92216.1|4531812_4533333_+	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	33.0	2.6e-10
>prophage 340
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	4553735	4563177	4614212		Enterobacteria_phage(85.71%)	10	NA	NA
AWY92236.1|4553735_4554662_+	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	26.8	5.7e-08
AWY92237.1|4554666_4555398_+	osmoprotectant uptake system permease	NA	NA	NA	NA	NA
AWY92238.1|4555378_4555486_-	hypothetical protein	NA	NA	NA	NA	NA
AWY92239.1|4555545_4556277_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
AWY92240.1|4556498_4558184_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
AWY92241.1|4558180_4558900_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AWY92242.1|4558946_4559417_+	DUF1456 domain-containing protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
AWY92243.1|4559457_4559919_-	hypothetical protein	NA	Q9EYF5	Enterobacteria_phage	99.3	3.2e-76
AWY92244.1|4560043_4562044_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	96.6	0.0e+00
AWY92245.1|4562040_4563177_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.4	3.2e-162
>prophage 341
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	4574809	4576843	4614212	tRNA	Indivirus(100.0%)	1	NA	NA
AWY92251.1|4574809_4576843_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	2.3e-54
>prophage 342
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	4584609	4586127	4614212		Streptococcus_phage(100.0%)	1	NA	NA
AWY92259.1|4584609_4586127_+	SIR2 family protein	NA	A0A1S5SA14	Streptococcus_phage	30.1	1.3e-30
>prophage 343
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	4589137	4589713	4614212		Mycobacterium_phage(100.0%)	1	NA	NA
AWY92261.1|4589137_4589713_-	recombinase family protein	NA	G8I4U3	Mycobacterium_phage	38.7	1.4e-25
>prophage 344
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	4595977	4599534	4614212		Paenibacillus_phage(50.0%)	4	NA	NA
AWY92271.1|4595977_4596796_+	hypothetical protein	NA	D0R7H8	Paenibacillus_phage	38.0	2.9e-24
AWY92272.1|4596847_4597594_+	transcriptional regulator	NA	NA	NA	NA	NA
AWY92273.1|4597567_4598533_-	sugar kinase	NA	NA	NA	NA	NA
AWY92274.1|4598529_4599534_-	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.4	5.8e-14
>prophage 345
CP029371	Escherichia coli strain C chromosome, complete genome	4614212	4608746	4613951	4614212	integrase	Salmonella_phage(37.5%)	10	4601673:4601685	4613329:4613341
4601673:4601685	attL	TAACTCCGCCTTT	NA	NA	NA	NA
AWY92284.1|4608746_4609646_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.3e-12
AWY92285.1|4610050_4610368_+	hypothetical protein	NA	NA	NA	NA	NA
AWY92286.1|4610355_4610571_+	hypothetical protein	NA	NA	NA	NA	NA
AWY92287.1|4610633_4611647_-|integrase	site-specific integrase	integrase	Q83VS6	Escherichia_phage	99.1	4.1e-193
AWY92288.1|4611762_4612062_-	helix-turn-helix domain-containing protein	NA	Q1JS61	Enterobacteria_phage	100.0	2.4e-48
AWY92289.1|4612183_4612459_+	hypothetical protein	NA	Q1JS60	Enterobacteria_phage	100.0	1.3e-48
AWY92290.1|4612636_4613137_+	replication protein B	NA	A0A0F7LBQ6	Escherichia_phage	100.0	4.5e-92
AWY92291.1|4613200_4613425_+	DUF2732 domain-containing protein	NA	S4TP68	Salmonella_phage	95.9	1.5e-31
4613329:4613341	attR	AAAGGCGGAGTTA	NA	NA	NA	NA
AWY92292.1|4613424_4613724_+	hypothetical protein	NA	S4TUD1	Salmonella_phage	99.0	3.2e-45
AWY92293.1|4613726_4613951_+	hypothetical protein	NA	S4TRY6	Salmonella_phage	98.6	1.5e-34
