The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP019612	Mycobacterium tuberculosis strain H107 chromosome, complete genome	4418796	999926	1051858	4418796	transposase,protease,tRNA,integrase	Klosneuvirus(18.18%)	54	1007749:1007765	1056807:1056823
AWY80167.1|999926_1001486_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SHR2	Klosneuvirus	39.2	2.8e-100
AWY83075.1|1001571_1002366_+	DNAase	NA	NA	NA	NA	NA
AWY80168.1|1002573_1003662_+	resuscitation-promoting factor RpfB	NA	Q856D9	Mycobacterium_phage	59.4	8.2e-22
AWY80169.1|1003634_1004588_+	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase	NA	NA	NA	NA	NA
AWY83076.1|1004673_1005594_+	4-diphosphocytidyl-2C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
AWY80170.1|1005610_1005904_+	hypothetical protein	NA	NA	NA	NA	NA
AWY83077.1|1005951_1006182_-	hypothetical protein	NA	NA	NA	NA	NA
AWY80171.1|1006107_1007742_+	polyketide synthase	NA	NA	NA	NA	NA
1007749:1007765	attL	CGAGCAGACGCAAAATC	NA	NA	NA	NA
AWY80172.1|1007815_1008391_-|tRNA	peptidyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
AWY80173.1|1008403_1009051_-	50S ribosomal protein L25/general stress protein Ctc	NA	NA	NA	NA	NA
AWY80174.1|1009267_1009948_-	hypothetical protein	NA	NA	NA	NA	NA
AWY80175.1|1009983_1010964_-	ribose-phosphate pyrophosphokinase	NA	A0A1V0SHF7	Hokovirus	32.7	1.8e-44
AWY80176.1|1011055_1012543_-	bifunctional N-acetylglucosamine-1-phosphate uridyltransferase/glucosamine-1-phosphate acetyltransferase	NA	NA	NA	NA	NA
AWY83078.1|1012797_1013391_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AWY80177.1|1013449_1017154_+	transcription-repair coupling factor	NA	NA	NA	NA	NA
AWY83079.1|1017153_1018131_+	nucleoside triphosphate pyrophosphohydrolase	NA	NA	NA	NA	NA
AWY80178.1|1018218_1018950_+	hypothetical protein	NA	NA	NA	NA	NA
AWY80179.1|1019046_1020336_+	enolase	NA	W6LP63	Streptococcus_phage	56.6	2.1e-133
AWY80180.1|1020340_1021027_+	septation inhibitor protein	NA	NA	NA	NA	NA
AWY83080.1|1021043_1021511_+	hypothetical protein	NA	NA	NA	NA	NA
AWY80181.1|1021501_1022461_+	exopolyphosphatase	NA	NA	NA	NA	NA
AWY80182.1|1022700_1022913_+	hypothetical protein	NA	NA	NA	NA	NA
AWY80183.1|1022909_1023590_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	30.6	4.2e-24
AWY80184.1|1023586_1026169_-	sensor protein KdpD	NA	NA	NA	NA	NA
AWY80185.1|1026259_1026406_+	potassium transporter Trk	NA	NA	NA	NA	NA
AWY83081.1|1026402_1026495_+	K+-transporting ATPase subunit F	NA	NA	NA	NA	NA
AWY80186.1|1026494_1028210_+	potassium-transporting ATPase A chain	NA	NA	NA	NA	NA
AWY80187.1|1028206_1030336_+	potassium-transporting ATPase B chain	NA	M1HRW9	Paramecium_bursaria_Chlorella_virus	26.2	3.8e-23
AWY80188.1|1030335_1030905_+	potassium-transporting ATPase C chain	NA	NA	NA	NA	NA
AWY80189.1|1030908_1032438_-	two-component sensor histidine kinase	NA	NA	NA	NA	NA
AWY80190.1|1032445_1033219_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	36.3	2.3e-34
AWY80191.1|1035026_1035311_-	ESAT-6-like protein EsxI	NA	NA	NA	NA	NA
AWY80192.1|1035337_1035634_-	WXG100 family type VII secretion target	NA	NA	NA	NA	NA
AWY80193.1|1035779_1036955_-	PPE family protein	NA	NA	NA	NA	NA
AWY80194.1|1037031_1037859_-	PE family protein	NA	NA	NA	NA	NA
AWY80195.1|1038419_1038668_+	hypothetical protein	NA	NA	NA	NA	NA
AWY80196.1|1038646_1038886_-	hypothetical protein	NA	NA	NA	NA	NA
AWY80197.1|1038791_1039010_-	hypothetical protein	NA	NA	NA	NA	NA
AWY80198.1|1039054_1039918_-|transposase	IS5 family transposase	transposase	A0A1V0SLQ8	Klosneuvirus	28.7	1.9e-05
AWY83082.1|1040264_1041290_-|protease	serine protease	protease	NA	NA	NA	NA
AWY80199.1|1041536_1042160_+	hypothetical protein	NA	NA	NA	NA	NA
AWY80200.1|1042156_1043038_+	hypothetical protein	NA	NA	NA	NA	NA
AWY80201.1|1043119_1043908_-	hypothetical protein	NA	NA	NA	NA	NA
AWY80202.1|1043907_1045155_+|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	45.1	3.1e-81
AWY80203.1|1045522_1046638_-	hypothetical protein	NA	NA	NA	NA	NA
AWY80204.1|1046594_1046798_-	hypothetical protein	NA	NA	NA	NA	NA
AWY80205.1|1046870_1047317_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AWY83083.1|1047365_1048271_+	oxidoreductase	NA	NA	NA	NA	NA
AWY80206.1|1048429_1049185_-	hypothetical protein	NA	NA	NA	NA	NA
AWY83084.1|1049479_1050106_-	hypothetical protein	NA	NA	NA	NA	NA
AWY80207.1|1050151_1050355_+	hypothetical protein	NA	NA	NA	NA	NA
AWY80208.1|1051050_1051389_+|integrase	integrase	integrase	NA	NA	NA	NA
AWY83085.1|1051412_1051727_+|integrase	integrase	integrase	Q854H9	Mycobacterium_phage	53.6	1.0e-09
AWY80209.1|1051663_1051858_+|integrase	integrase	integrase	A0A2H4JG32	uncultured_Caudovirales_phage	54.5	3.8e-07
1056807:1056823	attR	CGAGCAGACGCAAAATC	NA	NA	NA	NA
>prophage 2
CP019612	Mycobacterium tuberculosis strain H107 chromosome, complete genome	4418796	2807911	2849239	4418796	capsid,protease,tRNA,transposase,integrase	Mycobacterium_phage(27.27%)	54	2836712:2836739	2846336:2846363
AWY81663.1|2807911_2809990_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	34.9	2.5e-104
AWY81664.1|2810098_2810326_+	hypothetical protein	NA	NA	NA	NA	NA
AWY83275.1|2810322_2811708_-	PE family protein	NA	NA	NA	NA	NA
AWY81665.1|2812052_2812553_+	hypothetical protein	NA	NA	NA	NA	NA
AWY81666.1|2812569_2813010_-	hypothetical protein	NA	NA	NA	NA	NA
AWY83276.1|2813156_2813834_+	transcriptional regulator	NA	NA	NA	NA	NA
AWY81667.1|2813818_2814172_-	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
AWY81668.1|2814184_2814610_-	hypothetical protein	NA	NA	NA	NA	NA
AWY81669.1|2814606_2815281_-	transcriptional regulator	NA	NA	NA	NA	NA
AWY81670.1|2815358_2816180_+	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AWY81671.1|2816315_2817209_+	universal stress protein	NA	NA	NA	NA	NA
AWY83277.1|2817211_2818030_-	universal stress protein	NA	NA	NA	NA	NA
AWY81672.1|2818044_2819226_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
AWY81673.1|2819284_2819716_-	hypoxic response protein 1	NA	A0A2I6B2H4	Macacine_betaherpesvirus	100.0	1.9e-75
AWY81674.1|2820229_2821471_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
AWY83278.1|2821780_2822143_+	hypothetical protein	NA	NA	NA	NA	NA
AWY83279.1|2822489_2823614_+	hypothetical protein	NA	NA	NA	NA	NA
AWY81675.1|2823615_2824155_+	archease	NA	NA	NA	NA	NA
AWY81676.1|2824294_2825593_+	RNA-splicing ligase RtcB	NA	A2RQD0	Archaeal_BJ1_virus	43.3	3.8e-90
AWY81677.1|2825631_2825913_-	hypothetical protein	NA	NA	NA	NA	NA
AWY81678.1|2826057_2826543_-	hypothetical protein	NA	NA	NA	NA	NA
AWY81679.1|2826569_2826827_-	hypothetical protein	NA	NA	NA	NA	NA
AWY81680.1|2826827_2829164_-	PE family protein	NA	NA	NA	NA	NA
AWY81681.1|2829192_2829435_+	hypothetical protein	NA	NA	NA	NA	NA
AWY81682.1|2829435_2830113_+	hypothetical protein	NA	NA	NA	NA	NA
AWY81683.1|2830308_2830965_+	protein DedA	NA	NA	NA	NA	NA
AWY81684.1|2831127_2831574_+	anti-anti-sigma factor	NA	NA	NA	NA	NA
AWY81685.1|2831748_2832081_-	hypothetical protein	NA	NA	NA	NA	NA
AWY81686.1|2832200_2832560_-	transcriptional regulator	NA	NA	NA	NA	NA
AWY81687.1|2832661_2833120_+	cadmium-induced protein CadI	NA	NA	NA	NA	NA
AWY81688.1|2833255_2833636_+	transcriptional regulator	NA	NA	NA	NA	NA
AWY81689.1|2833632_2835129_+	arsenic-transport integral membrane protein ArsC	NA	A0A2H4PQT9	Staphylococcus_phage	39.7	5.1e-14
AWY81690.1|2835363_2835555_+	antitoxin MazE	NA	NA	NA	NA	NA
2836712:2836739	attL	ACTGGTTCAATCCCAGTATCGCGCACCA	NA	NA	NA	NA
AWY81691.1|2836845_2837277_+	hypothetical protein	NA	NA	NA	NA	NA
AWY81692.1|2837273_2838272_+|integrase	integrase	integrase	A0A2D1G8E2	Mycobacterium_phage	47.8	7.4e-62
AWY81693.1|2838285_2838750_+	hypothetical protein	NA	NA	NA	NA	NA
AWY81694.1|2838737_2838989_+	hypothetical protein	NA	NA	NA	NA	NA
AWY81695.1|2839159_2840599_-|capsid	major capsid protein	capsid	A0A1B3AYS4	Gordonia_phage	40.6	1.4e-66
AWY83280.1|2840606_2841140_-|protease	prophage protease	protease	A0A2H4JB68	uncultured_Caudovirales_phage	32.9	3.1e-06
AWY81696.1|2841292_2841919_-	hypothetical protein	NA	V9H0V4	Actinophage	47.2	1.6e-17
AWY83281.1|2841950_2842274_-	toxin	NA	NA	NA	NA	NA
AWY81697.1|2842353_2842599_-	antitoxin	NA	NA	NA	NA	NA
AWY81698.1|2842595_2844023_-	hypothetical protein	NA	NA	NA	NA	NA
AWY81699.1|2844024_2844417_-	hypothetical protein	NA	NA	NA	NA	NA
AWY81700.1|2844413_2844674_-	hypothetical protein	NA	A0A2P1CHK7	Mycobacterium_phage	64.6	3.0e-15
AWY83282.1|2844690_2845053_-	hypothetical protein	NA	NA	NA	NA	NA
AWY81701.1|2845055_2846183_-|integrase	integrase	integrase	A0A1X9SFC1	Mycobacterium_phage	40.4	1.5e-66
AWY83283.1|2846327_2846555_-	hypothetical protein	NA	NA	NA	NA	NA
2846336:2846363	attR	ACTGGTTCAATCCCAGTATCGCGCACCA	NA	NA	NA	NA
AWY83284.1|2846551_2846941_-	hypothetical protein	NA	NA	NA	NA	NA
AWY81702.1|2846846_2847119_+	hypothetical protein	NA	NA	NA	NA	NA
AWY81703.1|2847217_2847451_+	hypothetical protein	NA	NA	NA	NA	NA
AWY81704.1|2847461_2847716_+	hypothetical protein	NA	NA	NA	NA	NA
AWY81705.1|2847944_2848436_-	hypothetical protein	NA	NA	NA	NA	NA
AWY81706.1|2848435_2849239_+|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	46.4	3.5e-46
>prophage 3
CP019612	Mycobacterium tuberculosis strain H107 chromosome, complete genome	4418796	2965672	2988230	4418796	transposase,tRNA	Burkholderia_virus(40.0%)	26	NA	NA
AWY81812.1|2965672_2967052_-|transposase	transposase	transposase	A0A7P9	Microcystis_virus	30.3	9.3e-31
AWY81813.1|2967051_2967633_-|transposase	IS607 family transposase	transposase	F9VHY9	Thermus_phage	30.6	5.0e-18
AWY81814.1|2967834_2968731_-|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
AWY81815.1|2968727_2969411_-	4'-phosphopantetheinyl transferase	NA	NA	NA	NA	NA
AWY81816.1|2969407_2970382_-	metallophosphoesterase	NA	NA	NA	NA	NA
AWY81817.1|2970526_2971090_-	hypothetical protein	NA	NA	NA	NA	NA
AWY81818.1|2971089_2972778_-	hypothetical protein	NA	NA	NA	NA	NA
AWY81819.1|2972781_2973108_-	hypothetical protein	NA	NA	NA	NA	NA
AWY81820.1|2973238_2973868_+	DUF3558 domain-containing protein	NA	NA	NA	NA	NA
AWY81821.1|2973886_2975536_+	hydrolase	NA	NA	NA	NA	NA
AWY81822.1|2975679_2975994_-	mRNA interferase MazF9	NA	NA	NA	NA	NA
AWY81823.1|2975977_2976208_-	antitoxin MazE	NA	NA	NA	NA	NA
AWY81824.1|2977291_2977759_+	hypothetical protein	NA	NA	NA	NA	NA
AWY81825.1|2977934_2978126_-	hypothetical protein	NA	NA	NA	NA	NA
AWY81826.1|2978108_2978264_+	histone acetyltransferase	NA	NA	NA	NA	NA
AWY83309.1|2978336_2978741_+	hypothetical protein	NA	NA	NA	NA	NA
AWY81827.1|2978737_2978929_+	hypothetical protein	NA	NA	NA	NA	NA
AWY81828.1|2979127_2980282_+|transposase	transposase	transposase	NA	NA	NA	NA
AWY81829.1|2980440_2980767_+	hypothetical protein	NA	A0A1B3AZF8	Gordonia_phage	46.1	4.4e-16
AWY83310.1|2980865_2981702_+|transposase	transposase	transposase	Q8W6R2	Burkholderia_virus	59.0	2.9e-83
AWY81830.1|2981873_2982131_+	hypothetical protein	NA	NA	NA	NA	NA
AWY81831.1|2982235_2982547_+	hypothetical protein	NA	NA	NA	NA	NA
AWY81832.1|2982966_2983575_+	hypothetical protein	NA	NA	NA	NA	NA
AWY81833.1|2983645_2985055_+|transposase	transposase	transposase	NA	NA	NA	NA
AWY81834.1|2985051_2985864_+	AAA family ATPase	NA	NA	NA	NA	NA
AWY83311.1|2987393_2988230_-|transposase	transposase	transposase	Q8W6R2	Burkholderia_virus	59.0	2.9e-83
>prophage 4
CP019612	Mycobacterium tuberculosis strain H107 chromosome, complete genome	4418796	3580635	3627629	4418796	transposase,tRNA	Klosneuvirus(20.0%)	25	NA	NA
AWY82316.1|3580635_3580854_+|transposase	transposase	transposase	NA	NA	NA	NA
AWY82317.1|3580875_3582405_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AWY83383.1|3582337_3583276_-	RNA polymerase sigma factor SigJ	NA	NA	NA	NA	NA
AWY82318.1|3583284_3584652_+	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	25.8	9.0e-18
AWY82319.1|3584720_3585938_+	D-alanyl-D-alanine carboxypeptidase	NA	A0A1P8VVG5	Erythrobacter_phage	27.3	8.0e-10
AWY82320.1|3586033_3587542_+	MFS transporter	NA	NA	NA	NA	NA
AWY82321.1|3587538_3588690_+	N-acetylglucosamine-6-phosphate deacetylase	NA	NA	NA	NA	NA
AWY82322.1|3588880_3589726_-	hypothetical protein	NA	NA	NA	NA	NA
AWY83384.1|3589702_3590182_+	hypothetical protein	NA	NA	NA	NA	NA
AWY82323.1|3590200_3590641_+	heavy metal-responsive transcriptional regulator	NA	NA	NA	NA	NA
AWY82324.1|3590674_3591544_-	inner membrane protein YhjD	NA	NA	NA	NA	NA
AWY82325.1|3591564_3592575_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
AWY82326.1|3592859_3593492_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
AWY82327.1|3593558_3594788_-	isocitrate dehydrogenase	NA	NA	NA	NA	NA
AWY82328.1|3595070_3596420_+	bifunctional o-acetylhomoserine/o-acetylserine sulfhydrylase	NA	A0A0B5JD48	Pandoravirus	26.5	2.5e-12
AWY82329.1|3596431_3597571_+	homoserine O-acetyltransferase	NA	NA	NA	NA	NA
AWY83385.1|3597567_3598299_+	methyltransferase	NA	NA	NA	NA	NA
AWY82330.1|3598307_3607649_-	hypothetical protein	NA	NA	NA	NA	NA
AWY82331.1|3613902_3614160_-	hypothetical protein	NA	NA	NA	NA	NA
AWY82332.1|3621301_3621628_+	hypothetical protein	NA	A0A1B3AZF8	Gordonia_phage	46.1	4.4e-16
AWY83387.1|3621726_3622563_+|transposase	transposase	transposase	Q8W6R2	Burkholderia_virus	59.0	2.9e-83
AWY83388.1|3625286_3625778_-	hypothetical protein	NA	NA	NA	NA	NA
AWY82333.1|3625829_3626321_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AWY83386.1|3626357_3627098_-|transposase	transposase	transposase	NA	NA	NA	NA
AWY82334.1|3627392_3627629_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 5
CP019612	Mycobacterium tuberculosis strain H107 chromosome, complete genome	4418796	3670804	3723281	4418796	transposase,tRNA,integrase	uncultured_virus(18.18%)	56	3713584:3713605	3718445:3718466
AWY83394.1|3670804_3671509_+|transposase	transposase	transposase	NA	NA	NA	NA
AWY83393.1|3671498_3672176_+|transposase	transposase	transposase	NA	NA	NA	NA
AWY82368.1|3672365_3674570_+	PE family protein	NA	NA	NA	NA	NA
AWY82369.1|3674640_3675513_-	3-hydroxyacyl-thioester dehydratase HtdY	NA	NA	NA	NA	NA
AWY82370.1|3675586_3676297_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
AWY82371.1|3676342_3678295_+	short chain dehydrogenase	NA	NA	NA	NA	NA
AWY82372.1|3678295_3679159_-	cyclopropane mycolic acid synthase	NA	A0A2K9L4K8	Tupanvirus	33.9	3.1e-32
AWY82373.1|3679182_3680109_+	nucleoside hydrolase	NA	NA	NA	NA	NA
AWY82374.1|3680163_3681747_-	DNA polymerase	NA	NA	NA	NA	NA
AWY82375.1|3681743_3682358_-	hypothetical protein	NA	NA	NA	NA	NA
AWY83395.1|3682440_3683067_+	hypothetical protein	NA	NA	NA	NA	NA
AWY82376.1|3683222_3684800_-	GMP synthetase	NA	NA	NA	NA	NA
AWY83396.1|3684811_3685720_-	phytoene synthase	NA	NA	NA	NA	NA
AWY82377.1|3685748_3686828_-	farnesyl-diphosphate synthase	NA	NA	NA	NA	NA
AWY82378.1|3686850_3687897_+	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AWY82379.1|3687960_3688749_+	hydrolase	NA	NA	NA	NA	NA
AWY82380.1|3688763_3691124_+	family 65 glycosyl hydrolase	NA	NA	NA	NA	NA
AWY82381.1|3691169_3691382_-	hypothetical protein	NA	NA	NA	NA	NA
AWY82382.1|3691374_3692613_-	hypothetical protein	NA	A0A2D2W2B8	Stenotrophomonas_phage	26.5	1.5e-11
AWY82383.1|3692983_3694585_-	hypothetical protein	NA	NA	NA	NA	NA
AWY82384.1|3694601_3695306_-	hypothetical protein	NA	NA	NA	NA	NA
AWY82385.1|3695423_3695990_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AWY82386.1|3696051_3696939_+	taurine catabolism dioxygenase	NA	NA	NA	NA	NA
AWY82387.1|3696973_3697273_+	antitoxin VapB47	NA	A0A2I6AZZ6	Macacine_betaherpesvirus	100.0	4.2e-45
AWY82388.1|3697269_3697680_+	VapC toxin family PIN domain ribonuclease	NA	NA	NA	NA	NA
AWY82389.1|3697712_3699449_-	cholesterol oxidase	NA	NA	NA	NA	NA
AWY82390.1|3699504_3700632_-	oxidoreductase	NA	NA	NA	NA	NA
AWY82391.1|3700651_3702241_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.5	3.6e-87
AWY82392.1|3702447_3702858_+	hypothetical protein	NA	NA	NA	NA	NA
AWY82393.1|3702867_3703767_-	anti-sigma-D factor RsdA	NA	NA	NA	NA	NA
AWY82394.1|3703759_3704398_-	ECF RNA polymerase sigma factor SigD	NA	NA	NA	NA	NA
AWY82395.1|3704415_3705243_-	hypothetical protein	NA	NA	NA	NA	NA
AWY82396.1|3705613_3705922_+	WhiB family transcriptional regulator	NA	A0A159B6S6	Tsukamurella_phage	48.5	5.0e-09
AWY82397.1|3705993_3707613_-	molecular chaperone GroEL	NA	A0A240F779	uncultured_virus	51.4	9.6e-136
AWY82398.1|3707707_3708010_-	molecular chaperone GroES	NA	A0A221S3C8	uncultured_virus	53.8	9.5e-21
AWY82399.1|3708276_3709311_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	S4VW33	Pandoravirus	37.6	1.6e-35
AWY82400.1|3709307_3709784_-	ribosomal-protein-alanine N-acetyltransferase RimI	NA	NA	NA	NA	NA
AWY83397.1|3709780_3710416_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
AWY82401.1|3710412_3710919_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
AWY82402.1|3710915_3712142_-	alanine racemase	NA	NA	NA	NA	NA
AWY83398.1|3712101_3712332_+	hypothetical protein	NA	NA	NA	NA	NA
AWY82403.1|3712435_3712798_-	hypothetical protein	NA	NA	NA	NA	NA
AWY82404.1|3712960_3713491_+	PPE family protein PPE57	NA	NA	NA	NA	NA
3713584:3713605	attL	CAGATGAATCAGGCGTTTCACA	NA	NA	NA	NA
AWY82405.1|3713757_3714288_+	PPE family protein	NA	NA	NA	NA	NA
AWY82406.1|3714234_3714501_-	hypothetical protein	NA	NA	NA	NA	NA
AWY82407.1|3714605_3716690_-	AAA family ATPase	NA	U5N3V8	Enterobacteria_phage	30.3	3.2e-22
AWY82408.1|3716772_3716970_-|integrase	integrase	integrase	NA	NA	NA	NA
AWY83399.1|3717485_3717785_+	PE family protein	NA	NA	NA	NA	NA
AWY82409.1|3717870_3718413_+	PPE family protein	NA	NA	NA	NA	NA
AWY82410.1|3718503_3718899_+	hypothetical protein	NA	NA	NA	NA	NA
3718445:3718466	attR	CAGATGAATCAGGCGTTTCACA	NA	NA	NA	NA
AWY83400.1|3719047_3719314_-|transposase	transposase	transposase	NA	NA	NA	NA
AWY82411.1|3719781_3720144_-	hypothetical protein	NA	NA	NA	NA	NA
AWY82412.1|3720306_3720843_+	PPE family protein PPE59	NA	NA	NA	NA	NA
AWY82413.1|3720783_3721947_-|transposase	transposase	transposase	U5P429	Shigella_phage	27.6	3.2e-08
AWY82414.1|3721985_3722141_-	hypothetical protein	NA	NA	NA	NA	NA
AWY82415.1|3722435_3723281_-|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	53.2	2.7e-73
