The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP030269	Klebsiella pneumoniae subsp. pneumoniae strain SC-7 chromosome, complete genome	5379591	880473	891360	5379591		Escherichia_phage(87.5%)	9	NA	NA
AWY27760.1|880473_883581_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.6	0.0e+00
AWY27761.1|883635_884901_+	MFS transporter	NA	NA	NA	NA	NA
AWY27762.1|884931_886020_-	chromosome segregation protein SMC	NA	A0A077SLJ9	Escherichia_phage	99.7	1.0e-210
AWY27763.1|886106_886367_-	hypothetical protein	NA	A0A077SK33	Escherichia_phage	97.7	2.1e-40
AWY27764.1|886664_887525_+	class A broad-spectrum beta-lactamase SHV-11	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
AWY27765.1|887545_888307_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
AWY27766.1|888567_889470_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.7	2.6e-159
AWY27767.1|889481_890747_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.8	7.8e-234
AWY27768.1|890739_891360_+	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
>prophage 2
CP030269	Klebsiella pneumoniae subsp. pneumoniae strain SC-7 chromosome, complete genome	5379591	1284103	1378824	5379591	portal,terminase,holin,integrase,transposase,capsid,head,tail,tRNA	Klebsiella_phage(47.73%)	104	1276636:1276653	1386972:1386989
1276636:1276653	attL	ACGCCAAACCCCACCGTC	NA	NA	NA	NA
AWY28128.1|1284103_1284604_+|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
AWY28129.1|1284721_1285168_+	DUF441 domain-containing protein	NA	NA	NA	NA	NA
AWY31822.1|1285151_1285943_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AWY28130.1|1286044_1287229_+	cyanate MFS transporter	NA	NA	NA	NA	NA
AWY28131.1|1287260_1287953_-	hypothetical protein	NA	NA	NA	NA	NA
AWY28132.1|1288098_1288608_+	DUF523 domain-containing protein	NA	NA	NA	NA	NA
AWY28133.1|1288594_1288951_+	DUF488 domain-containing protein	NA	NA	NA	NA	NA
AWY28134.1|1288940_1289180_-	DUF333 domain-containing protein	NA	NA	NA	NA	NA
AWY28135.1|1289480_1290494_+	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	29.0	1.9e-12
AWY28136.1|1290551_1290653_+	hypothetical protein	NA	NA	NA	NA	NA
AWY31823.1|1290652_1290727_+	hypothetical protein	NA	NA	NA	NA	NA
AWY28137.1|1290844_1290970_+	hypothetical protein	NA	NA	NA	NA	NA
AWY28138.1|1291028_1291292_-	DUF2534 family protein	NA	NA	NA	NA	NA
AWY28139.1|1291422_1292061_-	leucine efflux protein	NA	NA	NA	NA	NA
AWY28140.1|1292150_1293065_-	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	50.4	1.1e-72
AWY28141.1|1293280_1293472_+	hypothetical protein	NA	NA	NA	NA	NA
AWY28142.1|1293726_1294770_-	type II asparaginase	NA	NA	NA	NA	NA
AWY28143.1|1295072_1296281_+	HD domain-containing protein	NA	NA	NA	NA	NA
AWY28144.1|1296354_1298139_+	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	36.1	5.8e-17
AWY28145.1|1298145_1299036_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AWY28146.1|1299156_1300665_+	UbiD family decarboxylase	NA	NA	NA	NA	NA
AWY28147.1|1300975_1301662_-	EAL domain-containing protein	NA	NA	NA	NA	NA
AWY28148.1|1302059_1302239_-	hypothetical protein	NA	NA	NA	NA	NA
AWY28149.1|1302278_1302911_-	DNA-binding protein	NA	NA	NA	NA	NA
AWY28150.1|1303477_1303675_+	hypothetical protein	NA	NA	NA	NA	NA
AWY28151.1|1303790_1304801_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
AWY28152.1|1304797_1306204_-	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
AWY28153.1|1306259_1307147_-	manganese catalase family protein	NA	NA	NA	NA	NA
AWY28154.1|1307163_1307670_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
AWY28155.1|1307696_1308191_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
AWY28156.1|1308281_1308467_-	stress-induced acidophilic repeat motif-containing protein	NA	NA	NA	NA	NA
AWY28157.1|1309089_1310283_+	glutathione-dependent formaldehyde dehydrogenase	NA	NA	NA	NA	NA
AWY28158.1|1310395_1310623_+	DUF1272 domain-containing protein	NA	NA	NA	NA	NA
AWY28159.1|1310643_1310829_-	hypothetical protein	NA	NA	NA	NA	NA
AWY28160.1|1311072_1311396_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
AWY28161.1|1311388_1311781_+	amino acid-binding protein	NA	NA	NA	NA	NA
AWY28162.1|1311777_1312491_+	ArsR family transcriptional regulator	NA	NA	NA	NA	NA
AWY28163.1|1312763_1312916_-	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.0	3.8e-18
AWY28164.1|1313235_1313559_-	hypothetical protein	NA	NA	NA	NA	NA
AWY28165.1|1313564_1314257_-	EAL domain-containing protein	NA	NA	NA	NA	NA
AWY28166.1|1314611_1315670_-	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	31.7	2.1e-14
AWY28167.1|1316092_1317520_-|tail	tail fiber domain-containing protein	tail	A0A0P0IDN1	Klebsiella_phage	55.5	3.0e-101
AWY28168.1|1317588_1330293_-	DUF1983 domain-containing protein	NA	Q6UAW1	Klebsiella_phage	46.9	0.0e+00
AWY28169.1|1330355_1330967_-|tail	tail assembly protein	tail	Q6UAW2	Klebsiella_phage	72.5	5.3e-71
AWY28170.1|1331364_1332075_-	peptidase P60	NA	Q6UAW4	Klebsiella_phage	89.8	1.4e-136
AWY28171.1|1332076_1332832_-|tail	phage minor tail protein L	tail	Q6UAW5	Klebsiella_phage	81.3	1.2e-125
AWY28172.1|1332828_1333167_-|tail	phage tail protein	tail	Q6UAW6	Klebsiella_phage	89.3	8.3e-58
AWY28173.1|1333166_1336502_-|tail	phage tail tape measure protein	tail	Q6UAW7	Klebsiella_phage	87.6	0.0e+00
AWY28174.1|1336501_1336714_-	hypothetical protein	NA	Q6UAW9	Klebsiella_phage	87.5	4.1e-31
AWY28175.1|1336734_1337100_-|tail	phage tail protein	tail	Q6UAW8	Klebsiella_phage	89.3	1.6e-51
AWY28176.1|1337157_1337619_-|tail	phage tail protein	tail	Q6UAX0	Klebsiella_phage	83.7	7.8e-67
AWY28177.1|1337650_1338052_-	hypothetical protein	NA	Q6UAX1	Klebsiella_phage	94.0	1.7e-62
AWY28178.1|1338048_1338438_-	hypothetical protein	NA	Q6UAX2	Klebsiella_phage	85.3	1.1e-56
AWY28179.1|1338418_1338757_-|head,tail	head-tail adaptor protein	head,tail	Q6UAX3	Klebsiella_phage	91.1	5.6e-54
AWY28180.1|1338753_1339071_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q6UAX4	Klebsiella_phage	88.8	2.6e-45
AWY28181.1|1339051_1339312_-	hypothetical protein	NA	Q6UAX5	Klebsiella_phage	63.9	1.5e-22
AWY28182.1|1339370_1340657_-|capsid	phage major capsid protein	capsid	Q6UAX6	Klebsiella_phage	89.3	4.4e-216
AWY28183.1|1340734_1341655_-	S49 family peptidase	NA	Q6UAX7	Klebsiella_phage	88.2	9.6e-149
AWY28184.1|1341691_1342951_-|portal	phage portal protein	portal	Q6UAX8	Klebsiella_phage	90.0	2.3e-222
AWY28185.1|1342950_1343130_-	hypothetical protein	NA	Q6UAX9	Klebsiella_phage	57.6	4.0e-11
AWY28186.1|1343123_1344845_-|terminase	terminase large subunit	terminase	Q7Y413	Yersinia_phage	57.4	1.1e-190
AWY28187.1|1344844_1345279_-|terminase	phage terminase small subunit P27 family	terminase	A0A1J0GV10	Halomonas_phage	61.9	9.4e-30
AWY28188.1|1345527_1345959_-	hypothetical protein	NA	Q6UAS0	Klebsiella_phage	61.6	1.8e-41
AWY28189.1|1345955_1346279_-	hypothetical protein	NA	NA	NA	NA	NA
AWY28190.1|1346230_1346593_-	HNH endonuclease	NA	Q6UAS2	Klebsiella_phage	82.5	1.3e-56
AWY28191.1|1346919_1347144_+	hypothetical protein	NA	NA	NA	NA	NA
AWY28192.1|1347182_1347635_-	hypothetical protein	NA	NA	NA	NA	NA
AWY28193.1|1348568_1348919_-	hypothetical protein	NA	A0A0K2FIW3	Enterobacter_phage	37.7	6.0e-11
AWY28194.1|1348915_1349413_-	lysozyme	NA	A0A1V0E5Q7	Salmonella_phage	86.4	4.3e-79
AWY28195.1|1349412_1349628_-|holin	holin	holin	A5LH82	Enterobacteria_phage	87.3	1.0e-29
AWY31824.1|1350639_1351080_+	hypothetical protein	NA	NA	NA	NA	NA
AWY28196.1|1351084_1351954_+	hypothetical protein	NA	NA	NA	NA	NA
AWY28197.1|1351982_1352327_-	antitermination protein	NA	A0A0P0ZCW0	Stx2-converting_phage	85.0	1.0e-55
AWY28198.1|1352339_1353371_-	DUF968 domain-containing protein	NA	S5MW46	Escherichia_phage	49.3	1.8e-95
AWY28199.1|1353370_1353574_-	hypothetical protein	NA	NA	NA	NA	NA
AWY28200.1|1353570_1353963_-	DNA-binding protein	NA	K7PHB4	Enterobacterial_phage	36.6	6.1e-12
AWY28201.1|1354003_1354294_-	hypothetical protein	NA	H6WRY6	Salmonella_phage	56.9	6.1e-17
AWY28202.1|1354305_1354539_-	DinI family protein	NA	K7PM44	Enterobacteria_phage	71.1	1.7e-25
AWY28203.1|1355193_1356555_+	hypothetical protein	NA	NA	NA	NA	NA
AWY28204.1|1356898_1358662_-	sensor domain-containing phosphodiesterase	NA	NA	NA	NA	NA
AWY28205.1|1358974_1359415_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
AWY28206.1|1359428_1359893_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	68.9	1.9e-60
AWY28207.1|1359885_1360869_-	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	56.4	3.3e-46
AWY28208.1|1360920_1361475_-	hypothetical protein	NA	NA	NA	NA	NA
AWY28209.1|1361477_1361693_-	Rha family transcriptional regulator	NA	A0A0M4QX15	Salmonella_phage	57.5	2.0e-17
AWY28210.1|1361794_1362184_+	helix-turn-helix domain-containing protein	NA	A0A0M4R5D1	Salmonella_phage	60.2	6.7e-35
AWY28211.1|1362798_1363017_+	hypothetical protein	NA	NA	NA	NA	NA
AWY28212.1|1363026_1363221_+	DUF1482 family protein	NA	NA	NA	NA	NA
AWY28213.1|1363263_1363608_+	transcriptional regulator	NA	NA	NA	NA	NA
AWY28214.1|1363749_1365888_+	exonuclease	NA	S4TNL0	Salmonella_phage	42.9	3.3e-99
AWY28215.1|1365940_1366186_+	excisionase	NA	NA	NA	NA	NA
AWY28216.1|1366166_1367294_+|integrase	integrase	integrase	O21925	Phage_21	58.4	3.3e-119
AWY28217.1|1367411_1368662_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	1.1e-19
AWY28218.1|1368902_1369553_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
AWY28219.1|1369569_1370028_+	NUDIX hydrolase	NA	NA	NA	NA	NA
AWY31825.1|1370084_1371191_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
AWY28220.1|1371245_1371887_+	lysogenization protein HflD	NA	NA	NA	NA	NA
AWY28221.1|1371890_1373261_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	45.3	1.2e-107
AWY28222.1|1373315_1373678_-	cupin domain-containing protein	NA	NA	NA	NA	NA
AWY28223.1|1373761_1374568_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AWY28224.1|1374850_1375522_+	two-component system response regulator PhoP	NA	NA	NA	NA	NA
AWY28225.1|1375521_1376988_+	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
AWY28226.1|1377073_1378195_+	cupin domain-containing protein	NA	NA	NA	NA	NA
AWY28227.1|1378332_1378824_-|transposase	transposase	transposase	NA	NA	NA	NA
1386972:1386989	attR	ACGCCAAACCCCACCGTC	NA	NA	NA	NA
>prophage 3
CP030269	Klebsiella pneumoniae subsp. pneumoniae strain SC-7 chromosome, complete genome	5379591	1627873	1637337	5379591	tRNA,protease	Brazilian_cedratvirus(16.67%)	9	NA	NA
AWY28442.1|1627873_1629595_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.3	1.5e-14
AWY28443.1|1629639_1630341_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
AWY28444.1|1630694_1630913_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
AWY28445.1|1631033_1633313_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
AWY28446.1|1633343_1633661_-|protease	ATP-dependent Clp protease adaptor ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
AWY28447.1|1633986_1634208_+	cold shock domain protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
AWY28448.1|1634141_1634345_-	hypothetical protein	NA	NA	NA	NA	NA
AWY28449.1|1634284_1636225_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	1.9e-37
AWY28450.1|1636221_1637337_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
>prophage 4
CP030269	Klebsiella pneumoniae subsp. pneumoniae strain SC-7 chromosome, complete genome	5379591	4791266	4853285	5379591	terminase,holin,transposase,capsid,tail	Salmonella_phage(37.25%)	67	NA	NA
AWY31294.1|4791266_4792733_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.7	1.2e-87
AWY31295.1|4792800_4794378_+	GMP synthase (glutamine-hydrolyzing)	NA	NA	NA	NA	NA
AWY31296.1|4794569_4795820_+	DUF4102 domain-containing protein	NA	A0A1X9TCT6	Enterobacter_phage	84.9	8.9e-206
AWY31297.1|4795836_4796028_-	hypothetical protein	NA	NA	NA	NA	NA
AWY31298.1|4796024_4796618_-	adenine methylase	NA	T1SA14	Salmonella_phage	92.9	3.3e-110
AWY31299.1|4796614_4796773_-	DUF1317 family protein	NA	T1SAR0	Salmonella_phage	78.8	2.5e-17
AWY31300.1|4796765_4797059_-	PerC family transcriptional regulator	NA	T1S9J5	Salmonella_phage	71.1	8.9e-32
AWY31301.1|4797168_4797417_-	AlpA family phage regulatory protein	NA	A0A0F6TJ45	Escherichia_coli_O157_typing_phage	78.0	2.8e-31
AWY31302.1|4797463_4798345_-	recombinase RecT	NA	T1SBJ5	Salmonella_phage	84.6	1.4e-136
AWY31303.1|4798341_4799163_-	exodeoxyribonuclease VIII	NA	A0A193GYK2	Enterobacter_phage	80.2	2.8e-131
AWY31968.1|4799162_4799354_-	hypothetical protein	NA	A0A1L2C975	Pseudomonas_phage	52.6	2.1e-05
AWY31304.1|4799413_4799713_-	hypothetical protein	NA	A0A0F6R7M4	Escherichia_coli_O157_typing_phage	54.5	2.1e-20
AWY31305.1|4800079_4800661_-	XRE family transcriptional regulator	NA	Q858D7	Salmonella_phage	64.8	4.2e-65
AWY31306.1|4800814_4801048_+	hypothetical protein	NA	T1SAR5	Salmonella_phage	66.2	9.2e-24
AWY31307.1|4801194_4801398_+	hypothetical protein	NA	A0A193GYW4	Enterobacter_phage	78.3	2.8e-21
AWY31308.1|4801394_4802057_+	serine/threonine protein phosphatase	NA	K7P6H8	Enterobacteria_phage	61.4	1.5e-82
AWY31309.1|4802056_4802818_+	DNA replication domain protein	NA	T1SA92	Salmonella_phage	57.4	3.4e-67
AWY31310.1|4802943_4803288_+	DUF1064 domain-containing protein	NA	A0A0F6R8N5	Escherichia_coli_O157_typing_phage	85.1	6.9e-52
AWY31311.1|4803480_4803942_+	hypothetical protein	NA	R9TME7	Aeromonas_phage	35.5	2.7e-06
AWY31312.1|4803934_4804615_+	DNA cytosine methyltransferase	NA	A0A0H5AU88	Pseudomonas_phage	58.3	9.2e-72
AWY31313.1|4805085_4805298_+	hypothetical protein	NA	A0A0F6TJE4	Escherichia_coli_O157_typing_phage	45.5	8.1e-11
AWY31314.1|4805905_4806190_+	hypothetical protein	NA	A0A0N7KZ94	Stx2-converting_phage	75.5	2.5e-15
AWY31969.1|4806189_4806378_+	hypothetical protein	NA	R9TNE4	Aeromonas_phage	76.7	9.4e-19
AWY31315.1|4806370_4806709_+	hypothetical protein	NA	A0A193GYX4	Enterobacter_phage	80.0	1.8e-44
AWY31970.1|4806784_4807114_+	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	55.1	1.9e-27
AWY31316.1|4807171_4807756_+|terminase	terminase small subunit	terminase	T1SBI8	Salmonella_phage	88.1	8.4e-90
AWY31317.1|4807752_4809228_+|terminase	terminase	terminase	Q858H3	Salmonella_phage	93.7	1.5e-281
AWY31318.1|4809224_4810016_-	hypothetical protein	NA	NA	NA	NA	NA
AWY31319.1|4811036_4811240_+	hypothetical protein	NA	NA	NA	NA	NA
AWY31320.1|4811243_4812923_+|tail	phage tail protein	tail	T1S9Z7	Salmonella_phage	59.3	3.6e-194
AWY31321.1|4812919_4813225_+	hypothetical protein	NA	Q2A090	Sodalis_phage	51.3	1.1e-16
AWY31322.1|4813506_4813905_+	peptidase	NA	T1SAP9	Salmonella_phage	59.5	5.6e-37
AWY31323.1|4813917_4814925_+|capsid	phage capsid protein	capsid	T1S9H9	Salmonella_phage	92.8	2.1e-181
AWY31324.1|4814935_4815328_+	hypothetical protein	NA	T1SA71	Salmonella_phage	89.9	1.5e-55
AWY31325.1|4815320_4815599_+	hypothetical protein	NA	T1SA01	Salmonella_phage	58.9	1.1e-20
AWY31326.1|4815647_4816259_+	hypothetical protein	NA	T1SAQ2	Salmonella_phage	48.8	9.2e-47
AWY31327.1|4816258_4818736_+	hypothetical protein	NA	G9L6D0	Escherichia_phage	56.8	7.3e-268
AWY31328.1|4818737_4819208_+	hypothetical protein	NA	Q858G2	Salmonella_phage	55.9	6.6e-45
AWY31329.1|4819200_4819698_+	hypothetical protein	NA	A0A0F6TJ56	Escherichia_coli_O157_typing_phage	43.6	4.0e-24
AWY31330.1|4819710_4822209_+	hypothetical protein	NA	A0A193GYI3	Enterobacter_phage	61.3	1.5e-289
AWY31331.1|4822205_4824011_+	hypothetical protein	NA	A0A0F6TJQ3	Escherichia_coli_O157_typing_phage	73.3	1.7e-237
AWY31332.1|4824014_4826489_+	hypothetical protein	NA	A0A0F6TK45	Escherichia_coli_O157_typing_phage	85.7	0.0e+00
AWY31333.1|4826684_4826981_+	hypothetical protein	NA	A0A2R9YJP3	Escherichia_phage	93.8	1.7e-46
AWY31334.1|4827023_4827176_-	transmembrane anchored protein	NA	G9L6D9	Escherichia_phage	81.6	9.6e-14
AWY31335.1|4827267_4827813_-	DUF2335 domain-containing protein	NA	NA	NA	NA	NA
AWY31336.1|4827736_4828072_-	hypothetical protein	NA	NA	NA	NA	NA
AWY31337.1|4828200_4828497_-	hypothetical protein	NA	T1SA06	Salmonella_phage	65.5	8.1e-25
AWY31338.1|4830989_4831397_+	hypothetical protein	NA	T1SA79	Salmonella_phage	82.7	1.4e-54
AWY31339.1|4831383_4831680_+|holin	phage holin family protein	holin	A0A193GYK3	Enterobacter_phage	77.6	2.1e-33
AWY31340.1|4831676_4832156_+	TIGR02594 family protein	NA	A0A222YWL8	Escherichia_phage	68.8	2.1e-62
AWY31341.1|4832152_4832653_+	DUF2514 domain-containing protein	NA	Q858E9	Salmonella_phage	78.8	5.9e-60
AWY31342.1|4832822_4834691_-	phosphatase	NA	A0A2P0VMN7	Tetraselmis_virus	22.6	2.6e-07
AWY31343.1|4834674_4835853_-	anaerobic sulfatase maturase	NA	NA	NA	NA	NA
AWY31344.1|4836146_4837379_-	MFS transporter	NA	NA	NA	NA	NA
AWY31345.1|4837476_4838364_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AWY31346.1|4838460_4838652_-	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	79.3	3.3e-19
AWY31347.1|4839004_4841233_+	sensor domain-containing phosphodiesterase	NA	NA	NA	NA	NA
AWY31348.1|4841286_4842819_-	exopolyphosphatase	NA	NA	NA	NA	NA
AWY31349.1|4842822_4844883_-	polyphosphate kinase 1	NA	NA	NA	NA	NA
AWY31350.1|4845063_4845705_-	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	41.1	9.0e-29
AWY31351.1|4845701_4846739_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	44.5	8.2e-72
AWY31352.1|4847002_4847896_+	beta-glucoside kinase	NA	NA	NA	NA	NA
AWY31353.1|4847905_4849339_+	6-phospho-beta-glucosidase	NA	NA	NA	NA	NA
AWY31354.1|4849556_4850183_+	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
AWY31355.1|4850278_4851565_+	uracil permease	NA	Q9KX94	Enterobacteria_phage	38.1	1.9e-65
AWY31356.1|4851663_4852365_+	DnaA inactivator Hda	NA	NA	NA	NA	NA
AWY31357.1|4852361_4853285_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	58.8	2.7e-74
>prophage 5
CP030269	Klebsiella pneumoniae subsp. pneumoniae strain SC-7 chromosome, complete genome	5379591	5168168	5175073	5379591		Planktothrix_phage(33.33%)	6	NA	NA
AWY31986.1|5168168_5169032_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.5	5.7e-10
AWY31628.1|5169042_5169816_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.7	3.9e-26
AWY31987.1|5170056_5170950_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.8	6.1e-15
AWY31629.1|5171195_5172557_-	U32 family peptidase	NA	Q6DW11	Phage_TP	94.8	1.8e-207
AWY31630.1|5172875_5173598_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	8.3e-31
AWY31631.1|5173594_5175073_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	28.3	8.5e-30
>prophage 1
CP030268	Klebsiella pneumoniae subsp. pneumoniae strain SC-7 plasmid pSC7-IncFIB-110K, complete sequence	111007	5309	46029	111007	capsid,terminase,tail	Salmonella_phage(88.64%)	49	NA	NA
AWY26825.1|5309_5921_-|tail	tail assembly protein	tail	J9Q7F8	Salmonella_phage	72.1	1.1e-76
AWY26826.1|5908_6706_-|tail	phage tail protein	tail	J9Q7R4	Salmonella_phage	85.3	5.4e-140
AWY26827.1|6698_7397_-|tail	phage minor tail protein L	tail	J9Q7Y5	Salmonella_phage	87.4	1.2e-122
AWY26828.1|7483_7819_-|tail	phage tail protein	tail	J9Q6E1	Salmonella_phage	84.5	2.6e-51
AWY26829.1|7862_12401_-|tail	phage tail tape measure protein	tail	J9Q712	Salmonella_phage	72.3	0.0e+00
AWY26830.1|12408_12642_-	hypothetical protein	NA	J9Q7F7	Salmonella_phage	93.5	3.4e-34
AWY26831.1|12758_13076_-	hypothetical protein	NA	J9Q7R3	Salmonella_phage	93.3	1.8e-46
AWY26832.1|13137_13884_-	hypothetical protein	NA	J9Q7Y4	Salmonella_phage	83.0	3.7e-106
AWY26833.1|13951_14344_-	hypothetical protein	NA	J9Q6D8	Salmonella_phage	67.5	1.0e-46
AWY26834.1|14345_14819_-	hypothetical protein	NA	J9Q711	Salmonella_phage	93.6	1.9e-76
AWY26835.1|14809_15154_-	hypothetical protein	NA	J9Q7F6	Salmonella_phage	92.1	7.4e-54
AWY26836.1|15251_16085_-	hypothetical protein	NA	J9Q7R2	Salmonella_phage	83.4	2.4e-130
AWY26837.1|16084_16519_-	hypothetical protein	NA	J9Q7Y3	Salmonella_phage	84.0	2.9e-63
AWY26838.1|16566_16995_-	hypothetical protein	NA	J9Q6D6	Salmonella_phage	71.6	7.9e-29
AWY26839.1|17073_17952_-|capsid	phage major capsid protein	capsid	J9Q710	Salmonella_phage	94.2	4.7e-153
AWY26840.1|17978_18878_-	hypothetical protein	NA	J9Q7F4	Salmonella_phage	82.6	6.1e-124
AWY26841.1|18900_20490_-	hypothetical protein	NA	J9Q7R1	Salmonella_phage	88.7	1.4e-275
AWY26842.1|20507_21764_-|terminase	terminase	terminase	J9Q7Y2	Salmonella_phage	97.4	9.4e-248
AWY26843.1|21766_22408_-	DNA-binding protein	NA	J9Q6D4	Salmonella_phage	88.2	5.0e-96
AWY26844.1|22583_22850_-	hypothetical protein	NA	J9Q757	Salmonella_phage	90.9	1.3e-37
AWY26845.1|22859_23759_-	hypothetical protein	NA	J9Q7I6	Salmonella_phage	97.0	4.2e-165
AWY26846.1|23755_24010_-	hypothetical protein	NA	J9Q7U0	Salmonella_phage	95.2	3.4e-40
AWY26847.1|24002_24641_-	ATP-binding cassette domain-containing protein	NA	J9Q807	Salmonella_phage	97.6	1.4e-109
AWY26848.1|24637_25306_-	chromosome partitioning protein ParB	NA	J9Q6L1	Salmonella_phage	91.4	1.5e-106
AWY26849.1|25305_25986_-	chromosome partitioning protein ParB	NA	J9Q756	Salmonella_phage	89.3	2.1e-108
AWY26850.1|26069_27629_+	ATP-dependent helicase	NA	J9Q7I4	Salmonella_phage	92.9	1.2e-279
AWY26851.1|27631_27907_+	hypothetical protein	NA	J9Q7T9	Salmonella_phage	68.1	4.0e-26
AWY26852.1|27957_28395_-	hypothetical protein	NA	A0A1V0E7W1	Vibrio_phage	36.4	9.5e-14
AWY26853.1|28550_29081_+	transcriptional regulator	NA	J9Q6L0	Salmonella_phage	84.5	1.3e-70
AWY26936.1|29213_29393_+	hypothetical protein	NA	NA	NA	NA	NA
AWY26854.1|29714_30365_+	hypothetical protein	NA	J9Q754	Salmonella_phage	91.7	8.4e-107
AWY26855.1|30415_30619_+	hypothetical protein	NA	J9Q7I3	Salmonella_phage	95.5	4.1e-28
AWY26856.1|31211_31694_-	hypothetical protein	NA	J9Q805	Salmonella_phage	76.9	1.8e-69
AWY26857.1|31899_32181_-	ABC transporter	NA	J9Q753	Salmonella_phage	83.9	5.3e-42
AWY26858.1|32183_32558_-	hypothetical protein	NA	NA	NA	NA	NA
AWY26859.1|32685_33093_-	hypothetical protein	NA	NA	NA	NA	NA
AWY26860.1|33212_33524_-	hypothetical protein	NA	J9Q7T7	Salmonella_phage	68.9	1.8e-30
AWY26861.1|33660_33873_-	hypothetical protein	NA	J9Q804	Salmonella_phage	77.9	4.4e-25
AWY26862.1|33885_34104_-	hypothetical protein	NA	J9Q6K7	Salmonella_phage	83.3	1.3e-27
AWY26863.1|34879_35212_+	hypothetical protein	NA	J9Q7T6	Salmonella_phage	73.2	1.2e-11
AWY26864.1|35985_37851_+	hypothetical protein	NA	NA	NA	NA	NA
AWY26865.1|38054_39611_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	42.5	7.1e-104
AWY26866.1|39607_40813_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
AWY26867.1|40929_44046_+	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	24.0	2.0e-25
AWY26868.1|44107_44323_-	DNA modification methylase	NA	J9Q747	Salmonella_phage	69.8	1.2e-14
AWY26869.1|44451_45030_-	hypothetical protein	NA	J9Q7H6	Salmonella_phage	57.5	1.7e-55
AWY26870.1|45157_45313_-	DUF3927 domain-containing protein	NA	H6WZJ7	Escherichia_phage	61.2	1.7e-05
AWY26871.1|45312_45738_-	tellurite/colicin resistance protein	NA	Q71TK7	Escherichia_phage	80.9	9.8e-56
AWY26872.1|45840_46029_-	hypothetical protein	NA	J9Q800	Salmonella_phage	54.2	1.5e-08
>prophage 2
CP030268	Klebsiella pneumoniae subsp. pneumoniae strain SC-7 plasmid pSC7-IncFIB-110K, complete sequence	111007	49588	104093	111007	integrase,tail	Salmonella_phage(85.45%)	65	70944:70968	88047:88071
AWY26876.1|49588_49822_-	hypothetical protein	NA	J9Q7H5	Salmonella_phage	84.2	2.7e-31
AWY26877.1|50019_50613_-	phage N-6-adenine-methyltransferase	NA	J9Q7T2	Salmonella_phage	84.8	1.7e-98
AWY26878.1|50797_51631_-	hypothetical protein	NA	J9Q7Z9	Salmonella_phage	56.4	1.1e-63
AWY26879.1|51756_52305_-	3'-5' exonuclease	NA	J9Q6J8	Salmonella_phage	74.4	3.2e-75
AWY26880.1|52301_52883_-	hypothetical protein	NA	A0A1B0VMI8	Pseudomonas_phage	50.4	4.2e-33
AWY26881.1|53105_53525_-	hypothetical protein	NA	J9Q743	Salmonella_phage	74.1	3.8e-52
AWY26882.1|53588_54233_-	hypothetical protein	NA	J9Q7H4	Salmonella_phage	77.6	2.1e-94
AWY26883.1|54232_54709_-	dihydrofolate reductase	NA	J9Q7T1	Salmonella_phage	80.3	1.3e-72
AWY26884.1|54705_55119_-	hypothetical protein	NA	J9Q7Z8	Salmonella_phage	77.4	6.2e-55
AWY26885.1|55120_56224_-	thymidylate synthase	NA	J9Q6J6	Salmonella_phage	79.6	1.6e-179
AWY26886.1|56417_57293_-	phosphoribosyl-ATP pyrophosphohydrolase	NA	J9Q742	Salmonella_phage	84.7	5.9e-140
AWY26887.1|57370_58513_-	ribonucleotide-diphosphate reductase subunit beta	NA	J9Q7H3	Salmonella_phage	95.5	1.5e-212
AWY26888.1|58643_60947_-	ribonucleoside-diphosphate reductase subunit alpha	NA	J9Q7T0	Salmonella_phage	90.9	0.0e+00
AWY26889.1|61022_61592_-	hypothetical protein	NA	J9Q7Z7	Salmonella_phage	89.9	1.1e-94
AWY26937.1|61601_62312_-	hypothetical protein	NA	J9Q6J5	Salmonella_phage	59.7	3.9e-73
AWY26890.1|62337_64254_-	exonuclease	NA	J9Q741	Salmonella_phage	84.3	1.8e-298
AWY26891.1|64250_64484_-	hypothetical protein	NA	J9Q7H1	Salmonella_phage	66.1	4.4e-18
AWY26892.1|64483_65569_-	exonuclease SbcCD subunit D	NA	J9Q7S9	Salmonella_phage	84.8	1.1e-183
AWY26893.1|65756_66251_-	N-acetyltransferase	NA	J9Q6J3	Salmonella_phage	67.1	1.0e-59
AWY26894.1|66326_66971_-	hypothetical protein	NA	J9Q739	Salmonella_phage	80.7	1.9e-98
AWY26895.1|67089_67281_-	hypothetical protein	NA	NA	NA	NA	NA
AWY26896.1|67292_68390_+	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	45.1	1.3e-72
AWY26897.1|68820_69033_-	hypothetical protein	NA	J9Q7S8	Salmonella_phage	80.0	4.3e-28
AWY26898.1|69032_69368_-	hypothetical protein	NA	J9Q7Z5	Salmonella_phage	67.6	2.1e-37
AWY26899.1|69364_69544_-	hypothetical protein	NA	NA	NA	NA	NA
AWY26900.1|70077_71154_-	recombinase	NA	J9Q736	Salmonella_phage	95.8	2.5e-196
70944:70968	attL	CGGCCGTCGCCAGGAAGGTTTTACC	NA	NA	NA	NA
AWY26901.1|71156_71423_-	hypothetical protein	NA	J9Q7G8	Salmonella_phage	83.0	8.6e-34
AWY26902.1|71422_72367_-	exonuclease	NA	J9Q7S6	Salmonella_phage	93.6	2.8e-172
AWY26903.1|72427_73435_-	regulator	NA	J9Q7Z3	Salmonella_phage	87.6	2.3e-143
AWY26904.1|73554_73986_-	hypothetical protein	NA	J9Q6I8	Salmonella_phage	92.3	6.2e-66
AWY26905.1|74106_74343_+	hypothetical protein	NA	NA	NA	NA	NA
AWY26906.1|74335_74551_+	RNA chaperone/antiterminator CspA	NA	A0A1W6JNX5	Morganella_phage	80.0	4.5e-25
AWY26907.1|74703_75147_-	hypothetical protein	NA	J9Q7S4	Salmonella_phage	83.0	5.8e-59
AWY26908.1|75143_76313_-	uracil-DNA glycosylase	NA	J9Q7Z2	Salmonella_phage	93.3	6.2e-209
AWY26909.1|76334_77036_-	hypothetical protein	NA	S5YLC4	Mycobacterium_phage	37.1	4.9e-20
AWY26910.1|77032_79396_-	DNA polymerase III subunit alpha	NA	J9Q7Z2	Salmonella_phage	86.7	0.0e+00
AWY26911.1|79370_79574_-	hypothetical protein	NA	J9Q6I7	Salmonella_phage	80.6	7.2e-25
AWY26912.1|79576_80809_-	porphyrin biosynthesis protein	NA	J9Q733	Salmonella_phage	86.4	2.2e-212
AWY26913.1|80905_83191_-	porphyrin biosynthesis protein	NA	J9Q7G6	Salmonella_phage	62.6	2.9e-247
AWY26938.1|83307_83520_-	hypothetical protein	NA	NA	NA	NA	NA
AWY26914.1|83793_84174_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AWY26915.1|84168_85269_-|integrase	integrase	integrase	A0A1P8DTG6	Proteus_phage	28.4	1.6e-17
AWY26916.1|85618_85978_+	hypothetical protein	NA	NA	NA	NA	NA
AWY26917.1|86042_86453_-	toxin YafO	NA	NA	NA	NA	NA
AWY26939.1|86462_86873_-	hypothetical protein	NA	NA	NA	NA	NA
AWY26940.1|87162_87408_-	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	47.4	7.0e-14
AWY26918.1|87537_88350_-	phosphate starvation-inducible protein PhoH	NA	W8D063	Erwinia_phage	65.4	1.1e-90
88047:88071	attR	CGGCCGTCGCCAGGAAGGTTTTACC	NA	NA	NA	NA
AWY26919.1|88473_89388_+	hypothetical protein	NA	NA	NA	NA	NA
AWY26920.1|90590_90890_-	C-type natriuretic protein	NA	J9Q7S1	Salmonella_phage	66.3	4.6e-28
AWY26921.1|90886_91039_-	hypothetical protein	NA	J9Q7Z1	Salmonella_phage	82.0	1.6e-16
AWY26922.1|91283_91751_-	hypothetical protein	NA	J9Q7R9	Salmonella_phage	63.9	1.3e-48
AWY26923.1|91830_92619_-	hypothetical protein	NA	J9Q7Z0	Salmonella_phage	51.1	3.1e-71
AWY26924.1|92910_94077_+	hypothetical protein	NA	NA	NA	NA	NA
AWY26941.1|94119_95238_-	DNA primase	NA	J9Q720	Salmonella_phage	91.0	4.1e-202
AWY26925.1|95390_96731_-	DNA helicase	NA	J9Q7G4	Salmonella_phage	96.0	5.4e-241
AWY26926.1|96795_97521_-	hypothetical protein	NA	J9Q7R8	Salmonella_phage	88.8	2.5e-128
AWY26927.1|97714_98473_-	DUF2971 domain-containing protein	NA	J9Q7Y9	Salmonella_phage	98.0	1.6e-146
AWY26928.1|98518_98881_-	hypothetical protein	NA	J9Q7G3	Salmonella_phage	97.9	1.5e-44
AWY26929.1|98880_99546_-	plasmid stability protein	NA	J9Q7R7	Salmonella_phage	83.7	2.9e-102
AWY26930.1|99730_100480_-	hypothetical protein	NA	J9Q7Y8	Salmonella_phage	31.3	1.6e-16
AWY26931.1|100464_100857_-	hypothetical protein	NA	A0A077SLR3	Escherichia_phage	42.2	1.0e-14
AWY26932.1|101273_101525_-	hypothetical protein	NA	J9Q7R6	Salmonella_phage	73.5	2.0e-24
AWY26933.1|101527_102220_-	hypothetical protein	NA	J9Q7Y7	Salmonella_phage	89.1	2.7e-119
AWY26934.1|102233_102557_-	hypothetical protein	NA	J9Q6E7	Salmonella_phage	95.3	2.3e-49
AWY26935.1|102647_104093_-|tail	tail fiber domain-containing protein	tail	A0A0H4TGH1	Klebsiella_phage	39.0	8.0e-41
>prophage 1
CP030270	Klebsiella pneumoniae subsp. pneumoniae strain SC-7 plasmid pSC7-vir, complete sequence	236809	164247	213866	236809	integrase,transposase,protease	Caulobacter_phage(17.65%)	54	197509:197528	219623:219642
AWY32128.1|164247_165243_+|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	28.7	3.1e-20
AWY32129.1|165448_166462_-	NAD(P)-dependent alcohol dehydrogenase	NA	M1PHA2	Moumouvirus	26.0	5.8e-06
AWY32130.1|166574_167102_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AWY32131.1|167115_170073_+|transposase	Tn3 family transposase	transposase	A0A125RQ78	Bacillus_phage	22.8	2.3e-50
AWY32132.1|170914_171775_+	alpha/beta hydrolase	NA	A2RQC8	Archaeal_BJ1_virus	21.7	9.0e-08
AWY32133.1|173506_174142_+	HAD-IB family hydrolase	NA	NA	NA	NA	NA
AWY32134.1|174477_175719_-	tellurium resistance protein TerF	NA	A0A2D1GNA9	Pseudoalteromonas_phage	25.1	4.8e-10
AWY32135.1|175803_176379_-	TerD family protein	NA	K4JRX3	Caulobacter_phage	42.6	9.6e-30
AWY32136.1|176465_177044_-	TerD family protein	NA	K4JRX3	Caulobacter_phage	40.8	1.9e-33
AWY32137.1|177082_178123_-	tellurium resistance protein TerC	NA	K7QKE8	Escherichia_phage	46.5	1.8e-71
AWY32138.1|178146_178602_-	Tellurium resistance protein TerB	NA	NA	NA	NA	NA
AWY32139.1|178624_179776_-	tellurium resistance protein TerA	NA	NA	NA	NA	NA
AWY32140.1|179772_180357_-	tellurium resistance protein TerZ	NA	K4JRX3	Caulobacter_phage	29.4	2.0e-11
AWY32141.1|180667_181726_+	carbamoyl-phosphate synthase large chain	NA	NA	NA	NA	NA
AWY32142.1|181737_182880_+	adenine/guanine phosphoribosyltransferase	NA	A0A172Q0Y1	Acinetobacter_phage	28.2	6.3e-33
AWY32143.1|182872_183646_+	hypothetical protein	NA	NA	NA	NA	NA
AWY32144.1|183647_184727_+	hypothetical protein	NA	A0A172Q0S8	Acinetobacter_phage	34.1	1.7e-40
AWY32145.1|184726_185683_+	citrate lyase subunit beta	NA	NA	NA	NA	NA
AWY32146.1|185693_186917_+	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
AWY32147.1|186919_187378_+	tellurium resistance protein TerW	NA	NA	NA	NA	NA
AWY32148.1|187857_188496_+	VWA domain-containing protein	NA	NA	NA	NA	NA
AWY32149.1|188520_189162_+	TerD family protein	NA	A0A2P1N0C0	Streptomyces_phage	25.1	2.4e-05
AWY32150.1|189162_189801_+	VWA domain-containing protein	NA	NA	NA	NA	NA
AWY32207.1|189893_190934_+	VWA domain-containing protein	NA	NA	NA	NA	NA
AWY32151.1|190933_192667_+	protein phosphatase 2C domain-containing protein	NA	NA	NA	NA	NA
AWY32152.1|192694_194194_+	kinase	NA	NA	NA	NA	NA
AWY32153.1|194644_195640_-	hypothetical protein	NA	NA	NA	NA	NA
AWY32154.1|195901_196819_-	hypothetical protein	NA	NA	NA	NA	NA
197509:197528	attL	ATGTCTACTGTATGCGATAT	NA	NA	NA	NA
AWY32155.1|197549_197786_-	hypothetical protein	NA	NA	NA	NA	NA
AWY32156.1|198069_198273_+	hypothetical protein	NA	NA	NA	NA	NA
AWY32157.1|198302_198617_+	hypothetical protein	NA	NA	NA	NA	NA
AWY32158.1|198860_199313_-	hypothetical protein	NA	NA	NA	NA	NA
AWY32159.1|199815_200751_-|protease	omptin family outer membrane protease Kop	protease	NA	NA	NA	NA
AWY32160.1|201507_201963_-	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
AWY32161.1|202034_202400_+	mercuric ion transporter MerT	NA	NA	NA	NA	NA
AWY32162.1|202415_202691_+	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
AWY32163.1|202718_203144_+	mercury transport protein MerC	NA	NA	NA	NA	NA
AWY32164.1|203182_204868_+	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	29.1	1.8e-39
AWY32165.1|204885_205251_+	transcriptional regulator	NA	NA	NA	NA	NA
AWY32166.1|205247_205484_+	mercury resistance protein	NA	NA	NA	NA	NA
AWY32208.1|205467_205587_-	mercury resistance protein	NA	NA	NA	NA	NA
AWY32167.1|205549_205762_+	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
AWY32168.1|205781_205958_-	resolvase	NA	NA	NA	NA	NA
AWY32169.1|205999_206764_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
AWY32170.1|206851_206965_+	NTP-binding protein	NA	NA	NA	NA	NA
AWY32171.1|207270_207771_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AWY32172.1|207789_207969_+	hypothetical protein	NA	NA	NA	NA	NA
AWY32173.1|207898_208738_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
AWY32174.1|208731_209079_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
AWY32175.1|209242_210034_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
AWY32209.1|210126_211386_-	chloramphenicol efflux MFS transporter CmlA1	NA	S4TR35	Salmonella_phage	31.7	4.8e-26
AWY32210.1|211647_212439_-	AadA family aminoglycoside 3''-O-nucleotidyltransferase	NA	NA	NA	NA	NA
AWY32176.1|212584_213598_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	6.1e-72
AWY32177.1|213542_213866_+|transposase	transposase	transposase	NA	NA	NA	NA
219623:219642	attR	ATATCGCATACAGTAGACAT	NA	NA	NA	NA
>prophage 2
CP030270	Klebsiella pneumoniae subsp. pneumoniae strain SC-7 plasmid pSC7-vir, complete sequence	236809	228651	236080	236809	transposase	Stx2-converting_phage(28.57%)	7	NA	NA
AWY32191.1|228651_229620_+|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	28.8	7.3e-14
AWY32192.1|229947_231540_-|transposase	IS66-like element ISKox1 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	61.8	3.2e-176
AWY32193.1|231570_231921_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBY2	Stx2-converting_phage	63.8	5.2e-39
AWY32194.1|231917_232358_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	53.8	4.4e-19
AWY32195.1|232554_232737_+	DUF4113 domain-containing protein	NA	A0A1W6JNT0	Morganella_phage	57.1	9.1e-11
AWY32196.1|233942_234914_-	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	86.9	7.0e-150
AWY32197.1|234913_236080_-	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	97.4	2.0e-223
