The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP029369	Escherichia coli strain WCHEC035148 chromosome, complete genome	4695840	248206	262288	4695840	transposase,integrase	Escherichia_phage(50.0%)	12	250589:250603	262681:262695
AWX36685.1|248206_249049_+|transposase	transposase	transposase	NA	NA	NA	NA
AWX36686.1|249519_250681_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	4.0e-51
250589:250603	attL	TAATTATATCGAATG	NA	NA	NA	NA
AWX40772.1|250800_252420_+|integrase	integrase core domain protein	integrase	NA	NA	NA	NA
AWX36687.1|252419_253868_+	ATP-binding protein	NA	NA	NA	NA	NA
AWX36688.1|253908_255465_+|transposase	transposase	transposase	NA	NA	NA	NA
AWX36689.1|255476_256403_+	hypothetical protein	NA	NA	NA	NA	NA
AWX36690.1|256755_257055_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AWX36691.1|257618_259445_+	OLD family endonuclease	NA	NA	NA	NA	NA
AWX36692.1|259613_259964_-	DUF305 domain-containing protein	NA	A0A218MND9	uncultured_virus	61.4	8.1e-16
AWX40773.1|260356_260473_+	chemotaxis protein	NA	NA	NA	NA	NA
AWX36693.1|260486_261509_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.1	1.0e-199
AWX36694.1|261505_262288_+|transposase	transposase	transposase	A0A2L1IVB6	Escherichia_phage	99.6	5.9e-139
262681:262695	attR	TAATTATATCGAATG	NA	NA	NA	NA
>prophage 2
CP029369	Escherichia coli strain WCHEC035148 chromosome, complete genome	4695840	1081439	1094622	4695840		Escherichia_phage(50.0%)	12	NA	NA
AWX37476.1|1081439_1082201_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	2.0e-59
AWX37477.1|1082194_1082821_+	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
AWX37478.1|1082960_1084100_+	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
AWX37479.1|1084162_1085155_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
AWX37480.1|1085248_1086613_-	GntP family transporter	NA	NA	NA	NA	NA
AWX37481.1|1086701_1087478_-	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
AWX37482.1|1087482_1088121_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
AWX37483.1|1088117_1089380_-	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	1.3e-135
AWX37484.1|1089376_1090285_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
AWX37485.1|1090480_1091248_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	3.3e-70
AWX37486.1|1091298_1091955_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	8.0e-49
AWX37487.1|1092060_1094622_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.7e-30
>prophage 3
CP029369	Escherichia coli strain WCHEC035148 chromosome, complete genome	4695840	1836083	1890912	4695840	transposase,integrase	Shigella_phage(16.67%)	46	1835328:1835342	1893855:1893869
1835328:1835342	attL	AAAACGGCGAAGCGA	NA	NA	NA	NA
AWX38127.1|1836083_1836473_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AWX38128.1|1837176_1838328_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	36.0	2.6e-42
AWX38129.1|1838284_1838641_-|transposase	IS3 family transposase	transposase	U5P4I9	Shigella_phage	92.5	4.4e-33
AWX38130.1|1840196_1840319_+	cobalamin biosynthesis protein	NA	NA	NA	NA	NA
AWX38131.1|1840470_1841016_+	bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase	NA	NA	NA	NA	NA
AWX38132.1|1841012_1841756_+	adenosylcobinamide-GDP ribazoletransferase	NA	NA	NA	NA	NA
AWX38133.1|1841767_1842847_+	nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase	NA	NA	NA	NA	NA
AWX38134.1|1842911_1843844_+	L,D-transpeptidase	NA	NA	NA	NA	NA
AWX38135.1|1844301_1845219_+	nitrogen assimilation regulatory protein nac	NA	NA	NA	NA	NA
AWX38136.1|1845320_1846271_+	HTH-type transcriptional regulator Cbl	NA	NA	NA	NA	NA
AWX38137.1|1846544_1848032_+	FMN/FAD transporter	NA	NA	NA	NA	NA
AWX38138.1|1848274_1848451_-	hypothetical protein	NA	NA	NA	NA	NA
AWX38139.1|1848662_1849379_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
AWX38140.1|1849721_1851176_-	AMP nucleosidase	NA	NA	NA	NA	NA
AWX38141.1|1851277_1852594_-	shikimate transporter	NA	NA	NA	NA	NA
AWX40825.1|1862095_1862893_-	protein MtfA	NA	NA	NA	NA	NA
AWX38142.1|1863380_1863623_-	hypothetical protein	NA	NA	NA	NA	NA
AWX38143.1|1863645_1864176_-	cytochrome b	NA	A0A0U2QLA7	Escherichia_phage	99.1	1.6e-55
AWX38144.1|1864518_1865169_-	metal-binding protein ZinT	NA	NA	NA	NA	NA
AWX38145.1|1865425_1866061_-	protein-methionine-sulfoxide reductase heme-binding subunit MsrQ	NA	NA	NA	NA	NA
AWX38146.1|1866061_1867066_-	mononuclear molybdenum enzyme YedY	NA	NA	NA	NA	NA
AWX38147.1|1867173_1867587_-	5-hydroxyisourate hydrolase	NA	NA	NA	NA	NA
AWX40826.1|1867719_1868391_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	35.6	1.4e-32
AWX38148.1|1868390_1869749_+	HAMP domain-containing protein	NA	Q8QKV7	Ectocarpus_siliculosus_virus	19.4	5.1e-05
AWX38149.1|1869856_1870708_-	protein deglycase HchA	NA	NA	NA	NA	NA
AWX38150.1|1870868_1871219_-	hypothetical protein	NA	NA	NA	NA	NA
AWX38151.1|1872217_1873490_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.4e-177
AWX38152.1|1873415_1873694_-	hypothetical protein	NA	NA	NA	NA	NA
AWX38153.1|1873980_1874166_-	hypothetical protein	NA	NA	NA	NA	NA
AWX38154.1|1874663_1875359_+	phosphohydrolase	NA	S4W232	Pandoravirus	28.2	4.7e-07
AWX38155.1|1875425_1876844_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	55.8	9.4e-103
AWX38156.1|1876824_1877295_+	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	47.6	2.6e-33
AWX38157.1|1877283_1878204_-	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
AWX38158.1|1878376_1879294_+	DUF808 domain-containing protein	NA	NA	NA	NA	NA
AWX38159.1|1879372_1879555_+	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
AWX38160.1|1879725_1881420_+	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	35.6	1.3e-18
AWX38161.1|1881416_1882232_-	mannosyl-3-phosphoglycerate phosphatase-related protein	NA	NA	NA	NA	NA
AWX38162.1|1882529_1882757_-	DUF2525 domain-containing protein	NA	NA	NA	NA	NA
AWX38163.1|1882864_1883107_+	hypothetical protein	NA	NA	NA	NA	NA
AWX38164.1|1884063_1884849_-	flagellar type III secretion system protein FliR	NA	NA	NA	NA	NA
AWX38165.1|1885799_1886114_+	flagellar hook-basal body complex protein FliE	NA	NA	NA	NA	NA
AWX38166.1|1886033_1886348_-|integrase	integrase	integrase	A0A286S1S8	Klebsiella_phage	61.8	6.9e-06
AWX38167.1|1886447_1886780_+	multidrug SMR transporter	NA	NA	NA	NA	NA
AWX38168.1|1886948_1887500_+	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
AWX38169.1|1887509_1888307_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AWX38170.1|1889703_1890912_+|transposase	transposase	transposase	A0A077SL42	Escherichia_phage	94.0	7.5e-210
1893855:1893869	attR	TCGCTTCGCCGTTTT	NA	NA	NA	NA
>prophage 4
CP029369	Escherichia coli strain WCHEC035148 chromosome, complete genome	4695840	1947318	1973562	4695840	holin,tail,terminase,head	Klebsiella_phage(21.21%)	44	NA	NA
AWX38225.1|1947318_1948062_-	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	3.5e-24
AWX38226.1|1948102_1948498_-	hypothetical protein	NA	NA	NA	NA	NA
AWX38227.1|1948550_1949330_-	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	98.4	2.3e-71
AWX38228.1|1949326_1950586_-	DUF3596 domain-containing protein	NA	A0A286S1S8	Klebsiella_phage	90.6	2.7e-226
AWX38229.1|1950628_1950874_-	excisionase	NA	A0A286S2A4	Klebsiella_phage	93.4	3.8e-36
AWX38230.1|1951033_1951252_-	conjugal transfer protein TraR	NA	A0A0K2FI84	Escherichia_phage	56.6	7.8e-09
AWX38231.1|1951248_1951449_-	hypothetical protein	NA	NA	NA	NA	NA
AWX38232.1|1951603_1951807_+	DUF4752 domain-containing protein	NA	T1S9K2	Salmonella_phage	78.5	1.2e-22
AWX38233.1|1951913_1952297_+	hypothetical protein	NA	A0A1V0E5L5	Salmonella_phage	61.5	1.0e-11
AWX38234.1|1952689_1952887_+	hypothetical protein	NA	NA	NA	NA	NA
AWX38235.1|1952923_1953106_+	hypothetical protein	NA	NA	NA	NA	NA
AWX38236.1|1953102_1953366_+	DNA polymerase III subunit theta	NA	G8C7V1	Escherichia_phage	73.7	1.5e-25
AWX38237.1|1953472_1954069_+	DUF1367 domain-containing protein	NA	A0A0U2RT94	Escherichia_phage	53.8	9.5e-57
AWX38238.1|1954068_1954275_+	hypothetical protein	NA	S4TNP0	Salmonella_phage	64.7	8.4e-21
AWX38239.1|1954277_1954568_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	88.5	3.1e-45
AWX38240.1|1954564_1954927_+	RusA family crossover junction endodeoxyribonuclease	NA	K7PM48	Enterobacteria_phage	82.4	4.3e-52
AWX38241.1|1954923_1955064_+	YlcG family protein	NA	NA	NA	NA	NA
AWX38242.1|1955060_1955750_+	antiterminator	NA	I6PDF8	Cronobacter_phage	54.5	3.2e-56
AWX38243.1|1956193_1956505_+|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	88.3	1.2e-42
AWX38244.1|1956501_1957041_+	hypothetical protein	NA	A0A286N2Q6	Klebsiella_phage	96.6	5.3e-99
AWX38245.1|1957037_1957385_+	hypothetical protein	NA	A0A286N2Q7	Klebsiella_phage	71.3	1.2e-35
AWX38246.1|1957381_1957657_+	hypothetical protein	NA	G8C7W1	Escherichia_phage	38.2	2.1e-06
AWX38247.1|1957607_1957805_+	hypothetical protein	NA	A0A286SGR9	Klebsiella_phage	88.1	6.6e-23
AWX38248.1|1957902_1958211_+	hypothetical protein	NA	Q5QF73	Pseudomonas_virus	55.1	4.2e-16
AWX38249.1|1958207_1958474_+	hypothetical protein	NA	NA	NA	NA	NA
AWX38250.1|1958643_1959072_+	hypothetical protein	NA	NA	NA	NA	NA
AWX38251.1|1959130_1959907_+	hypothetical protein	NA	A0A077KBY7	Edwardsiella_phage	66.0	8.4e-13
AWX38252.1|1959857_1961258_+|terminase	PBSX family phage terminase large subunit	terminase	A0A077KAW0	Edwardsiella_phage	69.0	2.1e-187
AWX38253.1|1961480_1962932_+	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	68.6	2.5e-191
AWX38254.1|1962987_1963536_+	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	55.8	7.0e-46
AWX38255.1|1963567_1963990_+	hypothetical protein	NA	NA	NA	NA	NA
AWX38256.1|1964045_1965248_+	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	49.3	2.4e-99
AWX38257.1|1965251_1965746_+	hypothetical protein	NA	A0A2H4JHM9	uncultured_Caudovirales_phage	62.7	4.2e-50
AWX38258.1|1965757_1966699_+	DUF2184 domain-containing protein	NA	A0A2H4J191	uncultured_Caudovirales_phage	77.7	3.5e-138
AWX38259.1|1966738_1967020_+	hypothetical protein	NA	NA	NA	NA	NA
AWX38260.1|1966988_1967408_+	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	62.2	3.9e-41
AWX38261.1|1967404_1967911_+	hypothetical protein	NA	NA	NA	NA	NA
AWX38262.1|1967910_1968297_+|head,tail	head-tail adaptor	head,tail	A0A2H4J1A4	uncultured_Caudovirales_phage	79.0	2.8e-49
AWX40828.1|1968391_1968832_+	hypothetical protein	NA	A0A2H4J1A0	uncultured_Caudovirales_phage	51.7	1.6e-40
AWX40829.1|1968967_1969726_+	DUF2612 domain-containing protein	NA	A0A2H4J1A9	uncultured_Caudovirales_phage	52.2	2.4e-68
AWX38263.1|1969725_1970607_+	hypothetical protein	NA	A0A2H4IYR0	uncultured_Caudovirales_phage	61.1	4.3e-29
AWX38264.1|1970921_1972943_+	hypothetical protein	NA	A0A0C5Q3X6	Klebsiella_phage	47.3	6.9e-107
AWX38265.1|1972951_1973131_+	hypothetical protein	NA	NA	NA	NA	NA
AWX38266.1|1973244_1973562_+	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	50.0	5.3e-22
>prophage 5
CP029369	Escherichia coli strain WCHEC035148 chromosome, complete genome	4695840	2255623	2284226	4695840	tail,integrase	Enterobacteria_phage(30.0%)	33	2256688:2256702	2280466:2280480
AWX38539.1|2255623_2258050_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.0	7.7e-214
2256688:2256702	attL	CGCCGTCGCGGATTG	NA	NA	NA	NA
AWX38540.1|2258248_2258554_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
AWX38541.1|2258661_2259372_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
AWX38542.1|2259374_2259935_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
AWX38543.1|2259969_2260311_-	DUF1283 domain-containing protein	NA	NA	NA	NA	NA
AWX38544.1|2260445_2260772_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
AWX38545.1|2260808_2260997_+	hypothetical protein	NA	NA	NA	NA	NA
AWX38546.1|2260977_2262192_+	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
AWX38547.1|2262203_2263223_+	starvation-sensing protein RspB	NA	E3SJ82	Synechococcus_phage	26.2	4.3e-17
AWX38548.1|2263280_2263391_+	transporter	NA	NA	NA	NA	NA
AWX38549.1|2263410_2264706_-	DUF3596 domain-containing protein	NA	B6DZ48	Enterobacteria_phage	62.3	6.7e-156
AWX38550.1|2264725_2264977_-	DNA-binding protein	NA	S4TND0	Salmonella_phage	50.0	2.2e-15
AWX38551.1|2265049_2267521_-	exonuclease	NA	K7PLW7	Enterobacteria_phage	59.8	6.1e-57
AWX38552.1|2267614_2267806_-	DUF1482 domain-containing protein	NA	NA	NA	NA	NA
AWX38553.1|2267802_2267991_-	division inhibition protein DicB	NA	NA	NA	NA	NA
AWX38554.1|2268074_2268317_+	hypothetical protein	NA	NA	NA	NA	NA
AWX38555.1|2268243_2269263_+	hypothetical protein	NA	U5P0A0	Shigella_phage	63.9	1.0e-58
AWX38556.1|2269303_2269726_+	DUF977 domain-containing protein	NA	A0A0U2QQN3	Escherichia_phage	85.6	2.0e-61
AWX38557.1|2269855_2270800_-	hypothetical protein	NA	NA	NA	NA	NA
AWX38558.1|2271347_2272697_-	hypothetical protein	NA	A0A1W6JNS5	Morganella_phage	98.0	5.7e-259
AWX38559.1|2273014_2273617_+|integrase	integrase	integrase	A0A1V0E036	Clostridioides_phage	31.2	3.7e-08
AWX38560.1|2273976_2274957_+	hypothetical protein	NA	NA	NA	NA	NA
AWX38561.1|2275326_2275470_+	hypothetical protein	NA	NA	NA	NA	NA
AWX38562.1|2275628_2275841_+	Hok/Gef family protein	NA	A0A0U2QV81	Escherichia_phage	95.4	2.0e-25
AWX38563.1|2276056_2276308_+	hypothetical protein	NA	NA	NA	NA	NA
AWX38564.1|2276374_2276653_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	7.4e-12
AWX38565.1|2276654_2277704_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.3	4.2e-108
AWX38566.1|2277716_2278091_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	8.4e-35
AWX38567.1|2278087_2278909_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	59.0	2.7e-78
AWX38568.1|2279654_2281817_+	DUF1983 domain-containing protein	NA	A0A291AWT4	Escherichia_phage	96.6	0.0e+00
2280466:2280480	attR	CGCCGTCGCGGATTG	NA	NA	NA	NA
AWX38569.1|2281887_2282283_+	hypothetical protein	NA	A5LH44	Enterobacteria_phage	97.4	6.1e-60
AWX38570.1|2282648_2284046_+	chaperone of endosialidase	NA	K7PGT9	Enterobacteria_phage	85.2	1.4e-204
AWX38571.1|2284100_2284226_+|tail	phage tail protein	tail	K7PMH7	Enterobacteria_phage	82.5	1.5e-12
>prophage 6
CP029369	Escherichia coli strain WCHEC035148 chromosome, complete genome	4695840	2685473	2698211	4695840	transposase,integrase	Enterobacteria_phage(33.33%)	13	2683446:2683469	2696914:2696937
2683446:2683469	attL	AACGGGCGTGTTATACGCCCGTTG	NA	NA	NA	NA
AWX38926.1|2685473_2687429_-	AAA family ATPase	NA	K4I1H4	Acidithiobacillus_phage	28.6	7.5e-26
AWX38927.1|2689793_2690333_-	regulator	NA	M9NZI6	Enterobacteria_phage	65.6	7.5e-61
AWX38928.1|2690515_2690827_+	recombinase	NA	A0A0N7KZJ3	Stx2-converting_phage	100.0	2.4e-43
AWX38929.1|2690823_2691504_+	exonuclease	NA	A0A0P0ZCD4	Stx2-converting_phage	98.7	5.1e-131
AWX40867.1|2691500_2691659_+	DUF1317 domain-containing protein	NA	M1FJ61	Enterobacteria_phage	88.5	6.4e-21
AWX38930.1|2691655_2692720_+	DGQHR domain-containing protein	NA	T1SBJ4	Salmonella_phage	64.8	1.7e-133
AWX38931.1|2692873_2693092_+	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	94.4	3.2e-34
AWX38932.1|2693139_2693379_+	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	94.9	3.9e-38
AWX38933.1|2693518_2693755_+	excisionase	NA	NA	NA	NA	NA
AWX38934.1|2693878_2694901_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.1	1.0e-199
AWX38935.1|2694897_2695680_+|transposase	transposase	transposase	A0A2L1IVB6	Escherichia_phage	99.6	5.9e-139
AWX40868.1|2695722_2696847_+|integrase	integrase	integrase	O21929	Phage_21	99.7	8.0e-206
AWX38936.1|2696960_2698211_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
2696914:2696937	attR	CAACGGGCGTATAACACGCCCGTT	NA	NA	NA	NA
>prophage 7
CP029369	Escherichia coli strain WCHEC035148 chromosome, complete genome	4695840	3013364	3022134	4695840	integrase	Salmonella_phage(90.0%)	12	3013034:3013047	3022176:3022189
3013034:3013047	attL	AAAACAATAAGTTA	NA	NA	NA	NA
AWX40883.1|3013364_3013553_-	hypothetical protein	NA	A0A1S6L006	Salmonella_phage	95.2	2.0e-24
AWX39220.1|3013711_3016105_-	replication endonuclease	NA	E5G6L9	Salmonella_phage	93.7	0.0e+00
AWX39221.1|3016101_3016959_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	95.8	9.5e-159
AWX39222.1|3016955_3017183_-	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	98.7	7.8e-36
AWX39223.1|3017182_3017416_-	DUF2732 domain-containing protein	NA	E5G6L6	Salmonella_phage	97.4	1.9e-32
AWX39224.1|3017483_3017825_-	hypothetical protein	NA	E5G6L5	Salmonella_phage	98.2	1.7e-55
AWX39225.1|3017942_3018239_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	88.5	1.9e-21
AWX39226.1|3018246_3018756_-	hypothetical protein	NA	E5G6L3	Salmonella_phage	98.2	1.3e-86
AWX39227.1|3018788_3019010_-	regulator	NA	NA	NA	NA	NA
AWX39228.1|3019155_3020034_+	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	39.4	1.7e-30
AWX39229.1|3020045_3020990_+	hypothetical protein	NA	NA	NA	NA	NA
AWX39230.1|3021081_3022134_+|integrase	integrase	integrase	A0A218M4I3	Erwinia_phage	57.0	1.4e-106
3022176:3022189	attR	TAACTTATTGTTTT	NA	NA	NA	NA
>prophage 8
CP029369	Escherichia coli strain WCHEC035148 chromosome, complete genome	4695840	3101717	3128921	4695840	tail,capsid,lysis,terminase,integrase	Enterobacteria_phage(47.06%)	52	3103633:3103647	3128995:3129009
AWX39300.1|3101717_3103007_+	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.1	3.4e-19
AWX39301.1|3103065_3103542_+	kinase inhibitor	NA	NA	NA	NA	NA
AWX39302.1|3103456_3103636_+	hypothetical protein	NA	NA	NA	NA	NA
3103633:3103647	attL	TTAGTATAAAAAAGC	NA	NA	NA	NA
AWX39303.1|3104287_3105619_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	37.1	1.4e-20
AWX39304.1|3105692_3105869_-|tail	phage tail protein	tail	K7PMH7	Enterobacteria_phage	84.5	9.4e-21
AWX40887.1|3106060_3106687_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AWX39305.1|3106631_3106769_-|capsid	nucleocapsid protein	capsid	NA	NA	NA	NA
AWX39306.1|3107577_3108138_-|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	98.8	4.9e-87
AWX39307.1|3108277_3108421_-	DNA-packaging protein	NA	NA	NA	NA	NA
AWX39308.1|3108526_3108760_+	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	94.4	7.3e-21
AWX39309.1|3108816_3109227_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	76.3	1.3e-52
AWX39310.1|3109272_3109437_+	hypothetical protein	NA	NA	NA	NA	NA
AWX39311.1|3109578_3109731_-	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	94.0	1.5e-19
AWX39312.1|3109718_3110186_-|lysis	lysis protein	lysis	A0A2D1GLQ7	Escherichia_phage	96.8	1.6e-75
AWX39313.1|3110182_3110680_-	lysozyme	NA	A0A1B5FP97	Escherichia_phage	97.0	1.6e-89
AWX39314.1|3110679_3110895_-|lysis	lysis protein S	lysis	A5LH82	Enterobacteria_phage	98.6	1.2e-33
AWX39315.1|3111082_3111670_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AWX39316.1|3111678_3111813_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AWX39317.1|3112164_3113124_-	DUF523 and DUF1722 domain-containing protein	NA	NA	NA	NA	NA
AWX39318.1|3113316_3113841_+	hypothetical protein	NA	A0A1W6JNX6	Morganella_phage	54.1	1.1e-48
AWX39319.1|3113996_3114374_-	antitermination protein	NA	Q777W5	Enterobacteria_phage	84.2	7.3e-55
AWX39320.1|3114459_3114600_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	67.4	5.5e-08
AWX39321.1|3114596_3114959_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	97.4	1.5e-60
AWX39322.1|3114955_3115246_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	91.7	4.8e-46
AWX39323.1|3115238_3115409_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
AWX39324.1|3115408_3115864_-	hypothetical protein	NA	I6PD71	Cronobacter_phage	66.2	5.9e-59
AWX39325.1|3115860_3115962_-	hypothetical protein	NA	NA	NA	NA	NA
AWX39326.1|3116054_3116507_-	hypothetical protein	NA	NA	NA	NA	NA
AWX39327.1|3116503_3117064_-	UDP-N-acetylglucosamine acyltransferase	NA	NA	NA	NA	NA
AWX39328.1|3117320_3117512_+	hypothetical protein	NA	NA	NA	NA	NA
AWX39329.1|3117548_3117842_-	protein ren	NA	A0A0N6WES4	Escherichia_phage	95.7	1.1e-42
AWX39330.1|3117838_3118540_-	Replication protein P	NA	K7P6G2	Enterobacteria_phage	99.6	3.8e-129
AWX39331.1|3118536_3119556_-	Replication protein O	NA	A0A0M5M7Y1	Salmonella_phage	63.4	1.7e-109
AWX39332.1|3119552_3120092_-	regulator	NA	M9NZI6	Enterobacteria_phage	66.1	2.0e-61
AWX39333.1|3120161_3120392_-	transcriptional regulator	NA	A0A2H4FNF3	Salmonella_phage	68.0	1.5e-21
AWX39334.1|3120430_3121186_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	75.0	1.4e-92
AWX39335.1|3121308_3122058_+	hypothetical protein	NA	NA	NA	NA	NA
AWX39336.1|3122054_3122882_+	DUF3037 domain-containing protein	NA	NA	NA	NA	NA
AWX39337.1|3123390_3123597_+	cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	85.3	3.2e-28
AWX39338.1|3123672_3123969_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
AWX39339.1|3123974_3124760_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
AWX39340.1|3124756_3125437_+	exonuclease	NA	A0A0P0ZCD4	Stx2-converting_phage	98.7	3.0e-131
AWX40888.1|3125433_3125616_+	DUF1317 domain-containing protein	NA	A0A0N7CHV0	Escherichia_phage	98.3	2.2e-28
AWX39341.1|3125588_3125780_+	DUF1382 domain-containing protein	NA	A0A0P0ZC67	Stx2-converting_phage	98.4	2.8e-26
AWX39342.1|3125790_3126072_+	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	100.0	2.5e-47
AWX39343.1|3126170_3126392_+	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	97.3	1.4e-34
AWX39344.1|3126602_3127133_-	hypothetical protein	NA	NA	NA	NA	NA
AWX39345.1|3127023_3127275_-	hypothetical protein	NA	NA	NA	NA	NA
AWX39346.1|3127329_3127515_-	hypothetical protein	NA	NA	NA	NA	NA
AWX39347.1|3127447_3127615_+	hypothetical protein	NA	A5VWB7	Enterobacteria_phage	98.2	2.9e-27
AWX39348.1|3127654_3127873_+	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
AWX39349.1|3127850_3128921_+|integrase	integrase	integrase	Q9MCR4	Enterobacteria_phage	99.7	1.9e-201
3128995:3129009	attR	TTAGTATAAAAAAGC	NA	NA	NA	NA
>prophage 9
CP029369	Escherichia coli strain WCHEC035148 chromosome, complete genome	4695840	3910165	3957141	4695840	capsid,tail,lysis,terminase,portal,integrase	Enterobacteria_phage(48.08%)	56	3912977:3912996	3957372:3957391
AWX40048.1|3910165_3910345_-	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	64.2	2.0e-10
AWX40049.1|3910453_3911059_-	molecular chaperone OsmY	NA	NA	NA	NA	NA
AWX40050.1|3911451_3913038_-	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	24.9	5.3e-30
3912977:3912996	attL	GGGTGAGAAATAATGGCAAA	NA	NA	NA	NA
AWX40051.1|3913257_3913506_+	damage-inducible protein DinI	NA	A5LH55	Enterobacteria_phage	98.8	7.0e-38
AWX40915.1|3914023_3914320_+	hypothetical protein	NA	A0A291AWW6	Escherichia_phage	99.0	6.8e-48
AWX40052.1|3914655_3915159_-	hypothetical protein	NA	A0A291AWW1	Escherichia_phage	99.4	1.5e-90
AWX40053.1|3915589_3915712_-|capsid	nucleocapsid protein	capsid	NA	NA	NA	NA
AWX40054.1|3915867_3919482_-|tail	phage tail protein	tail	K7PGT9	Enterobacteria_phage	86.0	0.0e+00
AWX40055.1|3919546_3920146_-	Ail/Lom family protein	NA	H6WZM8	Escherichia_phage	97.5	6.3e-109
AWX40056.1|3920214_3923694_-	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	89.6	0.0e+00
AWX40057.1|3923753_3924401_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	97.2	4.3e-111
AWX40058.1|3924298_3925042_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	98.8	6.3e-151
AWX40059.1|3925046_3925745_-|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	100.0	6.0e-135
AWX40060.1|3925754_3926084_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
AWX40061.1|3926083_3929149_-|tail	phage tail tape measure protein	tail	K7PKI9	Enterobacteria_phage	98.5	0.0e+00
AWX40062.1|3929120_3929450_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
AWX40916.1|3929458_3929845_-|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	100.0	1.6e-65
AWX40063.1|3929905_3930649_-|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	100.0	7.8e-133
AWX40064.1|3930660_3931062_-|tail	phage tail protein	tail	A0A291AWY2	Escherichia_phage	100.0	8.3e-73
AWX40065.1|3931058_3931637_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	100.0	4.2e-102
AWX40066.1|3931648_3931924_-	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	98.9	1.1e-44
AWX40067.1|3931916_3932285_-	DUF2190 domain-containing protein	NA	A5LH31	Enterobacteria_phage	100.0	9.7e-52
AWX40068.1|3932326_3934450_-	peptidase S14	NA	A0A291AWT6	Escherichia_phage	99.7	0.0e+00
AWX40069.1|3934298_3935807_-|portal	phage portal protein	portal	A0A291AWU2	Escherichia_phage	99.6	2.3e-288
AWX40070.1|3935806_3936019_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
AWX40071.1|3936015_3938115_-|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	96.9	0.0e+00
AWX40917.1|3938123_3938663_-	DUF1441 domain-containing protein	NA	A5LH26	Enterobacteria_phage	100.0	1.8e-94
AWX40072.1|3939296_3939449_-	hypothetical protein	NA	A0A291AWZ2	Escherichia_phage	100.0	1.2e-21
AWX40073.1|3939436_3939874_-|lysis	lysis protein	lysis	K7PJN9	Enterobacteria_phage	97.2	1.6e-69
AWX40074.1|3939870_3940368_-	lysozyme	NA	A0A291AWW2	Escherichia_phage	100.0	4.5e-92
AWX40075.1|3940367_3940583_-|lysis	lysis protein S	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
AWX40076.1|3940650_3941703_-	DNA adenine methylase	NA	A5LH81	Enterobacteria_phage	99.4	8.8e-207
AWX40077.1|3941853_3942057_-	hypothetical protein	NA	A0A291AWX6	Escherichia_phage	100.0	6.1e-32
AWX40078.1|3942280_3942706_-	hypothetical protein	NA	A0A291AWZ9	Escherichia_phage	100.0	3.6e-74
AWX40079.1|3942986_3943739_-	antitermination protein	NA	Q8SBE4	Shigella_phage	98.4	2.0e-136
AWX40080.1|3943752_3944742_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	100.0	1.5e-195
AWX40081.1|3944749_3945559_-	KilA-N domain-containing protein	NA	A5LH75	Enterobacteria_phage	100.0	8.2e-152
AWX40082.1|3945578_3945968_-	RusA family crossover junction endodeoxyribonuclease	NA	K7PH72	Enterobacteria_phage	100.0	7.1e-69
AWX40083.1|3945964_3946291_-	LexA family transcriptional regulator	NA	U5P451	Shigella_phage	100.0	9.2e-54
AWX40084.1|3946287_3946941_-	phage N-6-adenine-methyltransferase	NA	A0A0P0ZCC0	Stx2-converting_phage	100.0	1.1e-127
AWX40085.1|3946940_3947435_-	PerC family transcriptional regulator	NA	U5P0U0	Shigella_phage	98.2	1.9e-87
AWX40086.1|3947431_3948250_-	helix-turn-helix domain-containing protein	NA	Q8SBF1	Shigella_phage	97.1	4.4e-121
AWX40087.1|3948246_3948471_-	hypothetical protein	NA	A5LH70	Enterobacteria_phage	100.0	5.7e-39
AWX40088.1|3948467_3949616_-	peptidase	NA	A5LH69	Enterobacteria_phage	80.9	3.8e-163
AWX40089.1|3949612_3950164_-	hypothetical protein	NA	K7PGU3	Enterobacteria_phage	97.3	5.4e-99
AWX40090.1|3950156_3950417_-	XRE family transcriptional regulator	NA	K7PJQ8	Enterobacteria_phage	100.0	5.4e-41
AWX40091.1|3950388_3950541_-	amino acid permease	NA	NA	NA	NA	NA
AWX40092.1|3950514_3951207_+	XRE family transcriptional regulator	NA	S5FUZ3	Shigella_phage	96.1	3.7e-121
AWX40093.1|3951286_3951541_+	hypothetical protein	NA	A0A291AWY6	Escherichia_phage	97.4	2.7e-13
AWX40094.1|3951642_3951837_-	hypothetical protein	NA	A0A291AWX8	Escherichia_phage	96.9	7.1e-30
AWX40095.1|3951909_3952272_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
AWX40096.1|3952337_3953162_+	hypothetical protein	NA	U5P439	Shigella_phage	99.3	5.0e-149
AWX40097.1|3953289_3953826_+	HD family hydrolase	NA	K7PKJ9	Enterobacteria_phage	97.8	9.0e-99
AWX40098.1|3953860_3954055_+	DNA-binding protein	NA	A5LH59	Enterobacteria_phage	93.8	2.5e-30
AWX40099.1|3954356_3955712_-	hypothetical protein	NA	NA	NA	NA	NA
AWX40100.1|3955917_3957141_-|integrase	site-specific integrase	integrase	A0A291AWU1	Escherichia_phage	98.0	2.8e-236
3957372:3957391	attR	GGGTGAGAAATAATGGCAAA	NA	NA	NA	NA
>prophage 10
CP029369	Escherichia coli strain WCHEC035148 chromosome, complete genome	4695840	4033903	4095024	4695840	transposase,integrase,protease,tRNA	Escherichia_phage(14.29%)	55	4054496:4054523	4061810:4061837
AWX40179.1|4033903_4035289_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	89.3	3.4e-259
AWX40180.1|4035527_4036901_-	esterase-like activity of phytase family protein	NA	NA	NA	NA	NA
AWX40181.1|4037264_4037456_+	hypothetical protein	NA	A0A0N7BTS3	Escherichia_phage	96.2	2.4e-06
AWX40182.1|4037618_4037876_-	biofilm development YmgB/AriR family protein	NA	NA	NA	NA	NA
AWX40183.1|4039162_4039945_-|transposase	transposase	transposase	A0A2L1IVB6	Escherichia_phage	99.6	5.9e-139
AWX40184.1|4039941_4040964_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.1	1.0e-199
AWX40185.1|4041585_4042107_+	RNA polymerase sigma factor FecI	NA	NA	NA	NA	NA
AWX40186.1|4042103_4043057_+	protein FecR	NA	NA	NA	NA	NA
AWX40187.1|4043143_4045468_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
AWX40188.1|4045512_4046415_+	Fe(3+)-dicitrate ABC transporter substrate-binding protein FecB	NA	NA	NA	NA	NA
AWX40189.1|4046411_4047410_+	Fe3+ dicitrate ABC transporter permease	NA	NA	NA	NA	NA
AWX40190.1|4047406_4048363_+	iron-dicitrate transporter subunit FecD	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.1	1.1e-17
AWX40191.1|4048363_4049131_+	Fe(3+) dicitrate transport ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	24.8	6.4e-13
AWX40192.1|4049688_4050102_-	hypothetical protein	NA	NA	NA	NA	NA
AWX40193.1|4050997_4052149_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	36.0	2.6e-42
AWX40194.1|4052068_4052419_-	hypothetical protein	NA	Q716C1	Shigella_phage	97.7	8.9e-39
AWX40195.1|4052519_4053092_+	hypothetical protein	NA	Q858R9	Enterobacteria_phage	69.0	2.2e-71
AWX40196.1|4053140_4053965_-	hypothetical protein	NA	L7TR00	Rhizobium_phage	35.5	3.0e-16
4054496:4054523	attL	ACTTGGTGCCGAAGGCCGGACTCGAACC	NA	NA	NA	NA
AWX40922.1|4055002_4055467_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AWX40197.1|4055707_4056202_+	hypothetical protein	NA	NA	NA	NA	NA
AWX40198.1|4056262_4057108_-	hypothetical protein	NA	NA	NA	NA	NA
AWX40923.1|4057121_4057688_-	recombinase family protein	NA	A0A219Y912	Aeromonas_phage	39.9	4.2e-22
AWX40199.1|4058011_4058341_+	DUF1643 domain-containing protein	NA	A0A1V0EBT6	Caulobacter_phage	35.4	2.0e-11
AWX40200.1|4059346_4059679_+	NIPSNAP family protein	NA	NA	NA	NA	NA
AWX40201.1|4059811_4061722_-|integrase	integrase	integrase	NA	NA	NA	NA
AWX40202.1|4062092_4063112_+	aldehyde reductase Ahr	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	30.4	1.9e-44
4061810:4061837	attR	ACTTGGTGCCGAAGGCCGGACTCGAACC	NA	NA	NA	NA
AWX40203.1|4063241_4064744_+	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	44.8	2.1e-84
AWX40204.1|4064904_4065987_-	lipopolysaccharide ABC transporter permease LptG	NA	NA	NA	NA	NA
AWX40205.1|4065986_4067087_-	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
AWX40206.1|4067353_4068865_+	cytosol aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.0	6.0e-47
AWX40207.1|4069122_4069566_+	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
AWX40208.1|4069565_4072421_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.7	1.8e-140
AWX40209.1|4072474_4073671_-	DUF898 domain-containing protein	NA	NA	NA	NA	NA
AWX40210.1|4073863_4074367_+	N-acetyltransferase	NA	NA	NA	NA	NA
AWX40211.1|4074412_4074829_-	regulator of ribonuclease activity B	NA	NA	NA	NA	NA
AWX40212.1|4074990_4075995_+	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
AWX40213.1|4076051_4077647_-	DNA-binding protein	NA	NA	NA	NA	NA
AWX40214.1|4077769_4078222_-	YhcH/YjgK/YiaL family protein	NA	NA	NA	NA	NA
AWX40215.1|4078366_4078960_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AWX40216.1|4079030_4079744_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
AWX40217.1|4079874_4080270_+	RidA family protein	NA	NA	NA	NA	NA
AWX40924.1|4080238_4080421_-	hypothetical protein	NA	NA	NA	NA	NA
AWX40218.1|4080550_4080685_+	pyrBI operon leader peptide	NA	NA	NA	NA	NA
AWX40219.1|4080688_4081624_+	aspartate carbamoyltransferase catalytic subunit	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	40.2	2.9e-52
AWX40220.1|4081636_4082098_+	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
AWX40221.1|4082170_4082557_+	reactive intermediate/imine deaminase	NA	NA	NA	NA	NA
AWX40222.1|4082762_4085459_-	magnesium-translocating P-type ATPase	NA	M1HLC0	Paramecium_bursaria_Chlorella_virus	27.4	9.0e-46
AWX40925.1|4085599_4085653_-	mgtA regulatory leader peptide MgtL	NA	NA	NA	NA	NA
AWX40223.1|4085837_4086785_+	HTH-type transcriptional regulator TreR	NA	C6ZCU4	Enterobacteria_phage	21.8	7.9e-13
AWX40224.1|4086903_4088325_+	PTS trehalose transporter subunit IIBC	NA	NA	NA	NA	NA
AWX40225.1|4088374_4090030_+	alpha,alpha-phosphotrehalase	NA	NA	NA	NA	NA
AWX40226.1|4090423_4092562_+	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.6	9.1e-267
AWX40227.1|4092721_4093186_+	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	H6WXC9	Vibrio_phage	59.7	2.5e-52
AWX40228.1|4093230_4093617_-	cytochrome b562	NA	NA	NA	NA	NA
AWX40229.1|4093671_4095024_-|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
>prophage 1
CP029365	Escherichia coli strain WCHEC035148 plasmid p1_035148, complete sequence	89248	0	88835	89248	lysis,transposase,integrase,plate,holin,terminase,protease,tail,capsid,head,tRNA,portal	Escherichia_phage(91.3%)	99	46228:46254	66986:67012
AWX36192.1|137_941_+	hypothetical protein	NA	A0A222YXK1	Escherichia_phage	98.1	1.0e-114
AWX36193.1|1033_1492_+	hypothetical protein	NA	A0A222YWG1	Escherichia_phage	99.3	9.2e-68
AWX36194.1|1645_2104_-	hypothetical protein	NA	A0A222YWJ4	Escherichia_phage	99.3	6.1e-88
AWX36282.1|2120_2312_-	hypothetical protein	NA	A0A222YXX4	Escherichia_phage	100.0	3.7e-31
AWX36195.1|2671_4369_+|capsid	capsid protein	capsid	A0A222YWC7	Escherichia_phage	98.6	0.0e+00
AWX36196.1|4515_4794_+	hypothetical protein	NA	A0A222YWH8	Escherichia_phage	94.6	1.9e-39
AWX36197.1|4861_6520_+|tail	phage tail protein	tail	A0A222YWC8	Escherichia_phage	97.6	3.6e-303
AWX36198.1|6563_7298_+	hypothetical protein	NA	A0A222YXT7	Escherichia_phage	99.2	5.0e-124
AWX36199.1|7365_7938_+	hypothetical protein	NA	A0A222YY02	Escherichia_phage	99.5	1.8e-100
AWX36200.1|7946_8438_+|plate	baseplate protein	plate	A0A222YWE4	Escherichia_phage	98.2	1.1e-87
AWX36201.1|8490_9042_+	hypothetical protein	NA	A0A222YWE3	Escherichia_phage	98.4	8.7e-97
AWX36202.1|9057_9765_+|tail	phage tail protein	tail	A0A222YY05	Escherichia_phage	100.0	1.0e-126
AWX36203.1|10146_10902_-	RepB family plasmid replication initiator protein	NA	A0A222YYK1	Escherichia_phage	100.0	3.7e-138
AWX36204.1|11290_12112_+	hypothetical protein	NA	A0A222YZ63	Escherichia_phage	98.9	2.9e-157
AWX36205.1|16227_16602_+	hypothetical protein	NA	A0A222YXD0	Escherichia_phage	96.8	2.5e-63
AWX36206.1|16598_18029_+|plate	baseplate protein	plate	A0A222YWB2	Escherichia_phage	92.6	5.9e-254
AWX36207.1|18039_18885_+|tail	phage tail protein	tail	A0A222YWB7	Escherichia_phage	94.7	7.7e-153
AWX36283.1|19276_19426_+|tail	phage tail protein	tail	A0A222YXS1	Escherichia_phage	91.8	1.7e-18
AWX36208.1|19428_22611_+|tail	phage tail protein	tail	A0A222YWB9	Escherichia_phage	67.6	8.0e-219
AWX36209.1|22610_23021_+|tail	phage tail protein	tail	Q9MCR5	Enterobacteria_phage	80.3	1.6e-23
AWX36210.1|23415_23742_+|holin	holin	holin	A0A222YZ46	Escherichia_phage	100.0	3.3e-51
AWX36211.1|23741_24188_+|lysis	lysis protein	lysis	A0A222YXP5	Escherichia_phage	100.0	9.2e-81
AWX36212.1|24177_24798_+	hypothetical protein	NA	A0A222YXB2	Escherichia_phage	99.0	2.4e-79
AWX36213.1|24790_26716_+|head	head protein	head	A0A222YWA3	Escherichia_phage	97.2	3.5e-312
AWX36214.1|26715_27084_+	hypothetical protein	NA	A0A222YWB0	Escherichia_phage	84.7	8.0e-38
AWX36215.1|27178_28564_+	hypothetical protein	NA	A0A222YY44	Escherichia_phage	96.7	1.4e-236
AWX36216.1|29042_30311_+|portal	phage portal protein	portal	A0A222YXQ7	Escherichia_phage	99.8	6.4e-244
AWX36217.1|30324_31323_+|head	head processing protein	head	A0A222YWA7	Escherichia_phage	97.0	4.1e-177
AWX36218.1|31523_32486_+	lytic replication protein	NA	A0A222YXV1	Escherichia_phage	98.4	6.2e-175
AWX36219.1|32635_33805_-|transposase	transposase	transposase	A0A077SLN2	Escherichia_phage	87.7	4.0e-184
AWX36220.1|34239_34395_+	transcriptional regulator	NA	NA	NA	NA	NA
AWX36221.1|34397_34622_+	host cell division inhibitor Icd-like protein	NA	A0A222YWB3	Escherichia_phage	100.0	8.8e-40
AWX36222.1|35558_36044_-	TIGR02594 family protein	NA	A0A222YWL8	Escherichia_phage	100.0	3.3e-92
AWX36223.1|36195_43035_+	helicase SNF2	NA	A0A222YYH3	Escherichia_phage	93.5	0.0e+00
AWX36224.1|43071_43506_+	olxA	NA	A0A222YZ35	Escherichia_phage	100.0	2.9e-79
AWX36225.1|43508_43769_+	hypothetical protein	NA	A0A222YXI8	Escherichia_phage	100.0	1.8e-44
AWX36226.1|44103_44400_+	VRR-NUC domain-containing protein	NA	A0A222YXP1	Escherichia_phage	100.0	5.4e-53
AWX36227.1|44414_44615_+	hypothetical protein	NA	A0A222YWF9	Escherichia_phage	98.5	3.3e-30
AWX36284.1|44629_44911_+	hypothetical protein	NA	A0A222YW96	Escherichia_phage	97.8	2.0e-41
AWX36228.1|45024_46233_+	hypothetical protein	NA	A0A222YW83	Escherichia_phage	99.5	4.5e-231
46228:46254	attL	AAATAATATGTTAGAAAACTAAAATCA	NA	NA	NA	NA
AWX36229.1|48393_48630_+	hypothetical protein	NA	A0A0A7NQ74	Enterobacteria_phage	50.0	2.1e-07
AWX36230.1|48610_49438_+|protease	serine protease	protease	A0A077SLJ6	Escherichia_phage	98.5	4.0e-130
AWX36285.1|50505_50697_+	hypothetical protein	NA	A0A222YWJ0	Escherichia_phage	100.0	3.2e-30
AWX36286.1|50903_51089_+	hypothetical protein	NA	Q5QBF3	Escherichia_phage	98.4	6.4e-28
AWX36231.1|51197_51590_+	late promoter activating protein	NA	NA	NA	NA	NA
AWX36287.1|51970_52951_+	DNA pacase A subunit	NA	NA	NA	NA	NA
AWX36232.1|52950_54459_+|terminase	terminase	terminase	Q5QBP2	Enterobacteria_phage	56.8	1.2e-161
AWX36288.1|54486_54726_-	hypothetical protein	NA	Q5QBE5	Escherichia_phage	96.4	1.4e-06
AWX36233.1|55918_56947_+|integrase	integrase	integrase	Q5QBN6	Enterobacteria_phage	41.6	8.7e-58
AWX36234.1|57056_57365_+	hypothetical protein	NA	Q5QBE7	Escherichia_phage	100.0	1.4e-51
AWX36235.1|57361_57838_+	hypothetical protein	NA	NA	NA	NA	NA
AWX36236.1|57834_58329_+	dUTP diphosphatase	NA	A0A222YYP1	Escherichia_phage	95.7	3.3e-87
AWX36237.1|58343_59045_+	DUF2829 domain-containing protein	NA	A0A1B0VBT1	Salmonella_phage	63.9	2.7e-79
AWX36238.1|59051_59816_+	hypothetical protein	NA	A0A222YXM9	Escherichia_phage	98.8	3.8e-135
AWX36239.1|59805_60900_+	hypothetical protein	NA	Q71T61	Escherichia_phage	33.1	4.6e-41
AWX36240.1|60935_61316_-	type II toxin-antitoxin system death-on-curing family toxin	NA	Q71T66	Escherichia_phage	91.9	2.7e-57
AWX36241.1|61315_61537_-	type II toxin-antitoxin system prevent-host-death family antitoxin	NA	A0A222YXU1	Escherichia_phage	100.0	6.7e-32
AWX36242.1|61609_61999_-	DNA repair protein	NA	A0A077SK24	Escherichia_phage	96.9	7.1e-69
AWX36243.1|62097_62349_-	DNA polymerase III subunit theta	NA	Q71T70	Escherichia_phage	92.8	3.9e-36
AWX36289.1|62351_62552_-	hypothetical protein	NA	NA	NA	NA	NA
AWX36244.1|62663_63494_-	hypothetical protein	NA	A0A077SK54	Escherichia_phage	72.0	1.7e-80
AWX36245.1|63504_63768_-	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	73.6	3.9e-31
AWX36246.1|63769_63961_-	hypothetical protein	NA	A0A1I9LJM4	Stx_converting_phage	90.3	3.3e-27
AWX36247.1|64133_64580_-	hypothetical protein	NA	A0A222YWN7	Escherichia_phage	81.4	3.7e-37
AWX36248.1|64576_65263_-	ead/Ea22-like family protein	NA	E7C9P6	Salmonella_phage	61.5	2.8e-44
AWX36249.1|65249_65939_-	hypothetical protein	NA	Q71T76	Escherichia_phage	70.8	2.9e-89
AWX36250.1|65955_66951_-	DUF968 domain-containing protein	NA	A0A222YWL6	Escherichia_phage	99.4	2.1e-197
AWX36251.1|67049_67742_-	serine/threonine protein phosphatase	NA	A0A222YWF0	Escherichia_phage	95.2	6.8e-131
66986:67012	attR	AAATAATATGTTAGAAAACTAAAATCA	NA	NA	NA	NA
AWX36252.1|67738_68050_-	hypothetical protein	NA	A0A222YY67	Escherichia_phage	97.1	4.5e-58
AWX36253.1|68046_68271_-	hypothetical protein	NA	A0A222YYR6	Escherichia_phage	95.9	5.0e-35
AWX36254.1|68267_68543_-	DUF4752 domain-containing protein	NA	A0A222YWQ2	Escherichia_phage	83.5	3.6e-35
AWX36255.1|68539_69235_-	hypothetical protein	NA	A0A2I6TCG8	Escherichia_phage	97.5	6.5e-41
AWX36256.1|69231_69555_-	carboxylate--amine ligase	NA	A0A222YZB4	Escherichia_phage	82.4	1.2e-40
AWX36257.1|69554_70256_-	hypothetical protein	NA	A0A222YWM9	Escherichia_phage	94.1	3.2e-112
AWX36290.1|70245_70530_-	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	91.5	1.8e-42
AWX36258.1|70559_71171_-	hypothetical protein	NA	A0A222YYT7	Escherichia_phage	89.7	3.2e-100
AWX36259.1|71442_72018_+	recombinase	NA	A0A222YXV2	Escherichia_phage	90.0	4.4e-67
AWX36260.1|72640_72820_+	host cell division inhibitor Icd-like protein	NA	A0A222YWG3	Escherichia_phage	97.5	6.4e-17
AWX36291.1|72904_73132_-	hypothetical protein	NA	NA	NA	NA	NA
AWX36261.1|73317_73926_-	hypothetical protein	NA	NA	NA	NA	NA
AWX36262.1|74209_74863_+	maturation control protein	NA	A0A222YZ79	Escherichia_phage	99.1	1.4e-114
AWX36263.1|75191_75521_+|plate	baseplate protein	plate	A0A222YYR0	Escherichia_phage	99.1	2.4e-57
AWX36264.1|75513_76707_+|tail	phage tail protein	tail	A0A222YXT1	Escherichia_phage	99.7	2.6e-202
AWX36265.1|76740_77469_-	hypothetical protein	NA	A0A222YY57	Escherichia_phage	57.1	2.9e-71
AWX36266.1|77490_77691_-	hypothetical protein	NA	A0A222YXG1	Escherichia_phage	90.8	8.1e-29
AWX36267.1|77747_78086_-	addiction module antidote protein, HigA family	NA	A0A222YWD7	Escherichia_phage	100.0	1.3e-55
AWX36268.1|78156_78459_-	hypothetical protein	NA	A0A222YWE2	Escherichia_phage	100.0	5.9e-55
AWX36269.1|78621_79413_+|tail	phage tail protein	tail	A0A222YXU3	Escherichia_phage	98.1	2.4e-148
AWX36270.1|79409_80177_+|plate	baseplate	plate	A0A222YWF4	Escherichia_phage	100.0	4.4e-139
AWX36271.1|80180_81161_+|tail	tail length tape measure protein	tail	A0A222YXZ0	Escherichia_phage	100.0	2.5e-187
AWX36272.1|81157_81811_+|plate	baseplate protein	plate	A0A222YWF1	Escherichia_phage	93.5	1.3e-94
AWX36273.1|81870_82776_+	recombination-associated protein RdgC	NA	A0A222YY21	Escherichia_phage	99.3	3.6e-164
AWX36274.1|82759_83440_+	hypothetical protein	NA	A0A222YXN3	Escherichia_phage	100.0	5.8e-135
AWX36275.1|83432_84338_+	DNA methylase	NA	A0A222YYM0	Escherichia_phage	99.7	2.2e-174
AWX36276.1|84386_86048_-|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	99.3	0.0e+00
AWX36277.1|86316_86604_-	hypothetical protein	NA	A0A222YZA7	Escherichia_phage	100.0	8.1e-46
AWX36278.1|86596_87238_-	cobyrinic acid ac-diamide synthase	NA	A0A222YXS3	Escherichia_phage	100.0	7.5e-116
AWX36279.1|87526_87865_-	plasmid stabilization protein	NA	A0A222YWJ6	Escherichia_phage	99.1	2.6e-51
AWX36280.1|87878_88835_-	recombinase	NA	A0A222YXF2	Escherichia_phage	99.4	2.4e-179
>prophage 1
CP029368	Escherichia coli strain WCHEC035148 plasmid pQnrS1_035148, complete sequence	122194	9716	55765	122194	transposase	Escherichia_phage(38.89%)	44	NA	NA
AWX36341.1|9716_10499_-|transposase	transposase	transposase	A0A2L1IVB6	Escherichia_phage	99.6	5.9e-139
AWX36342.1|10495_11518_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.1	1.0e-199
AWX36343.1|12597_12972_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	9.8e-60
AWX36344.1|12996_13701_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AWX36345.1|14027_14504_+	non-heme ferritin-like protein	NA	NA	NA	NA	NA
AWX36450.1|14715_14973_-	phosphoribulokinase	NA	NA	NA	NA	NA
AWX36346.1|16127_16688_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AWX36347.1|16775_17327_-	osmotically inducible protein C	NA	NA	NA	NA	NA
AWX36348.1|17417_17753_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
AWX36349.1|17779_18574_-	sugar dehydrogenase	NA	A0A0M4JSW6	Mollivirus	27.4	2.1e-11
AWX36350.1|18730_19072_-	thiol reductase thioredoxin	NA	A0A0K2FIM3	Achromobacter_phage	40.0	1.1e-09
AWX36351.1|19286_20396_+	alkene reductase	NA	NA	NA	NA	NA
AWX36352.1|20464_21163_+	DsbA family oxidoreductase	NA	NA	NA	NA	NA
AWX36353.1|21504_22410_-	hypothetical protein	NA	NA	NA	NA	NA
AWX36354.1|22575_22902_+	thioredoxin	NA	A0A2I2L415	Orpheovirus	37.4	6.0e-13
AWX36355.1|23111_23321_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
AWX36356.1|23983_24688_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AWX36451.1|24910_25222_-	hypothetical protein	NA	NA	NA	NA	NA
AWX36357.1|25968_27444_-	hypothetical protein	NA	NA	NA	NA	NA
AWX36358.1|28196_28799_-	hypothetical protein	NA	NA	NA	NA	NA
AWX36359.1|28985_29243_-	hypothetical protein	NA	NA	NA	NA	NA
AWX36360.1|29367_30087_-	RepB family plasmid replication initiator protein	NA	I3WF20	Macacine_betaherpesvirus	30.0	1.3e-20
AWX36361.1|30646_30988_+	ArdK family transcriptional regulator	NA	NA	NA	NA	NA
AWX36452.1|31002_31794_-	sprT domain-containing protein	NA	NA	NA	NA	NA
AWX36362.1|31944_33210_-	translesion error-prone DNA polymerase V subunit MucB	NA	F1C5A5	Cronobacter_phage	54.0	4.4e-120
AWX36363.1|33197_33638_-	translesion error-prone DNA polymerase V autoproteolytic subunit MucA	NA	A0A1W6JNS2	Morganella_phage	48.8	1.2e-27
AWX36364.1|33764_33962_+	hypothetical protein	NA	NA	NA	NA	NA
AWX36365.1|34053_34479_+	hypothetical protein	NA	NA	NA	NA	NA
AWX36366.1|34536_34941_+	antirestriction protein ArdR	NA	NA	NA	NA	NA
AWX36367.1|34950_35190_+	cobalamin biosynthesis protein CbiX	NA	NA	NA	NA	NA
AWX36368.1|36074_36371_+	cobalamin biosynthesis protein CbiX	NA	NA	NA	NA	NA
AWX36369.1|36367_36562_+	hypothetical protein	NA	NA	NA	NA	NA
AWX36370.1|37054_37843_-	MltA-interacting MipA family protein	NA	NA	NA	NA	NA
AWX36371.1|37968_38661_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	31.8	1.2e-26
AWX36372.1|38657_39839_+	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	24.7	4.7e-15
AWX36373.1|39930_41076_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AWX36374.1|41072_44132_+	ACR family transporter	NA	NA	NA	NA	NA
AWX36375.1|44298_44661_+	RlgA	NA	A0JC18	Ralstonia_phage	46.8	2.8e-19
AWX36376.1|44672_45377_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AWX36377.1|48694_49399_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AWX36378.1|49468_49942_-	trimethoprim-resistant dihydrofolate reductase DfrA14	NA	G3MBI7	Bacillus_virus	28.9	8.4e-16
AWX36379.1|51155_51860_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AWX36380.1|52937_53594_+	quinolone resistance pentapeptide repeat protein QnrS1	NA	NA	NA	NA	NA
AWX36381.1|54373_55765_-|transposase	ISKra4 family transposase ISKpn19	transposase	NA	NA	NA	NA
>prophage 2
CP029368	Escherichia coli strain WCHEC035148 plasmid pQnrS1_035148, complete sequence	122194	83195	91575	122194	transposase	Stx2-converting_phage(50.0%)	14	NA	NA
AWX36410.1|83195_84767_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.5	4.9e-169
AWX36411.1|84786_85134_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
AWX36412.1|85133_85811_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
AWX36413.1|85772_85955_+	hypothetical protein	NA	U5P0U6	Shigella_phage	100.0	8.5e-09
AWX36414.1|86255_86468_-	hypothetical protein	NA	NA	NA	NA	NA
AWX36415.1|86601_87162_-	conjugal transfer protein	NA	NA	NA	NA	NA
AWX36416.1|87216_87993_-	type-F conjugative transfer system pilin acetylase TraX	NA	A0A077JBM8	Xanthomonas_phage	30.5	3.3e-09
AWX36417.1|87931_88102_-	hypothetical protein	NA	NA	NA	NA	NA
AWX36418.1|88098_88521_-	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
AWX36419.1|88567_88993_-	antirestriction protein	NA	NA	NA	NA	NA
AWX36420.1|89406_90177_-	hypothetical protein	NA	NA	NA	NA	NA
AWX36421.1|90221_90656_-	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
AWX36422.1|90669_90891_-	hypothetical protein	NA	NA	NA	NA	NA
AWX36423.1|90891_91575_-	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.0	1.1e-29
