The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP033396	Klebsiella pneumoniae strain WCHKP015625 chromosome, complete genome	5445546	451532	520910	5445546	head,capsid,portal,tail,integrase,terminase,tRNA,protease	uncultured_Caudovirales_phage(61.11%)	74	469140:469157	485135:485152
AYQ61890.1|451532_452480_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	37.2	2.2e-07
AYQ61891.1|452494_453004_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	40.3	2.6e-18
AYQ61892.1|453132_454257_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
AYQ61893.1|454228_454702_+	DUF494 domain-containing protein	NA	NA	NA	NA	NA
AYQ61894.1|454727_455270_+	hypothetical protein	NA	NA	NA	NA	NA
AYQ61895.1|455274_455847_+	L-threonylcarbamoyladenylate synthase type 1 TsaC	NA	NA	NA	NA	NA
AYQ61896.1|455850_456669_+	shikimate dehydrogenase	NA	NA	NA	NA	NA
AYQ61897.1|456665_456923_+	DUF1488 domain-containing protein	NA	NA	NA	NA	NA
AYQ66474.1|456898_457453_-	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
AYQ61898.1|463248_463470_-	hypothetical protein	NA	NA	NA	NA	NA
AYQ61899.1|463763_466874_-	multidrug efflux RND transporter permease subunit	NA	NA	NA	NA	NA
AYQ61900.1|466886_468026_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AYQ61901.1|468404_469055_+	acrEF/envCD operon transcriptional regulator	NA	NA	NA	NA	NA
469140:469157	attL	GTATCAGTTCATGCCGTA	NA	NA	NA	NA
AYQ61902.1|469330_470557_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	62.2	1.8e-150
AYQ61903.1|470649_471591_+	hypothetical protein	NA	NA	NA	NA	NA
AYQ61904.1|471772_472057_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
AYQ61905.1|472067_472847_+	hypothetical protein	NA	Q8HA02	Enterobacteria_phage	51.5	6.2e-40
AYQ61906.1|472970_473165_-	toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
AYQ66475.1|473298_473568_+	host cell division inhibitor Icd-like protein	NA	A0A2H4JGW3	uncultured_Caudovirales_phage	94.4	2.4e-44
AYQ61907.1|473560_473749_+	hypothetical protein	NA	NA	NA	NA	NA
AYQ61908.1|473741_474056_+	hypothetical protein	NA	NA	NA	NA	NA
AYQ61909.1|474052_474421_+	hypothetical protein	NA	A0A2H4JCX7	uncultured_Caudovirales_phage	81.1	3.7e-51
AYQ61910.1|474417_474783_+	hypothetical protein	NA	NA	NA	NA	NA
AYQ61911.1|474782_476918_+	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	62.4	3.4e-205
AYQ61912.1|477260_477596_+	hypothetical protein	NA	NA	NA	NA	NA
AYQ61913.1|477644_478157_-	hypothetical protein	NA	NA	NA	NA	NA
AYQ61914.1|478420_479587_+|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	95.9	9.8e-207
AYQ61915.1|479638_480199_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	95.7	1.2e-98
AYQ61916.1|480200_481442_+|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	96.5	1.0e-230
AYQ61917.1|481438_481774_+|head,tail	head-tail adaptor	head,tail	A0A2H4JHK5	uncultured_Caudovirales_phage	57.8	3.7e-26
AYQ61918.1|481770_482070_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	80.8	3.4e-39
AYQ61919.1|482069_482513_+	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	91.8	2.8e-77
AYQ61920.1|482639_482831_+|terminase	terminase	terminase	NA	NA	NA	NA
AYQ61921.1|482788_483145_+|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	99.2	5.5e-60
AYQ61922.1|483128_484790_+|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	98.0	0.0e+00
AYQ61923.1|484792_484984_+	hypothetical protein	NA	NA	NA	NA	NA
AYQ61924.1|485137_485434_-	Fis family transcriptional regulator	NA	NA	NA	NA	NA
485135:485152	attR	GTATCAGTTCATGCCGTA	NA	NA	NA	NA
AYQ61925.1|485458_486424_-|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
AYQ61926.1|486581_486776_-	hypothetical protein	NA	NA	NA	NA	NA
AYQ61927.1|486781_487663_-	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
AYQ61928.1|487674_489126_-	sodium/pantothenate symporter	NA	NA	NA	NA	NA
AYQ61929.1|489115_489358_-	DUF997 family protein	NA	NA	NA	NA	NA
AYQ61930.1|489468_490818_-	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
AYQ61931.1|490828_491296_-	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
AYQ61932.1|491318_491771_-	type II 3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
AYQ61933.1|491994_492603_-	protein-methionine-sulfoxide reductase heme-binding subunit MsrQ	NA	NA	NA	NA	NA
AYQ61934.1|492602_493604_-	protein-methionine-sulfoxide reductase catalytic subunit MsrP	NA	NA	NA	NA	NA
AYQ61935.1|493832_494024_+	hypothetical protein	NA	NA	NA	NA	NA
AYQ61936.1|494103_496044_+	RNase E specificity factor CsrD	NA	NA	NA	NA	NA
AYQ61937.1|496349_497393_+	rod shape-determining protein	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
AYQ61938.1|497463_498456_+	rod shape-determining protein MreC	NA	NA	NA	NA	NA
AYQ61939.1|498455_498944_+	rod shape-determining protein MreD	NA	NA	NA	NA	NA
AYQ61940.1|498951_499533_+	septum formation inhibitor Maf	NA	NA	NA	NA	NA
AYQ61941.1|499535_501005_+	ribonuclease G	NA	NA	NA	NA	NA
AYQ61942.1|501042_504840_+	AsmA2 domain-containing protein	NA	NA	NA	NA	NA
AYQ61943.1|504928_506374_+|protease	metalloprotease TldD	protease	NA	NA	NA	NA
AYQ61944.1|506409_507339_-	HTH-type transcriptional activator AaeR	NA	NA	NA	NA	NA
AYQ61945.1|507470_507674_+	protein AaeX	NA	NA	NA	NA	NA
AYQ61946.1|507681_508614_+	p-hydroxybenzoic acid efflux pump subunit AaeA	NA	NA	NA	NA	NA
AYQ61947.1|508619_510587_+	p-hydroxybenzoic acid efflux pump subunit AaeB	NA	NA	NA	NA	NA
AYQ61948.1|510666_510942_+	hypothetical protein	NA	NA	NA	NA	NA
AYQ61949.1|510992_511259_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
AYQ61950.1|511357_511621_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
AYQ61951.1|511996_512467_-	transcriptional regulator ArgR	NA	NA	NA	NA	NA
AYQ61952.1|512881_513820_+	malate dehydrogenase	NA	NA	NA	NA	NA
AYQ61953.1|513956_515015_-|protease	serine endoprotease DegS	protease	NA	NA	NA	NA
AYQ61954.1|515102_516470_-|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	25.3	6.0e-22
AYQ61955.1|516643_517042_-	DUF1043 family protein	NA	NA	NA	NA	NA
AYQ61956.1|517232_518360_+	cell division protein ZapE	NA	NA	NA	NA	NA
AYQ61957.1|518625_519054_+	50S ribosomal protein L13	NA	NA	NA	NA	NA
AYQ61958.1|519069_519462_+	30S ribosomal protein S9	NA	NA	NA	NA	NA
AYQ61959.1|519571_519775_-	hypothetical protein	NA	NA	NA	NA	NA
AYQ61960.1|519773_520412_+	stringent starvation protein A	NA	NA	NA	NA	NA
AYQ61961.1|520415_520910_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	54.8	1.5e-26
>prophage 2
CP033396	Klebsiella pneumoniae strain WCHKP015625 chromosome, complete genome	5445546	1238362	1264417	5445546	integrase,transposase	Salmonella_phage(44.12%)	39	1229458:1229472	1266952:1266966
1229458:1229472	attL	GCCAGCACCCGCGCG	NA	NA	NA	NA
AYQ62652.1|1238362_1239343_-|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
AYQ62653.1|1239388_1240387_-|integrase	site-specific integrase	integrase	A0A1S6L016	Salmonella_phage	94.5	2.2e-183
AYQ62654.1|1240389_1241019_-	phage repressor protein	NA	A0A1S6KZZ7	Salmonella_phage	54.5	1.4e-61
AYQ62655.1|1241141_1241384_+	Rha family transcriptional regulator	NA	A0A1S6KZZ6	Salmonella_phage	98.8	4.0e-38
AYQ62656.1|1241416_1241926_+	phage regulatory CII family protein	NA	A0A1S6L008	Salmonella_phage	85.8	1.1e-77
AYQ62657.1|1241933_1242134_+	DUF2724 domain-containing protein	NA	A0A1S6L005	Salmonella_phage	68.8	4.5e-19
AYQ62658.1|1242097_1242436_+	hypothetical protein	NA	A0A218M4I7	Erwinia_phage	58.0	6.2e-29
AYQ62659.1|1242503_1242737_+	DUF2732 family protein	NA	A0A1S6L021	Salmonella_phage	90.9	6.0e-31
AYQ62660.1|1242736_1242964_+	TraR/DksA family transcriptional regulator	NA	A0A1S6L007	Salmonella_phage	92.0	5.1e-35
AYQ62661.1|1242960_1243812_+	DNA adenine methylase	NA	A0A1S6L011	Salmonella_phage	75.4	2.2e-115
AYQ62662.1|1243808_1246193_+	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	87.9	0.0e+00
AYQ62663.1|1246422_1246674_+	hypothetical protein	NA	NA	NA	NA	NA
AYQ62664.1|1246673_1248158_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
AYQ62665.1|1248254_1248593_-	hypothetical protein	NA	A0A193GYX4	Enterobacter_phage	80.0	1.8e-44
AYQ66499.1|1248585_1248789_-	hypothetical protein	NA	NA	NA	NA	NA
AYQ62666.1|1248788_1249409_-	hypothetical protein	NA	Q1MVF7	Enterobacteria_phage	40.7	1.0e-29
AYQ62667.1|1249405_1249699_-	hypothetical protein	NA	Q6UAT9	Klebsiella_phage	86.6	2.7e-44
AYQ66500.1|1249698_1250166_-	hypothetical protein	NA	A0A2R2Z312	Escherichia_phage	51.7	1.3e-37
AYQ62668.1|1250459_1251104_-	hypothetical protein	NA	Q1MVG0	Enterobacteria_phage	79.3	8.0e-110
AYQ62669.1|1251100_1251292_-	hypothetical protein	NA	NA	NA	NA	NA
AYQ62670.1|1251275_1251686_-	hypothetical protein	NA	A0A2P1MXC5	Escherichia_phage	45.1	4.3e-16
AYQ62671.1|1251878_1252226_-	DUF1064 domain-containing protein	NA	A0A0F6R8N5	Escherichia_coli_O157_typing_phage	82.6	6.5e-50
AYQ62672.1|1252345_1253131_-	replication protein	NA	A0A193GYX1	Enterobacter_phage	87.7	3.7e-133
AYQ62673.1|1253127_1253895_-	primosomal protein	NA	A0A193GZ86	Enterobacter_phage	91.4	8.9e-140
AYQ62674.1|1253894_1254104_-	hypothetical protein	NA	A0A193GYW4	Enterobacter_phage	78.3	1.8e-26
AYQ62675.1|1254250_1254484_-	hypothetical protein	NA	T1SAR5	Salmonella_phage	66.2	9.2e-24
AYQ62676.1|1254638_1255220_+	XRE family transcriptional regulator	NA	Q858D7	Salmonella_phage	64.3	7.1e-65
AYQ62677.1|1255586_1255886_+	hypothetical protein	NA	A0A0F6R7M4	Escherichia_coli_O157_typing_phage	54.5	2.1e-20
AYQ62678.1|1255882_1256704_+	exodeoxyribonuclease VIII	NA	A0A193GYK2	Enterobacter_phage	80.2	1.8e-130
AYQ62679.1|1256700_1257582_+	recombinase RecT	NA	T1SBJ5	Salmonella_phage	84.3	8.9e-136
AYQ62680.1|1257630_1257879_+	AlpA family phage regulatory protein	NA	A0A0F6TJ45	Escherichia_coli_O157_typing_phage	76.8	4.9e-31
AYQ62681.1|1257988_1258282_+	PerC family transcriptional regulator	NA	T1S9J5	Salmonella_phage	71.1	4.0e-32
AYQ62682.1|1258274_1258433_+	DUF1317 family protein	NA	T1SAR0	Salmonella_phage	78.8	1.1e-17
AYQ62683.1|1258429_1259092_+	hypothetical protein	NA	A0A059VF56	Pseudomonas_phage	46.6	1.2e-47
AYQ62684.1|1259088_1259682_+	adenine methylase	NA	T1SA14	Salmonella_phage	91.9	6.3e-109
AYQ62685.1|1259678_1259921_+	hypothetical protein	NA	NA	NA	NA	NA
AYQ62686.1|1259863_1261114_-	DUF4102 domain-containing protein	NA	A0A1X9TCT6	Enterobacter_phage	84.4	5.8e-205
AYQ62687.1|1261305_1262883_-	GMP synthase (glutamine-hydrolyzing)	NA	NA	NA	NA	NA
AYQ62688.1|1262950_1264417_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.7	1.2e-87
1266952:1266966	attR	GCCAGCACCCGCGCG	NA	NA	NA	NA
>prophage 3
CP033396	Klebsiella pneumoniae strain WCHKP015625 chromosome, complete genome	5445546	1335767	1444965	5445546	head,holin,transposase,capsid,portal,tail,coat,lysis,plate,terminase,tRNA	Salmonella_phage(60.0%)	112	NA	NA
AYQ62751.1|1335767_1336505_-|tRNA	tRNA (adenosine(37)-N6)-methyltransferase TrmM	tRNA	NA	NA	NA	NA
AYQ62752.1|1336636_1337968_+	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	31.9	6.2e-48
AYQ62753.1|1338013_1338397_-	autonomous glycyl radical cofactor GrcA	NA	A0A193GZ98	Escherichia_phage	79.3	4.0e-32
AYQ62754.1|1338710_1339400_+	uracil-DNA glycosylase	NA	A0A077BCN4	Equid_alphaherpesvirus	53.0	1.3e-57
AYQ62755.1|1339457_1340543_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
AYQ62756.1|1340746_1341172_+	thioredoxin TrxC	NA	A0A1J0GW78	Streptomyces_phage	40.2	6.0e-13
AYQ62757.1|1341241_1341940_+	DTW domain-containing protein	NA	NA	NA	NA	NA
AYQ62758.1|1341974_1344626_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
AYQ62759.1|1344746_1346102_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
AYQ62760.1|1346143_1346467_+	YfiM family lipoprotein	NA	NA	NA	NA	NA
AYQ62761.1|1346470_1347769_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	31.5	3.1e-44
AYQ62762.1|1353734_1356308_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.4	6.9e-128
AYQ62763.1|1356437_1357169_-	peptidoglycan editing factor PgeF	NA	NA	NA	NA	NA
AYQ62764.1|1357165_1358146_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
AYQ62765.1|1358277_1359015_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
AYQ62766.1|1359285_1359621_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
AYQ66502.1|1359727_1359775_+	hypothetical protein	NA	NA	NA	NA	NA
AYQ62767.1|1359875_1361036_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
AYQ62768.1|1361032_1361905_-	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
AYQ62769.1|1361967_1363089_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
AYQ62770.1|1363098_1364169_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.5	1.8e-90
AYQ62771.1|1364511_1365021_+	YfiR family protein	NA	NA	NA	NA	NA
AYQ62772.1|1365013_1366237_+	diguanylate cyclase	NA	NA	NA	NA	NA
AYQ62773.1|1366250_1366733_+	OmpA family protein	NA	NA	NA	NA	NA
AYQ62774.1|1366741_1368112_-	PepSY domain-containing protein	NA	NA	NA	NA	NA
AYQ62775.1|1368168_1368627_-	DUF2946 domain-containing protein	NA	NA	NA	NA	NA
AYQ62776.1|1368746_1369094_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
AYQ62777.1|1369133_1369901_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
AYQ62778.1|1369932_1370481_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
AYQ62779.1|1370499_1370748_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
AYQ62780.1|1371007_1372372_-	signal recognition particle protein	NA	NA	NA	NA	NA
AYQ62781.1|1372535_1373327_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
AYQ62782.1|1373346_1374633_+	DUF21 domain-containing protein	NA	NA	NA	NA	NA
AYQ62783.1|1374752_1375343_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
AYQ62784.1|1375467_1376346_+	NAD(+) kinase	NA	NA	NA	NA	NA
AYQ62785.1|1376432_1378094_+	DNA repair protein RecN	NA	NA	NA	NA	NA
AYQ62786.1|1378241_1378583_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
AYQ62787.1|1378649_1378940_-	RnfH family protein	NA	NA	NA	NA	NA
AYQ62788.1|1378929_1379406_-	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
AYQ62789.1|1379516_1379999_+	SsrA-binding protein	NA	W5RAM5	Staphylococcus_phage	47.4	2.3e-29
AYQ62790.1|1380602_1380980_+	hypothetical protein	NA	NA	NA	NA	NA
AYQ62791.1|1381007_1381226_-	levansucrase regulator	NA	Q53ZE7	Salmonella_virus	72.2	1.9e-26
AYQ62792.1|1381292_1382387_-	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	83.6	2.4e-170
AYQ62793.1|1382383_1382869_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.1	5.2e-61
AYQ62794.1|1382865_1385496_-|tail	phage tail tape measure protein	tail	E5FFG5	Burkholderia_phage	41.9	8.9e-115
AYQ62795.1|1385488_1385608_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.2e-13
AYQ62796.1|1385622_1385922_-|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	78.0	8.2e-33
AYQ62797.1|1385974_1386490_-|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	84.2	1.4e-80
AYQ62798.1|1386499_1387672_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	91.5	3.4e-207
AYQ62799.1|1387820_1388894_-|tail	phage tail protein	tail	A0A1S6KZZ8	Salmonella_phage	53.6	6.6e-40
AYQ62800.1|1388945_1390064_-	hypothetical protein	NA	A0A248XD67	Klebsiella_phage	38.0	4.4e-55
AYQ62801.1|1390073_1392023_-|coat	spore coat protein CotH	coat	Q6QI97	Burkholderia_phage	38.9	1.0e-06
AYQ62802.1|1392024_1392696_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	58.9	3.2e-61
AYQ62803.1|1392688_1393597_-|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	68.9	1.9e-109
AYQ62804.1|1393583_1393946_-|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	85.6	8.4e-48
AYQ62805.1|1393942_1394515_-|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	70.8	1.4e-76
AYQ62806.1|1394609_1395476_+	hypothetical protein	NA	NA	NA	NA	NA
AYQ62807.1|1395498_1395945_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	72.3	2.5e-54
AYQ62808.1|1395937_1396360_-|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	83.2	8.2e-63
AYQ62809.1|1396322_1396526_-	hypothetical protein	NA	A0A1S6KZX6	Salmonella_phage	77.6	3.0e-23
AYQ62810.1|1396455_1396884_-|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	82.5	7.1e-54
AYQ62811.1|1396880_1397264_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	45.4	1.9e-18
AYQ62812.1|1397268_1397778_-	lysozyme	NA	E5G6N1	Salmonella_phage	85.2	1.6e-81
AYQ66503.1|1397758_1397974_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	88.7	6.1e-30
AYQ62813.1|1397977_1398181_-|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	89.6	9.8e-30
AYQ62814.1|1398180_1398645_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	85.7	1.5e-73
AYQ62815.1|1398740_1399394_-	hypothetical protein	NA	A0A1S6KZX1	Salmonella_phage	80.0	1.9e-90
AYQ62816.1|1399397_1400450_-|capsid	phage major capsid protein, P2 family	capsid	A0A1S6KZZ3	Salmonella_phage	91.0	6.8e-175
AYQ62817.1|1400466_1401300_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	77.6	4.4e-100
AYQ62818.1|1401440_1403204_+	oxidoreductase	NA	A0A1S6KZW3	Salmonella_phage	91.8	0.0e+00
AYQ62819.1|1403203_1404247_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	85.6	3.1e-172
AYQ66504.1|1404303_1404573_-	hypothetical protein	NA	D2IZW1	Enterococcus_phage	41.3	1.4e-15
AYQ62820.1|1405094_1406096_+	hypothetical protein	NA	NA	NA	NA	NA
AYQ62821.1|1406095_1407175_+	hypothetical protein	NA	NA	NA	NA	NA
AYQ62822.1|1407161_1407845_+	hypothetical protein	NA	NA	NA	NA	NA
AYQ62823.1|1407940_1408174_-	DinI family protein	NA	A0A0M4S6H1	Salmonella_phage	96.1	2.0e-34
AYQ62824.1|1408185_1408374_-	hypothetical protein	NA	A0A1S6L006	Salmonella_phage	90.3	2.2e-23
AYQ62825.1|1408481_1409966_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
AYQ62826.1|1409965_1410217_-	hypothetical protein	NA	NA	NA	NA	NA
AYQ66505.1|1410369_1410627_+	lF-82	NA	NA	NA	NA	NA
AYQ66506.1|1410704_1411289_+|terminase	terminase small subunit	terminase	T1SBI8	Salmonella_phage	88.6	2.2e-90
AYQ62827.1|1411285_1412761_+|terminase	terminase	terminase	Q858H3	Salmonella_phage	93.1	6.4e-280
AYQ62828.1|1412804_1413176_-	hypothetical protein	NA	A0A0F6TJP2	Escherichia_coli_O157_typing_phage	91.9	3.7e-59
AYQ62829.1|1413225_1413468_+	hypothetical protein	NA	NA	NA	NA	NA
AYQ62830.1|1413929_1414136_+	hypothetical protein	NA	T1SA67	Salmonella_phage	88.2	4.8e-08
AYQ62831.1|1414150_1415833_+|tail	phage tail protein	tail	A0A0F6TJD8	Escherichia_coli_O157_typing_phage	84.4	1.5e-264
AYQ62832.1|1415829_1416126_+	hypothetical protein	NA	T1SBI9	Salmonella_phage	70.4	1.2e-33
AYQ62833.1|1416128_1416809_+	peptidase	NA	G9L6C4	Escherichia_phage	84.0	6.1e-76
AYQ62834.1|1416823_1417810_+	hypothetical protein	NA	A0A193GZ49	Enterobacter_phage	94.2	2.5e-179
AYQ62835.1|1417863_1418301_+	hypothetical protein	NA	A0A193GYT9	Enterobacter_phage	91.7	1.3e-66
AYQ62836.1|1418311_1418653_+	hypothetical protein	NA	G9L6C7	Escherichia_phage	70.8	2.4e-36
AYQ62837.1|1418703_1419027_+	hypothetical protein	NA	G9L6C8	Escherichia_phage	85.0	5.3e-46
AYQ62838.1|1419026_1419632_+	hypothetical protein	NA	A0A0F6TJN5	Escherichia_coli_O157_typing_phage	77.0	4.0e-87
AYQ62839.1|1419631_1422109_+	hypothetical protein	NA	Q858G3	Salmonella_phage	84.4	0.0e+00
AYQ62840.1|1422108_1422573_+	hypothetical protein	NA	Q858G2	Salmonella_phage	81.2	1.5e-70
AYQ62841.1|1422572_1423112_+	hypothetical protein	NA	A0A0F6TJ56	Escherichia_coli_O157_typing_phage	80.0	8.0e-71
AYQ62842.1|1423122_1425657_+	hypothetical protein	NA	Q858G0	Salmonella_phage	84.1	0.0e+00
AYQ62843.1|1425656_1427567_+	hypothetical protein	NA	Q858F9	Salmonella_phage	82.7	5.4e-287
AYQ62844.1|1427566_1430323_+	hypothetical protein	NA	Q858F8	Salmonella_phage	95.4	0.0e+00
AYQ62845.1|1430319_1430514_+	hypothetical protein	NA	Q858F7	Salmonella_phage	67.2	6.5e-15
AYQ62846.1|1430548_1430701_-	transmembrane anchored protein	NA	G9L6D9	Escherichia_phage	83.7	2.5e-14
AYQ62847.1|1430799_1431096_-	hypothetical protein	NA	T1SA06	Salmonella_phage	63.9	6.9e-24
AYQ62848.1|1433923_1434187_+	hypothetical protein	NA	NA	NA	NA	NA
AYQ62849.1|1434227_1435148_-	hypothetical protein	NA	NA	NA	NA	NA
AYQ62850.1|1435474_1436455_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.4	1.0e-185
AYQ62851.1|1437323_1438586_-|transposase	IS1380 family transposase ISEc9	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
AYQ62852.1|1439694_1441011_+	right-handed parallel beta-helix repeat-containing protein	NA	A0A0K2FI18	Enterobacter_phage	32.3	2.3e-34
AYQ62853.1|1441097_1441502_+	hypothetical protein	NA	T1SA79	Salmonella_phage	81.1	8.7e-54
AYQ62854.1|1441488_1441794_+|holin	phage holin family protein	holin	A0A193GYK3	Enterobacter_phage	81.4	2.7e-39
AYQ62855.1|1441783_1442413_+	glycoside hydrolase family 19 protein	NA	Q858F0	Salmonella_phage	76.9	1.8e-90
AYQ62856.1|1442409_1442910_+	DUF2514 domain-containing protein	NA	Q858E9	Salmonella_phage	76.9	1.3e-59
AYQ62857.1|1443096_1444965_-	phosphatase	NA	A0A2P0VMN7	Tetraselmis_virus	22.6	2.6e-07
>prophage 4
CP033396	Klebsiella pneumoniae strain WCHKP015625 chromosome, complete genome	5445546	1777316	1784221	5445546		Planktothrix_phage(33.33%)	6	NA	NA
AYQ66519.1|1777316_1778180_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.5	7.4e-10
AYQ63145.1|1778190_1778964_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.7	3.9e-26
AYQ66520.1|1779204_1780098_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.8	6.1e-15
AYQ63146.1|1780343_1781705_-	U32 family peptidase	NA	Q6DW11	Phage_TP	94.8	1.8e-207
AYQ63147.1|1782023_1782746_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	8.3e-31
AYQ63148.1|1782742_1784221_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	28.3	1.9e-29
>prophage 5
CP033396	Klebsiella pneumoniae strain WCHKP015625 chromosome, complete genome	5445546	1827566	1839241	5445546	transposase	Escherichia_phage(33.33%)	10	NA	NA
AYQ63176.1|1827566_1828973_+	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.7	4.7e-38
AYQ63177.1|1829199_1830615_+	mannose-1-phosphate guanylyltransferase	NA	A0A1V0SH58	Hokovirus	31.0	1.4e-53
AYQ63178.1|1830636_1832007_+	phosphomannomutase	NA	A0A127AWJ1	Bacillus_phage	25.9	6.4e-32
AYQ66523.1|1832161_1833226_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.7	9.8e-105
AYQ63179.1|1833239_1834109_+	glucose-1-phosphate thymidylyltransferase	NA	I7I009	Enterobacteria_phage	66.7	1.7e-110
AYQ63180.1|1834140_1835031_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.2	2.8e-28
AYQ63181.1|1835045_1835600_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	58.2	2.9e-52
AYQ63182.1|1835779_1836946_+	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	54.7	9.1e-112
AYQ63183.1|1837308_1838220_+	acyltransferase	NA	NA	NA	NA	NA
AYQ63184.1|1838260_1839241_+|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
>prophage 6
CP033396	Klebsiella pneumoniae strain WCHKP015625 chromosome, complete genome	5445546	2832323	2843210	5445546		Escherichia_phage(87.5%)	9	NA	NA
AYQ64104.1|2832323_2835431_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.6	0.0e+00
AYQ64105.1|2835485_2836751_+	MFS transporter	NA	NA	NA	NA	NA
AYQ64106.1|2836781_2837870_-	chromosome segregation protein SMC	NA	A0A077SLJ9	Escherichia_phage	100.0	8.0e-211
AYQ64107.1|2837956_2838217_-	hypothetical protein	NA	A0A077SK33	Escherichia_phage	97.7	3.5e-40
AYQ64108.1|2838514_2839375_+	class A broad-spectrum beta-lactamase SHV-11	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
AYQ64109.1|2839395_2840157_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
AYQ64110.1|2840417_2841320_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.3	7.7e-159
AYQ64111.1|2841331_2842597_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.5	6.6e-233
AYQ64112.1|2842589_2843210_+	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
>prophage 7
CP033396	Klebsiella pneumoniae strain WCHKP015625 chromosome, complete genome	5445546	3026174	3098871	5445546	head,transposase,tail,lysis,plate,terminase	uncultured_Caudovirales_phage(32.69%)	85	NA	NA
AYQ64280.1|3026174_3027260_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
AYQ64281.1|3027223_3028978_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
AYQ64282.1|3030649_3034075_-	type VI secretion protein VasK	NA	NA	NA	NA	NA
AYQ64283.1|3034058_3035198_-	hypothetical protein	NA	NA	NA	NA	NA
AYQ64284.1|3035194_3035452_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
AYQ64285.1|3035496_3037914_-	DUF2235 domain-containing protein	NA	NA	NA	NA	NA
AYQ64286.1|3037901_3038432_-	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
AYQ64287.1|3038499_3039030_-	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
AYQ64288.1|3039098_3039629_-	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
AYQ64289.1|3039696_3040227_-	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
AYQ64290.1|3040295_3040826_-	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
AYQ64291.1|3040889_3041669_-	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
AYQ64292.1|3041669_3044048_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	33.8	9.2e-18
AYQ64293.1|3044040_3046695_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	33.4	2.5e-96
AYQ64294.1|3046959_3047451_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
AYQ64295.1|3047455_3049162_-	OmpA family protein	NA	NA	NA	NA	NA
AYQ64296.1|3049158_3049848_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
AYQ66576.1|3049844_3051185_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
AYQ64297.1|3051197_3052742_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
AYQ64298.1|3052784_3053276_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
AYQ64299.1|3053745_3054726_+|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
AYQ64300.1|3054783_3054993_+	hypothetical protein	NA	NA	NA	NA	NA
AYQ64301.1|3055321_3055570_+	DinI family protein	NA	S5MQI1	Escherichia_phage	70.4	1.4e-25
AYQ64302.1|3055792_3056077_-	hypothetical protein	NA	NA	NA	NA	NA
AYQ64303.1|3056181_3056391_-	hypothetical protein	NA	NA	NA	NA	NA
AYQ64304.1|3056387_3057119_-	hypothetical protein	NA	NA	NA	NA	NA
AYQ66577.1|3057129_3057858_-	hypothetical protein	NA	NA	NA	NA	NA
AYQ64305.1|3060208_3060406_-	hypothetical protein	NA	NA	NA	NA	NA
AYQ64306.1|3060405_3061272_-	hypothetical protein	NA	A0A2H4IYR0	uncultured_Caudovirales_phage	64.5	1.9e-34
AYQ64307.1|3061271_3062045_-	DUF2612 domain-containing protein	NA	A0A2H4J1A9	uncultured_Caudovirales_phage	54.4	2.8e-77
AYQ64308.1|3062041_3063238_-	hypothetical protein	NA	A0A0M4RD32	Salmonella_phage	72.9	3.9e-158
AYQ64309.1|3063237_3063591_-	hypothetical protein	NA	A0A2H4J629	uncultured_Caudovirales_phage	80.3	2.3e-50
AYQ64310.1|3063592_3064246_-	hypothetical protein	NA	A0A2H4J8H6	uncultured_Caudovirales_phage	63.5	1.0e-59
AYQ64311.1|3064299_3064866_-	hypothetical protein	NA	NA	NA	NA	NA
AYQ64312.1|3064902_3065088_+	hypothetical protein	NA	NA	NA	NA	NA
AYQ64313.1|3065140_3065482_-	hypothetical protein	NA	A0A2H4J1A5	uncultured_Caudovirales_phage	46.6	1.8e-23
AYQ64314.1|3065481_3066504_-	hypothetical protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	54.2	9.2e-100
AYQ64315.1|3066506_3066809_-	hypothetical protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	55.2	2.0e-26
AYQ64316.1|3066809_3067409_-	hypothetical protein	NA	A0A2H4J1B3	uncultured_Caudovirales_phage	57.6	9.9e-54
AYQ64317.1|3067408_3069412_-	lytic transglycosylase domain-containing protein	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	63.6	1.2e-247
AYQ64318.1|3069401_3069554_-	NTP pyrophosphohydrolase	NA	A0A2H4J1A2	uncultured_Caudovirales_phage	88.0	7.6e-19
AYQ64319.1|3069589_3070015_-	hypothetical protein	NA	A0A2H4J2V6	uncultured_Caudovirales_phage	63.4	2.6e-40
AYQ64320.1|3070018_3070459_-	DUF3277 family protein	NA	A0A0M5M1K6	Salmonella_phage	80.1	3.3e-62
AYQ64321.1|3070469_3071615_-	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	76.9	6.3e-166
AYQ64322.1|3071618_3072059_-	hypothetical protein	NA	A0A2H4J1A0	uncultured_Caudovirales_phage	51.7	1.6e-40
AYQ64323.1|3072153_3072540_-|head,tail	head-tail adaptor	head,tail	A0A2H4J1A4	uncultured_Caudovirales_phage	78.2	1.1e-48
AYQ64324.1|3072539_3073046_-	hypothetical protein	NA	NA	NA	NA	NA
AYQ64325.1|3073042_3073462_-	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	60.7	3.3e-40
AYQ64326.1|3073430_3073712_-	hypothetical protein	NA	NA	NA	NA	NA
AYQ64327.1|3073751_3074693_-	DUF2184 domain-containing protein	NA	A0A2H4J191	uncultured_Caudovirales_phage	77.1	1.7e-137
AYQ64328.1|3074704_3075199_-	hypothetical protein	NA	A0A2H4JHM9	uncultured_Caudovirales_phage	62.7	4.2e-50
AYQ64329.1|3075202_3076405_-	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	54.1	2.6e-106
AYQ64330.1|3076456_3077005_-	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	56.3	3.0e-49
AYQ64331.1|3077060_3078512_-	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	68.8	3.8e-192
AYQ64332.1|3078749_3080150_-|terminase	PBSX family phage terminase large subunit	terminase	A0A077KAW0	Edwardsiella_phage	69.0	9.4e-188
AYQ64333.1|3080100_3080853_-	hypothetical protein	NA	A0A077KBY7	Edwardsiella_phage	66.0	4.0e-12
AYQ64334.1|3080954_3081275_-	negative regulator GrlR	NA	NA	NA	NA	NA
AYQ64335.1|3081367_3081625_-	Rz1 lytic protein	NA	S5FXQ4	Shigella_phage	70.9	2.3e-23
AYQ64336.1|3081509_3081899_-	lipase chaperone	NA	A0A192Y6H8	Salmonella_phage	49.2	9.4e-21
AYQ64337.1|3081895_3082426_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	77.1	2.7e-79
AYQ64338.1|3082428_3082677_-|lysis	lysis protein	lysis	NA	NA	NA	NA
AYQ64339.1|3083082_3083865_-	antitermination protein	NA	F1C595	Cronobacter_phage	76.8	7.2e-113
AYQ64340.1|3083861_3084338_-	hypothetical protein	NA	A0A286N2Q1	Klebsiella_phage	100.0	1.8e-90
AYQ64341.1|3084334_3085297_-	DNA primase	NA	A0A286N2Q0	Klebsiella_phage	99.4	4.8e-183
AYQ64342.1|3085298_3086957_-	DEAD/DEAH box helicase	NA	A0A286N2P9	Klebsiella_phage	96.0	0.0e+00
AYQ64343.1|3087265_3087559_-	hypothetical protein	NA	A0A286S2B5	Klebsiella_phage	97.6	2.8e-38
AYQ64344.1|3087533_3087755_-	XRE family transcriptional regulator	NA	A0A286S2C1	Klebsiella_phage	100.0	3.0e-32
AYQ64345.1|3087852_3088521_+	LexA family transcriptional regulator	NA	A0A286S2B2	Klebsiella_phage	99.5	2.4e-125
AYQ64346.1|3088691_3089006_+	hypothetical protein	NA	A0A286S1T9	Klebsiella_phage	100.0	1.0e-49
AYQ64347.1|3088998_3089187_+	hypothetical protein	NA	A0A286S1P8	Klebsiella_phage	100.0	4.6e-26
AYQ64348.1|3089356_3089722_+	hypothetical protein	NA	A0A286S1Q6	Klebsiella_phage	99.2	6.9e-58
AYQ64349.1|3089714_3089969_+	hypothetical protein	NA	A0A286SGR4	Klebsiella_phage	97.6	3.1e-41
AYQ64350.1|3090155_3090581_+	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	77.9	3.5e-53
AYQ64351.1|3090577_3090772_+	hypothetical protein	NA	NA	NA	NA	NA
AYQ64352.1|3090768_3091596_+	SPFH/Band 7/PHB domain protein	NA	Q8W654	Enterobacteria_phage	84.0	5.5e-111
AYQ64353.1|3091700_3092219_+	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	98.8	1.7e-94
AYQ64354.1|3092224_3092935_+	DNA-binding protein	NA	A0A286S260	Klebsiella_phage	88.3	2.1e-111
AYQ64355.1|3092924_3093149_+	hypothetical protein	NA	A0A286S2B3	Klebsiella_phage	89.2	3.1e-29
AYQ64356.1|3093145_3093358_+	hypothetical protein	NA	A0A286S2B6	Klebsiella_phage	98.6	3.4e-33
AYQ64357.1|3093354_3093834_+	hypothetical protein	NA	NA	NA	NA	NA
AYQ64358.1|3094012_3094255_+	AlpA family transcriptional regulator	NA	A0A0M4RTZ2	Salmonella_phage	73.8	2.2e-20
AYQ64359.1|3094235_3095417_-	DUF4102 domain-containing protein	NA	A0A0M4QX09	Salmonella_phage	84.2	5.6e-202
AYQ64360.1|3095613_3096162_+	DJ-1/PfpI family protein	NA	NA	NA	NA	NA
AYQ64361.1|3096360_3097893_-	HD domain-containing protein	NA	A0A1B1ISR1	uncultured_Mediterranean_phage	30.0	1.1e-21
AYQ64362.1|3098109_3098871_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.5	2.4e-20
>prophage 8
CP033396	Klebsiella pneumoniae strain WCHKP015625 chromosome, complete genome	5445546	3131804	3185897	5445546	integrase,protease,holin,transposase	Enterobacteria_phage(33.33%)	64	3131586:3131601	3161255:3161270
3131586:3131601	attL	TATGCCCTACGATAGC	NA	NA	NA	NA
AYQ64393.1|3131804_3132476_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	59.6	4.5e-79
AYQ66580.1|3132662_3133490_+	FRG domain-containing protein	NA	A0A1S6KZX9	Salmonella_phage	30.2	8.4e-19
AYQ64394.1|3133565_3134831_-	translesion error-prone DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	82.7	9.6e-208
AYQ64395.1|3134832_3135252_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	57.5	1.4e-35
AYQ64396.1|3135331_3136816_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
AYQ64397.1|3136815_3137067_-	hypothetical protein	NA	NA	NA	NA	NA
AYQ64398.1|3137713_3138136_-	hypothetical protein	NA	K7P834	Enterobacteria_phage	45.3	3.6e-26
AYQ64399.1|3138728_3139433_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AYQ64400.1|3140048_3140396_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
AYQ66581.1|3140559_3141351_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
AYQ64401.1|3142332_3143037_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AYQ64402.1|3143073_3143361_-	hypothetical protein	NA	A0A286N2Q7	Klebsiella_phage	95.4	4.4e-36
AYQ64403.1|3143357_3143897_-	hypothetical protein	NA	A0A286N2Q6	Klebsiella_phage	98.9	3.3e-101
AYQ66582.1|3143893_3144193_-|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	100.0	4.5e-47
AYQ64404.1|3144671_3145718_-|transposase	IS481-like element ISKpn28 family transposase	transposase	A0A0M3LR35	Mannheimia_phage	21.9	1.3e-05
AYQ66583.1|3145943_3146633_-	antiterminator	NA	I6PDF8	Cronobacter_phage	53.1	2.1e-55
AYQ64405.1|3146632_3146773_-	YlcG family protein	NA	NA	NA	NA	NA
AYQ64406.1|3146769_3147408_-	hypothetical protein	NA	H6WRY9	Salmonella_phage	69.8	3.2e-74
AYQ64407.1|3147400_3148069_-	serine/threonine protein phosphatase	NA	K7P6H8	Enterobacteria_phage	78.7	1.4e-104
AYQ64408.1|3148065_3148233_-	NinE family protein	NA	K7P7K0	Enterobacteria_phage	62.5	4.6e-09
AYQ64409.1|3148213_3148681_-	recombination protein NinB	NA	Q8VNP6	Enterobacteria_phage	45.8	3.4e-33
AYQ64410.1|3149201_3150230_+	hypothetical protein	NA	NA	NA	NA	NA
AYQ64411.1|3150437_3150683_-	hypothetical protein	NA	NA	NA	NA	NA
AYQ64412.1|3150738_3151041_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AYQ64413.1|3151037_3151886_-	AAA family ATPase	NA	K7PLU3	Enterobacteria_phage	60.1	5.1e-88
AYQ64414.1|3151882_3152743_-	replication protein	NA	K7PGT1	Enterobacteria_phage	53.3	1.0e-59
AYQ64415.1|3152828_3153050_-	transcriptional regulator	NA	G8EYH8	Enterobacteria_phage	41.7	6.9e-05
AYQ64416.1|3153090_3153318_-	transcriptional regulator	NA	Q76H55	Enterobacteria_phage	77.1	1.4e-24
AYQ66584.1|3153429_3154128_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	84.1	3.7e-108
AYQ66585.1|3154150_3154270_+	hypothetical protein	NA	NA	NA	NA	NA
AYQ64417.1|3154415_3155492_+	ParA family protein	NA	H2BD62	Pseudomonas_phage	37.9	9.1e-58
AYQ64418.1|3155573_3155777_-	hypothetical protein	NA	A0A192Y6Q5	Salmonella_phage	71.6	3.9e-18
AYQ64419.1|3156205_3156400_+	hypothetical protein	NA	NA	NA	NA	NA
AYQ64420.1|3156488_3156773_+	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	79.8	1.1e-39
AYQ64421.1|3156788_3157634_+	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	59.2	1.8e-69
AYQ64422.1|3157919_3158600_+	exonuclease	NA	A0A0M3ULE0	Salmonella_phage	91.2	8.2e-121
AYQ64423.1|3158596_3159025_+	regulator	NA	M9NYX4	Enterobacteria_phage	80.3	7.5e-64
AYQ64424.1|3159021_3159684_+	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	84.6	2.7e-105
AYQ64425.1|3159680_3159995_+	hypothetical protein	NA	K7PM28	Enterobacteria_phage	50.8	1.6e-10
AYQ66586.1|3159891_3161079_-|integrase	site-specific integrase	integrase	K7PGY1	Enterobacteria_phage	52.4	1.1e-120
AYQ64426.1|3161255_3162146_+	peptide ABC transporter permease SapC	NA	NA	NA	NA	NA
3161255:3161270	attR	TATGCCCTACGATAGC	NA	NA	NA	NA
AYQ64427.1|3162145_3163138_+	peptide ABC transporter ATP-binding protein SapD	NA	G9BWD6	Planktothrix_phage	27.2	3.0e-07
AYQ64428.1|3163139_3163949_+	peptide ABC transporter ATP-binding protein SapF	NA	A0A2H4PQG7	Staphylococcus_phage	28.9	2.1e-14
AYQ64429.1|3163993_3165424_-	cytosine permease	NA	NA	NA	NA	NA
AYQ66587.1|3165620_3166163_+	HutD family protein	NA	NA	NA	NA	NA
AYQ64430.1|3166361_3167150_+	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
AYQ64431.1|3167340_3168498_+	CMD domain-containing protein	NA	NA	NA	NA	NA
AYQ64432.1|3168579_3170514_+	exoribonuclease 2	NA	A0A2H4UVB7	Bodo_saltans_virus	24.6	7.0e-08
AYQ64433.1|3170672_3170852_+	hypothetical protein	NA	NA	NA	NA	NA
AYQ64434.1|3170923_3171673_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
AYQ64435.1|3171945_3172167_+	osmotically-inducible lipoprotein OsmB	NA	NA	NA	NA	NA
AYQ64436.1|3172298_3172625_-	stress response translation initiation inhibitor YciH	NA	NA	NA	NA	NA
AYQ64437.1|3172624_3173362_-	orotidine-5'-phosphate decarboxylase	NA	NA	NA	NA	NA
AYQ64438.1|3173553_3174723_-	lipopolysaccharide assembly protein LapB	NA	NA	NA	NA	NA
AYQ64439.1|3174729_3175038_-	LapA family protein	NA	NA	NA	NA	NA
AYQ64440.1|3175173_3175941_-	phosphatidylglycerophosphatase B	NA	NA	NA	NA	NA
AYQ64441.1|3176104_3176707_+	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	49.5	1.2e-43
AYQ64442.1|3176753_3179426_-	aconitate hydratase AcnA	NA	NA	NA	NA	NA
AYQ64443.1|3179436_3179643_-	hypothetical protein	NA	NA	NA	NA	NA
AYQ64444.1|3179814_3179982_-	YmiA family putative membrane protein	NA	NA	NA	NA	NA
AYQ64445.1|3180227_3181202_-	LysR family transcriptional regulator CysB	NA	NA	NA	NA	NA
AYQ64446.1|3181547_3184145_-	type I DNA topoisomerase	NA	A0A2K9L5F8	Tupanvirus	35.6	2.9e-89
AYQ64447.1|3184551_3184803_+	DUF2498 family protein	NA	NA	NA	NA	NA
AYQ64448.1|3184850_3185897_-|protease	protease SohB	protease	NA	NA	NA	NA
>prophage 9
CP033396	Klebsiella pneumoniae strain WCHKP015625 chromosome, complete genome	5445546	3291621	3379500	5445546	head,holin,capsid,portal,tail,terminase,integrase,tRNA	Klebsiella_phage(45.45%)	96	3318424:3318438	3377311:3377325
AYQ64548.1|3291621_3292122_+|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
AYQ64549.1|3292238_3292685_+	DUF441 domain-containing protein	NA	NA	NA	NA	NA
AYQ66590.1|3292668_3293460_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AYQ64550.1|3293561_3294746_+	MFS transporter	NA	NA	NA	NA	NA
AYQ64551.1|3294777_3295470_-	hypothetical protein	NA	NA	NA	NA	NA
AYQ64552.1|3295615_3296125_+	DUF523 domain-containing protein	NA	NA	NA	NA	NA
AYQ64553.1|3296111_3296468_+	DUF488 domain-containing protein	NA	NA	NA	NA	NA
AYQ64554.1|3296457_3296697_-	DUF333 domain-containing protein	NA	NA	NA	NA	NA
AYQ64555.1|3296997_3298011_+	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	29.0	1.4e-12
AYQ64556.1|3298068_3298170_+	hypothetical protein	NA	NA	NA	NA	NA
AYQ66591.1|3298169_3298244_+	protein YoaJ	NA	NA	NA	NA	NA
AYQ64557.1|3298361_3298487_+	hypothetical protein	NA	NA	NA	NA	NA
AYQ64558.1|3298546_3298810_-	DUF2534 family protein	NA	NA	NA	NA	NA
AYQ64559.1|3298940_3299579_-	leucine efflux protein	NA	NA	NA	NA	NA
AYQ64560.1|3299668_3300583_-	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	50.4	1.1e-72
AYQ64561.1|3300798_3300990_+	hypothetical protein	NA	NA	NA	NA	NA
AYQ64562.1|3301244_3302288_-	type II asparaginase	NA	NA	NA	NA	NA
AYQ64563.1|3302590_3303799_+	HD domain-containing protein	NA	NA	NA	NA	NA
AYQ64564.1|3303872_3305657_+	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	36.1	5.8e-17
AYQ64565.1|3305663_3306554_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AYQ64566.1|3306674_3308183_+	UbiD family decarboxylase	NA	NA	NA	NA	NA
AYQ64567.1|3308493_3309180_-	EAL domain-containing protein	NA	NA	NA	NA	NA
AYQ64568.1|3309577_3309757_-	hypothetical protein	NA	NA	NA	NA	NA
AYQ64569.1|3309796_3310429_-	DNA-binding protein	NA	NA	NA	NA	NA
AYQ64570.1|3310995_3311193_+	hypothetical protein	NA	NA	NA	NA	NA
AYQ64571.1|3311308_3312319_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
AYQ64572.1|3312315_3313722_-	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
AYQ64573.1|3313777_3314665_-	manganese catalase family protein	NA	NA	NA	NA	NA
AYQ64574.1|3314681_3315188_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
AYQ64575.1|3315214_3315709_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
AYQ64576.1|3315799_3315985_-	stress-induced acidophilic repeat motif-containing protein	NA	NA	NA	NA	NA
AYQ64577.1|3316606_3317800_+	glutathione-dependent formaldehyde dehydrogenase	NA	NA	NA	NA	NA
AYQ64578.1|3317912_3318140_+	DUF1272 domain-containing protein	NA	NA	NA	NA	NA
3318424:3318438	attL	TGGCTGGCGTTCTTT	NA	NA	NA	NA
AYQ64579.1|3318576_3318900_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
AYQ64580.1|3318892_3319285_+	amino acid-binding protein	NA	NA	NA	NA	NA
AYQ64581.1|3319281_3319995_+	ArsR family transcriptional regulator	NA	NA	NA	NA	NA
AYQ64582.1|3320267_3320420_-	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.0	3.8e-18
AYQ64583.1|3320574_3322071_-|tail	tail fiber domain-containing protein	tail	A0A0P0IDN1	Klebsiella_phage	63.7	1.4e-125
AYQ64584.1|3322139_3334844_-	DUF1983 domain-containing protein	NA	Q6UAW1	Klebsiella_phage	47.1	0.0e+00
AYQ64585.1|3334906_3335500_-|tail	tail assembly protein	tail	K7PHE5	Enterobacteria_phage	76.6	8.0e-80
AYQ64586.1|3335526_3335949_-	hypothetical protein	NA	J9Q806	Salmonella_phage	50.0	5.9e-29
AYQ64587.1|3335990_3336701_-	peptidase P60	NA	Q6UAW4	Klebsiella_phage	90.3	1.9e-136
AYQ64588.1|3336702_3337458_-|tail	phage minor tail protein L	tail	Q6UAW5	Klebsiella_phage	80.5	4.6e-125
AYQ64589.1|3337454_3337793_-|tail	phage tail protein	tail	Q6UAW6	Klebsiella_phage	88.4	1.4e-57
AYQ64590.1|3337792_3341128_-|tail	phage tail tape measure protein	tail	Q6UAW7	Klebsiella_phage	88.3	0.0e+00
AYQ64591.1|3341127_3341346_-	hypothetical protein	NA	Q6UAW9	Klebsiella_phage	90.5	5.4e-34
AYQ64592.1|3341360_3341726_-|tail	phage tail protein	tail	Q6UAW8	Klebsiella_phage	89.3	1.6e-51
AYQ64593.1|3341783_3342245_-|tail	phage tail protein	tail	Q6UAX0	Klebsiella_phage	83.7	7.8e-67
AYQ64594.1|3342276_3342678_-	hypothetical protein	NA	Q6UAX1	Klebsiella_phage	94.0	2.3e-62
AYQ64595.1|3342674_3343064_-	hypothetical protein	NA	Q6UAX2	Klebsiella_phage	86.0	9.6e-58
AYQ64596.1|3343044_3343383_-|head,tail	head-tail adaptor protein	head,tail	Q6UAX3	Klebsiella_phage	89.3	1.4e-52
AYQ64597.1|3343379_3343697_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q6UAX4	Klebsiella_phage	89.8	1.5e-45
AYQ64598.1|3343677_3343938_-	hypothetical protein	NA	Q6UAX5	Klebsiella_phage	60.5	7.4e-22
AYQ64599.1|3343996_3345283_-|capsid	phage major capsid protein	capsid	Q6UAX6	Klebsiella_phage	89.0	9.8e-216
AYQ64600.1|3345360_3346281_-	S49 family peptidase	NA	Q6UAX7	Klebsiella_phage	88.2	9.6e-149
AYQ64601.1|3346317_3347577_-|portal	phage portal protein	portal	Q6UAX8	Klebsiella_phage	89.8	1.8e-222
AYQ64602.1|3347576_3347756_-	hypothetical protein	NA	Q6UAX9	Klebsiella_phage	57.6	3.1e-11
AYQ64603.1|3347749_3349471_-|terminase	terminase large subunit	terminase	Q7Y413	Yersinia_phage	57.4	1.5e-190
AYQ64604.1|3349470_3349905_-|terminase	phage terminase small subunit P27 family	terminase	A0A1J0GV10	Halomonas_phage	61.9	9.4e-30
AYQ64605.1|3350153_3350585_-	hypothetical protein	NA	Q6UAS0	Klebsiella_phage	61.6	1.8e-41
AYQ64606.1|3350581_3350905_-	hypothetical protein	NA	NA	NA	NA	NA
AYQ64607.1|3350856_3351219_-	HNH endonuclease	NA	Q6UAS2	Klebsiella_phage	83.3	1.2e-57
AYQ64608.1|3351545_3351770_+	hypothetical protein	NA	NA	NA	NA	NA
AYQ64609.1|3351808_3352246_-	hypothetical protein	NA	NA	NA	NA	NA
AYQ64610.1|3353195_3353546_-	hypothetical protein	NA	R9TPM9	Aeromonas_phage	38.1	7.9e-11
AYQ64611.1|3353542_3354040_-	lysozyme	NA	A0A1V0E5Q7	Salmonella_phage	84.6	1.1e-77
AYQ64612.1|3354039_3354255_-|holin	holin	holin	A5LH82	Enterobacteria_phage	88.7	2.7e-30
AYQ64613.1|3356506_3357109_-	hypothetical protein	NA	H9C175	Pectobacterium_phage	68.6	1.1e-76
AYQ64614.1|3357125_3358157_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	49.6	4.7e-96
AYQ64615.1|3358156_3358360_-	hypothetical protein	NA	NA	NA	NA	NA
AYQ64616.1|3358356_3358749_-	DNA-binding protein	NA	K7PHB4	Enterobacterial_phage	36.6	8.0e-12
AYQ64617.1|3358789_3359080_-	hypothetical protein	NA	H6WRY6	Salmonella_phage	56.9	8.0e-17
AYQ64618.1|3359091_3359325_-	DinI family protein	NA	K7PM44	Enterobacteria_phage	71.1	3.7e-25
AYQ64619.1|3359403_3360888_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
AYQ64620.1|3360887_3361139_-	hypothetical protein	NA	NA	NA	NA	NA
AYQ64621.1|3361728_3363090_-	deoxyguanosinetriphosphate triphosphohydrolase family protein	NA	NA	NA	NA	NA
AYQ64622.1|3363263_3363977_-	hypothetical protein	NA	NA	NA	NA	NA
AYQ66592.1|3364328_3365198_+	hypothetical protein	NA	NA	NA	NA	NA
AYQ64623.1|3365286_3366678_+	hypothetical protein	NA	NA	NA	NA	NA
AYQ64624.1|3367026_3367467_-	hypothetical protein	NA	NA	NA	NA	NA
AYQ64625.1|3367480_3367945_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	72.2	4.1e-63
AYQ66593.1|3367937_3368942_-	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	40.0	1.4e-31
AYQ64626.1|3369001_3369556_-	hypothetical protein	NA	NA	NA	NA	NA
AYQ64627.1|3369558_3369783_-	Cro/Cl family transcriptional regulator	NA	H6WRX5	Salmonella_phage	62.5	1.3e-19
AYQ64628.1|3369871_3370309_+	helix-turn-helix domain-containing protein	NA	H6WRX4	Salmonella_phage	62.2	1.3e-39
AYQ64629.1|3370630_3370945_-	hypothetical protein	NA	NA	NA	NA	NA
AYQ64630.1|3371107_3371326_+	hypothetical protein	NA	NA	NA	NA	NA
AYQ64631.1|3371335_3371530_+	DUF1482 family protein	NA	NA	NA	NA	NA
AYQ64632.1|3371572_3371917_+	transcriptional regulator	NA	NA	NA	NA	NA
AYQ64633.1|3372058_3374197_+	exonuclease	NA	S4TNL0	Salmonella_phage	42.7	5.6e-99
AYQ64634.1|3374249_3374495_+	excisionase	NA	NA	NA	NA	NA
AYQ64635.1|3374475_3375603_+|integrase	integrase	integrase	O21925	Phage_21	58.4	4.4e-119
AYQ64636.1|3375720_3376971_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	1.1e-19
AYQ64637.1|3377211_3377862_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
3377311:3377325	attR	AAAGAACGCCAGCCA	NA	NA	NA	NA
AYQ64638.1|3377878_3378337_+	NUDIX hydrolase	NA	NA	NA	NA	NA
AYQ66594.1|3378393_3379500_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
>prophage 10
CP033396	Klebsiella pneumoniae strain WCHKP015625 chromosome, complete genome	5445546	3595479	3688429	5445546	head,capsid,portal,tail,lysis,plate,integrase,tRNA,protease	Salmonella_phage(57.89%)	95	3634072:3634087	3690862:3690877
AYQ64829.1|3595479_3596772_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	44.7	7.3e-94
AYQ64830.1|3596862_3598206_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.8	7.3e-81
AYQ64831.1|3598214_3598826_-	outer membrane lipoprotein carrier protein LolA	NA	NA	NA	NA	NA
AYQ64832.1|3598948_3603202_-	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	49.2	5.2e-88
AYQ64833.1|3603337_3603832_-	leucine-responsive regulatory protein	NA	NA	NA	NA	NA
AYQ64834.1|3604337_3605333_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.0	3.3e-62
AYQ64835.1|3605447_3607214_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	25.9	2.3e-21
AYQ64836.1|3607214_3608936_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.3	1.5e-14
AYQ64837.1|3608980_3609682_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
AYQ64838.1|3610035_3610254_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
AYQ64839.1|3610374_3612654_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
AYQ64840.1|3612684_3613002_-|protease	ATP-dependent Clp protease adaptor ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
AYQ64841.1|3613327_3613549_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
AYQ64842.1|3613625_3615566_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	1.9e-37
AYQ64843.1|3615562_3616678_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
AYQ64844.1|3616824_3618483_-	ATP-dependent endonuclease	NA	NA	NA	NA	NA
AYQ64845.1|3618902_3619598_+	aquaporin Z	NA	NA	NA	NA	NA
AYQ64846.1|3619713_3620613_+	lysine exporter LysO family protein	NA	NA	NA	NA	NA
AYQ66604.1|3620756_3622409_+	hydroxylamine reductase	NA	NA	NA	NA	NA
AYQ64847.1|3622419_3623388_+	NADH oxidoreductase	NA	NA	NA	NA	NA
AYQ64848.1|3623338_3623542_+	hypothetical protein	NA	NA	NA	NA	NA
AYQ64849.1|3623599_3624034_-	DoxX family protein	NA	NA	NA	NA	NA
AYQ66605.1|3624185_3625904_+	ubiquinone-dependent pyruvate dehydrogenase	NA	NA	NA	NA	NA
AYQ64850.1|3625942_3626944_+	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
AYQ64851.1|3626954_3628397_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
AYQ64852.1|3628484_3629498_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
AYQ64853.1|3629494_3630325_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	31.6	4.1e-05
AYQ64854.1|3630356_3631496_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
AYQ64855.1|3631548_3631728_+	hypothetical protein	NA	NA	NA	NA	NA
AYQ64856.1|3632373_3632889_+	lipoprotein	NA	NA	NA	NA	NA
AYQ64857.1|3633115_3633844_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	37.1	1.2e-29
AYQ66606.1|3633864_3634596_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
3634072:3634087	attL	GACAGCCTGATCCCGG	NA	NA	NA	NA
AYQ64858.1|3634602_3635319_+	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
AYQ64859.1|3635318_3635987_+	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
AYQ64860.1|3636170_3636902_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AYQ64861.1|3636944_3638417_-	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	31.8	7.9e-28
AYQ64862.1|3638413_3639130_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	36.9	2.1e-34
AYQ64863.1|3639208_3640336_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A2K5B251	Erysipelothrix_phage	25.6	1.3e-19
AYQ64864.1|3640377_3640866_-	DUF2593 family protein	NA	NA	NA	NA	NA
AYQ64865.1|3640923_3641769_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
AYQ64866.1|3641765_3642719_-	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
AYQ66607.1|3642729_3643863_-	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.9	2.2e-30
AYQ64867.1|3644026_3645139_-	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
AYQ64868.1|3645487_3645967_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
AYQ64869.1|3646055_3646958_-	30S ribosomal protein S6--L-glutamate ligase	NA	A0A1D7SR78	Cyanophage	35.3	2.0e-34
AYQ64870.1|3647779_3648067_-	DUF1418 family protein	NA	NA	NA	NA	NA
AYQ64871.1|3648269_3648533_+	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	73.1	1.6e-27
AYQ64872.1|3648539_3648923_-	hypothetical protein	NA	NA	NA	NA	NA
AYQ66608.1|3649189_3650875_+	transporter	NA	NA	NA	NA	NA
AYQ64873.1|3651094_3651313_-	transcriptional regulator	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
AYQ64874.1|3651404_3652505_-	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	87.4	4.9e-176
AYQ64875.1|3652501_3652987_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	75.6	7.2e-63
AYQ64876.1|3652983_3655611_-|tail	phage tail tape measure protein	tail	E5FFG5	Burkholderia_phage	42.0	5.6e-117
AYQ64877.1|3655603_3655723_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.2e-13
AYQ64878.1|3655737_3656037_-|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	79.0	3.7e-33
AYQ64879.1|3656089_3656605_-|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	85.4	1.3e-81
AYQ64880.1|3656614_3657787_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	93.3	1.9e-210
AYQ64881.1|3659030_3659234_-	hypothetical protein	NA	NA	NA	NA	NA
AYQ64882.1|3659230_3659962_-	hypothetical protein	NA	NA	NA	NA	NA
AYQ64883.1|3659965_3662917_-	hypothetical protein	NA	A0A2H4N7A3	Pectobacterium_phage	50.9	1.2e-06
AYQ64884.1|3662918_3663518_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	60.5	1.3e-58
AYQ64885.1|3663510_3664419_-|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	66.9	7.6e-106
AYQ64886.1|3664405_3664768_-|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	83.9	4.9e-48
AYQ64887.1|3664764_3665337_-|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	72.3	4.7e-77
AYQ64888.1|3665431_3666124_+	hypothetical protein	NA	NA	NA	NA	NA
AYQ64889.1|3666120_3666567_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	71.2	2.2e-50
AYQ64890.1|3666559_3666991_-|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	82.5	9.9e-64
AYQ64891.1|3667086_3667515_-|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	77.9	9.6e-51
AYQ64892.1|3667511_3667895_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	42.0	2.1e-17
AYQ64893.1|3667899_3668409_-	lysozyme	NA	E5G6N1	Salmonella_phage	83.4	2.1e-81
AYQ64894.1|3668389_3668605_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	90.1	3.6e-30
AYQ64895.1|3668608_3668812_-|tail	phage tail protein	tail	A0A1S6KZY4	Salmonella_phage	88.1	1.3e-29
AYQ64896.1|3668811_3669276_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.0	8.4e-77
AYQ64897.1|3669371_3670022_-	hypothetical protein	NA	E5G6M7	Salmonella_phage	96.3	8.7e-112
AYQ64898.1|3670025_3671084_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.1	1.1e-180
AYQ64899.1|3671100_3671934_-|capsid	capsid protein	capsid	A0A1S6KZW9	Salmonella_phage	88.8	6.3e-123
AYQ64900.1|3672076_3673843_+	oxidoreductase	NA	A0A1S6KZW3	Salmonella_phage	99.0	0.0e+00
AYQ64901.1|3673842_3674868_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	86.7	7.6e-171
AYQ64902.1|3674929_3676672_-	hypothetical protein	NA	NA	NA	NA	NA
AYQ64903.1|3676947_3677625_-	hypothetical protein	NA	NA	NA	NA	NA
AYQ64904.1|3677739_3678045_-	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
AYQ66609.1|3677983_3678172_-	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
AYQ64905.1|3678325_3680740_-	replication endonuclease	NA	E5G6L9	Salmonella_phage	97.5	0.0e+00
AYQ64906.1|3680736_3681594_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	95.4	2.0e-156
AYQ64907.1|3681590_3681818_-	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	98.7	6.0e-36
AYQ64908.1|3681817_3682051_-	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	96.1	4.1e-32
AYQ64909.1|3682118_3682460_-	hypothetical protein	NA	E5G6L5	Salmonella_phage	99.1	4.6e-56
AYQ64910.1|3682423_3682624_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	97.0	1.6e-32
AYQ64911.1|3682631_3683141_-	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.8	5.8e-87
AYQ64912.1|3683173_3683395_-	regulator	NA	NA	NA	NA	NA
AYQ66610.1|3683540_3684419_+	Repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	39.9	1.7e-30
AYQ64913.1|3684430_3685375_+	hypothetical protein	NA	NA	NA	NA	NA
AYQ64914.1|3685473_3686958_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
AYQ64915.1|3686957_3687209_-	hypothetical protein	NA	NA	NA	NA	NA
AYQ64916.1|3687376_3688429_+|integrase	site-specific integrase	integrase	A0A218M4I3	Erwinia_phage	57.0	1.0e-106
3690862:3690877	attR	GACAGCCTGATCCCGG	NA	NA	NA	NA
>prophage 11
CP033396	Klebsiella pneumoniae strain WCHKP015625 chromosome, complete genome	5445546	4332127	4343780	5445546		Enterobacteria_phage(70.0%)	13	NA	NA
AYQ65486.1|4332127_4333231_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.5	4.8e-62
AYQ65487.1|4333241_4334495_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	44.9	8.9e-89
AYQ65488.1|4334847_4336038_+	DUF4102 domain-containing protein	NA	Q7M297	Enterobacteria_phage	62.7	6.4e-145
AYQ65489.1|4336025_4336976_+	cobyrinic acid a,c-diamide synthase	NA	A0A1X9IGI7	Lactococcus_phage	27.1	1.2e-13
AYQ65490.1|4336975_4337401_+	hypothetical protein	NA	NA	NA	NA	NA
AYQ65491.1|4337968_4338535_-	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	63.8	9.7e-59
AYQ65492.1|4338552_4338798_-	hypothetical protein	NA	Q7M294	Enterobacteria_phage	56.8	5.5e-19
AYQ65493.1|4338794_4339532_-	glycoprotein 3	NA	Q7M2A2	Enterobacteria_phage	59.4	1.9e-70
AYQ65494.1|4340073_4340340_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	71.6	2.6e-30
AYQ65495.1|4340336_4340894_+	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	70.4	1.8e-33
AYQ65496.1|4340890_4341118_+	hypothetical protein	NA	NA	NA	NA	NA
AYQ65497.1|4341114_4341435_+	hypothetical protein	NA	NA	NA	NA	NA
AYQ65498.1|4341446_4343780_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	82.2	0.0e+00
>prophage 12
CP033396	Klebsiella pneumoniae strain WCHKP015625 chromosome, complete genome	5445546	4812924	4820550	5445546	transposase	Enterobacteria_phage(83.33%)	8	NA	NA
AYQ65899.1|4812924_4815258_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	83.9	0.0e+00
AYQ65900.1|4815272_4815593_-	hypothetical protein	NA	NA	NA	NA	NA
AYQ65901.1|4815589_4815817_-	hypothetical protein	NA	NA	NA	NA	NA
AYQ65902.1|4815813_4816362_-	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	69.4	1.1e-30
AYQ65903.1|4817185_4817923_+	glycoprotein 3	NA	Q7M2A2	Enterobacteria_phage	59.4	1.1e-70
AYQ65904.1|4817919_4818165_+	hypothetical protein	NA	Q7M294	Enterobacteria_phage	56.8	5.5e-19
AYQ65905.1|4818182_4818749_+	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	63.8	9.7e-59
AYQ65906.1|4819569_4820550_-|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
>prophage 1
CP033394	Klebsiella pneumoniae strain WCHKP015625 plasmid pCTXM65_015625, complete sequence	142207	1798	50240	142207	transposase,protease	Escherichia_phage(42.31%)	56	NA	NA
AYQ61254.1|1798_2503_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AYQ61255.1|5146_5851_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AYQ61256.1|6277_6994_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	2.4e-139
AYQ61257.1|7226_7973_+	type-F conjugative transfer system pilin acetylase TraX	NA	A0A077JBM8	Xanthomonas_phage	30.9	4.2e-09
AYQ61258.1|8027_8588_+	fertility inhibition protein FinO	NA	NA	NA	NA	NA
AYQ61259.1|8719_8920_+	hypothetical protein	NA	NA	NA	NA	NA
AYQ61260.1|9305_9905_+	hypothetical protein	NA	NA	NA	NA	NA
AYQ61261.1|10068_10299_+	hypothetical protein	NA	NA	NA	NA	NA
AYQ61262.1|10603_10753_+	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
AYQ61263.1|11036_11285_+	replication regulatory protein RepA	NA	NA	NA	NA	NA
AYQ61264.1|11285_11495_-	replication protein RepA	NA	NA	NA	NA	NA
AYQ61396.1|11529_11604_+	RepA leader peptide Tap	NA	NA	NA	NA	NA
AYQ61265.1|11596_12454_+	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
AYQ61266.1|12816_13203_+	hypothetical protein	NA	NA	NA	NA	NA
AYQ61267.1|13392_14046_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
AYQ61268.1|14138_14396_+	antitoxin PemI	NA	NA	NA	NA	NA
AYQ61269.1|14397_14730_+	mRNA interferase PemK	NA	NA	NA	NA	NA
AYQ61270.1|16040_16745_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AYQ61271.1|17255_18131_+	class A extended-spectrum beta-lactamase CTX-M-65	NA	A0A1B0VBP7	Salmonella_phage	98.9	6.8e-152
AYQ61272.1|18210_19134_+|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	99.7	2.2e-177
AYQ61273.1|20884_21589_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AYQ61274.1|21714_22089_-	hypothetical protein	NA	A0A248SL90	Klebsiella_phage	62.7	2.2e-27
AYQ61275.1|22714_23074_-	hypothetical protein	NA	NA	NA	NA	NA
AYQ61276.1|23135_23459_-	theronine dehydrogenase	NA	I3UM57	Rhodobacter_phage	38.1	6.0e-13
AYQ61277.1|23455_24184_-	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
AYQ61278.1|24180_24612_-	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
AYQ61279.1|26734_26965_-	DUF905 domain-containing protein	NA	NA	NA	NA	NA
AYQ61280.1|27942_28203_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	46.2	4.1e-12
AYQ61281.1|28389_28581_-	hypothetical protein	NA	NA	NA	NA	NA
AYQ61282.1|28623_29130_-	antirestriction protein ArdA	NA	A0A1I9S7Y0	Rhodococcus_phage	31.8	4.8e-09
AYQ61283.1|29534_30314_-	hypothetical protein	NA	NA	NA	NA	NA
AYQ61284.1|30367_30787_-	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
AYQ61285.1|30797_31019_-	hypothetical protein	NA	NA	NA	NA	NA
AYQ61286.1|31018_31696_-	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.9	1.6e-28
AYQ61287.1|32054_32726_+	DNA breaking-rejoining protein	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	61.7	5.1e-83
AYQ61288.1|32905_33328_+	peptidase	NA	A0A1W6JNS2	Morganella_phage	51.5	3.1e-30
AYQ61289.1|33327_34599_+	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	63.0	6.1e-154
AYQ61290.1|34734_35706_-	ParB/RepB/Spo0J family partition protein	NA	Q1MVJ4	Enterobacteria_phage	68.9	1.4e-113
AYQ61291.1|35702_36908_-	ParA family protein	NA	Q1MVJ3	Enterobacteria_phage	89.2	1.1e-205
AYQ61292.1|37270_37903_+	LacI family DNA-binding transcriptional regulator	NA	A0A1V0E035	Clostridioides_phage	31.9	2.5e-07
AYQ61293.1|37956_38157_+	hypothetical protein	NA	NA	NA	NA	NA
AYQ61294.1|38303_39254_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	55.6	6.6e-76
AYQ61295.1|39250_39862_-	DUF2913 family protein	NA	NA	NA	NA	NA
AYQ61397.1|39858_40254_-	hypothetical protein	NA	NA	NA	NA	NA
AYQ61296.1|40767_41748_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.4	1.0e-185
AYQ61398.1|42399_42957_+	hypothetical protein	NA	NA	NA	NA	NA
AYQ61297.1|43425_44130_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AYQ61298.1|44262_44904_-	type A-2 chloramphenicol O-acetyltransferase CatII	NA	G3CFL0	Escherichia_phage	45.9	7.3e-55
AYQ61299.1|44965_45670_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AYQ61300.1|45749_46250_+	hypothetical protein	NA	NA	NA	NA	NA
AYQ61301.1|46461_47166_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AYQ61302.1|47199_47691_-	hypothetical protein	NA	NA	NA	NA	NA
AYQ61303.1|47797_48535_+	resolvase	NA	NA	NA	NA	NA
AYQ61304.1|48531_48756_+	hypothetical protein	NA	NA	NA	NA	NA
AYQ61305.1|48877_49054_+	DUF4102 domain-containing protein	NA	T1S9J3	Salmonella_phage	68.6	1.0e-06
AYQ61306.1|49235_50240_-|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
>prophage 2
CP033394	Klebsiella pneumoniae strain WCHKP015625 plasmid pCTXM65_015625, complete sequence	142207	56296	98004	142207	integrase,transposase	Escherichia_phage(40.0%)	43	54919:54978	98151:98302
54919:54978	attL	TGTCATTTTCAGAAGACGACTGCACCAGTTGATTGGGCGTAATGGCTGTTGTGCAGCCAG	NA	NA	NA	NA
AYQ61314.1|56296_57001_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AYQ61315.1|57040_57514_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	99.3	3.3e-76
AYQ61316.1|58576_59644_-|transposase	IS481-like element ISKpn28 family transposase	transposase	NA	NA	NA	NA
AYQ61317.1|59715_59874_+	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
AYQ61318.1|60566_60839_+	hypothetical protein	NA	NA	NA	NA	NA
AYQ61319.1|60835_61186_+	hypothetical protein	NA	NA	NA	NA	NA
AYQ61320.1|61200_61518_+	hypothetical protein	NA	NA	NA	NA	NA
AYQ61321.1|62358_62715_+	hypothetical protein	NA	A0A248SL90	Klebsiella_phage	58.1	7.5e-25
AYQ61322.1|62775_62988_+	hypothetical protein	NA	NA	NA	NA	NA
AYQ61323.1|62998_63223_+	hypothetical protein	NA	NA	NA	NA	NA
AYQ61324.1|63303_63624_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A088CBP5	Shigella_phage	39.5	1.5e-08
AYQ61325.1|63613_63892_+	XRE family transcriptional regulator	NA	O64356	Escherichia_phage	39.4	2.5e-07
AYQ61400.1|64337_64598_-	hypothetical protein	NA	NA	NA	NA	NA
AYQ61326.1|64835_65378_+	single-stranded DNA-binding protein	NA	A0A0A0P1Q9	Enterobacteria_phage	76.7	4.6e-50
AYQ61327.1|65426_65675_+	DUF905 domain-containing protein	NA	NA	NA	NA	NA
AYQ61328.1|65744_67802_+	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	25.4	1.2e-21
AYQ61329.1|67846_68278_+	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
AYQ61330.1|68274_69003_+	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
AYQ61331.1|68999_69326_+	theronine dehydrogenase	NA	NA	NA	NA	NA
AYQ61332.1|69381_69756_+	hypothetical protein	NA	NA	NA	NA	NA
AYQ61333.1|69939_71013_-|transposase	IS481-like element ISKpn28 family transposase	transposase	NA	NA	NA	NA
AYQ61334.1|71362_72244_+	carbapenem-hydrolyzing class A beta-lactamase KPC-12	NA	A0A1B0VBP7	Salmonella_phage	51.8	3.7e-73
AYQ61335.1|73512_74217_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AYQ61336.1|74250_79386_-	conjugative transfer relaxase/helicase TraI	NA	NA	NA	NA	NA
AYQ61337.1|79385_81584_-	type IV conjugative transfer system coupling protein TraD	NA	NA	NA	NA	NA
AYQ61338.1|81634_82372_-	hypothetical protein	NA	NA	NA	NA	NA
AYQ61401.1|82574_83306_-	complement resistance protein TraT	NA	NA	NA	NA	NA
AYQ61339.1|83330_83852_-	conjugal transfer protein TraS	NA	NA	NA	NA	NA
AYQ61340.1|83884_86701_-	conjugal transfer protein TraG	NA	NA	NA	NA	NA
AYQ61341.1|87777_88482_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AYQ61342.1|89592_90297_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AYQ61343.1|90514_90799_-|transposase	transposase	transposase	NA	NA	NA	NA
AYQ61344.1|90767_91781_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
AYQ61402.1|92072_92627_+	fluoroquinolone-acetylating aminoglycoside 6'-N-acetyltransferase AAC(6')-Ib-cr5	NA	NA	NA	NA	NA
AYQ61345.1|92723_93176_+	NAD(+)--rifampin ADP-ribosyltransferase Arr-3	NA	NA	NA	NA	NA
AYQ61403.1|93308_93782_+	trimethoprim-resistant dihydrofolate reductase DfrA27	NA	G3MBI7	Bacillus_virus	29.1	1.4e-15
AYQ61404.1|93962_94808_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA16	NA	NA	NA	NA	NA
AYQ61346.1|94924_95272_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
AYQ61347.1|95265_96105_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
AYQ61348.1|96034_96214_-	hypothetical protein	NA	NA	NA	NA	NA
AYQ61349.1|96232_96733_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AYQ61350.1|97038_97152_-	NTP-binding protein	NA	NA	NA	NA	NA
AYQ61351.1|97239_98004_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
98151:98302	attR	CTGGCTGCACAACAGCCATTACGCCCAATCAACTGGTGCAGTCGTCTTCTGAAAATGACACTGTTTGTATATAATCATGAAAAAATGGTGAGTAGAGTTTCAGGGTAACAGGGGATGCTTATGTCGGTTTTCCACAACTGGCTACTTGAGAT	NA	NA	NA	NA
>prophage 1
CP033395	Klebsiella pneumoniae strain WCHKP015625 plasmid pKPC12_015625, complete sequence	55373	4344	15503	55373		Escherichia_phage(50.0%)	11	NA	NA
AYQ61419.1|4344_5046_-	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.2	1.6e-26
AYQ61420.1|5482_5713_-	hypothetical protein	NA	NA	NA	NA	NA
AYQ61421.1|5775_6447_-	Mediator of plasmid stability	NA	NA	NA	NA	NA
AYQ61422.1|6449_7421_-	StbA family protein	NA	A0A222YXF2	Escherichia_phage	46.8	1.1e-73
AYQ61423.1|7669_9154_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
AYQ61424.1|9153_9405_-	hypothetical protein	NA	NA	NA	NA	NA
AYQ61425.1|9563_9995_+	peptidase	NA	A0A1W6JNS2	Morganella_phage	53.3	2.1e-29
AYQ61426.1|9994_11266_+	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	63.7	7.5e-152
AYQ61427.1|11347_12325_-	ParB/RepB/Spo0J family partition protein	NA	Q38420	Escherichia_phage	53.8	1.4e-86
AYQ61428.1|12321_13527_-	ParA family protein	NA	A0A077SL49	Escherichia_phage	69.3	5.3e-163
AYQ61429.1|14636_15503_-	RepB family plasmid replication initiator protein	NA	A0A222YYK1	Escherichia_phage	31.1	1.5e-23
