The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP030073	Streptomyces sp. ZFG47 chromosome, complete genome	9269371	90119	122993	9269371	integrase,transposase,coat	Mycobacterium_phage(40.0%)	31	115838:115861	122994:123017
AWW35359.1|90119_90977_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AWW35360.1|93555_94962_-|transposase	IS1380 family transposase	transposase	A0A222ZN33	Mycobacterium_phage	45.8	1.5e-92
AWW42156.1|95196_96039_+|transposase	IS5 family transposase	transposase	A0A0M5M147	Mycobacterium_phage	53.8	3.1e-77
AWW35361.1|95996_96785_-	hypothetical protein	NA	NA	NA	NA	NA
AWW35362.1|97299_97869_-	N-acetyltransferase	NA	NA	NA	NA	NA
AWW35363.1|97879_99187_-	hypothetical protein	NA	NA	NA	NA	NA
AWW35364.1|99380_99791_+	hypothetical protein	NA	NA	NA	NA	NA
AWW35365.1|99787_100243_+	ATP-binding protein	NA	NA	NA	NA	NA
AWW35366.1|100360_101131_+	NUDIX hydrolase	NA	NA	NA	NA	NA
AWW42157.1|101176_101971_+	hydratase	NA	NA	NA	NA	NA
AWW35367.1|101996_102887_+	acetylating acetaldehyde dehydrogenase	NA	E5EQ71	Micromonas_sp._RCC1109_virus	30.7	2.4e-27
AWW35368.1|102883_103903_+	4-hydroxy-2-oxovalerate aldolase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	39.8	5.2e-55
AWW35369.1|103899_104763_+	CoA ester lyase	NA	NA	NA	NA	NA
AWW42158.1|104771_105296_+	MaoC family dehydratase	NA	NA	NA	NA	NA
AWW35370.1|105309_106476_+|coat	spore coat protein	coat	NA	NA	NA	NA
AWW35371.1|106532_106811_+	hypothetical protein	NA	NA	NA	NA	NA
AWW35372.1|107042_107564_-	hypothetical protein	NA	NA	NA	NA	NA
AWW35373.1|108274_109291_-	hypothetical protein	NA	NA	NA	NA	NA
AWW35374.1|109293_109488_-	hypothetical protein	NA	NA	NA	NA	NA
AWW35375.1|110093_110816_-	hypothetical protein	NA	NA	NA	NA	NA
AWW35376.1|110812_111040_-	hypothetical protein	NA	NA	NA	NA	NA
AWW35377.1|111094_111505_+	hypothetical protein	NA	NA	NA	NA	NA
AWW35378.1|111762_112905_+	hypothetical protein	NA	NA	NA	NA	NA
AWW35379.1|114733_115186_+	cyclase	NA	NA	NA	NA	NA
115838:115861	attL	CGTTGCCGTCAACTACTGCCGTCA	NA	NA	NA	NA
AWW35380.1|115949_116351_-	hypothetical protein	NA	NA	NA	NA	NA
AWW35381.1|116356_116599_-	type IV secretion protein Rhs	NA	NA	NA	NA	NA
AWW42159.1|117369_117789_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AWW42160.1|119763_120558_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AWW42161.1|120505_121033_-	hypothetical protein	NA	NA	NA	NA	NA
AWW35382.1|121494_121686_+	DNA-binding protein	NA	NA	NA	NA	NA
AWW35383.1|121685_122993_+|integrase	site-specific integrase	integrase	A0A1B0T6A8	Bacillus_phage	33.3	1.2e-38
122994:123017	attR	CGTTGCCGTCAACTACTGCCGTCA	NA	NA	NA	NA
>prophage 2
CP030073	Streptomyces sp. ZFG47 chromosome, complete genome	9269371	152048	213907	9269371	integrase,transposase	Bacillus_phage(50.0%)	48	202444:202459	219366:219381
AWW35400.1|152048_153455_+|transposase	IS1380 family transposase	transposase	A0A222ZN33	Mycobacterium_phage	45.3	8.5e-88
AWW35401.1|153858_154191_-	hypothetical protein	NA	NA	NA	NA	NA
AWW35402.1|154761_155856_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
AWW35403.1|155939_156341_-	cupin	NA	NA	NA	NA	NA
AWW35404.1|156579_157101_-	hypothetical protein	NA	NA	NA	NA	NA
AWW35405.1|156892_157969_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AWW35406.1|158219_158603_-	hypothetical protein	NA	NA	NA	NA	NA
AWW35407.1|159120_160539_+	hypothetical protein	NA	NA	NA	NA	NA
AWW35408.1|160586_160832_+	hypothetical protein	NA	NA	NA	NA	NA
AWW42166.1|161321_162680_-	NmrA/HSCARG family protein	NA	NA	NA	NA	NA
AWW35409.1|162711_163464_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AWW35410.1|163588_163891_+	hypothetical protein	NA	NA	NA	NA	NA
AWW35411.1|164439_165477_-	hypothetical protein	NA	NA	NA	NA	NA
AWW42167.1|166739_170057_-	peptidase S8	NA	A0A217EQY2	Bacillus_phage	36.0	5.5e-29
AWW35412.1|171095_171521_+	hypothetical protein	NA	NA	NA	NA	NA
AWW35413.1|172140_172599_+	cupin domain-containing protein	NA	NA	NA	NA	NA
AWW35414.1|173725_174454_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	32.5	4.5e-32
AWW35415.1|174455_175718_+	sensor histidine kinase	NA	NA	NA	NA	NA
AWW35416.1|176166_176466_+	hypothetical protein	NA	NA	NA	NA	NA
AWW35417.1|176462_177578_+	peptidoglycan-binding protein	NA	NA	NA	NA	NA
AWW35418.1|177574_178264_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	42.4	1.7e-33
AWW35419.1|178260_179466_+	ABC transporter permease	NA	NA	NA	NA	NA
AWW35420.1|180418_181252_-	GlcNAc-PI de-N-acetylase	NA	NA	NA	NA	NA
AWW35421.1|181770_181965_+	hypothetical protein	NA	NA	NA	NA	NA
AWW35422.1|182656_186322_+	hypothetical protein	NA	A0A217EQY2	Bacillus_phage	38.3	2.7e-32
AWW35423.1|186318_186945_+	hypothetical protein	NA	NA	NA	NA	NA
AWW35424.1|187080_187554_-	glyoxalase	NA	NA	NA	NA	NA
AWW35425.1|187902_189405_+	monooxygenase	NA	NA	NA	NA	NA
AWW35426.1|189709_190567_+	arylamine N-acetyltransferase	NA	NA	NA	NA	NA
AWW42168.1|190586_191429_-|transposase	IS5 family transposase	transposase	A0A0M5M147	Mycobacterium_phage	53.8	3.1e-77
AWW35427.1|192134_192944_+	hypothetical protein	NA	NA	NA	NA	NA
AWW35428.1|193445_194099_+	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AWW42169.1|194236_194443_-	hypothetical protein	NA	NA	NA	NA	NA
AWW42170.1|195416_195881_-	hypothetical protein	NA	NA	NA	NA	NA
AWW35429.1|195948_196398_-	hypothetical protein	NA	NA	NA	NA	NA
AWW35430.1|198018_198702_-	hypothetical protein	NA	NA	NA	NA	NA
AWW42171.1|199034_199487_-	hypothetical protein	NA	NA	NA	NA	NA
AWW35431.1|200004_201510_+	hypothetical protein	NA	NA	NA	NA	NA
202444:202459	attL	ACCCCGGTCCGCACCC	NA	NA	NA	NA
AWW35432.1|202639_202969_-	deoxyxylulose-5-phosphate synthase	NA	NA	NA	NA	NA
AWW35433.1|204112_204385_-	hypothetical protein	NA	NA	NA	NA	NA
AWW35434.1|205600_206014_+	peptide-methionine (R)-S-oxide reductase	NA	NA	NA	NA	NA
AWW35435.1|206173_206773_-	hypothetical protein	NA	NA	NA	NA	NA
AWW35436.1|206881_207424_-	hypothetical protein	NA	NA	NA	NA	NA
AWW35437.1|209243_209789_+	ferredoxin	NA	NA	NA	NA	NA
AWW35438.1|210265_210556_+	hypothetical protein	NA	NA	NA	NA	NA
AWW35439.1|210935_211946_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
AWW35440.1|211942_212257_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AWW35441.1|212269_213907_+|integrase	integrase	integrase	NA	NA	NA	NA
219366:219381	attR	ACCCCGGTCCGCACCC	NA	NA	NA	NA
>prophage 3
CP030073	Streptomyces sp. ZFG47 chromosome, complete genome	9269371	837407	931812	9269371	plate,tail,protease	Mycobacterium_phage(33.33%)	51	NA	NA
AWW35828.1|837407_838664_+|protease	serine protease	protease	NA	NA	NA	NA
AWW35829.1|838818_842847_-	secretion protein EccC	NA	V5UPA0	Mycobacterium_phage	26.7	1.3e-96
AWW35830.1|843299_844703_+	type VII secretion integral membrane protein EccD	NA	NA	NA	NA	NA
AWW35831.1|844747_846379_+	type VII secretion protein EccB	NA	NA	NA	NA	NA
AWW35832.1|846826_847162_+	hypothetical protein	NA	NA	NA	NA	NA
AWW35833.1|847256_847565_+	WXG100 family type VII secretion target	NA	NA	NA	NA	NA
AWW35834.1|847959_848427_+	type VII secretion system-associated protein	NA	NA	NA	NA	NA
AWW35835.1|848558_851573_+	hypothetical protein	NA	NA	NA	NA	NA
AWW35836.1|851697_852153_+	YbaB/EbfC family DNA-binding protein	NA	NA	NA	NA	NA
AWW35837.1|852155_852533_+	hypothetical protein	NA	NA	NA	NA	NA
AWW35838.1|870174_871386_-	serine hydrolase	NA	A0A1D8EXR7	Mycobacterium_phage	27.7	4.7e-18
AWW35839.1|871732_872701_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
AWW35840.1|872735_873275_-	flavin reductase	NA	NA	NA	NA	NA
AWW35841.1|873375_876432_-	transcriptional regulator	NA	NA	NA	NA	NA
AWW35842.1|876455_877340_-	hypothetical protein	NA	NA	NA	NA	NA
AWW35843.1|877466_878999_-	2,4,6-trichlorophenol monooxygenase	NA	NA	NA	NA	NA
AWW35844.1|879313_880231_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
AWW35845.1|880687_881494_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
AWW35846.1|881612_883169_+	Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
AWW42235.1|883189_884620_+	Re/Si-specific NAD(P)(+) transhydrogenase subunit beta	NA	NA	NA	NA	NA
AWW35847.1|884753_886172_+	FAD-linked oxidoreductase	NA	S4VXI2	Pandoravirus	31.9	3.5e-41
AWW35848.1|886338_887676_-	MFS transporter	NA	NA	NA	NA	NA
AWW35849.1|887887_889312_-	NADP-dependent succinic semialdehyde dehydrogenase	NA	NA	NA	NA	NA
AWW35850.1|889538_890249_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AWW35851.1|890255_890759_-	VOC family protein	NA	NA	NA	NA	NA
AWW35852.1|890890_893080_+	MFS transporter	NA	NA	NA	NA	NA
AWW35853.1|893072_894392_+	2-oxo acid dehydrogenase subunit E2	NA	NA	NA	NA	NA
AWW35854.1|894552_895305_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AWW35855.1|895450_896215_+	FAD synthetase	NA	NA	NA	NA	NA
AWW35856.1|896449_897850_+	aminopeptidase P family protein	NA	NA	NA	NA	NA
AWW35857.1|898116_898845_+	hydrolase	NA	NA	NA	NA	NA
AWW35858.1|899079_901020_-	FHA domain-containing protein	NA	NA	NA	NA	NA
AWW35859.1|901247_903209_-	serine/threonine protein kinase	NA	M1HZT4	Acanthocystis_turfacea_Chlorella_virus	26.9	3.8e-17
AWW35860.1|903685_905704_-	PAS sensor protein	NA	NA	NA	NA	NA
AWW35861.1|906322_907999_+	cation tolerance protein CutA	NA	NA	NA	NA	NA
AWW35862.1|908571_909474_+	hypothetical protein	NA	NA	NA	NA	NA
AWW35863.1|909632_910037_+	hypothetical protein	NA	NA	NA	NA	NA
AWW42236.1|910031_912485_-	PAS domain S-box protein	NA	NA	NA	NA	NA
AWW35864.1|915237_918183_-	AfsR family transcriptional regulator	NA	NA	NA	NA	NA
AWW35865.1|919030_919528_+	RNA polymerase	NA	A0A076YQ50	Rhizobium_phage	24.8	7.0e-05
AWW35866.1|919650_920934_-	hypothetical protein	NA	NA	NA	NA	NA
AWW35867.1|920930_921482_-|tail	phage tail protein	tail	NA	NA	NA	NA
AWW35868.1|921478_923431_-|plate	putative baseplate assembly protein	plate	NA	NA	NA	NA
AWW35869.1|923436_923844_-|plate	baseplate protein	plate	A0A0K0KW55	Prochlorococcus_phage	31.0	5.6e-08
AWW35870.1|923843_925697_-	type IV secretion protein Rhs	NA	NA	NA	NA	NA
AWW35871.1|925734_926472_-	LysM domain-containing protein	NA	NA	NA	NA	NA
AWW35872.1|926471_926909_-|tail	phage tail protein	tail	NA	NA	NA	NA
AWW35873.1|930009_930294_+	hypothetical protein	NA	NA	NA	NA	NA
AWW42237.1|930752_930956_-	hypothetical protein	NA	NA	NA	NA	NA
AWW35874.1|930904_931369_-	hypothetical protein	NA	NA	NA	NA	NA
AWW35875.1|931368_931812_-|tail	phage tail protein	tail	NA	NA	NA	NA
>prophage 4
CP030073	Streptomyces sp. ZFG47 chromosome, complete genome	9269371	1578615	1636608	9269371	integrase,transposase,bacteriocin	Planktothrix_phage(50.0%)	40	1573385:1573402	1604488:1604505
1573385:1573402	attL	GCGGCCCGGACCGGGCCG	NA	NA	NA	NA
AWW42312.1|1578615_1580487_+|bacteriocin	bacteriocin biosynthesis protein SagD	bacteriocin	NA	NA	NA	NA
AWW36332.1|1580538_1582122_+	nitroreductase	NA	NA	NA	NA	NA
AWW36333.1|1582134_1584858_+	lantibiotic dehydratase	NA	NA	NA	NA	NA
AWW36334.1|1584845_1585901_+	lantibiotic biosynthesis protein	NA	NA	NA	NA	NA
AWW36335.1|1586335_1587010_+	hypothetical protein	NA	NA	NA	NA	NA
AWW36336.1|1587034_1588069_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.8	1.2e-17
AWW36337.1|1588065_1588821_+	ABC transporter permease	NA	NA	NA	NA	NA
AWW42313.1|1588847_1590758_+	cyclodehydratase	NA	NA	NA	NA	NA
AWW36338.1|1590886_1591063_-|bacteriocin	thiazolylpeptide-type bacteriocin	bacteriocin	NA	NA	NA	NA
AWW36339.1|1591116_1591311_-	hypothetical protein	NA	NA	NA	NA	NA
AWW36340.1|1591317_1592634_+	amidohydrolase	NA	NA	NA	NA	NA
AWW36341.1|1592859_1594284_+	amidase	NA	NA	NA	NA	NA
AWW36342.1|1594313_1594760_+	type II toxin-antitoxin system PemK/MazF family toxin	NA	NA	NA	NA	NA
AWW36343.1|1594803_1595856_-	TIGR02452 family protein	NA	G3MBH6	Bacillus_virus	36.5	1.2e-38
AWW36344.1|1595881_1597183_+	ergothioneine biosynthesis glutamate--cysteine ligase EgtA	NA	NA	NA	NA	NA
AWW36345.1|1597179_1598532_+	ergothioneine biosynthesis protein EgtB	NA	NA	NA	NA	NA
AWW36346.1|1598531_1599323_+	ergothioneine biosynthesis protein EgtC	NA	NA	NA	NA	NA
AWW36347.1|1600203_1601184_+	L-histidine N(alpha)-methyltransferase	NA	NA	NA	NA	NA
AWW36348.1|1602094_1602739_+	hypothetical protein	NA	NA	NA	NA	NA
AWW42314.1|1602841_1604275_+|integrase	integrase	integrase	NA	NA	NA	NA
AWW36349.1|1604271_1606188_+	hypothetical protein	NA	NA	NA	NA	NA
1604488:1604505	attR	GCGGCCCGGACCGGGCCG	NA	NA	NA	NA
AWW36350.1|1606184_1608320_+	hypothetical protein	NA	NA	NA	NA	NA
AWW36351.1|1609010_1609922_-	hypothetical protein	NA	NA	NA	NA	NA
AWW36352.1|1610111_1612928_-	hypothetical protein	NA	NA	NA	NA	NA
AWW36353.1|1612977_1613340_+	hypothetical protein	NA	NA	NA	NA	NA
AWW36354.1|1613788_1614115_+	hypothetical protein	NA	NA	NA	NA	NA
AWW36355.1|1614744_1615449_-	PE-PGRS family protein	NA	NA	NA	NA	NA
AWW36356.1|1615583_1616417_-	hypothetical protein	NA	NA	NA	NA	NA
AWW36357.1|1616322_1622493_-	hypothetical protein	NA	NA	NA	NA	NA
AWW36358.1|1623483_1623978_+	hypothetical protein	NA	NA	NA	NA	NA
AWW36359.1|1624483_1624687_-	hypothetical protein	NA	NA	NA	NA	NA
AWW36360.1|1627144_1627417_+	hypothetical protein	NA	NA	NA	NA	NA
AWW36361.1|1627417_1627744_+	hypothetical protein	NA	NA	NA	NA	NA
AWW36362.1|1627740_1628493_+	hypothetical protein	NA	NA	NA	NA	NA
AWW36363.1|1628537_1629320_-	hypothetical protein	NA	NA	NA	NA	NA
AWW36364.1|1629883_1630879_-	hypothetical protein	NA	NA	NA	NA	NA
AWW42315.1|1631124_1631343_-	hypothetical protein	NA	NA	NA	NA	NA
AWW36365.1|1632631_1634212_+|transposase	IS1182 family transposase	transposase	NA	NA	NA	NA
AWW36366.1|1634419_1635172_+|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
AWW36367.1|1635417_1636608_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
>prophage 5
CP030073	Streptomyces sp. ZFG47 chromosome, complete genome	9269371	7319056	7329155	9269371		Mycobacterium_phage(60.0%)	14	NA	NA
AWW40769.1|7319056_7319842_+	PD-(D/E)XK nuclease family protein	NA	A0A249XU24	Mycobacterium_phage	41.2	1.9e-44
AWW40770.1|7320393_7321182_+	hypothetical protein	NA	A0A2H4PDK6	Mycobacterium_phage	46.7	3.0e-58
AWW40771.1|7321195_7321423_+	hypothetical protein	NA	NA	NA	NA	NA
AWW40772.1|7321503_7321860_+	hypothetical protein	NA	A0A193GYZ0	Escherichia_phage	51.0	1.8e-15
AWW40773.1|7321852_7322056_+	hypothetical protein	NA	NA	NA	NA	NA
AWW40774.1|7322248_7322653_+	hypothetical protein	NA	A0A2H4PRA0	Streptomyces_phage	44.2	2.5e-16
AWW40775.1|7322666_7323131_+	hypothetical protein	NA	A0A1D8EW07	Mycobacterium_phage	45.1	7.7e-30
AWW40776.1|7323123_7323537_+	hypothetical protein	NA	A0A2K9VI50	Mycobacterium_phage	38.2	2.5e-08
AWW40777.1|7323523_7323757_+	hypothetical protein	NA	NA	NA	NA	NA
AWW40778.1|7323938_7324745_+	hypothetical protein	NA	A0A2K9VI72	Mycobacterium_phage	43.8	8.4e-56
AWW40779.1|7325475_7325658_+	hypothetical protein	NA	NA	NA	NA	NA
AWW42774.1|7325668_7327702_+	ribonucleoside-triphosphate reductase, adenosylcobalamin-dependent	NA	G9FHM7	Rhodococcus_virus	59.4	1.4e-229
AWW40780.1|7327857_7328589_+	FAD-dependent thymidylate synthase	NA	A0A1J0GVX7	Streptomyces_phage	63.7	3.6e-66
AWW40781.1|7328729_7329155_+	cell division protein DedD	NA	A0A2P1N569	Mycobacterium_phage	52.9	4.4e-32
>prophage 6
CP030073	Streptomyces sp. ZFG47 chromosome, complete genome	9269371	8896000	8950328	9269371	transposase,tail	Streptomyces_phage(22.22%)	48	NA	NA
AWW41883.1|8896000_8896843_-|transposase	transposase	transposase	U5N3V8	Enterobacteria_phage	41.5	1.9e-50
AWW41884.1|8896842_8898099_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	36.4	6.1e-29
AWW42949.1|8899647_8900289_-	hypothetical protein	NA	NA	NA	NA	NA
AWW41885.1|8900197_8901091_+	RNA polymerase subunit sigma	NA	NA	NA	NA	NA
AWW41886.1|8901370_8902213_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
AWW41887.1|8902597_8903548_-	esterase	NA	K7YHC8	Megavirus	41.0	4.0e-65
AWW42950.1|8904097_8904448_+	hypothetical protein	NA	NA	NA	NA	NA
AWW42951.1|8904685_8906407_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	37.6	5.3e-92
AWW42952.1|8907032_8907776_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AWW42953.1|8907898_8910385_-	protein phosphatase	NA	NA	NA	NA	NA
AWW41888.1|8910815_8911523_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AWW41889.1|8911609_8912947_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
AWW42954.1|8913956_8914541_+	RNA polymerase subunit sigma	NA	NA	NA	NA	NA
AWW42955.1|8914546_8915296_+	anti-sigma factor	NA	NA	NA	NA	NA
AWW42956.1|8915628_8915946_+	hypothetical protein	NA	NA	NA	NA	NA
AWW41890.1|8915976_8917101_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
AWW42957.1|8917176_8917683_-	hypothetical protein	NA	NA	NA	NA	NA
AWW41891.1|8918103_8918283_+	hypothetical protein	NA	NA	NA	NA	NA
AWW41892.1|8918398_8919058_-	fasciclin domain-containing protein	NA	NA	NA	NA	NA
AWW41893.1|8919164_8920802_-	molybdopterin-binding oxidoreductase	NA	NA	NA	NA	NA
AWW41894.1|8920977_8921319_+	hypothetical protein	NA	NA	NA	NA	NA
AWW42958.1|8921608_8923513_+	hypothetical protein	NA	NA	NA	NA	NA
AWW41895.1|8923864_8924494_+	hypothetical protein	NA	NA	NA	NA	NA
AWW41896.1|8924794_8927350_-	ABC transporter	NA	NA	NA	NA	NA
AWW41897.1|8927443_8928253_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.6	2.6e-12
AWW41898.1|8928742_8931055_-	protein translocase subunit SecD	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	35.3	9.2e-31
AWW41899.1|8931663_8932323_-	DNA-binding response regulator	NA	NA	NA	NA	NA
AWW42959.1|8932319_8933276_-	sensor histidine kinase	NA	NA	NA	NA	NA
AWW41900.1|8933655_8933982_+	molecular chaperone DnaK	NA	NA	NA	NA	NA
AWW41901.1|8934031_8934403_+	hypothetical protein	NA	NA	NA	NA	NA
AWW41902.1|8934399_8935224_+	hypothetical protein	NA	NA	NA	NA	NA
AWW41903.1|8935290_8935914_+	hypothetical protein	NA	NA	NA	NA	NA
AWW42960.1|8936328_8936757_-	hypothetical protein	NA	A0A1J0MC67	Streptomyces_phage	62.4	3.9e-20
AWW41904.1|8937066_8938074_-	hypothetical protein	NA	NA	NA	NA	NA
AWW41905.1|8938199_8938742_-	hypothetical protein	NA	NA	NA	NA	NA
AWW41906.1|8938919_8939375_-	peptidoglycan-binding protein	NA	NA	NA	NA	NA
AWW41907.1|8939687_8940485_+	peptidoglycan-binding protein	NA	NA	NA	NA	NA
AWW41908.1|8940481_8941327_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AWW41909.1|8941535_8942423_-	bile acid:sodium symporter family protein	NA	NA	NA	NA	NA
AWW41910.1|8942860_8943421_-	hypothetical protein	NA	NA	NA	NA	NA
AWW41911.1|8943536_8943959_-	ATP-binding protein	NA	A0A1V0E640	Streptomyces_phage	36.3	5.8e-08
AWW41912.1|8944459_8945866_-|transposase	IS1380 family transposase	transposase	A0A222ZN33	Mycobacterium_phage	45.6	2.9e-88
AWW42961.1|8946197_8947061_+	hypothetical protein	NA	NA	NA	NA	NA
AWW41913.1|8947045_8947585_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AWW41914.1|8948028_8948412_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AWW41915.1|8948408_8949164_-	hypothetical protein	NA	NA	NA	NA	NA
AWW41916.1|8949565_8949745_-	hypothetical protein	NA	NA	NA	NA	NA
AWW41917.1|8949830_8950328_-|tail	lamin tail domain-containing protein	tail	NA	NA	NA	NA
>prophage 7
CP030073	Streptomyces sp. ZFG47 chromosome, complete genome	9269371	9044263	9179252	9269371	integrase,transposase,coat	Mycobacterium_phage(35.71%)	107	9146355:9146377	9153511:9153533
AWW41988.1|9044263_9045874_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
AWW42973.1|9046511_9047354_+|transposase	IS5 family transposase	transposase	A0A0M5M147	Mycobacterium_phage	53.8	3.1e-77
AWW41989.1|9047476_9047953_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AWW41990.1|9048014_9048857_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
AWW41991.1|9048888_9049473_-	fasciclin domain-containing protein	NA	NA	NA	NA	NA
AWW41992.1|9051766_9052255_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AWW41993.1|9052523_9052931_+	hypothetical protein	NA	NA	NA	NA	NA
AWW41994.1|9053776_9054301_-	cupin domain-containing protein	NA	NA	NA	NA	NA
AWW41995.1|9054522_9056316_-	FAD-binding monooxygenase	NA	NA	NA	NA	NA
AWW41996.1|9056553_9056937_-	hypothetical protein	NA	NA	NA	NA	NA
AWW41997.1|9057132_9058233_-	hypothetical protein	NA	NA	NA	NA	NA
AWW41998.1|9059076_9059280_+	hypothetical protein	NA	NA	NA	NA	NA
AWW41999.1|9059961_9061554_+	hypothetical protein	NA	NA	NA	NA	NA
AWW42000.1|9062568_9063126_+	hypothetical protein	NA	NA	NA	NA	NA
AWW42001.1|9063409_9064213_+|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
AWW42002.1|9064364_9065015_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
AWW42003.1|9065870_9066122_+	hypothetical protein	NA	NA	NA	NA	NA
AWW42004.1|9066333_9066831_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AWW42005.1|9066887_9069008_+	MMPL family transporter	NA	NA	NA	NA	NA
AWW42006.1|9069345_9069804_-	cupin domain-containing protein	NA	NA	NA	NA	NA
AWW42007.1|9070182_9070950_-	pirin family protein	NA	NA	NA	NA	NA
AWW42008.1|9073702_9074803_+	hypothetical protein	NA	NA	NA	NA	NA
AWW42009.1|9075242_9075545_+	hypothetical protein	NA	NA	NA	NA	NA
AWW42010.1|9075513_9075924_+	hypothetical protein	NA	NA	NA	NA	NA
AWW42011.1|9075937_9076492_+|transposase	transposase	transposase	NA	NA	NA	NA
AWW42974.1|9077942_9078785_+|transposase	IS5 family transposase	transposase	A0A0M5M147	Mycobacterium_phage	53.8	3.1e-77
AWW42012.1|9078804_9079662_-	arylamine N-acetyltransferase	NA	NA	NA	NA	NA
AWW42013.1|9079966_9081469_-	monooxygenase	NA	NA	NA	NA	NA
AWW42014.1|9081817_9082291_+	glyoxalase	NA	NA	NA	NA	NA
AWW42015.1|9082426_9083053_-	hypothetical protein	NA	NA	NA	NA	NA
AWW42016.1|9083049_9086715_-	hypothetical protein	NA	A0A217EQY2	Bacillus_phage	38.3	2.7e-32
AWW42017.1|9087406_9087601_-	hypothetical protein	NA	NA	NA	NA	NA
AWW42018.1|9088119_9088953_+	GlcNAc-PI de-N-acetylase	NA	NA	NA	NA	NA
AWW42019.1|9089072_9089285_-	hypothetical protein	NA	NA	NA	NA	NA
AWW42020.1|9089905_9091111_-	ABC transporter permease	NA	NA	NA	NA	NA
AWW42021.1|9091107_9091797_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	42.4	1.7e-33
AWW42022.1|9091793_9092909_-	peptidoglycan-binding protein	NA	NA	NA	NA	NA
AWW42023.1|9092905_9093205_-	hypothetical protein	NA	NA	NA	NA	NA
AWW42024.1|9093653_9094916_-	sensor histidine kinase	NA	NA	NA	NA	NA
AWW42025.1|9094917_9095646_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	32.5	4.5e-32
AWW42026.1|9096772_9097231_-	cupin domain-containing protein	NA	NA	NA	NA	NA
AWW42027.1|9097850_9098276_-	hypothetical protein	NA	NA	NA	NA	NA
AWW42975.1|9099314_9102632_+	peptidase S8	NA	A0A217EQY2	Bacillus_phage	36.0	5.5e-29
AWW42028.1|9103894_9104932_+	hypothetical protein	NA	NA	NA	NA	NA
AWW42029.1|9105480_9105783_-	hypothetical protein	NA	NA	NA	NA	NA
AWW42030.1|9105907_9106660_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AWW42976.1|9106691_9108050_+	NmrA/HSCARG family protein	NA	NA	NA	NA	NA
AWW42031.1|9108539_9108785_-	hypothetical protein	NA	NA	NA	NA	NA
AWW42032.1|9108832_9110251_-	hypothetical protein	NA	NA	NA	NA	NA
AWW42033.1|9110768_9111152_+	hypothetical protein	NA	NA	NA	NA	NA
AWW42034.1|9111402_9112479_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AWW42035.1|9112270_9112792_+	hypothetical protein	NA	NA	NA	NA	NA
AWW42036.1|9113030_9113432_+	cupin	NA	NA	NA	NA	NA
AWW42037.1|9113515_9114610_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
AWW42038.1|9115180_9115513_+	hypothetical protein	NA	NA	NA	NA	NA
AWW42039.1|9115916_9117323_-|transposase	IS1380 family transposase	transposase	A0A222ZN33	Mycobacterium_phage	45.3	8.5e-88
AWW42040.1|9119713_9120172_+	Mini-circle protein	NA	NA	NA	NA	NA
AWW42977.1|9120387_9121200_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AWW42041.1|9121461_9122544_+	aldo/keto reductase	NA	NA	NA	NA	NA
AWW42042.1|9122596_9123355_+	short chain dehydrogenase	NA	A0A0M4JSW6	Mollivirus	28.1	5.9e-11
AWW42043.1|9123365_9124061_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
AWW42044.1|9124250_9124439_-	hypothetical protein	NA	NA	NA	NA	NA
AWW42045.1|9124746_9125292_-	hypothetical protein	NA	NA	NA	NA	NA
AWW42046.1|9125288_9125846_-	hypothetical protein	NA	NA	NA	NA	NA
AWW42047.1|9126097_9126874_+	aminotransferase	NA	NA	NA	NA	NA
AWW42048.1|9126886_9127804_+	DNA-binding protein	NA	A0A7H6	Microcystis_virus	25.3	3.4e-05
AWW42049.1|9127976_9128204_+	hypothetical protein	NA	NA	NA	NA	NA
AWW42978.1|9129879_9130449_+	hypothetical protein	NA	NA	NA	NA	NA
AWW42050.1|9130991_9131615_-	hypothetical protein	NA	NA	NA	NA	NA
AWW42979.1|9131611_9132265_-	RNA polymerase subunit sigma	NA	NA	NA	NA	NA
AWW42051.1|9132759_9133278_+	hypothetical protein	NA	NA	NA	NA	NA
AWW42052.1|9133361_9133718_-	hypothetical protein	NA	NA	NA	NA	NA
AWW42053.1|9134307_9134586_+	hypothetical protein	NA	NA	NA	NA	NA
AWW42054.1|9134859_9138345_-	hypothetical protein	NA	NA	NA	NA	NA
AWW42980.1|9138889_9146071_+	hypothetical protein	NA	NA	NA	NA	NA
AWW42055.1|9146084_9146282_+	hypothetical protein	NA	NA	NA	NA	NA
9146355:9146377	attL	TGACGGCAGTAGTTGACGGCAAC	NA	NA	NA	NA
AWW42056.1|9146378_9147686_-|integrase	site-specific integrase	integrase	A0A1B0T6A8	Bacillus_phage	33.3	1.2e-38
AWW42057.1|9147685_9147877_-	DNA-binding protein	NA	NA	NA	NA	NA
AWW42982.1|9148338_9148866_+	hypothetical protein	NA	NA	NA	NA	NA
AWW42981.1|9148813_9149608_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AWW42983.1|9151582_9152002_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AWW42058.1|9152772_9153015_+	type IV secretion protein Rhs	NA	NA	NA	NA	NA
AWW42059.1|9153020_9153422_+	hypothetical protein	NA	NA	NA	NA	NA
AWW42060.1|9154185_9154638_-	cyclase	NA	NA	NA	NA	NA
9153511:9153533	attR	TGACGGCAGTAGTTGACGGCAAC	NA	NA	NA	NA
AWW42061.1|9156466_9157609_-	hypothetical protein	NA	NA	NA	NA	NA
AWW42062.1|9157866_9158277_-	hypothetical protein	NA	NA	NA	NA	NA
AWW42063.1|9158331_9158559_+	hypothetical protein	NA	NA	NA	NA	NA
AWW42064.1|9158555_9159278_+	hypothetical protein	NA	NA	NA	NA	NA
AWW42065.1|9159784_9160078_+	hypothetical protein	NA	NA	NA	NA	NA
AWW42066.1|9160080_9161097_+	hypothetical protein	NA	NA	NA	NA	NA
AWW42067.1|9161807_9162329_+	hypothetical protein	NA	NA	NA	NA	NA
AWW42068.1|9162560_9162839_-	hypothetical protein	NA	NA	NA	NA	NA
AWW42069.1|9162895_9164062_-|coat	spore coat protein	coat	NA	NA	NA	NA
AWW42984.1|9164075_9164600_-	MaoC family dehydratase	NA	NA	NA	NA	NA
AWW42070.1|9164608_9165472_-	CoA ester lyase	NA	NA	NA	NA	NA
AWW42071.1|9165468_9166488_-	4-hydroxy-2-oxovalerate aldolase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	39.8	5.2e-55
AWW42072.1|9166484_9167375_-	acetylating acetaldehyde dehydrogenase	NA	E5EQ71	Micromonas_sp._RCC1109_virus	30.7	2.4e-27
AWW42985.1|9167400_9168195_-	hydratase	NA	NA	NA	NA	NA
AWW42073.1|9168240_9169011_-	NUDIX hydrolase	NA	NA	NA	NA	NA
AWW42074.1|9169128_9169584_-	ATP-binding protein	NA	NA	NA	NA	NA
AWW42075.1|9169580_9169991_-	hypothetical protein	NA	NA	NA	NA	NA
AWW42076.1|9170184_9171492_+	hypothetical protein	NA	NA	NA	NA	NA
AWW42077.1|9171502_9172072_+	N-acetyltransferase	NA	NA	NA	NA	NA
AWW42078.1|9172586_9173375_+	hypothetical protein	NA	NA	NA	NA	NA
AWW42986.1|9173332_9174175_-|transposase	IS5 family transposase	transposase	A0A0M5M147	Mycobacterium_phage	53.8	3.1e-77
AWW42079.1|9174409_9175816_+|transposase	IS1380 family transposase	transposase	A0A222ZN33	Mycobacterium_phage	45.8	1.5e-92
AWW42080.1|9178394_9179252_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 1
CP030074	Streptomyces sp. ZFG47 plasmid unnamed1, complete sequence	969901	703841	803806	969901	bacteriocin,transposase,protease	Bacillus_phage(27.27%)	59	NA	NA
AWW43454.1|703841_707669_+|protease	serine protease	protease	A0A217EQY2	Bacillus_phage	36.9	1.6e-27
AWW43455.1|708061_708688_-	FMN-dependent NADH-azoreductase	NA	NA	NA	NA	NA
AWW43456.1|709229_709652_-	organic hydroperoxide resistance protein	NA	NA	NA	NA	NA
AWW43457.1|709792_710008_+	hypothetical protein	NA	NA	NA	NA	NA
AWW43458.1|710110_710362_+	hypothetical protein	NA	NA	NA	NA	NA
AWW43459.1|710358_710754_+	hypothetical protein	NA	NA	NA	NA	NA
AWW43460.1|710911_711565_-	hypothetical protein	NA	NA	NA	NA	NA
AWW43666.1|711561_712182_-	hypothetical protein	NA	NA	NA	NA	NA
AWW43461.1|712633_713893_+	hypothetical protein	NA	NA	NA	NA	NA
AWW43462.1|715537_715954_+	hypothetical protein	NA	NA	NA	NA	NA
AWW43463.1|715950_719826_+	hypothetical protein	NA	NA	NA	NA	NA
AWW43464.1|720498_720870_-	hypothetical protein	NA	NA	NA	NA	NA
AWW43465.1|721696_722287_-	hypothetical protein	NA	NA	NA	NA	NA
AWW43466.1|723025_724588_+	hypothetical protein	NA	NA	NA	NA	NA
AWW43467.1|725037_729825_+	hypothetical protein	NA	A0A2K9KZV5	Tupanvirus	22.0	9.1e-57
AWW43468.1|730148_731039_-	hypothetical protein	NA	NA	NA	NA	NA
AWW43469.1|731386_732571_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
AWW43470.1|732632_733388_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AWW43471.1|733533_733716_+	hypothetical protein	NA	NA	NA	NA	NA
AWW43472.1|733758_735114_-	hypothetical protein	NA	NA	NA	NA	NA
AWW43473.1|735136_735403_-	hypothetical protein	NA	NA	NA	NA	NA
AWW43667.1|736500_738663_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
AWW43474.1|738949_740584_+	endolytic transglycosylase MltG	NA	NA	NA	NA	NA
AWW43475.1|741438_741726_+	WhiB family transcriptional regulator	NA	Q1WDI3	Streptomyces_phage	44.3	1.6e-09
AWW43476.1|742080_743154_+	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L339	Tupanvirus	28.3	6.0e-25
AWW43477.1|743318_744485_-	hypothetical protein	NA	NA	NA	NA	NA
AWW43478.1|746553_746775_+	hypothetical protein	NA	NA	NA	NA	NA
AWW43668.1|746898_750480_-	hypothetical protein	NA	A0A217EQY2	Bacillus_phage	34.2	1.0e-28
AWW43479.1|751579_753076_-	MFS transporter	NA	NA	NA	NA	NA
AWW43480.1|753624_753894_+	hypothetical protein	NA	NA	NA	NA	NA
AWW43481.1|754057_754249_-	hypothetical protein	NA	NA	NA	NA	NA
AWW43482.1|756878_757139_+	hypothetical protein	NA	NA	NA	NA	NA
AWW43483.1|758788_759820_+	LuxR family transcriptional regulator	NA	A0A142K655	Streptomyces_phage	28.0	4.4e-17
AWW43484.1|760505_761942_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
AWW43485.1|761991_763170_-	LacI family transcriptional regulator	NA	NA	NA	NA	NA
AWW43486.1|763187_764306_+	spermidine/putrescine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AWW43487.1|764302_765184_+	ABC transporter permease	NA	NA	NA	NA	NA
AWW43488.1|765180_766071_+	ABC transporter permease	NA	NA	NA	NA	NA
AWW43669.1|766100_767150_+	polyamine ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	35.1	3.3e-28
AWW43489.1|767201_767996_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
AWW43490.1|768075_768483_+	glyoxalase/bleomycin resistance/dioxygenase family protein	NA	NA	NA	NA	NA
AWW43491.1|768479_769289_+	ribulose phosphate epimerase	NA	NA	NA	NA	NA
AWW43492.1|769285_770443_+	peptidase C45	NA	NA	NA	NA	NA
AWW43493.1|770941_772198_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AWW43494.1|772211_773702_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
AWW43495.1|776714_777065_+	hypothetical protein	NA	NA	NA	NA	NA
AWW43496.1|777296_780065_+	hypothetical protein	NA	NA	NA	NA	NA
AWW43497.1|780311_780581_+	hypothetical protein	NA	NA	NA	NA	NA
AWW43498.1|780888_781089_-	hypothetical protein	NA	NA	NA	NA	NA
AWW43499.1|781512_781803_-	hypothetical protein	NA	NA	NA	NA	NA
AWW43500.1|782242_783511_+	hypothetical protein	NA	NA	NA	NA	NA
AWW43501.1|783749_784955_+	hypothetical protein	NA	NA	NA	NA	NA
AWW43502.1|785491_785950_-	hypothetical protein	NA	NA	NA	NA	NA
AWW43503.1|791485_792577_+	hypothetical protein	NA	NA	NA	NA	NA
AWW43504.1|792638_794825_+|bacteriocin	NHLP family bacteriocin export ABC transporter peptidase/permease/ATPase subunit	bacteriocin	W8CYL7	Bacillus_phage	27.3	1.4e-28
AWW43505.1|794827_797764_+|bacteriocin	NHLP bacteriocin export ABC transporter permease/ATPase subunit	bacteriocin	F2Y2R6	Organic_Lake_phycodnavirus	26.9	1.3e-13
AWW43506.1|798480_798789_+	hypothetical protein	NA	NA	NA	NA	NA
AWW43507.1|802622_802922_+	hypothetical protein	NA	Q9ETV7	Enterobacteria_phage	41.0	4.1e-08
AWW43508.1|802918_803806_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	31.4	9.3e-32
>prophage 2
CP030074	Streptomyces sp. ZFG47 plasmid unnamed1, complete sequence	969901	883691	951655	969901	transposase	Mycobacterium_phage(28.57%)	40	NA	NA
AWW43544.1|883691_885098_+|transposase	IS1380 family transposase	transposase	A0A222ZN33	Mycobacterium_phage	45.8	4.3e-92
AWW43545.1|885812_886214_-	hypothetical protein	NA	NA	NA	NA	NA
AWW43546.1|886899_887343_+	hypothetical protein	NA	NA	NA	NA	NA
AWW43547.1|887506_888574_+	hypothetical protein	NA	NA	NA	NA	NA
AWW43548.1|888812_889118_-	hypothetical protein	NA	NA	NA	NA	NA
AWW43549.1|889593_890496_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AWW43550.1|890669_891440_+	SDR family NAD(P)-dependent oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	26.3	2.1e-08
AWW43551.1|893211_893619_-	hypothetical protein	NA	NA	NA	NA	NA
AWW43552.1|896528_897361_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AWW43553.1|898912_899485_+	hypothetical protein	NA	NA	NA	NA	NA
AWW43674.1|901170_902814_+	maturase	NA	NA	NA	NA	NA
AWW43554.1|903146_903533_-	hypothetical protein	NA	NA	NA	NA	NA
AWW43555.1|904015_905197_-	hypothetical protein	NA	NA	NA	NA	NA
AWW43556.1|905199_906480_-	hypothetical protein	NA	NA	NA	NA	NA
AWW43557.1|908112_908307_+	hypothetical protein	NA	NA	NA	NA	NA
AWW43558.1|908825_910013_+	hypothetical protein	NA	NA	NA	NA	NA
AWW43559.1|910182_911418_+	hypothetical protein	NA	NA	NA	NA	NA
AWW43560.1|911454_911622_+	hypothetical protein	NA	NA	NA	NA	NA
AWW43675.1|911717_912560_+|transposase	IS5 family transposase	transposase	A0A0M5M147	Mycobacterium_phage	53.1	2.6e-76
AWW43561.1|916592_919499_+	CRISPR-associated endonuclease Cas3''	NA	NA	NA	NA	NA
AWW43676.1|919942_921523_+	type I-E CRISPR-associated protein Cse1/CasA	NA	NA	NA	NA	NA
AWW43562.1|921509_922121_+	CRISPR-associated protein Cse2	NA	NA	NA	NA	NA
AWW43563.1|922120_923314_+	type I-E CRISPR-associated protein Cas7/Cse4/CasC	NA	NA	NA	NA	NA
AWW43564.1|923310_924102_+	type I-E CRISPR-associated protein Cas5/CasD	NA	NA	NA	NA	NA
AWW43565.1|924098_924770_+	type I-E CRISPR-associated protein Cas6/Cse3/CasE	NA	NA	NA	NA	NA
AWW43566.1|924815_926462_+	recombinase	NA	B5TA80	Burkholderia_phage	25.1	7.3e-06
AWW43567.1|926445_927225_+	ATP-binding protein	NA	NA	NA	NA	NA
AWW43568.1|927649_928750_+	DNA processing protein DprA	NA	NA	NA	NA	NA
AWW43569.1|928739_929963_+	hypothetical protein	NA	NA	NA	NA	NA
AWW43570.1|930200_930917_-	hypothetical protein	NA	NA	NA	NA	NA
AWW43571.1|930897_931461_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
AWW43572.1|931453_931678_-	hypothetical protein	NA	NA	NA	NA	NA
AWW43573.1|931836_932247_+	hypothetical protein	NA	NA	NA	NA	NA
AWW43574.1|933194_933524_+	hypothetical protein	NA	NA	NA	NA	NA
AWW43575.1|933525_934836_+	MFS transporter	NA	NA	NA	NA	NA
AWW43576.1|935837_936680_-|transposase	transposase	transposase	U5N3V8	Enterobacteria_phage	41.5	1.9e-50
AWW43577.1|936679_937936_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	36.4	6.1e-29
AWW43578.1|939669_943281_+	LamG domain-containing protein	NA	NA	NA	NA	NA
AWW43579.1|943469_950039_+	RHS repeat-associated core domain-containing protein	NA	NA	NA	NA	NA
AWW43580.1|950983_951655_+|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	36.8	1.7e-17
