The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP021964	Lactobacillus fermentum strain CBA7106 chromosome, complete genome	2042277	22165	72421	2042277	protease,transposase	Acanthocystis_turfacea_Chlorella_virus(13.33%)	39	NA	NA
AWV29307.1|22165_23437_+|protease	serine protease	protease	A0A1B1IT49	uncultured_Mediterranean_phage	29.3	5.8e-19
AWV29308.1|23944_24424_+	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
AWV29309.1|24638_25064_+	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
AWV29310.1|25069_26005_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
AWV29311.1|26384_27728_+	MFS transporter	NA	NA	NA	NA	NA
AWV29312.1|27740_29987_+	family 65 glycosyl hydrolase	NA	NA	NA	NA	NA
AWV29313.1|30133_30802_+	beta-phosphoglucomutase	NA	NA	NA	NA	NA
AWV29314.1|30884_31550_-	sodium ABC transporter	NA	NA	NA	NA	NA
AWV29315.1|31600_32578_-	choloylglycine hydrolase	NA	M1H9I8	Acanthocystis_turfacea_Chlorella_virus	25.4	2.5e-14
AWV29316.1|32632_33568_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
AWV29317.1|33870_34863_-	lactate dehydrogenase	NA	M1HKI4	Acanthocystis_turfacea_Chlorella_virus	32.7	3.7e-37
AWV29318.1|34878_36063_-	aromatic amino acid aminotransferase	NA	NA	NA	NA	NA
AWV29319.1|36411_36642_+	transcriptional regulator	NA	NA	NA	NA	NA
AWV29320.1|36756_38850_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	H6X3M6	Enterobacteria_phage	40.6	3.0e-121
AWV29321.1|39150_40611_+	cardiolipin synthase	NA	NA	NA	NA	NA
AWV29322.1|41093_44831_+	ATP-dependent helicase	NA	NA	NA	NA	NA
AWV29323.1|44837_48851_+	helicase-exonuclease AddAB subunit AddA	NA	S5MMD7	Bacillus_phage	23.2	9.7e-12
AWV29324.1|48850_49714_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	46.4	4.3e-58
AWV29325.1|49951_51577_+	glycerophosphodiester phosphodiesterase	NA	NA	NA	NA	NA
AWV29326.1|51870_52227_-	arsenate reductase	NA	NA	NA	NA	NA
AWV29327.1|52265_53381_-	antibiotic ABC transporter permease	NA	NA	NA	NA	NA
AWV29328.1|53373_54105_-	glycosyl transferase family 2	NA	A0A2H4PQG7	Staphylococcus_phage	32.7	1.4e-25
AWV29329.1|54243_54798_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AWV29330.1|54878_55853_-	GMP reductase	NA	Q4ZCY7	Staphylococcus_virus	68.7	1.9e-134
AWV29331.1|56050_57340_+	adenylosuccinate synthetase	NA	A0A285PX35	Cedratvirus	36.2	3.9e-71
AWV29332.1|57667_59050_+	succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
AWV29333.1|59333_59873_+	bifunctional pyrimidine operon transcriptional regulator/uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
AWV29334.1|59991_60723_+	orotidine-5'-phosphate decarboxylase	NA	NA	NA	NA	NA
AWV29335.1|60722_61349_+	orotate phosphoribosyltransferase	NA	S4VS55	Pandoravirus	38.6	2.8e-35
AWV29336.1|61715_62171_-|transposase	IS200/IS605 family transposase	transposase	A0A0P0IQC6	Lactobacillus_phage	50.7	9.5e-33
AWV29337.1|62244_63495_+|transposase	transposase	transposase	A0A286QQE5	Streptococcus_phage	37.0	2.0e-56
AWV29338.1|64010_64442_-	hypothetical protein	NA	NA	NA	NA	NA
AWV29339.1|64545_66084_+	poly(glycerol-phosphate) alpha-glucosyltransferase	NA	NA	NA	NA	NA
AWV29340.1|66083_67580_+	poly(glycerol-phosphate) alpha-glucosyltransferase	NA	NA	NA	NA	NA
AWV29341.1|67989_68832_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AWV29342.1|68857_69922_+	methionine ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.8	5.7e-28
AWV29343.1|69914_70616_+	methionine ABC transporter permease	NA	NA	NA	NA	NA
AWV29344.1|70823_71261_+|transposase	IS200/IS605 family transposase	transposase	A0A1P8BMC0	Lactococcus_phage	71.0	9.1e-49
AWV29345.1|71257_72421_+|transposase	transposase	transposase	Q5ULQ4	Lactobacillus_virus	71.7	1.8e-160
>prophage 2
CP021964	Lactobacillus fermentum strain CBA7106 chromosome, complete genome	2042277	82620	137608	2042277	transposase,tRNA	Lactobacillus_phage(23.81%)	51	NA	NA
AWV29354.1|82620_83073_-|transposase	IS200/IS605 family transposase	transposase	A0A0P0IQC6	Lactobacillus_phage	51.5	2.8e-32
AWV29355.1|83151_84402_+|transposase	transposase	transposase	A0A286QQE5	Streptococcus_phage	37.0	2.0e-56
AWV29356.1|84614_85748_+	exonuclease sbcCD subunit D	NA	NA	NA	NA	NA
AWV29357.1|85744_88849_+	exonuclease SbcC	NA	NA	NA	NA	NA
AWV29358.1|89136_90435_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.8	6.2e-93
AWV29359.1|90920_91934_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
AWV29360.1|92191_93445_-|tRNA	tyrosine--tRNA ligase	tRNA	A0A1L2CUL7	Pectobacterium_phage	42.2	1.3e-84
AWV29361.1|93912_95367_+	glutamine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AWV29362.1|95370_96114_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	41.1	5.4e-33
AWV29363.1|96620_97994_+	amino acid permease	NA	NA	NA	NA	NA
AWV29364.1|98317_99568_-|transposase	transposase	transposase	A0A286QQE5	Streptococcus_phage	36.5	1.1e-57
AWV29365.1|99646_100099_+|transposase	IS200/IS605 family transposase	transposase	A0A0P0IQC6	Lactobacillus_phage	51.5	2.8e-32
AWV29366.1|100879_102079_+	NupC/NupG family nucleoside CNT transporter	NA	NA	NA	NA	NA
AWV29367.1|102313_103234_+	ribonucleoside hydrolase RihC	NA	NA	NA	NA	NA
AWV31099.1|103422_104160_+	16S rRNA methyltransferase G	NA	NA	NA	NA	NA
AWV29368.1|104178_105114_+	chromosome partitioning protein ParB	NA	I3NLC2	Bifidobacterium_phage	33.6	8.0e-10
AWV29369.1|105127_105961_+	chromosome partitioning protein ParB	NA	I3NLC2	Bifidobacterium_phage	32.9	2.3e-16
AWV29370.1|105973_106174_+	DUF951 domain-containing protein	NA	NA	NA	NA	NA
AWV29371.1|106189_107287_+	GTP-binding protein YchF	NA	NA	NA	NA	NA
AWV29372.1|107320_108094_+	hypothetical protein	NA	NA	NA	NA	NA
AWV29373.1|108365_109508_+	guanosine monophosphate reductase	NA	A0A1V0SHK8	Klosneuvirus	32.4	2.5e-58
AWV29374.1|109855_110848_+	transcriptional regulator	NA	NA	NA	NA	NA
AWV29375.1|110847_111618_+	exopolysaccharide biosynthesis protein	NA	NA	NA	NA	NA
AWV29376.1|111634_112375_+	exopolysaccharide biosynthesis protein	NA	NA	NA	NA	NA
AWV29377.1|112398_113169_+	exopolysaccharide biosynthesis protein	NA	NA	NA	NA	NA
AWV29378.1|113199_114141_+	epimerase	NA	A0A1V0SAI6	Catovirus	36.3	6.6e-44
AWV29379.1|114094_114784_+	UDP-phosphate N-acetylgalactosaminyl-1-phosphate transferase	NA	NA	NA	NA	NA
AWV29380.1|114820_115654_+	glycosyl transferase	NA	NA	NA	NA	NA
AWV29381.1|115695_115893_+	hypothetical protein	NA	NA	NA	NA	NA
AWV29382.1|115945_116836_-	hypothetical protein	NA	Q6J1X2	Lactobacillus_phage	98.2	6.6e-155
AWV29383.1|116841_117093_-|transposase	IS3 family transposase	transposase	Q6J1X3	Lactobacillus_phage	96.4	9.2e-38
AWV29384.1|117207_118305_+	hypothetical protein	NA	NA	NA	NA	NA
AWV29385.1|119255_119756_+	hypothetical protein	NA	NA	NA	NA	NA
AWV29386.1|119781_120897_+	hypothetical protein	NA	NA	NA	NA	NA
AWV29387.1|121160_121367_+	hypothetical protein	NA	NA	NA	NA	NA
AWV29388.1|121373_122315_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	30.7	6.4e-31
AWV29389.1|122332_123448_+	hypothetical protein	NA	NA	NA	NA	NA
AWV29390.1|123516_125097_+	hypothetical protein	NA	NA	NA	NA	NA
AWV29391.1|125108_125399_+	hypothetical protein	NA	NA	NA	NA	NA
AWV29392.1|126184_127063_-|transposase	transposase	transposase	A0A1P8CWQ3	Bacillus_phage	36.4	2.0e-42
AWV29393.1|127086_127374_-|transposase	transposase	transposase	NA	NA	NA	NA
AWV29394.1|128048_128801_-	glycosyl transferase	NA	L7RBS6	Acanthamoeba_polyphaga_moumouvirus	30.3	6.1e-08
AWV29395.1|128971_129913_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	30.4	7.0e-30
AWV29396.1|130182_130689_-	cupin	NA	NA	NA	NA	NA
AWV31100.1|130885_131575_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	36.3	3.1e-35
AWV29397.1|131772_132915_+	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	29.8	3.8e-30
AWV29398.1|132914_134210_+	peptidase S11	NA	NA	NA	NA	NA
AWV29399.1|134425_135286_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
AWV29400.1|135295_135715_+	AzlD domain-containing protein	NA	NA	NA	NA	NA
AWV29401.1|135826_136279_-|transposase	IS200/IS605 family transposase	transposase	A0A0P0IQC6	Lactobacillus_phage	51.5	2.8e-32
AWV29402.1|136357_137608_+|transposase	transposase	transposase	A0A286QQE5	Streptococcus_phage	36.0	6.9e-57
>prophage 3
CP021964	Lactobacillus fermentum strain CBA7106 chromosome, complete genome	2042277	416263	422565	2042277	protease,transposase	Streptococcus_phage(50.0%)	7	NA	NA
AWV29641.1|416263_417133_+	RNase adaptor protein RapZ	NA	A0A0R8VB27	Thermobifida_phage	30.8	8.3e-09
AWV29642.1|417154_418132_+	gluconeogenesis factor	NA	A1IMD5	Streptococcus_phage	54.0	2.7e-93
AWV29643.1|418149_419088_+	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	36.8	2.3e-49
AWV29644.1|419208_419856_-	thiaminase II	NA	NA	NA	NA	NA
AWV29645.1|420046_421297_-|transposase	transposase	transposase	A0A286QQE5	Streptococcus_phage	37.0	2.0e-56
AWV29646.1|421375_421828_+|transposase	IS200/IS605 family transposase	transposase	A0A0P0IQC6	Lactobacillus_phage	51.5	2.8e-32
AWV29647.1|421974_422565_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	56.8	3.6e-56
>prophage 4
CP021964	Lactobacillus fermentum strain CBA7106 chromosome, complete genome	2042277	660702	746890	2042277	tRNA,protease,transposase,integrase	Lactobacillus_phage(12.5%)	83	672734:672749	723054:723133
AWV29869.1|660702_661953_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	57.1	3.7e-135
AWV29870.1|661966_662560_+	GTP-binding protein	NA	NA	NA	NA	NA
AWV29871.1|662559_662859_+	nucleotide pyrophosphohydrolase	NA	A0A1S7FYY8	Listeria_phage	51.5	6.9e-24
AWV29872.1|663459_664206_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.8	1.4e-28
AWV29873.1|664483_666295_+	excinuclease ABC subunit C	NA	NA	NA	NA	NA
AWV29874.1|666359_667667_+	GTPase ObgE	NA	NA	NA	NA	NA
AWV29875.1|667693_668626_+	ribonuclease Z	NA	NA	NA	NA	NA
AWV29876.1|668646_669486_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
AWV29877.1|669558_671856_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	29.3	2.6e-70
AWV29878.1|671869_672397_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	44.0	2.3e-30
AWV29879.1|672728_673106_+	DUF4440 domain-containing protein	NA	NA	NA	NA	NA
672734:672749	attL	GAGAAGCGATGAAGAA	NA	NA	NA	NA
AWV29880.1|673185_674184_-	lactate dehydrogenase	NA	M1H502	Paramecium_bursaria_Chlorella_virus	36.3	7.7e-51
672734:672749	attL	GAGAAGCGATGAAGAA	NA	NA	NA	NA
AWV29881.1|674686_675496_+	2-keto-4-pentenoate hydratase	NA	NA	NA	NA	NA
AWV29882.1|675843_676266_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
AWV29883.1|676268_676805_+	NAD(P)H oxidoreductase	NA	NA	NA	NA	NA
AWV29884.1|676815_677097_+	hypothetical protein	NA	NA	NA	NA	NA
AWV29885.1|677096_677426_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
AWV29886.1|677773_678082_-	hypothetical protein	NA	NA	NA	NA	NA
AWV29887.1|678783_679131_-	transcriptional regulator	NA	E9LUL4	Lactobacillus_phage	41.8	3.0e-10
AWV29888.1|679282_680374_-	glycerol dehydrogenase	NA	NA	NA	NA	NA
AWV29889.1|680632_680812_+	hypothetical protein	NA	NA	NA	NA	NA
AWV29890.1|681174_682035_+	short-chain dehydrogenase	NA	NA	NA	NA	NA
AWV29891.1|682090_682336_-	hypothetical protein	NA	NA	NA	NA	NA
AWV29892.1|682867_684055_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	28.8	1.7e-36
AWV29893.1|684077_684425_+	hypothetical protein	NA	A0A0K2CZ57	Paenibacillus_phage	59.0	2.4e-20
AWV29894.1|684573_686163_-	asparagine synthetase B	NA	L7RC73	Acanthamoeba_polyphaga_moumouvirus	40.3	3.1e-102
AWV29895.1|688478_688919_-	hypothetical protein	NA	NA	NA	NA	NA
AWV29896.1|688929_689919_-	LacI family transcriptional regulator	NA	NA	NA	NA	NA
AWV29897.1|689940_690387_-	nucleoside 2-deoxyribosyltransferase	NA	A0A1D3SPR3	Enterococcus_phage	36.7	2.4e-20
AWV29898.1|690504_691125_+	hypothetical protein	NA	NA	NA	NA	NA
AWV29899.1|691369_692455_-|integrase	site-specific integrase	integrase	A0A0M9JJ77	Lactobacillus_phage	53.8	2.0e-105
AWV29900.1|692562_693075_-	hypothetical protein	NA	E9LUL0	Lactobacillus_phage	97.1	1.5e-66
692873:692888	attR	TTCTTCATCGCTTCTC	NA	NA	NA	NA
AWV29901.1|693801_694800_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	38.4	1.7e-50
692873:692888	attR	TTCTTCATCGCTTCTC	NA	NA	NA	NA
AWV29902.1|694890_696177_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
AWV29903.1|696186_696660_-	hypothetical protein	NA	NA	NA	NA	NA
AWV29904.1|697091_698015_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.3	3.7e-31
AWV29905.1|698324_699923_+	amino acid:proton symporter	NA	NA	NA	NA	NA
AWV29906.1|699933_700113_-	hypothetical protein	NA	NA	NA	NA	NA
AWV29907.1|700130_701054_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.3	3.7e-31
AWV29908.1|701176_701752_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AWV29909.1|702274_702637_+	hypothetical protein	NA	NA	NA	NA	NA
AWV31107.1|702905_703520_+|transposase	transposase	transposase	A0A0C5AJ29	Paenibacillus_phage	37.5	9.6e-28
AWV29910.1|703516_704362_+|integrase	integrase	integrase	NA	NA	NA	NA
AWV29911.1|704470_704791_-	hypothetical protein	NA	NA	NA	NA	NA
AWV29912.1|704919_706143_+	hypothetical protein	NA	NA	NA	NA	NA
AWV29913.1|706164_707499_-	amino acid transporter	NA	NA	NA	NA	NA
AWV29914.1|707588_708278_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	51.8	1.3e-60
AWV29915.1|708652_709999_+	MFS transporter	NA	NA	NA	NA	NA
AWV29916.1|709998_711765_+	alpha-glycosidase	NA	NA	NA	NA	NA
AWV31108.1|712428_712863_+	hypothetical protein	NA	NA	NA	NA	NA
AWV29917.1|713032_715846_-	methylase	NA	Q6NE04	Leptospira_phage	35.5	1.2e-152
AWV29918.1|716008_716566_+	transcriptional regulator	NA	NA	NA	NA	NA
AWV29919.1|716820_716973_-|transposase	transposase	transposase	NA	NA	NA	NA
AWV29920.1|717060_717864_-	hypothetical protein	NA	NA	NA	NA	NA
AWV29921.1|718194_718377_+	hypothetical protein	NA	NA	NA	NA	NA
AWV29922.1|718373_719552_+	DNA-binding protein	NA	NA	NA	NA	NA
AWV29923.1|719925_720540_+	Pin-related site-specific recombinase/DNA invertase	NA	A0A1V0E035	Clostridioides_phage	34.9	1.1e-20
AWV29924.1|720663_721680_-|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	33.1	6.0e-35
AWV29925.1|721892_722402_+	hypothetical protein	NA	NA	NA	NA	NA
AWV29926.1|723335_723590_-	hypothetical protein	NA	NA	NA	NA	NA
AWV29927.1|723814_724495_+	serine dehydratase	NA	NA	NA	NA	NA
AWV29928.1|724495_725383_+	L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha	NA	NA	NA	NA	NA
AWV29929.1|725379_725694_+	DNA methyltransferase	NA	NA	NA	NA	NA
AWV29930.1|726166_726475_+	hypothetical protein	NA	NA	NA	NA	NA
AWV29931.1|729500_730511_+	mucin-binding protein	NA	NA	NA	NA	NA
AWV29932.1|730878_731613_-	lactate utilization protein C	NA	NA	NA	NA	NA
AWV29933.1|731605_733123_-	iron-sulfur cluster-binding protein	NA	NA	NA	NA	NA
AWV29934.1|733123_733930_-	Fe-S oxidoreductase	NA	NA	NA	NA	NA
AWV29935.1|734182_735352_+	hydroxymethylglutaryl-CoA synthase	NA	NA	NA	NA	NA
AWV29936.1|735700_736327_-	LexA repressor	NA	A0A1B2APZ1	Phage_Wrath	52.9	6.6e-16
AWV29937.1|736482_736734_+	DUF896 family protein	NA	NA	NA	NA	NA
AWV29938.1|736810_737038_+	hypothetical protein	NA	NA	NA	NA	NA
AWV29939.1|737104_737737_-	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
AWV29940.1|737832_738585_+|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
AWV29941.1|738577_738868_+	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
AWV29942.1|739021_739801_+	30S ribosomal protein S2	NA	NA	NA	NA	NA
AWV29943.1|739891_740770_+	elongation factor Ts	NA	NA	NA	NA	NA
AWV29944.1|740851_741577_+	UMP kinase	NA	NA	NA	NA	NA
AWV29945.1|741573_742137_+	ribosome recycling factor	NA	NA	NA	NA	NA
AWV29946.1|742263_743037_+	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	34.6	1.1e-17
AWV29947.1|743053_743842_+	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
AWV29948.1|743863_745135_+|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
AWV29949.1|745168_746890_+|tRNA	proline--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	25.3	1.8e-07
>prophage 5
CP021964	Lactobacillus fermentum strain CBA7106 chromosome, complete genome	2042277	765376	824508	2042277	transposase,tRNA	Streptococcus_phage(25.0%)	55	NA	NA
AWV29963.1|765376_766273_+|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
AWV29964.1|766283_767249_+	bifunctional riboflavin kinase/FMN adenylyltransferase	NA	NA	NA	NA	NA
AWV29965.1|767363_768752_+	MFS transporter	NA	NA	NA	NA	NA
AWV31109.1|768870_769341_+|transposase	transposase	transposase	A0A0C5AJ29	Paenibacillus_phage	30.5	1.1e-15
AWV29966.1|770243_771122_-|transposase	transposase	transposase	A0A1P8CWQ3	Bacillus_phage	36.4	2.0e-42
AWV29967.1|771145_771433_-|transposase	transposase	transposase	NA	NA	NA	NA
AWV29968.1|771556_771736_+	hypothetical protein	NA	NA	NA	NA	NA
AWV29969.1|772123_773461_-	MFS transporter	NA	NA	NA	NA	NA
AWV29970.1|773469_775164_-	glucohydrolase	NA	NA	NA	NA	NA
AWV29971.1|775321_776308_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
AWV29972.1|777156_777756_+	hypothetical protein	NA	NA	NA	NA	NA
AWV29973.1|777736_778054_+	acetyl-CoA carboxylase	NA	NA	NA	NA	NA
AWV29974.1|778206_779379_+	1,3-propanediol dehydrogenase	NA	NA	NA	NA	NA
AWV29975.1|781021_781987_+	2-dehydropantoate 2-reductase	NA	NA	NA	NA	NA
AWV29976.1|782378_782732_-	hypothetical protein	NA	NA	NA	NA	NA
AWV29977.1|782744_783356_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
AWV29978.1|783530_784859_-	D-serine ammonia-lyase	NA	NA	NA	NA	NA
AWV29979.1|785148_786549_-	amino acid permease	NA	NA	NA	NA	NA
AWV29980.1|786815_787103_+|transposase	transposase	transposase	NA	NA	NA	NA
AWV29981.1|787126_788005_+|transposase	transposase	transposase	A0A1P8CWQ3	Bacillus_phage	36.1	1.7e-41
AWV29982.1|788845_789211_-	hypothetical protein	NA	NA	NA	NA	NA
AWV29983.1|789336_790383_+	heat-inducible transcriptional repressor HrcA	NA	NA	NA	NA	NA
AWV29984.1|790393_790981_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
AWV29985.1|791018_792875_+	molecular chaperone DnaK	NA	A0A2P1EIW2	Megavirus	45.5	3.2e-135
AWV29986.1|792986_794147_+	molecular chaperone DnaJ	NA	A0A1V0SBY2	Catovirus	27.0	5.3e-19
AWV29987.1|795314_795881_+	hypothetical protein	NA	NA	NA	NA	NA
AWV29988.1|796088_796928_+	histidinol-phosphatase	NA	NA	NA	NA	NA
AWV29989.1|797249_798410_+	ATP phosphoribosyltransferase regulatory subunit	NA	NA	NA	NA	NA
AWV29990.1|798402_799017_+	ATP phosphoribosyltransferase	NA	NA	NA	NA	NA
AWV29991.1|799018_800302_+	histidinol dehydrogenase	NA	NA	NA	NA	NA
AWV29992.1|800303_800888_+	imidazoleglycerol-phosphate dehydratase	NA	NA	NA	NA	NA
AWV29993.1|800887_801496_+	imidazole glycerol phosphate synthase subunit HisH	NA	NA	NA	NA	NA
AWV29994.1|801492_802218_+	1-(5-phosphoribosyl)-5-((5- phosphoribosylamino)methylideneamino)imidazole-4- carboxamide isomerase	NA	NA	NA	NA	NA
AWV29995.1|802207_802993_+	imidazole glycerol phosphate synthase cyclase subunit	NA	NA	NA	NA	NA
AWV29996.1|802962_803280_+	phosphoribosyl-AMP cyclohydrolase	NA	NA	NA	NA	NA
AWV29997.1|803281_803602_+	phosphoribosyl-ATP pyrophosphatase	NA	NA	NA	NA	NA
AWV29998.1|803614_804700_+	histidinol-phosphate transaminase	NA	A0A1X6WGT4	Pacmanvirus	23.5	1.0e-11
AWV29999.1|804767_806600_+	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	26.1	2.5e-23
AWV30000.1|807112_807616_-	hypothetical protein	NA	NA	NA	NA	NA
AWV30001.1|807651_808275_-	fructose-2,6-bisphosphatase	NA	NA	NA	NA	NA
AWV30002.1|808369_809389_+	aldo/keto reductase	NA	NA	NA	NA	NA
AWV30003.1|809647_810721_+	phosphoserine transaminase	NA	M1Q1P2	Streptococcus_phage	48.2	5.3e-90
AWV30004.1|810732_811908_+	3-phosphoglycerate dehydrogenase	NA	M1NSB9	Streptococcus_phage	41.2	1.1e-88
AWV30005.1|812047_813799_+	hypothetical protein	NA	NA	NA	NA	NA
AWV30006.1|813836_814292_+	transcriptional regulator	NA	NA	NA	NA	NA
AWV30007.1|814452_814923_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	43.4	2.0e-25
AWV30008.1|814915_816109_-	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.4	1.4e-96
AWV30009.1|816095_816704_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	39.1	4.7e-27
AWV30010.1|816703_817762_-	riboflavin biosynthesis protein RibD	NA	A0A2H4PQS8	Staphylococcus_phage	33.9	3.4e-41
AWV30011.1|818171_818657_-	flavodoxin	NA	NA	NA	NA	NA
AWV30012.1|818717_819752_-	histidine kinase	NA	A0A1B0VMK3	Pseudomonas_phage	25.6	1.2e-06
AWV31110.1|820352_820931_+	hypothetical protein	NA	NA	NA	NA	NA
AWV30013.1|821264_822437_+	cysteine desulfurase NifS	NA	NA	NA	NA	NA
AWV30014.1|822726_823179_-|transposase	IS200/IS605 family transposase	transposase	A0A0P0IQC6	Lactobacillus_phage	50.8	1.0e-31
AWV30015.1|823257_824508_+|transposase	transposase	transposase	A0A286QQE5	Streptococcus_phage	37.0	4.0e-57
>prophage 6
CP021964	Lactobacillus fermentum strain CBA7106 chromosome, complete genome	2042277	960528	1108610	2042277	transposase,integrase	Lactobacillus_phage(15.0%)	132	988247:988263	1003304:1003320
AWV30147.1|960528_961716_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	28.8	9.8e-37
AWV30148.1|961726_962977_-|transposase	transposase	transposase	A0A286QQE5	Streptococcus_phage	36.4	7.1e-54
AWV30149.1|963050_963506_+|transposase	IS200/IS605 family transposase	transposase	A0A0P0IQC6	Lactobacillus_phage	50.0	2.8e-32
AWV30150.1|964082_964205_-	Cloride channel-like protein	NA	NA	NA	NA	NA
AWV30151.1|964234_964543_-	hypothetical protein	NA	NA	NA	NA	NA
AWV30152.1|965073_966300_+	NAD/NADP octopine/nopaline dehydrogenase	NA	NA	NA	NA	NA
AWV30153.1|967045_968524_-	arginine:ornithine antiporter	NA	NA	NA	NA	NA
AWV30154.1|968681_969713_-	branched chain amino acid aminotransferase	NA	NA	NA	NA	NA
AWV31114.1|970350_970992_-	galactoside O-acetyltransferase	NA	NA	NA	NA	NA
AWV30155.1|971747_972260_-	hypothetical protein	NA	NA	NA	NA	NA
AWV30156.1|972651_973209_-	adenine phosphoribosyltransferase	NA	NA	NA	NA	NA
AWV30157.1|973553_974930_+	MFS transporter	NA	NA	NA	NA	NA
AWV30158.1|975099_976167_+	ornithine cyclodeaminase	NA	NA	NA	NA	NA
AWV30159.1|976178_977315_+	aminotransferase	NA	A0A1X6WGT4	Pacmanvirus	23.8	9.8e-10
AWV30160.1|977851_978061_+	hypothetical protein	NA	NA	NA	NA	NA
AWV30161.1|979960_980485_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AWV30162.1|980596_980779_-	hypothetical protein	NA	NA	NA	NA	NA
AWV30163.1|980832_981759_+	hypothetical protein	NA	NA	NA	NA	NA
AWV30164.1|981792_982665_-	MFS transporter	NA	A0A1V0SDE7	Indivirus	31.5	6.5e-30
AWV30165.1|982757_983243_-	ECF transporter S component	NA	NA	NA	NA	NA
AWV30166.1|983258_984089_-	pyridoxal kinase	NA	NA	NA	NA	NA
AWV30167.1|986294_987374_+	tyrosine recombinase XerS	NA	A0A0E3XA96	Gordonia_phage	30.0	1.6e-06
AWV30168.1|987375_988302_+	choloylglycine hydrolase	NA	NA	NA	NA	NA
988247:988263	attL	TGCCAGCCTTGATGGCT	NA	NA	NA	NA
AWV30169.1|988329_989508_-	plastocyanin	NA	NA	NA	NA	NA
AWV30170.1|989933_990986_+	butanediol dehydrogenase	NA	A0A2K9L7I1	Tupanvirus	25.9	7.9e-14
AWV30171.1|991078_992038_-	quinone oxidoreductase	NA	NA	NA	NA	NA
AWV30172.1|992053_992683_-	glycine/betaine ABC transporter permease	NA	NA	NA	NA	NA
AWV30173.1|992679_993447_-	glycine/betaine ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.1	3.4e-22
AWV30174.1|993427_994072_-	glycine/betaine ABC transporter permease	NA	NA	NA	NA	NA
AWV30175.1|994222_995125_-	glycine/betaine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AWV30176.1|995265_995715_+	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
AWV30177.1|995752_996178_-	hypothetical protein	NA	NA	NA	NA	NA
AWV30178.1|998156_998780_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AWV30179.1|998861_999482_-|integrase	site-specific integrase	integrase	D2XR58	Bacillus_phage	35.3	3.9e-21
AWV30180.1|999778_1000558_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
AWV30181.1|1000541_1001975_-	triphosphoribosyl-dephospho-CoA synthase	NA	NA	NA	NA	NA
AWV30182.1|1002113_1003652_-	citrate lyase subunit alpha	NA	NA	NA	NA	NA
1003304:1003320	attR	TGCCAGCCTTGATGGCT	NA	NA	NA	NA
AWV30183.1|1003641_1004541_-	citrate (pro-3S)-lyase subunit beta	NA	NA	NA	NA	NA
AWV30184.1|1004543_1004837_-	citrate lyase acyl carrier protein	NA	NA	NA	NA	NA
AWV30185.1|1004838_1005888_-	[citrate (pro-3S)-lyase] ligase	NA	NA	NA	NA	NA
AWV30186.1|1005943_1006912_-	malate permease	NA	NA	NA	NA	NA
AWV30187.1|1006931_1008095_-	NAD-dependent malic enzyme	NA	NA	NA	NA	NA
AWV30188.1|1008246_1009191_+	citrate lyase	NA	NA	NA	NA	NA
AWV30189.1|1009254_1010376_-	NAD(P)-dependent alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	27.9	9.9e-23
AWV31115.1|1010587_1011286_+|transposase	transposase	transposase	A0A0C5AJ29	Paenibacillus_phage	30.8	9.9e-21
AWV30190.1|1011282_1011582_+|transposase	transposase	transposase	NA	NA	NA	NA
AWV30191.1|1011632_1012511_-|transposase	transposase	transposase	A0A1P8CWQ3	Bacillus_phage	36.1	9.8e-42
AWV30192.1|1012534_1012822_-|transposase	transposase	transposase	NA	NA	NA	NA
AWV31116.1|1012991_1013777_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	37.8	3.6e-35
AWV30193.1|1014050_1014824_-	translation factor (SUA5)	NA	NA	NA	NA	NA
AWV30194.1|1014844_1015429_-	3-isopropylmalate dehydratase small subunit	NA	NA	NA	NA	NA
AWV30195.1|1015433_1016831_-	3-isopropylmalate dehydratase large subunit	NA	NA	NA	NA	NA
AWV30196.1|1016830_1017877_-	3-isopropylmalate dehydrogenase	NA	NA	NA	NA	NA
AWV30197.1|1017889_1019230_-	MFS transporter	NA	NA	NA	NA	NA
AWV31117.1|1019587_1019854_-	hypothetical protein	NA	NA	NA	NA	NA
AWV31118.1|1019875_1020124_-	hypothetical protein	NA	NA	NA	NA	NA
AWV30198.1|1020198_1020426_-	triphosphoribosyl-dephospho-CoA synthase	NA	NA	NA	NA	NA
AWV30199.1|1020485_1021409_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.9	5.1e-33
AWV30200.1|1021426_1021630_+	hypothetical protein	NA	NA	NA	NA	NA
AWV30201.1|1021530_1021911_-	aromatic compound catabolic protein	NA	NA	NA	NA	NA
AWV30202.1|1021945_1022767_+	1,4-dihydroxy-2-naphthoyl-CoA synthase	NA	NA	NA	NA	NA
AWV30203.1|1022776_1024201_+	2-succinylbenzoate-CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	32.7	3.6e-70
AWV30204.1|1024248_1025442_+	MFS transporter	NA	NA	NA	NA	NA
AWV31119.1|1025854_1026469_+|transposase	transposase	transposase	A0A0C5AJ29	Paenibacillus_phage	38.0	9.6e-28
AWV30205.1|1027365_1027803_+|transposase	IS200/IS605 family transposase	transposase	A0A1P8BMC0	Lactococcus_phage	70.3	9.1e-49
AWV30206.1|1027799_1028963_+|transposase	transposase	transposase	Q5ULQ4	Lactobacillus_virus	71.7	1.4e-160
AWV30207.1|1029084_1030227_-	cystathionine gamma-synthase	NA	NA	NA	NA	NA
AWV30208.1|1030239_1031151_-	cysteine synthase	NA	A0A1X9I5K7	Streptococcus_phage	41.1	1.8e-59
AWV30209.1|1031492_1031759_+	ACT domain-containing protein	NA	NA	NA	NA	NA
AWV30210.1|1031768_1033112_+	PFL family protein	NA	NA	NA	NA	NA
AWV30211.1|1033302_1034259_-	DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
AWV30212.1|1034315_1034708_+	FMN-binding protein	NA	NA	NA	NA	NA
AWV30213.1|1034929_1035130_-	hypothetical protein	NA	NA	NA	NA	NA
AWV30214.1|1036356_1036539_-	hypothetical protein	NA	NA	NA	NA	NA
AWV30215.1|1036849_1037212_-	hypothetical protein	NA	NA	NA	NA	NA
AWV30216.1|1037272_1038202_-	transporter	NA	NA	NA	NA	NA
AWV30217.1|1038444_1039029_+	DUF4352 domain-containing protein	NA	A0A0P0IXE0	Lactobacillus_phage	63.2	1.1e-41
AWV30218.1|1039135_1040989_-	flavocytochrome c	NA	A0A2P0ZL82	Lactobacillus_phage	62.2	4.4e-217
AWV30219.1|1041105_1042038_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	42.8	4.5e-61
AWV30220.1|1042134_1042992_+	patatin family protein	NA	NA	NA	NA	NA
AWV30221.1|1043086_1044259_+	acetyl-CoA acetyltransferase	NA	NA	NA	NA	NA
AWV30222.1|1044268_1045369_+	AI-2E family transporter	NA	NA	NA	NA	NA
AWV30223.1|1045448_1046189_+	transporter	NA	Q6EVM7	Oenoccocus_phage	39.8	1.1e-46
AWV30224.1|1046382_1046880_-	phosphatidylglycerophosphatase A	NA	A0A291I9Q0	Lactobacillus_phage	54.3	3.1e-45
AWV30225.1|1046892_1047945_-	penicillin-binding protein	NA	NA	NA	NA	NA
AWV30226.1|1047941_1049141_-	hypothetical protein	NA	NA	NA	NA	NA
AWV30227.1|1049340_1050198_-	hydrolase	NA	NA	NA	NA	NA
AWV30228.1|1050336_1052685_-	hypothetical protein	NA	NA	NA	NA	NA
AWV30229.1|1053071_1053959_+	3-hydroxybutyryl-CoA dehydrogenase	NA	NA	NA	NA	NA
AWV30230.1|1054049_1054937_-	DNA/RNA non-specific endonuclease	NA	NA	NA	NA	NA
AWV30231.1|1056381_1057113_-	hypothetical protein	NA	NA	NA	NA	NA
AWV30232.1|1057232_1058618_-	amino acid permease	NA	NA	NA	NA	NA
AWV30233.1|1058892_1059855_-	hypothetical protein	NA	NA	NA	NA	NA
AWV30234.1|1060171_1061950_-	1-deoxy-D-xylulose-5-phosphate synthase	NA	NA	NA	NA	NA
AWV30235.1|1062109_1063345_+	DNA replication initiation protein	NA	NA	NA	NA	NA
AWV31120.1|1064104_1064542_-	nucleoside-diphosphate kinase	NA	D2E8E1	Anguillid_herpesvirus	42.2	1.6e-24
AWV31121.1|1064547_1065090_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
AWV30236.1|1065544_1066795_-|transposase	transposase	transposase	A0A286QQE5	Streptococcus_phage	37.3	1.1e-57
AWV30237.1|1067868_1068141_-	hypothetical protein	NA	NA	NA	NA	NA
AWV30238.1|1068281_1069397_-	hypothetical protein	NA	NA	NA	NA	NA
AWV30239.1|1069735_1070173_+|transposase	IS200/IS605 family transposase	transposase	A0A1P8BMC0	Lactococcus_phage	71.0	2.4e-49
AWV30240.1|1070169_1071333_+|transposase	transposase	transposase	Q5ULQ4	Lactobacillus_virus	71.4	5.3e-160
AWV30241.1|1071695_1072526_-	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AWV30242.1|1072720_1074094_-	glutamate--cysteine ligase	NA	NA	NA	NA	NA
AWV30243.1|1074461_1075646_+	aminotransferase	NA	NA	NA	NA	NA
AWV30244.1|1076233_1077166_-|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	30.4	4.2e-27
AWV30245.1|1077434_1078784_-	NADH oxidase	NA	NA	NA	NA	NA
AWV30246.1|1078932_1079949_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	33.1	2.1e-35
AWV30247.1|1080173_1081172_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	38.4	1.7e-50
AWV30248.1|1081257_1082589_-	guanine deaminase	NA	NA	NA	NA	NA
AWV30249.1|1082710_1083862_-	succinyl-diaminopimelate desuccinylase	NA	NA	NA	NA	NA
AWV30250.1|1084759_1085176_-	low molecular weight phosphatase family protein	NA	A0A2H4PQT9	Staphylococcus_phage	36.6	8.2e-15
AWV30251.1|1085172_1085856_-	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	45.7	1.4e-11
AWV30252.1|1085939_1086368_-	NADH-dependent oxidoreductase	NA	NA	NA	NA	NA
AWV30253.1|1086482_1086989_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
AWV30254.1|1087040_1087808_-	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
AWV30255.1|1087800_1088442_-	spermidine/putrescine ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.6	5.5e-18
AWV30256.1|1088785_1090468_-	acetolactate synthase AlsS	NA	NA	NA	NA	NA
AWV30257.1|1091020_1092271_-|transposase	transposase	transposase	A0A286QQE5	Streptococcus_phage	37.3	1.4e-57
AWV30258.1|1092344_1092800_+|transposase	IS200/IS605 family transposase	transposase	A0A0P0IQC6	Lactobacillus_phage	48.6	1.4e-31
AWV30259.1|1093019_1093556_-	hypothetical protein	NA	NA	NA	NA	NA
AWV31122.1|1093767_1094460_-	DNA methyltransferase	NA	Q58MW7	Prochlorococcus_phage	31.5	5.8e-05
AWV30260.1|1094474_1098890_-	restriction endonuclease	NA	A0A1V0SII8	Klosneuvirus	20.9	1.4e-24
AWV30261.1|1098954_1099707_-	hypothetical protein	NA	NA	NA	NA	NA
AWV30262.1|1099889_1100450_+	RpoE protein	NA	NA	NA	NA	NA
AWV30263.1|1100794_1101409_+|transposase	transposase	transposase	A0A0C5AJ29	Paenibacillus_phage	37.5	9.6e-28
AWV31123.1|1101627_1101828_+|transposase	transposase	transposase	NA	NA	NA	NA
AWV30264.1|1103677_1103974_-	hypothetical protein	NA	NA	NA	NA	NA
AWV30265.1|1104079_1104415_-	hypothetical protein	NA	NA	NA	NA	NA
AWV30266.1|1104720_1106895_-	hypothetical protein	NA	NA	NA	NA	NA
AWV30267.1|1107420_1107708_+|transposase	transposase	transposase	NA	NA	NA	NA
AWV30268.1|1107731_1108610_+|transposase	transposase	transposase	A0A1P8CWQ3	Bacillus_phage	36.4	2.0e-42
>prophage 7
CP021964	Lactobacillus fermentum strain CBA7106 chromosome, complete genome	2042277	1191645	1234827	2042277	transposase,portal	Bacillus_phage(25.0%)	42	NA	NA
AWV30348.1|1191645_1193655_+|portal	portal protein	portal	M1IBC2	Acanthocystis_turfacea_Chlorella_virus	35.7	2.0e-66
AWV30349.1|1193873_1194320_-	hypothetical protein	NA	NA	NA	NA	NA
AWV30350.1|1194316_1195828_-	glycerol kinase	NA	NA	NA	NA	NA
AWV30351.1|1195895_1196081_-	4-oxalocrotonate tautomerase	NA	NA	NA	NA	NA
AWV30352.1|1196145_1198017_-	potassium transporter	NA	NA	NA	NA	NA
AWV30353.1|1198125_1199538_-	dipeptidase	NA	NA	NA	NA	NA
AWV30354.1|1199558_1200458_-	acyltransferase	NA	NA	NA	NA	NA
AWV30355.1|1200450_1201761_-	PTS cellobiose transporter subunit IIC	NA	NA	NA	NA	NA
AWV30356.1|1201929_1202199_-	30S ribosomal protein S14	NA	NA	NA	NA	NA
AWV30357.1|1202301_1203165_-	phosphodiesterase	NA	NA	NA	NA	NA
AWV31127.1|1203421_1204813_+	MFS transporter	NA	NA	NA	NA	NA
AWV30358.1|1204828_1206070_+	multidrug transporter subunit MdtG	NA	NA	NA	NA	NA
AWV30359.1|1206233_1207622_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
AWV30360.1|1207808_1209035_+	MFS transporter	NA	NA	NA	NA	NA
AWV30361.1|1209241_1209454_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AWV30362.1|1209426_1209735_-	hypothetical protein	NA	NA	NA	NA	NA
AWV30363.1|1209783_1209942_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AWV30364.1|1210069_1211191_-	lipolytic protein G-D-S-L family protein	NA	NA	NA	NA	NA
AWV30365.1|1211247_1212267_-	lipoate--protein ligase	NA	NA	NA	NA	NA
AWV30366.1|1212295_1213702_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	28.8	9.5e-47
AWV30367.1|1213708_1214998_-	dienelactone hydrolase	NA	NA	NA	NA	NA
AWV30368.1|1215013_1215991_-	alpha-ketoacid dehydrogenase subunit beta	NA	NA	NA	NA	NA
AWV30369.1|1215993_1217085_-	pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha	NA	NA	NA	NA	NA
AWV30370.1|1217424_1217745_+	4-carboxymuconolactone decarboxylase	NA	NA	NA	NA	NA
AWV30371.1|1218026_1218353_-	branched-chain amino acid transporter AzlD	NA	NA	NA	NA	NA
AWV30372.1|1218349_1219051_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
AWV30373.1|1219058_1220567_-	threonine synthase	NA	NA	NA	NA	NA
AWV30374.1|1220681_1221959_+	homoserine dehydrogenase	NA	NA	NA	NA	NA
AWV30375.1|1221968_1222829_+	homoserine kinase	NA	NA	NA	NA	NA
AWV30376.1|1223060_1223585_-	N-acetyltransferase	NA	NA	NA	NA	NA
AWV30377.1|1223685_1224327_-	NAD-dependent dehydratase	NA	NA	NA	NA	NA
AWV30378.1|1224449_1225106_+	phosphohydrolase	NA	A0A2P1EMT6	Moumouvirus	27.8	4.9e-06
AWV30379.1|1225102_1225846_-	hypothetical protein	NA	NA	NA	NA	NA
AWV30380.1|1226119_1226731_-	hypothetical protein	NA	NA	NA	NA	NA
AWV30381.1|1226727_1227606_-	fatty acid-binding protein DegV	NA	A0A0N9SI50	Staphylococcus_phage	38.9	1.9e-16
AWV30382.1|1227796_1229488_+	hypothetical protein	NA	M1I5P2	Paramecium_bursaria_Chlorella_virus	36.2	1.5e-09
AWV30383.1|1230822_1231086_+|transposase	transposase	transposase	A0A0C5AJ30	Paenibacillus_phage	37.5	6.8e-07
AWV30384.1|1231124_1231892_+|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	33.2	7.7e-35
AWV30385.1|1232177_1232552_+	hypothetical protein	NA	NA	NA	NA	NA
AWV30386.1|1232571_1233465_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
AWV30387.1|1233637_1233925_+|transposase	transposase	transposase	NA	NA	NA	NA
AWV30388.1|1233948_1234827_+|transposase	transposase	transposase	A0A1P8CWQ3	Bacillus_phage	35.7	1.3e-41
>prophage 8
CP021964	Lactobacillus fermentum strain CBA7106 chromosome, complete genome	2042277	1238178	1303540	2042277	transposase,tRNA	Bacillus_phage(26.32%)	57	NA	NA
AWV30391.1|1238178_1238787_-|transposase	transposase	transposase	A0A0C5AJ29	Paenibacillus_phage	34.2	1.9e-15
AWV30392.1|1238748_1239036_+|transposase	transposase	transposase	NA	NA	NA	NA
AWV30393.1|1239059_1239938_+|transposase	transposase	transposase	A0A1P8CWQ3	Bacillus_phage	36.4	2.6e-42
AWV31129.1|1240539_1241706_-	hypothetical protein	NA	NA	NA	NA	NA
AWV30394.1|1241767_1242676_-	sodium ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.3	4.0e-22
AWV30395.1|1243772_1244993_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	46.0	2.6e-93
AWV30396.1|1245181_1245598_-	arsenate reductase (thioredoxin)	NA	A0A2H4PQT9	Staphylococcus_phage	46.8	1.0e-25
AWV30397.1|1245609_1246647_-	arsenical-resistance protein	NA	NA	NA	NA	NA
AWV30398.1|1246697_1247015_-	transcriptional regulator	NA	A0A2H4PQT4	Staphylococcus_phage	51.1	4.0e-22
AWV30399.1|1247504_1248644_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	32.5	2.2e-41
AWV30400.1|1248744_1249077_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
AWV30401.1|1249295_1250207_+	transcriptional regulator	NA	NA	NA	NA	NA
AWV30402.1|1250324_1250960_+	carbonate dehydratase	NA	NA	NA	NA	NA
AWV30403.1|1251152_1253657_-	carbamoyl-phosphate synthase large subunit	NA	NA	NA	NA	NA
AWV30404.1|1253658_1254741_-	carbamoyl phosphate synthase small subunit	NA	NA	NA	NA	NA
AWV31130.1|1254770_1255646_-	pseudouridine synthase	NA	NA	NA	NA	NA
AWV30405.1|1255686_1256124_-	signal peptidase II	NA	NA	NA	NA	NA
AWV30406.1|1256123_1256558_-	VPDSG-CTERM exosortase interaction domain protein	NA	NA	NA	NA	NA
AWV30407.1|1256570_1256972_+	ribonuclease HI	NA	NA	NA	NA	NA
AWV30408.1|1257127_1257730_-	nitroreductase	NA	NA	NA	NA	NA
AWV30409.1|1257953_1258817_-	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AWV30410.1|1259030_1259720_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
AWV30411.1|1259806_1260505_-	glycosyl transferase family 2	NA	NA	NA	NA	NA
AWV30412.1|1260626_1260914_+|transposase	transposase	transposase	NA	NA	NA	NA
AWV30413.1|1260937_1261816_+|transposase	transposase	transposase	A0A1P8CWQ3	Bacillus_phage	36.1	1.7e-41
AWV30414.1|1261801_1262680_-	hypothetical protein	NA	NA	NA	NA	NA
AWV30415.1|1263477_1264956_+	amidase	NA	NA	NA	NA	NA
AWV30416.1|1266174_1267308_-	RNA methyltransferase	NA	NA	NA	NA	NA
AWV30417.1|1267350_1267800_-	NTP pyrophosphohydrolase	NA	NA	NA	NA	NA
AWV30418.1|1267803_1268985_-	ATPase	NA	NA	NA	NA	NA
AWV30419.1|1269092_1271027_-	elongation factor G	NA	D0R0F5	Streptococcus_phage	28.5	3.1e-64
AWV30420.1|1271679_1272048_-	cell division protein GpsB	NA	NA	NA	NA	NA
AWV30421.1|1272146_1272743_-	DUF1273 domain-containing protein	NA	NA	NA	NA	NA
AWV30422.1|1272834_1273470_+	Holliday junction resolvase RecU	NA	A0A1C8E9C3	Bacillus_phage	36.6	6.6e-24
AWV30423.1|1273462_1275727_+	carboxypeptidase	NA	NA	NA	NA	NA
AWV30424.1|1275833_1276745_-	EamA family transporter	NA	NA	NA	NA	NA
AWV30425.1|1276867_1277887_+	L-glyceraldehyde 3-phosphate reductase	NA	NA	NA	NA	NA
AWV30426.1|1278203_1279211_-	hypothetical protein	NA	NA	NA	NA	NA
AWV30427.1|1279310_1280039_-	DNA replication protein DnaD	NA	A0A0N7AE27	Bacillus_phage	37.1	3.5e-13
AWV30428.1|1280130_1281426_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2P1EMB4	Moumouvirus	29.2	1.6e-53
AWV30429.1|1281452_1281971_-	peptidase	NA	NA	NA	NA	NA
AWV30430.1|1282021_1284862_-	ATP-dependent DNA helicase	NA	A0A1X9I5C8	Streptococcus_phage	34.8	9.5e-62
AWV30431.1|1285090_1286026_+	mevalonate kinase	NA	NA	NA	NA	NA
AWV30432.1|1286027_1287017_+	diphosphomevalonate decarboxylase	NA	NA	NA	NA	NA
AWV30433.1|1287036_1288146_+	phosphomevalonate kinase	NA	NA	NA	NA	NA
AWV30434.1|1288201_1289287_+	type 2 isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
AWV30435.1|1289442_1290201_-	phosphate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.8	1.4e-12
AWV30436.1|1290396_1291647_-|transposase	transposase	transposase	A0A286QQE5	Streptococcus_phage	37.3	1.1e-57
AWV30437.1|1291734_1292175_+|transposase	IS200/IS605 family transposase	transposase	A0A0P0IQC6	Lactobacillus_phage	50.7	2.1e-32
AWV31131.1|1292225_1293599_-	RNA methyltransferase	NA	NA	NA	NA	NA
AWV30438.1|1293727_1294534_+	HAD family hydrolase	NA	NA	NA	NA	NA
AWV30439.1|1294765_1295683_-	dihydroorotate dehydrogenase B catalytic subunit	NA	NA	NA	NA	NA
AWV30440.1|1295695_1298875_-	carbamoyl phosphate synthase large subunit	NA	NA	NA	NA	NA
AWV30441.1|1298874_1299957_-	carbamoyl phosphate synthase small subunit	NA	R4TGJ8	Halovirus	35.3	1.6e-54
AWV30442.1|1299958_1301248_-	dihydroorotase	NA	NA	NA	NA	NA
AWV30443.1|1301247_1302213_-	aspartate carbamoyltransferase	NA	A0A1J0F9B8	Only_Syngen_Nebraska_virus	29.9	5.9e-24
AWV30444.1|1302661_1303540_-|transposase	transposase	transposase	A0A1P8CWQ3	Bacillus_phage	36.4	2.0e-42
>prophage 9
CP021964	Lactobacillus fermentum strain CBA7106 chromosome, complete genome	2042277	1514172	1558399	2042277	protease,transposase,tRNA	Paenibacillus_phage(30.0%)	42	NA	NA
AWV30649.1|1514172_1515330_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	29.1	3.3e-37
AWV30650.1|1515682_1517110_-	flippase	NA	NA	NA	NA	NA
AWV30651.1|1517112_1518234_-	UDP-galactopyranose mutase	NA	E4ZFQ1	Streptococcus_phage	77.8	5.8e-172
AWV30652.1|1518460_1519648_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	29.1	5.7e-37
AWV30653.1|1519808_1520960_-	hypothetical protein	NA	NA	NA	NA	NA
AWV30654.1|1521018_1521636_-	lipopolysaccharide biosynthesis protein	NA	NA	NA	NA	NA
AWV30655.1|1521610_1522834_-	polymerase	NA	NA	NA	NA	NA
AWV30656.1|1522844_1523606_-	exopolysaccharide biosynthesis protein	NA	NA	NA	NA	NA
AWV30657.1|1523617_1524271_-	sugar transferase	NA	NA	NA	NA	NA
AWV30658.1|1524440_1525259_-	recombination regulator RecX	NA	NA	NA	NA	NA
AWV30659.1|1525352_1525559_+	hypothetical protein	NA	NA	NA	NA	NA
AWV30660.1|1525594_1525810_+	DUF2922 domain-containing protein	NA	NA	NA	NA	NA
AWV30661.1|1525990_1526887_-	ribonuclease BN	NA	NA	NA	NA	NA
AWV30662.1|1527015_1529901_-	phosphoglyceromutase	NA	NA	NA	NA	NA
AWV30663.1|1530111_1530969_-	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
AWV30664.1|1531081_1531528_+	flavodoxin	NA	NA	NA	NA	NA
AWV30665.1|1531537_1531972_+	GtrA family protein	NA	NA	NA	NA	NA
AWV30666.1|1532626_1533955_-	ATP-dependent helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	29.1	1.8e-34
AWV30667.1|1533958_1534969_-	gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
AWV30668.1|1535133_1535499_+	DUF4828 domain-containing protein	NA	NA	NA	NA	NA
AWV30669.1|1535640_1536210_+	Rossman fold protein, TIGR00730 family	NA	NA	NA	NA	NA
AWV30670.1|1536210_1537113_-	L-2-hydroxyisocaproate dehydrogenase	NA	NA	NA	NA	NA
AWV30671.1|1537277_1538786_-	glutamate--cysteine ligase	NA	NA	NA	NA	NA
AWV30672.1|1538900_1539680_-	flavoprotein	NA	NA	NA	NA	NA
AWV30673.1|1539821_1540175_+	iron-sulfur cluster biosynthesis protein	NA	NA	NA	NA	NA
AWV30674.1|1540717_1542343_-	ABC-F family ATPase	NA	A0A2K9L3Z8	Tupanvirus	25.3	1.3e-44
AWV30675.1|1542512_1542980_-	DNA starvation/stationary phase protection protein	NA	A0A291I9P0	Lactobacillus_phage	31.5	7.1e-15
AWV30676.1|1543060_1543621_-	hypothetical protein	NA	NA	NA	NA	NA
AWV30677.1|1545574_1546123_-	transcriptional regulator	NA	NA	NA	NA	NA
AWV30678.1|1547526_1548045_+	cysteine methyltransferase	NA	M1PFU9	Streptococcus_phage	46.2	2.1e-31
AWV30679.1|1548136_1548730_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
AWV30680.1|1548746_1548968_+	hypothetical protein	NA	NA	NA	NA	NA
AWV30681.1|1549005_1549695_-	SAM-dependent methyltransferase	NA	A0A097BYE1	Leuconostoc_phage	41.6	9.1e-35
AWV30682.1|1549857_1550430_-	diguanylate cyclase	NA	NA	NA	NA	NA
AWV30683.1|1550432_1550876_-	transcriptional regulator	NA	NA	NA	NA	NA
AWV30684.1|1551017_1552556_-	copper oxidase	NA	NA	NA	NA	NA
AWV30685.1|1552619_1553126_-|tRNA	prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
AWV30686.1|1553201_1553984_+	dimethylargininase	NA	NA	NA	NA	NA
AWV30687.1|1554371_1555769_+	Na+/H+ antiporter NhaC	NA	NA	NA	NA	NA
AWV30688.1|1556156_1556771_+|transposase	transposase	transposase	A0A0C5AJ29	Paenibacillus_phage	37.5	3.1e-26
AWV30689.1|1557209_1557497_+|transposase	transposase	transposase	NA	NA	NA	NA
AWV30690.1|1557520_1558399_+|transposase	transposase	transposase	A0A1P8CWQ3	Bacillus_phage	35.7	1.7e-41
>prophage 10
CP021964	Lactobacillus fermentum strain CBA7106 chromosome, complete genome	2042277	1726677	1824717	2042277	integrase,transposase,tRNA	Streptococcus_phage(18.52%)	69	1726503:1726541	1820222:1820242
1726503:1726541	attL	TCGTCAACCACCACTGACTAAAGTCAGTGGCTTGTGAGC	NA	NA	NA	NA
AWV30844.1|1726677_1727928_-|transposase	transposase	transposase	A0A286QQE5	Streptococcus_phage	37.0	2.0e-56
1726503:1726541	attL	TCGTCAACCACCACTGACTAAAGTCAGTGGCTTGTGAGC	NA	NA	NA	NA
AWV30845.1|1728006_1728459_+|transposase	IS200/IS605 family transposase	transposase	A0A0P0IQC6	Lactobacillus_phage	51.5	2.8e-32
AWV30846.1|1728647_1728896_-	hypothetical protein	NA	NA	NA	NA	NA
AWV30847.1|1729263_1730616_-	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	24.3	5.2e-18
AWV30848.1|1730596_1732051_-	amino acid permease	NA	NA	NA	NA	NA
AWV30849.1|1732388_1732829_-	NAD(P)H dehydrogenase (quinone)	NA	NA	NA	NA	NA
AWV30850.1|1732974_1733805_-	radical SAM protein	NA	NA	NA	NA	NA
AWV30851.1|1733902_1734433_+	acetyltransferase	NA	NA	NA	NA	NA
AWV30852.1|1734655_1736038_-	argininosuccinate lyase	NA	NA	NA	NA	NA
AWV30853.1|1736037_1737327_-	argininosuccinate synthase	NA	NA	NA	NA	NA
AWV30854.1|1737553_1739749_+	hypothetical protein	NA	NA	NA	NA	NA
AWV31141.1|1739950_1740379_+|transposase	IS200/IS605 family transposase	transposase	A0A1P8BMC0	Lactococcus_phage	65.2	1.9e-46
AWV30855.1|1740400_1741567_+|transposase	transposase	transposase	Q5ULQ4	Lactobacillus_virus	73.8	9.6e-162
AWV30856.1|1741686_1743564_-	hypothetical protein	NA	NA	NA	NA	NA
AWV30857.1|1743556_1744129_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AWV30858.1|1744261_1744510_+	ABC transporter	NA	NA	NA	NA	NA
AWV30859.1|1744510_1746367_+	hypothetical protein	NA	NA	NA	NA	NA
AWV31142.1|1746413_1746881_+|tRNA	prolyl-tRNA editing protein	tRNA	NA	NA	NA	NA
AWV30860.1|1747221_1748496_-	iron reductase	NA	NA	NA	NA	NA
AWV30861.1|1748479_1749256_-	thiamine biosynthesis protein	NA	NA	NA	NA	NA
AWV30862.1|1749259_1749730_-	FMN-binding protein	NA	NA	NA	NA	NA
AWV30863.1|1749946_1751932_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.3	7.1e-32
AWV30864.1|1752018_1752687_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AWV30865.1|1753085_1754306_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	46.2	1.1e-94
AWV30866.1|1754418_1755102_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	33.3	1.1e-21
AWV30867.1|1755091_1756090_+	ATP-binding protein	NA	NA	NA	NA	NA
AWV30868.1|1756451_1757207_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.1	3.7e-29
AWV30869.1|1757208_1759149_+	ABC transporter permease	NA	NA	NA	NA	NA
AWV30870.1|1759545_1760238_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AWV30871.1|1760357_1761113_+|integrase	integrase	integrase	NA	NA	NA	NA
AWV30872.1|1761240_1761576_-	hypothetical protein	NA	A0A1X9I619	Streptococcus_phage	54.3	3.4e-27
AWV30873.1|1761695_1762919_+|integrase	integrase	integrase	A0A059NT83	Lactococcus_phage	45.0	5.1e-89
AWV30874.1|1764094_1765282_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	29.1	2.9e-36
AWV30875.1|1766633_1767884_-|transposase	transposase	transposase	A0A286QQE5	Streptococcus_phage	37.3	1.8e-57
1766457:1766495	attR	TCGTCAACCACCACTGACTAAAGTCAGTGGCTTGTGAGC	NA	NA	NA	NA
AWV30876.1|1768495_1768816_-	hypothetical protein	NA	NA	NA	NA	NA
1766457:1766495	attR	TCGTCAACCACCACTGACTAAAGTCAGTGGCTTGTGAGC	NA	NA	NA	NA
AWV30877.1|1768901_1769645_-	arginase	NA	NA	NA	NA	NA
AWV30878.1|1770011_1770332_-	transcriptional regulator	NA	NA	NA	NA	NA
AWV30879.1|1770379_1770952_-	DUF4767 domain-containing protein	NA	NA	NA	NA	NA
AWV30880.1|1772034_1774800_+	haloacid dehalogenase	NA	M1IAU8	Acanthocystis_turfacea_Chlorella_virus	29.4	1.1e-70
AWV30881.1|1775029_1777372_-	nitric-oxide reductase large subunit	NA	NA	NA	NA	NA
AWV30882.1|1777661_1778852_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	26.5	2.7e-34
AWV30883.1|1779385_1780339_-	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	41.2	2.5e-59
AWV30884.1|1780422_1785318_-	hypothetical protein	NA	NA	NA	NA	NA
AWV30885.1|1786809_1787523_+|transposase	transposase	transposase	NA	NA	NA	NA
AWV30886.1|1787552_1788371_+|transposase	transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	31.2	6.8e-21
AWV30887.1|1789167_1790517_-	hypothetical protein	NA	NA	NA	NA	NA
AWV30888.1|1792190_1794083_-	helicase	NA	A0A249XXD7	Clostridium_phage	25.0	2.2e-06
AWV30889.1|1794063_1795356_-	hypothetical protein	NA	NA	NA	NA	NA
AWV30890.1|1795357_1798333_-	type III restriction endonuclease subunit R	NA	Q71TG1	Escherichia_phage	30.2	1.4e-92
AWV30891.1|1798336_1799182_-	adenine-specific DNA methylase	NA	A0A2K5B2C1	Erysipelothrix_phage	34.6	1.7e-22
AWV30892.1|1799374_1800595_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	46.2	6.2e-95
AWV30893.1|1802843_1804397_-	GMP synthase (glutamine-hydrolyzing)	NA	A0A1V0SH76	Hokovirus	28.0	3.0e-17
AWV30894.1|1804711_1805323_+	GTP pyrophosphokinase	NA	NA	NA	NA	NA
AWV30895.1|1805336_1806008_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	29.1	8.9e-19
AWV30896.1|1806020_1807274_+	sensor histidine kinase	NA	NA	NA	NA	NA
AWV30897.1|1807588_1808512_-	type I pantothenate kinase	NA	NA	NA	NA	NA
AWV30898.1|1808622_1809174_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AWV30899.1|1809270_1811364_-	glycerol phosphate lipoteichoic acid synthase	NA	W6LM83	Streptococcus_phage	45.3	6.8e-150
AWV30900.1|1811597_1812503_+	EamA family transporter	NA	NA	NA	NA	NA
AWV30901.1|1812595_1814890_-	ATP-dependent DNA helicase	NA	NA	NA	NA	NA
AWV30902.1|1815072_1815729_+	cytochrome O ubiquinol oxidase	NA	NA	NA	NA	NA
AWV30903.1|1815853_1816498_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
AWV30904.1|1816519_1817797_+	GTPase HflX	NA	NA	NA	NA	NA
AWV30905.1|1818018_1819128_+	o-succinylbenzoate synthase	NA	NA	NA	NA	NA
AWV30906.1|1819189_1819912_-	nicotinamide mononucleotide transporter	NA	G3BLP7	Salmonella_phage	24.3	1.5e-11
AWV30907.1|1820260_1821874_-	amino acid:proton symporter	NA	NA	NA	NA	NA
AWV30908.1|1822032_1822530_-	N-acetyltransferase	NA	NA	NA	NA	NA
AWV30909.1|1823143_1824319_-|transposase	transposase	transposase	A0A0P0ICY9	Lactobacillus_phage	54.9	2.6e-114
AWV31143.1|1824318_1824717_-|transposase	IS200/IS605 family transposase	transposase	A0A286QN76	Streptococcus_phage	62.9	1.1e-45
>prophage 11
CP021964	Lactobacillus fermentum strain CBA7106 chromosome, complete genome	2042277	1867219	1913321	2042277	transposase	Streptococcus_phage(28.57%)	44	NA	NA
AWV30944.1|1867219_1867798_+|transposase	transposase	transposase	NA	NA	NA	NA
AWV30945.1|1867884_1868103_+	hypothetical protein	NA	NA	NA	NA	NA
AWV30946.1|1868023_1868602_+	hypothetical protein	NA	A0A2I6AZV9	Macacine_betaherpesvirus	43.9	1.9e-33
AWV30947.1|1868655_1869513_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
AWV30948.1|1869911_1870565_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
AWV30949.1|1870788_1872918_+	alkaline phosphatase	NA	W6LM83	Streptococcus_phage	49.8	4.6e-170
AWV30950.1|1873309_1873789_+	hypothetical protein	NA	NA	NA	NA	NA
AWV30951.1|1873889_1874537_-	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
AWV30952.1|1874514_1875063_-	DNA-binding protein	NA	NA	NA	NA	NA
AWV30953.1|1875062_1875293_-	copper-binding protein	NA	NA	NA	NA	NA
AWV30954.1|1875354_1877208_-	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	34.7	1.2e-84
AWV30955.1|1877401_1878394_-	NAD(P)/FAD-dependent oxidoreductase	NA	Q9JRK7	Streptococcus_phage	41.1	1.0e-18
AWV30956.1|1878566_1879526_+	nucleoside hydrolase	NA	NA	NA	NA	NA
AWV30957.1|1880062_1880632_+	ABC transporter permease	NA	NA	NA	NA	NA
AWV30958.1|1880635_1882018_+	ABC transporter ATP-binding protein	NA	A0A1V0SI78	Klosneuvirus	21.2	9.1e-10
AWV30959.1|1882007_1882661_+	energy-coupling factor transporter transmembrane protein EcfT	NA	NA	NA	NA	NA
AWV30960.1|1882705_1883065_+	hypothetical protein	NA	NA	NA	NA	NA
AWV30961.1|1883155_1885117_+	sodium:proton antiporter	NA	NA	NA	NA	NA
AWV30962.1|1885534_1886548_-	lipoate--protein ligase	NA	A0A2H4UVX5	Bodo_saltans_virus	30.4	5.6e-17
AWV30963.1|1888275_1888797_-|transposase	transposase	transposase	A0A0C5AJ29	Paenibacillus_phage	36.0	5.6e-21
AWV30964.1|1889013_1889976_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
AWV30965.1|1890105_1890531_+	transcriptional regulator	NA	A0A1S5SDR1	Streptococcus_phage	34.4	3.8e-07
AWV30966.1|1890527_1891379_+	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AWV30967.1|1891832_1892309_-	hypothetical protein	NA	NA	NA	NA	NA
AWV30968.1|1892315_1892714_-	hypothetical protein	NA	NA	NA	NA	NA
AWV30969.1|1892813_1893284_+	universal stress protein	NA	NA	NA	NA	NA
AWV30970.1|1893310_1893661_+	hypothetical protein	NA	NA	NA	NA	NA
AWV31146.1|1893840_1894659_+	paraslipin	NA	NA	NA	NA	NA
AWV30971.1|1894754_1896116_-	MFS transporter	NA	NA	NA	NA	NA
AWV30972.1|1896326_1898330_-	transketolase	NA	NA	NA	NA	NA
AWV30973.1|1898342_1899089_-	transaldolase	NA	A0A222YW60	Synechococcus_phage	29.2	1.1e-09
AWV30974.1|1899480_1900161_-	ribose-5-phosphate isomerase	NA	NA	NA	NA	NA
AWV30975.1|1900295_1901219_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.9	5.1e-33
AWV30976.1|1902634_1903333_+|transposase	transposase	transposase	A0A0C5AJ29	Paenibacillus_phage	31.2	1.7e-20
AWV30977.1|1903329_1904178_+|transposase	transposase	transposase	Q8W6R2	Burkholderia_virus	29.6	1.3e-11
AWV30978.1|1904477_1905488_-	HoxN/HupN/NixA family nickel/cobalt transporter	NA	NA	NA	NA	NA
AWV30979.1|1905516_1906344_-	TIGR00268 family protein	NA	NA	NA	NA	NA
AWV30980.1|1906368_1907079_-	aquaporin family protein	NA	NA	NA	NA	NA
AWV30981.1|1907080_1908445_-	TIGR00299 family protein	NA	NA	NA	NA	NA
AWV30982.1|1908444_1909203_-	1-(5-phosphoribosyl)-5-amino-4-imidazole- carboxylate carboxylase	NA	A0A288TYA6	Enterococcus_phage	47.2	3.7e-21
AWV30983.1|1909210_1910494_-	lactate racemization operon protein LarA	NA	NA	NA	NA	NA
AWV30984.1|1910734_1911406_+	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
AWV30985.1|1911920_1912121_-	hypothetical protein	NA	NA	NA	NA	NA
AWV30986.1|1912133_1913321_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	29.1	7.5e-37
>prophage 12
CP021964	Lactobacillus fermentum strain CBA7106 chromosome, complete genome	2042277	1933724	1980434	2042277	transposase,tRNA	Bacillus_phage(15.38%)	45	NA	NA
AWV31001.1|1933724_1934225_+|tRNA	Cys-tRNA(Pro) deacylase	tRNA	NA	NA	NA	NA
AWV31002.1|1934228_1934972_+	hypothetical protein	NA	NA	NA	NA	NA
AWV31003.1|1935031_1936468_+	dipeptidase	NA	NA	NA	NA	NA
AWV31004.1|1936587_1937103_-	hypothetical protein	NA	NA	NA	NA	NA
AWV31005.1|1937112_1937640_-	hypothetical protein	NA	NA	NA	NA	NA
AWV31006.1|1937788_1939174_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
AWV31007.1|1939260_1939725_+	ribonucleotide reductase assembly protein NrdI	NA	NA	NA	NA	NA
AWV31008.1|1939969_1940401_-	VOC family protein	NA	NA	NA	NA	NA
AWV31009.1|1940593_1941763_+	MFS transporter	NA	NA	NA	NA	NA
AWV31010.1|1942253_1943735_+	glucose-6-phosphate dehydrogenase	NA	M4SIY3	Cyanophage	36.9	4.0e-72
AWV31011.1|1943919_1945359_+	phosphogluconate dehydrogenase (NADP(+)-dependent, decarboxylating)	NA	E3SPS4	Prochlorococcus_phage	30.2	1.1e-29
AWV31012.1|1945725_1946199_-	universal stress protein	NA	NA	NA	NA	NA
AWV31013.1|1946360_1946816_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
AWV31014.1|1946974_1947721_+	2-deoxy-D-gluconate 3-dehydrogenase	NA	A0A0M4JSW6	Mollivirus	28.0	1.4e-17
AWV31015.1|1947737_1948739_+	transcriptional regulator	NA	NA	NA	NA	NA
AWV31016.1|1949010_1950819_-	oligoendopeptidase F	NA	NA	NA	NA	NA
AWV31017.1|1950821_1952114_-	glutamate/aspartate:proton symporter GltP	NA	NA	NA	NA	NA
AWV31018.1|1952361_1953033_+	hypothetical protein	NA	NA	NA	NA	NA
AWV31147.1|1953490_1953688_+|transposase	transposase	transposase	NA	NA	NA	NA
AWV31019.1|1953726_1954494_+|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	33.6	1.2e-35
AWV31020.1|1954675_1956355_+	D-lactate dehydrogenase	NA	NA	NA	NA	NA
AWV31021.1|1956937_1957597_-	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	43.3	8.1e-41
AWV31022.1|1959289_1959835_+|transposase	transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	43.5	9.7e-32
AWV31023.1|1959912_1960047_-	hypothetical protein	NA	NA	NA	NA	NA
AWV31024.1|1960117_1960540_-	dihydrodipicolinate synthase	NA	NA	NA	NA	NA
AWV31025.1|1960558_1960648_-	PbsX family transcriptional regulator	NA	NA	NA	NA	NA
AWV31026.1|1962450_1963161_-	hypothetical protein	NA	NA	NA	NA	NA
AWV31027.1|1963480_1964404_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	30.3	2.2e-28
AWV31028.1|1964462_1964675_+	hypothetical protein	NA	NA	NA	NA	NA
AWV31029.1|1964802_1965426_-	cation transporter	NA	NA	NA	NA	NA
AWV31148.1|1965395_1966022_-	DNA invertase Pin	NA	K7PJT4	Enterobacteria_phage	35.3	1.3e-11
AWV31149.1|1966594_1966891_+|transposase	transposase	transposase	NA	NA	NA	NA
AWV31030.1|1967082_1967571_-	histidine kinase	NA	NA	NA	NA	NA
AWV31031.1|1967640_1968564_-	ferrochelatase	NA	NA	NA	NA	NA
AWV31032.1|1968560_1969940_-	MFS transporter	NA	NA	NA	NA	NA
AWV31033.1|1970544_1971765_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	46.0	1.8e-94
AWV31034.1|1972027_1972324_-	lysophospholipase	NA	NA	NA	NA	NA
AWV31035.1|1972342_1972507_-	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
AWV31036.1|1972559_1974755_-	copper-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	30.3	2.4e-60
AWV31037.1|1975005_1975437_-	transcriptional regulator	NA	NA	NA	NA	NA
AWV31038.1|1976021_1976603_+	Pin-related site-specific recombinase/DNA invertase	NA	A0A1V0E035	Clostridioides_phage	34.9	1.7e-21
AWV31039.1|1976931_1977603_-	peptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.4	5.0e-30
AWV31040.1|1977607_1978654_-	ABC transporter permease	NA	NA	NA	NA	NA
AWV31041.1|1979244_1980123_-|transposase	transposase	transposase	A0A1P8CWQ3	Bacillus_phage	36.4	2.6e-42
AWV31042.1|1980146_1980434_-|transposase	transposase	transposase	NA	NA	NA	NA
