The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP030007	Enterobacter hormaechei subsp. xiangfangensis strain Pb204 chromosome, complete genome	4956155	1869194	1878440	4956155		Enterobacteria_phage(25.0%)	9	NA	NA
AWV75537.1|1869194_1870259_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.4	6.4e-104
AWV75538.1|1870274_1871141_+	glucose-1-phosphate thymidylyltransferase	NA	I7I009	Enterobacteria_phage	66.3	2.2e-110
AWV75539.1|1871153_1872044_+	dTDP-4-dehydrorhamnose reductase	NA	A0A1D7XFA3	Escherichia_phage	31.3	2.8e-28
AWV75540.1|1872054_1872603_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	54.4	9.1e-54
AWV75541.1|1872738_1874145_+	phosphogluconate dehydrogenase (NADP(+)-dependent, decarboxylating)	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.3	6.8e-37
AWV75542.1|1874397_1875564_+	UDP-glucose 6-dehydrogenase	NA	A0A1J0FA55	Only_Syngen_Nebraska_virus	54.0	4.1e-112
AWV75543.1|1875612_1876617_-	NAD-dependent epimerase	NA	A0A2K9L0I7	Tupanvirus	29.0	2.5e-33
AWV75544.1|1876808_1877789_+	LPS O-antigen chain length determinant protein WzzB	NA	NA	NA	NA	NA
AWV75545.1|1877828_1878440_-	bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE	NA	A0A2H4UVM0	Bodo_saltans_virus	29.3	1.6e-14
>prophage 2
CP030007	Enterobacter hormaechei subsp. xiangfangensis strain Pb204 chromosome, complete genome	4956155	2036198	2167443	4956155	transposase,integrase,protease,terminase,lysis,holin,tRNA,capsid,coat,tail,portal,head	Cronobacter_phage(22.86%)	159	2109550:2109579	2155160:2155189
AWV75686.1|2036198_2037932_-|tRNA	arginine--tRNA ligase	tRNA	A0A1V0SIS8	Klosneuvirus	36.8	2.6e-86
AWV75687.1|2038170_2038731_+	VOC family protein	NA	NA	NA	NA	NA
AWV75688.1|2038809_2039553_+	copper homeostasis protein CutC	NA	NA	NA	NA	NA
AWV75689.1|2039533_2039773_+	hypothetical protein	NA	NA	NA	NA	NA
AWV75690.1|2039727_2040699_-|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
AWV75691.1|2040695_2041439_-	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	A0A1S6L2V9	Erwinia_phage	30.2	6.1e-29
AWV75692.1|2041479_2041875_-	hypothetical protein	NA	NA	NA	NA	NA
AWV75693.1|2041926_2042700_-	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	81.1	2.3e-58
AWV75694.1|2042678_2043992_-	DUF3596 domain-containing protein	NA	Q8W658	Enterobacteria_phage	85.3	6.0e-221
AWV78402.1|2044047_2044284_-	excisionase	NA	Q8W657	Enterobacteria_phage	85.9	4.8e-36
AWV75695.1|2044434_2044659_-	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	58.3	3.7e-14
AWV75696.1|2044659_2045073_-	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	67.2	1.6e-47
AWV75697.1|2045069_2045291_-	hypothetical protein	NA	A0A286S1P6	Klebsiella_phage	66.7	1.1e-18
AWV75698.1|2045262_2045670_-	hypothetical protein	NA	A0A286S1Q6	Klebsiella_phage	78.6	1.1e-43
AWV75699.1|2045662_2045896_-	hypothetical protein	NA	NA	NA	NA	NA
AWV75700.1|2046456_2046750_-	hypothetical protein	NA	NA	NA	NA	NA
AWV75701.1|2046921_2047614_-	helix-turn-helix transcriptional regulator	NA	A0A2H4FNG6	Salmonella_phage	65.4	4.3e-85
AWV78403.1|2047767_2047983_+	transcriptional regulator	NA	A0A2H4FNF3	Salmonella_phage	50.0	2.4e-10
AWV75702.1|2047984_2048194_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
AWV75703.1|2048186_2049209_+	hypothetical protein	NA	V5URT9	Shigella_phage	55.2	3.1e-47
AWV75704.1|2049312_2051184_+	bifunctional DNA primase/helicase	NA	K7PK08	Enterobacteria_phage	61.3	4.5e-230
AWV75705.1|2051185_2051497_+	hypothetical protein	NA	NA	NA	NA	NA
AWV75706.1|2051493_2052276_+	antitermination protein	NA	F1C595	Cronobacter_phage	79.1	9.4e-113
AWV75707.1|2052570_2053056_+	HNH endonuclease	NA	C4ML56	Xanthomonas_virus	42.7	1.5e-23
AWV75708.1|2053131_2053356_+	hypothetical protein	NA	NA	NA	NA	NA
AWV75709.1|2053467_2053848_+	hypothetical protein	NA	F1C592	Cronobacter_phage	80.2	1.9e-50
AWV75710.1|2053834_2054119_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	51.1	1.2e-17
AWV75711.1|2054115_2054565_+	lysozyme	NA	A0A0M4R365	Salmonella_phage	79.7	1.7e-58
AWV75712.1|2054564_2055110_+	hypothetical protein	NA	K7PHH7	Enterobacteria_phage	69.4	7.1e-51
AWV75713.1|2055226_2055442_+	hypothetical protein	NA	NA	NA	NA	NA
AWV75714.1|2055642_2056467_+	hypothetical protein	NA	K7PH02	Enterobacteria_phage	77.4	2.9e-19
AWV75715.1|2056479_2056707_+	hypothetical protein	NA	NA	NA	NA	NA
AWV75716.1|2056723_2058181_+	glycosyltransferase family 2 protein	NA	K7PKP3	Enterobacterial_phage	73.6	6.9e-218
AWV75717.1|2058453_2059662_+|transposase	IS4-like element ISVsa5 family transposase	transposase	Q9E8P4	Bluetongue_virus	100.0	3.0e-235
AWV75718.1|2059630_2059852_-	hypothetical protein	NA	Q38575	Escherichia_phage	70.7	5.1e-16
AWV75719.1|2060016_2060610_+	hypothetical protein	NA	S4TR53	Salmonella_phage	85.8	1.8e-100
AWV75720.1|2060602_2060971_+	HNH endonuclease	NA	S4TTG9	Salmonella_phage	91.8	3.7e-59
AWV75721.1|2061076_2061571_+|terminase	terminase small subunit	terminase	S4TNN3	Salmonella_phage	100.0	1.7e-83
AWV75722.1|2061567_2063229_+|terminase	terminase large subunit	terminase	S4TSQ6	Salmonella_phage	98.4	0.0e+00
AWV75723.1|2063287_2065222_+|capsid	phage major capsid protein	capsid	S4TNE3	Salmonella_phage	95.0	0.0e+00
AWV75724.1|2065425_2066781_+|portal	phage portal protein	portal	S4TTG7	Salmonella_phage	98.4	1.7e-258
AWV75725.1|2066777_2067692_+|head,tail	phage gp6-like head-tail connector protein	head,tail	S4TNN1	Salmonella_phage	76.9	4.3e-109
AWV75726.1|2067688_2068015_+|head,tail	phage gp6-like head-tail connector protein	head,tail	S4TSQ3	Salmonella_phage	90.7	3.4e-48
AWV75727.1|2068023_2068374_+|head,tail	head-tail adaptor protein	head,tail	S4TND9	Salmonella_phage	92.2	8.9e-55
AWV75728.1|2068370_2068820_+	hypothetical protein	NA	K7P6X4	Enterobacteria_phage	98.7	2.9e-74
AWV75729.1|2068816_2069164_+	DUF3168 domain-containing protein	NA	Q9MCS8	Enterobacteria_phage	98.3	1.5e-57
AWV75730.1|2069223_2069667_+	hypothetical protein	NA	K7PHL2	Enterobacterial_phage	93.8	4.6e-72
AWV75731.1|2069675_2070059_+|tail	phage tail protein	tail	K7PKV6	Enterobacterial_phage	93.7	4.4e-63
AWV75732.1|2070067_2070346_+	DUF4035 domain-containing protein	NA	Q9MCS5	Enterobacteria_phage	95.7	1.8e-42
AWV75733.1|2070401_2070743_+	hypothetical protein	NA	NA	NA	NA	NA
AWV78404.1|2070800_2074103_+|tail	phage tail tape measure protein	tail	K7P7L6	Enterobacteria_phage	85.2	0.0e+00
AWV75734.1|2074105_2074444_+|tail	phage tail protein	tail	K7PKL8	Enterobacterial_phage	59.8	7.3e-38
AWV75735.1|2074440_2075199_+|tail	phage minor tail protein L	tail	A0A1W6JNX9	Morganella_phage	63.6	2.3e-95
AWV75736.1|2075201_2075912_+	peptidase P60	NA	F1C573	Cronobacter_phage	69.8	1.5e-96
AWV75737.1|2075911_2076499_+|tail	tail assembly protein	tail	A0A1P8DTG7	Proteus_phage	47.4	6.1e-48
AWV75738.1|2076551_2080112_+	host specificity protein	NA	Q9MCU0	Escherichia_phage	69.8	0.0e+00
AWV78405.1|2080156_2080471_+	hypothetical protein	NA	A0A2P0WA17	Enterobacter_phage	67.6	7.8e-34
AWV75739.1|2080471_2081143_+	hypothetical protein	NA	A0A2P0WA07	Enterobacter_phage	73.1	7.6e-87
AWV75740.1|2081250_2081484_+	cor protein	NA	E4WL42	Enterobacteria_phage	75.3	8.6e-30
AWV78406.1|2082071_2082833_+|tail	phage tail protein	tail	G8C7K5	Escherichia_phage	67.6	4.0e-92
AWV75741.1|2082928_2083195_-	DinI family protein	NA	K7PKM2	Enterobacterial_phage	93.2	1.5e-38
AWV75742.1|2083559_2084126_-	hydrolase	NA	NA	NA	NA	NA
AWV75743.1|2084388_2086161_+|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
AWV75744.1|2086162_2086606_+	dihydroneopterin triphosphate diphosphatase	NA	NA	NA	NA	NA
AWV75745.1|2086633_2087374_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
AWV75746.1|2087408_2087930_+	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.6e-10
AWV75747.1|2088010_2088625_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
AWV75748.1|2088633_2089644_+	Holliday junction branch migration DNA helicase RuvB	NA	B3GAM6	uncultured_virus	29.9	2.4e-07
AWV75749.1|2089696_2090482_-	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
AWV75750.1|2090478_2091234_-	zinc ABC transporter ATP-binding protein ZnuC	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.8	8.8e-15
AWV75751.1|2091296_2092256_+	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
AWV75752.1|2092271_2093591_+	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	40.9	1.2e-14
AWV75753.1|2093708_2094680_+	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
AWV75754.1|2094723_2096166_-	pyruvate kinase	NA	NA	NA	NA	NA
AWV75755.1|2096280_2097150_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
AWV75756.1|2097506_2098982_+	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	36.2	6.0e-76
AWV75757.1|2099215_2101027_+	phosphogluconate dehydratase	NA	NA	NA	NA	NA
AWV75758.1|2101066_2101708_+	keto-hydroxyglutarate-aldolase/keto-deoxy- phosphogluconate aldolase	NA	NA	NA	NA	NA
AWV75759.1|2101782_2102961_-	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
AWV75760.1|2103132_2103783_+	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
AWV75761.1|2103858_2105934_+	oligopeptidase B	NA	NA	NA	NA	NA
AWV75762.1|2105915_2106578_-	exodeoxyribonuclease X	NA	NA	NA	NA	NA
AWV75763.1|2106602_2107253_-	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
AWV75764.1|2107364_2107595_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	7.0e-16
AWV75765.1|2107732_2108104_+	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
AWV75766.1|2108105_2108975_+	hypothetical protein	NA	NA	NA	NA	NA
AWV75767.1|2108991_2109330_+	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
2109550:2109579	attL	ACAGGAATCGTATTCGGTCTCTTTTTATCT	NA	NA	NA	NA
AWV75768.1|2109652_2110738_-|integrase	integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	68.4	1.6e-147
AWV75769.1|2110706_2110979_-	excisionase	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	64.4	2.9e-29
AWV75770.1|2111138_2111891_-	SAM-dependent methyltransferase	NA	A0A1P8VVC9	Erythrobacter_phage	41.4	9.9e-35
AWV75771.1|2112179_2112395_-	TraR/DksA family transcriptional regulator	NA	A0A0P0ZCX5	Stx2-converting_phage	61.4	3.2e-15
AWV75772.1|2112486_2112687_-	hypothetical protein	NA	NA	NA	NA	NA
AWV75773.1|2112683_2112956_-	hypothetical protein	NA	K7P7M4	Enterobacteria_phage	57.5	4.2e-20
AWV75774.1|2112952_2113171_-	hypothetical protein	NA	NA	NA	NA	NA
AWV75775.1|2113167_2113719_-	phage N-6-adenine-methyltransferase	NA	E5AGF8	Erwinia_phage	59.4	9.7e-56
AWV75776.1|2114035_2114716_-	exonuclease	NA	M9NZE1	Enterobacteria_phage	93.8	7.1e-125
AWV75777.1|2114712_2115558_-	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	61.6	2.1e-70
AWV75778.1|2115576_2115861_-	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	96.8	1.7e-48
AWV75779.1|2115933_2116143_-	cell division protein FtsZ	NA	M9NZE2	Enterobacteria_phage	95.7	6.7e-34
AWV78407.1|2116294_2116474_-	hypothetical protein	NA	Q3HQW9	Burkholderia_phage	55.1	9.6e-05
AWV75780.1|2116679_2117000_-	hypothetical protein	NA	NA	NA	NA	NA
AWV75781.1|2117639_2118227_-	hypothetical protein	NA	NA	NA	NA	NA
AWV75782.1|2118238_2118994_-	XRE family transcriptional regulator	NA	G8C7L8	Escherichia_phage	59.6	2.1e-77
AWV75783.1|2119029_2119257_+	Cro/Cl family transcriptional regulator	NA	A0A2I6PIE5	Escherichia_phage	57.7	1.4e-16
AWV75784.1|2119286_2119829_+	regulator	NA	M9NZI6	Enterobacteria_phage	79.4	3.2e-75
AWV75785.1|2119914_2120823_+	hypothetical protein	NA	K7PGZ0	Enterobacteria_phage	99.3	2.9e-158
AWV75786.1|2120819_2121509_+	phage replication protein	NA	G8C7U6	Escherichia_phage	94.8	1.1e-125
AWV75787.1|2121977_2122661_+	hypothetical protein	NA	NA	NA	NA	NA
AWV75788.1|2122661_2123150_+	hypothetical protein	NA	NA	NA	NA	NA
AWV75789.1|2123562_2124018_+	hypothetical protein	NA	I6PD71	Cronobacter_phage	66.9	5.4e-60
AWV75790.1|2124017_2124188_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	94.3	7.7e-20
AWV75791.1|2124180_2124471_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	90.6	1.8e-45
AWV75792.1|2124467_2124830_+	RusA family crossover junction endodeoxyribonuclease	NA	K7PM48	Enterobacteria_phage	82.2	1.6e-51
AWV75793.1|2124826_2124943_+	hypothetical protein	NA	NA	NA	NA	NA
AWV75794.1|2124939_2125629_+	antiterminator	NA	I6PDF8	Cronobacter_phage	51.5	2.5e-56
AWV75795.1|2126031_2126349_+|holin	holin	holin	E7C9S8	Salmonella_phage	86.7	8.9e-46
AWV75796.1|2126335_2126776_+	lysozyme	NA	A0A0M4R365	Salmonella_phage	76.5	1.4e-57
AWV75797.1|2126772_2127255_+|lysis	lysis protein	lysis	M9NYX9	Enterobacteria_phage	64.8	4.1e-42
AWV75798.1|2127318_2127726_+	hypothetical protein	NA	NA	NA	NA	NA
AWV75799.1|2128372_2128933_+|terminase	terminase small subunit	terminase	G0ZND3	Cronobacter_phage	76.3	2.0e-77
AWV75800.1|2128919_2130392_+	DNA-packaging protein	NA	G0ZND4	Cronobacter_phage	86.3	5.5e-255
AWV75801.1|2130403_2131855_+	DUF1073 domain-containing protein	NA	F1C5D7	Cronobacter_phage	50.1	8.1e-118
AWV75802.1|2131772_2132780_+|head	phage head morphogenesis protein	head	F1C5D8	Cronobacter_phage	67.7	2.4e-113
AWV75803.1|2132847_2133495_+	hypothetical protein	NA	NA	NA	NA	NA
AWV75804.1|2133682_2134039_-	hypothetical protein	NA	NA	NA	NA	NA
AWV75805.1|2134084_2135473_+	DUF2213 domain-containing protein	NA	F1C5D9	Cronobacter_phage	59.2	2.0e-153
AWV75806.1|2135476_2135911_+	hypothetical protein	NA	F1C5E0	Cronobacter_phage	74.3	5.1e-52
AWV75807.1|2135920_2137018_+|coat	phage coat protein	coat	F1C5E1	Cronobacter_phage	77.7	7.6e-161
AWV75808.1|2137027_2137393_+	hypothetical protein	NA	NA	NA	NA	NA
AWV75809.1|2137395_2137776_+	hypothetical protein	NA	F1C5E2	Cronobacter_phage	55.3	2.4e-29
AWV75810.1|2137775_2137949_+	50S ribosomal protein L13	NA	I6R0P9	Salmonella_phage	48.2	5.1e-11
AWV75811.1|2137948_2138305_+	hypothetical protein	NA	G0ZNE2	Cronobacter_phage	55.6	6.1e-27
AWV75812.1|2138307_2138772_+	HK97 gp10 family phage protein	NA	A0A2P1MXA4	Escherichia_phage	43.5	2.2e-29
AWV75813.1|2138768_2139152_+	hypothetical protein	NA	F1C5E4	Cronobacter_phage	64.6	2.3e-40
AWV75814.1|2139215_2139959_+	DNA breaking-rejoining protein	NA	F1C5E5	Cronobacter_phage	86.0	5.9e-72
AWV75815.1|2140016_2140709_+	hypothetical protein	NA	G0ZNE7	Cronobacter_phage	49.5	1.8e-54
AWV75816.1|2140756_2141137_+	hypothetical protein	NA	NA	NA	NA	NA
AWV75817.1|2141136_2141493_+	hypothetical protein	NA	A0A0P0IE45	Acinetobacter_phage	47.0	5.9e-14
AWV75818.1|2141547_2144478_+|tail	tail protein (tape measure)	tail	F1C5E9	Cronobacter_phage	46.8	1.8e-161
AWV75819.1|2144477_2144975_+	hypothetical protein	NA	F1C5F0	Cronobacter_phage	91.5	3.5e-89
AWV75820.1|2144974_2145445_+	hypothetical protein	NA	F1C5F1	Cronobacter_phage	93.6	8.2e-80
AWV75821.1|2145454_2145847_+	peptidoglycan endopeptidase	NA	F1C5F2	Cronobacter_phage	87.9	1.6e-65
AWV75822.1|2145833_2148311_+	MoaD/ThiS family protein	NA	F1C5A7	Cronobacter_phage	92.1	0.0e+00
AWV75823.1|2148369_2150385_+	hypothetical protein	NA	F1C5A8	Cronobacter_phage	61.8	5.5e-40
AWV75824.1|2150414_2151896_-	hypothetical protein	NA	NA	NA	NA	NA
AWV75825.1|2151892_2152834_-	glycosyltransferase	NA	U5P087	Shigella_phage	91.4	7.2e-160
AWV75826.1|2152830_2153193_-	GtrA family protein	NA	U5P0S6	Shigella_phage	84.2	2.0e-49
AWV75827.1|2153305_2153611_+	hypothetical protein	NA	I6PCW5	Cronobacter_phage	39.6	1.0e-14
AWV75828.1|2153610_2154879_+	DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	90.5	4.9e-228
AWV75829.1|2155308_2156289_-	DUF535 domain-containing protein	NA	NA	NA	NA	NA
2155160:2155189	attR	ACAGGAATCGTATTCGGTCTCTTTTTATCT	NA	NA	NA	NA
AWV75830.1|2156456_2157101_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	48.8	2.1e-54
AWV75831.1|2157135_2157375_-	DUF1480 family protein	NA	NA	NA	NA	NA
AWV78408.1|2157481_2158924_-	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
AWV75832.1|2159001_2161635_-	MCE family protein	NA	NA	NA	NA	NA
AWV78409.1|2161603_2162887_-	paraquat-inducible protein A	NA	NA	NA	NA	NA
AWV75833.1|2163019_2163517_+	GAF domain-containing protein	NA	NA	NA	NA	NA
AWV75834.1|2163613_2164300_+	RNA chaperone ProQ	NA	NA	NA	NA	NA
AWV75835.1|2164319_2166368_+	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	32.6	7.8e-82
AWV75836.1|2166561_2167443_+|protease	protease HtpX	protease	NA	NA	NA	NA
>prophage 3
CP030007	Enterobacter hormaechei subsp. xiangfangensis strain Pb204 chromosome, complete genome	4956155	3682427	3730653	4956155	holin,tail,integrase,terminase	Cronobacter_phage(24.14%)	70	3682201:3682247	3730667:3730713
3682201:3682247	attL	AATGGCACGCCCTGTAGGATTCGAACCTACGACCTACGGCTTAGAAG	NA	NA	NA	NA
AWV77183.1|3682427_3682751_-	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	49.5	7.0e-22
AWV77184.1|3682750_3682990_-	hypothetical protein	NA	K7P7E2	Enterobacteria_phage	69.2	1.0e-25
AWV77185.1|3683102_3683465_+	GtrA family protein	NA	B9UDL8	Salmonella_phage	71.7	4.3e-44
AWV77186.1|3683461_3684394_+	glycosyltransferase	NA	U5P087	Shigella_phage	91.4	1.9e-160
AWV77187.1|3684403_3685906_+	hypothetical protein	NA	Q8LTG0	Salmonella_phage	27.1	4.3e-37
AWV77188.1|3685953_3688158_-	hypothetical protein	NA	F1C5A8	Cronobacter_phage	60.6	8.7e-39
AWV77189.1|3688216_3690694_-	MoaD/ThiS family protein	NA	F1C5A7	Cronobacter_phage	92.7	0.0e+00
AWV78460.1|3690680_3691046_-	peptidoglycan endopeptidase	NA	F1C5F2	Cronobacter_phage	85.7	3.3e-60
AWV77190.1|3691069_3691534_-	HNH endonuclease	NA	S4TVL1	Salmonella_phage	42.4	5.5e-28
AWV77191.1|3691610_3692081_-	hypothetical protein	NA	F1C5F1	Cronobacter_phage	92.9	2.4e-79
AWV77192.1|3692080_3692578_-	hypothetical protein	NA	F1C5F0	Cronobacter_phage	92.1	3.8e-91
AWV77193.1|3692619_3692847_-	hypothetical protein	NA	NA	NA	NA	NA
AWV77194.1|3692857_3695533_-|tail	phage tail tape measure protein	tail	A0A1B1W284	Salmonella_phage	34.9	3.8e-97
AWV77195.1|3695590_3695953_-	hypothetical protein	NA	NA	NA	NA	NA
AWV77196.1|3696062_3696737_-	hypothetical protein	NA	G0ZNE7	Cronobacter_phage	50.2	1.0e-54
AWV77197.1|3696794_3697538_-	DNA breaking-rejoining protein	NA	F1C5E5	Cronobacter_phage	86.0	1.7e-71
AWV77198.1|3697601_3697985_-	hypothetical protein	NA	F1C5E4	Cronobacter_phage	63.8	8.9e-40
AWV77199.1|3697981_3698389_-	HK97 gp10 family phage protein	NA	A0A291AXD9	Shigella_phage	51.1	1.4e-30
AWV77200.1|3698391_3698748_-	hypothetical protein	NA	G0ZNE2	Cronobacter_phage	56.4	2.7e-27
AWV77201.1|3698747_3698921_-	50S ribosomal protein L13	NA	Q5G8X7	Enterobacteria_phage	50.9	4.6e-12
AWV77202.1|3698965_3699511_-	HNH endonuclease	NA	A0A2D2W633	Pectobacterium_phage	44.0	6.3e-23
AWV78461.1|3699566_3699965_-	hypothetical protein	NA	G0ZNE1	Cronobacter_phage	79.2	1.7e-54
AWV77203.1|3700008_3700557_-	HNH endonuclease	NA	A0A2D2W633	Pectobacterium_phage	35.3	2.3e-20
AWV77204.1|3700649_3700943_-	hypothetical protein	NA	A0A1V0E5P8	Salmonella_phage	89.7	1.5e-42
AWV77205.1|3700952_3702029_-	hypothetical protein	NA	Q5G8Y0	Enterobacteria_phage	91.3	1.9e-188
AWV77206.1|3702046_3702496_-	hypothetical protein	NA	A0A1V0E5Q8	Salmonella_phage	86.6	7.1e-65
AWV77207.1|3702508_3703774_-	hypothetical protein	NA	Q5G8Y2	Enterobacteria_phage	87.6	7.6e-213
AWV77208.1|3703776_3705510_-	hypothetical protein	NA	G0ZND6	Cronobacter_phage	66.5	6.5e-215
AWV77209.1|3705469_3706819_-	DUF1073 domain-containing protein	NA	A0A1V0E5Q5	Salmonella_phage	87.3	1.3e-231
AWV77210.1|3707273_3707615_-	hypothetical protein	NA	NA	NA	NA	NA
AWV77211.1|3707759_3709013_-|terminase	PBSX family phage terminase large subunit	terminase	I6RSK1	Salmonella_phage	96.7	4.4e-213
AWV77212.1|3709009_3709444_-	ubiquitin carboxyl-hydrolase	NA	Q716H4	Shigella_phage	73.9	8.5e-47
AWV77213.1|3709450_3709669_-	hypothetical protein	NA	NA	NA	NA	NA
AWV77214.1|3709819_3710095_-	hypothetical protein	NA	K7P6G5	Enterobacteria_phage	71.4	2.8e-27
AWV77215.1|3710413_3710890_-	Rz lytic protein	NA	NA	NA	NA	NA
AWV77216.1|3710877_3711522_-	glycoside hydrolase family 19 protein	NA	F1C5D2	Cronobacter_phage	43.8	3.1e-37
AWV77217.1|3711505_3711877_-|holin	holin	holin	A0A2D1GNJ3	Pseudomonas_phage	32.4	1.3e-06
AWV77218.1|3711969_3712512_-	HNH endonuclease	NA	D6PIK0	uncultured_phage	40.7	1.1e-22
AWV77219.1|3712725_3713415_-	antiterminator	NA	I6PDF8	Cronobacter_phage	50.2	6.0e-55
AWV77220.1|3713411_3713528_-	hypothetical protein	NA	NA	NA	NA	NA
AWV77221.1|3713514_3713715_-	hypothetical protein	NA	NA	NA	NA	NA
AWV77222.1|3713711_3714323_-	recombination protein NinG	NA	M9NYX8	Enterobacteria_phage	48.4	2.4e-39
AWV77223.1|3714315_3714486_-	hypothetical protein	NA	G8C7V4	Escherichia_phage	82.1	5.0e-19
AWV77224.1|3714478_3714928_-	recombination protein NinB	NA	I6R9D0	Salmonella_phage	47.2	2.5e-33
AWV77225.1|3715156_3715558_-	hypothetical protein	NA	NA	NA	NA	NA
AWV77226.1|3715557_3715830_-	hypothetical protein	NA	NA	NA	NA	NA
AWV77227.1|3715834_3716590_-	DUF551 domain-containing protein	NA	K7P7E4	Enterobacteria_phage	37.7	2.2e-34
AWV77228.1|3716586_3717063_-	hypothetical protein	NA	M9NZE4	Enterobacteria_phage	44.8	1.9e-15
AWV77229.1|3717059_3717389_-	hypothetical protein	NA	NA	NA	NA	NA
AWV77230.1|3717385_3717823_-	hypothetical protein	NA	K7PGR4	Enterobacteria_phage	67.0	3.6e-29
AWV77231.1|3717819_3718131_-	protein ren	NA	M1FPD5	Enterobacteria_phage	50.5	7.7e-18
AWV77232.1|3718120_3719494_-	replicative DNA helicase	NA	E5AGF0	Erwinia_phage	63.1	4.9e-165
AWV77233.1|3720893_3721460_-	hypothetical protein	NA	NA	NA	NA	NA
AWV77234.1|3721490_3721709_-	XRE family transcriptional regulator	NA	A0A0N7C2U7	Escherichia_phage	47.0	1.9e-10
AWV77235.1|3721817_3722477_+	LexA family transcriptional regulator	NA	F1C599	Cronobacter_phage	65.6	3.0e-72
AWV77236.1|3723250_3723448_-	hypothetical protein	NA	G8C7T7	Escherichia_phage	96.9	2.4e-25
AWV77237.1|3723872_3724415_+	Pathogenesis-related transcriptional factor and ERF protein	NA	A0A0N9RV98	Escherichia_phage	44.4	1.4e-30
AWV78462.1|3724844_3725042_+	hypothetical protein	NA	B5WZV1	Pseudomonas_phage	51.9	4.7e-05
AWV77238.1|3725193_3725403_+	cell division protein FtsZ	NA	M9NZE2	Enterobacteria_phage	95.7	6.7e-34
AWV77239.1|3725475_3725760_+	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	96.8	1.7e-48
AWV77240.1|3725778_3726525_+	phage recombination protein Bet	NA	A0A0M4RD39	Salmonella_phage	65.8	1.8e-65
AWV77241.1|3726521_3727139_+	exonuclease	NA	A0A0S2SY31	Pseudomonas_phage	57.3	3.6e-59
AWV77242.1|3727379_3727706_+	protein ninX	NA	R9VYJ6	Serratia_phage	40.6	1.0e-12
AWV77243.1|3727695_3728229_+	hypothetical protein	NA	A0A1B1PEF9	Pectobacterium_phage	38.0	8.0e-23
AWV77244.1|3728191_3728431_+	DUF4222 domain-containing protein	NA	Q6H9Z8	Enterobacteria_phage	47.4	1.2e-10
AWV77245.1|3728440_3728626_+	hypothetical protein	NA	A0A1B0V7L5	Salmonella_phage	50.0	5.3e-06
AWV77246.1|3728710_3728908_+	hypothetical protein	NA	S4TWN3	Salmonella_phage	50.0	1.1e-12
AWV77247.1|3729068_3729269_+	hypothetical protein	NA	G8C7S1	Escherichia_phage	95.5	6.0e-32
AWV78463.1|3729277_3729613_+	DNA-binding protein	NA	NA	NA	NA	NA
AWV78464.1|3729609_3730653_+|integrase	integrase	integrase	G8C7S0	Escherichia_phage	97.1	4.7e-200
3730667:3730713	attR	AATGGCACGCCCTGTAGGATTCGAACCTACGACCTACGGCTTAGAAG	NA	NA	NA	NA
>prophage 4
CP030007	Enterobacter hormaechei subsp. xiangfangensis strain Pb204 chromosome, complete genome	4956155	4016602	4089497	4956155	protease,terminase,tRNA,capsid,tail,portal,head	uncultured_Caudovirales_phage(44.44%)	66	NA	NA
AWV77510.1|4016602_4017955_-|protease	sigma E protease regulator RseP	protease	NA	NA	NA	NA
AWV77511.1|4017966_4018824_-	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
AWV77512.1|4018836_4019595_-	(2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase	NA	R9W0U9	Flavobacterium_phage	43.0	1.4e-25
AWV77513.1|4019780_4020980_-	1-deoxy-D-xylulose-5-phosphate reductoisomerase	NA	NA	NA	NA	NA
AWV77514.1|4021072_4021630_-	ribosome recycling factor	NA	NA	NA	NA	NA
AWV77515.1|4021797_4022523_-	UMP kinase	NA	NA	NA	NA	NA
AWV77516.1|4022672_4023524_-	elongation factor Ts	NA	NA	NA	NA	NA
AWV77517.1|4023641_4024367_-	30S ribosomal protein S2	NA	NA	NA	NA	NA
AWV77518.1|4024688_4025483_+	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
AWV78473.1|4025545_4028221_+	bifunctional uridylyltransferase/uridylyl-removing protein GlnD	NA	NA	NA	NA	NA
AWV77519.1|4028253_4029078_+	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase	NA	NA	NA	NA	NA
AWV77520.1|4029189_4029579_+	DUF3461 family protein	NA	NA	NA	NA	NA
AWV77521.1|4029668_4030826_-	CdaR family transcriptional regulator	NA	NA	NA	NA	NA
AWV77522.1|4030972_4032406_-|protease	serine endoprotease DegP	protease	A0A1B1IT49	uncultured_Mediterranean_phage	29.2	2.5e-26
AWV77523.1|4032538_4034053_-	dGTPase	NA	NA	NA	NA	NA
AWV77524.1|4034135_4034834_+	5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase	NA	NA	NA	NA	NA
AWV77525.1|4034826_4035636_+	vitamin B12 ABC transporter substrate-binding protein BtuF	NA	NA	NA	NA	NA
AWV77526.1|4035660_4036284_+	hypothetical protein	NA	NA	NA	NA	NA
AWV77527.1|4036342_4036687_-	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	51.4	4.5e-27
AWV77528.1|4036772_4038173_-	H(+)/Cl(-) exchange transporter ClcA	NA	NA	NA	NA	NA
AWV77529.1|4038350_4039631_+	glutamate-1-semialdehyde-2,1-aminomutase	NA	NA	NA	NA	NA
AWV77530.1|4039719_4040079_-	hypothetical protein	NA	NA	NA	NA	NA
AWV77531.1|4040103_4042086_-	Fe(3+)-hydroxamate ABC transporter permease FhuB	NA	NA	NA	NA	NA
AWV77532.1|4042082_4042973_-	Fe(3+)-hydroxamate ABC transporter substrate-binding protein FhuD	NA	NA	NA	NA	NA
AWV77533.1|4042972_4043770_-	Fe3+-hydroxamate ABC transporter ATP-binding protein FhuC	NA	G9BWD6	Planktothrix_phage	26.9	3.0e-13
AWV77534.1|4043820_4046031_-	ferrichrome porin FhuA	NA	NA	NA	NA	NA
AWV77535.1|4046235_4046934_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
AWV77536.1|4047227_4049705_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
AWV77537.1|4049725_4050439_-	molecular chaperone	NA	NA	NA	NA	NA
AWV77538.1|4050482_4051091_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
AWV77539.1|4051363_4053889_-	bifunctional glycosyl transferase/transpeptidase	NA	NA	NA	NA	NA
AWV77540.1|4054041_4056471_-	ATP-dependent helicase HrpB	NA	A0A0G2Y9F4	Acanthamoeba_polyphaga_mimivirus	30.3	4.5e-36
AWV77541.1|4056544_4057099_+	RNA 2',3'-cyclic phosphodiesterase	NA	NA	NA	NA	NA
AWV77542.1|4057088_4057793_+	DNA/RNA nuclease SfsA	NA	NA	NA	NA	NA
AWV77543.1|4057969_4058425_+	RNA polymerase-binding transcription factor DksA	NA	NA	NA	NA	NA
AWV77544.1|4058484_4059375_+|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
AWV78474.1|4059390_4060815_+	polynucleotide adenylyltransferase	NA	H7BUW3	unidentified_phage	31.5	1.6e-25
AWV77545.1|4060811_4061291_+	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
AWV77546.1|4061414_4062206_+	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	NA	NA	NA	NA
AWV77547.1|4062217_4063069_+	pantoate--beta-alanine ligase	NA	NA	NA	NA	NA
AWV77548.1|4063101_4063482_+	aspartate 1-decarboxylase	NA	NA	NA	NA	NA
AWV77549.1|4063759_4064368_+	fimbrial assembly protein	NA	NA	NA	NA	NA
AWV77550.1|4064448_4065192_+	fimbrial chaperone	NA	NA	NA	NA	NA
AWV77551.1|4065273_4067865_+	outer membrane usher protein	NA	NA	NA	NA	NA
AWV77552.1|4067893_4068469_+	fimbrial protein	NA	NA	NA	NA	NA
AWV77553.1|4068495_4069059_+	fimbrial protein	NA	NA	NA	NA	NA
AWV77554.1|4069073_4069682_+	fimbrial protein	NA	NA	NA	NA	NA
AWV77555.1|4069693_4070770_+	fimbrial protein StkG	NA	NA	NA	NA	NA
AWV77556.1|4070771_4072019_-	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
AWV77557.1|4072082_4072523_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
AWV77558.1|4072628_4073399_-	ABC transporter permease	NA	NA	NA	NA	NA
AWV77559.1|4073395_4074322_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	32.3	5.3e-22
AWV77560.1|4074429_4075092_+	carbonate dehydratase	NA	NA	NA	NA	NA
AWV77561.1|4075242_4076586_+	hypothetical protein	NA	NA	NA	NA	NA
AWV77562.1|4076632_4077169_-	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	33.1	1.3e-17
AWV77563.1|4077362_4080668_-|tail	phage tail tape measure protein	tail	Q9MCS3	Enterobacteria_phage	56.2	9.3e-295
AWV77564.1|4080681_4082343_-|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	98.0	0.0e+00
AWV77565.1|4082326_4082683_-|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	94.0	3.9e-58
AWV77566.1|4082956_4083400_-	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	63.3	1.1e-49
AWV77567.1|4083399_4083693_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	84.5	1.3e-43
AWV77568.1|4083689_4084028_-|head,tail	head-tail adaptor protein	head,tail	A0A2H4JHK5	uncultured_Caudovirales_phage	90.2	1.8e-52
AWV78475.1|4084024_4085251_-|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	97.3	2.0e-234
AWV77569.1|4085261_4085822_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	97.8	2.9e-100
AWV77570.1|4085873_4087040_-|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	99.7	5.2e-216
AWV77571.1|4087260_4087443_-	hypothetical protein	NA	NA	NA	NA	NA
AWV77572.1|4087745_4089497_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	51.8	3.2e-129
>prophage 5
CP030007	Enterobacter hormaechei subsp. xiangfangensis strain Pb204 chromosome, complete genome	4956155	4562185	4574776	4956155		uncultured_Caudovirales_phage(55.56%)	13	NA	NA
AWV77992.1|4562185_4563220_-	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	57.9	3.4e-110
AWV78491.1|4563269_4564544_-	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	60.0	4.4e-144
AWV77993.1|4564585_4565026_-	peptidase	NA	A0A1W6JNS2	Morganella_phage	53.3	3.6e-29
AWV77994.1|4565219_4566119_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AWV77995.1|4566217_4566745_+	N-acetyltransferase	NA	A0A2H4J136	uncultured_Caudovirales_phage	37.1	7.2e-16
AWV77996.1|4566741_4567974_+	MFS transporter	NA	NA	NA	NA	NA
AWV77997.1|4568022_4568358_+	ArsR family transcriptional regulator	NA	NA	NA	NA	NA
AWV78492.1|4568363_4569077_+	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	71.7	1.2e-95
AWV77998.1|4569133_4569562_-	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.0	6.2e-50
AWV77999.1|4569611_4570895_-	arsenical efflux pump membrane protein ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	75.1	2.9e-175
AWV78000.1|4570991_4571345_-	transcriptional regulator	NA	A0A2H4J145	uncultured_Caudovirales_phage	57.3	2.2e-21
AWV78001.1|4571607_4572066_-	Cd(II)/Pb(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
AWV78493.1|4572574_4574776_+	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	45.4	1.9e-134
