The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP021971	Hafnia alvei strain CBA7135 chromosome, complete genome	4498956	1582469	1594030	4498956	tRNA	Escherichia_phage(62.5%)	10	NA	NA
AWV44412.1|1582469_1583813_+	recombination factor protein RarA	NA	G3MBE0	Bacillus_virus	41.0	4.8e-80
AWV44413.1|1583921_1585214_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	43.8	3.1e-92
AWV46861.1|1585697_1588142_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.1	1.3e-213
AWV44414.1|1588152_1588773_+	dimethylsulfoxide reductase, chain B	NA	A0A077SL61	Escherichia_phage	59.6	4.3e-76
AWV44415.1|1588774_1589635_+	dimethylsulfoxide reductase	NA	A0A077SK59	Escherichia_phage	35.7	2.1e-25
AWV44416.1|1589748_1590363_+	DMSO reductase maturation protein DsmD	NA	A0A077SLS7	Escherichia_phage	39.7	3.5e-30
AWV44417.1|1590362_1590950_+	ferredoxin-type protein NapF	NA	A0A077SLP0	Escherichia_phage	38.0	6.6e-26
AWV44418.1|1591066_1592206_+	MFS transporter	NA	NA	NA	NA	NA
AWV44419.1|1592281_1592737_-	transcriptional regulator	NA	NA	NA	NA	NA
AWV44420.1|1593289_1594030_-	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.5	8.0e-21
>prophage 2
CP021971	Hafnia alvei strain CBA7135 chromosome, complete genome	4498956	1764165	1797003	4498956	tail,plate,holin,capsid,head,integrase	Escherichia_phage(41.94%)	37	1755600:1755614	1805713:1805727
1755600:1755614	attL	AAATGCGCAAAGAAA	NA	NA	NA	NA
AWV44545.1|1764165_1764384_-	transcriptional regulator	NA	A0A2I8TV89	Erwinia_phage	70.8	4.1e-26
AWV44546.1|1764505_1765669_-	hypothetical protein	NA	S4TRX8	Salmonella_phage	74.7	6.6e-155
AWV44547.1|1765665_1766151_-|tail	phage tail protein	tail	A0A0F7LDE8	Escherichia_phage	60.1	7.3e-47
AWV44548.1|1766163_1768608_-|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	61.8	9.1e-239
AWV44549.1|1768597_1768732_-|tail	GpE family phage tail protein	tail	Q858U8	Yersinia_virus	73.7	9.6e-10
AWV44550.1|1768764_1769073_-	hypothetical protein	NA	A0A0F7LDQ8	Escherichia_phage	76.1	6.0e-31
AWV44551.1|1769132_1769651_-|tail	phage major tail tube protein	tail	A0A218M4J0	Erwinia_phage	79.7	2.2e-78
AWV44552.1|1769664_1770852_-|tail	phage tail protein	tail	A0A0F7LBW9	Escherichia_phage	81.8	2.3e-187
AWV44553.1|1770990_1771542_-|tail	phage tail protein	tail	A0A0A7NRZ7	Enterobacteria_phage	43.5	4.4e-32
AWV46866.1|1771538_1772486_-	hypothetical protein	NA	A0A0A0RVQ0	Citrobacter_phage	34.9	2.2e-07
AWV44554.1|1773390_1773951_-|tail	phage tail protein I	tail	Q858V5	Yersinia_virus	79.4	1.8e-81
AWV44555.1|1773943_1774852_-|plate	baseplate assembly protein	plate	Q6K1H4	Salmonella_virus	78.5	2.3e-126
AWV44556.1|1774855_1775203_-|plate	baseplate assembly protein	plate	F1BUP4	Erwinia_phage	70.2	1.5e-38
AWV44557.1|1775199_1775838_-|plate	baseplate assembly protein	plate	A0A0M4S6F6	Salmonella_phage	62.0	5.8e-68
AWV44558.1|1776076_1777615_+	hypothetical protein	NA	NA	NA	NA	NA
AWV44559.1|1777715_1778162_-	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	66.0	7.1e-49
AWV44560.1|1778154_1778622_-|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	69.7	9.7e-57
AWV44561.1|1778717_1779143_-	hypothetical protein	NA	A0A0F7L9Y0	Escherichia_phage	42.3	2.3e-20
AWV44562.1|1779139_1779640_-	lysozyme	NA	A0A0F7LBS0	Escherichia_phage	77.2	7.4e-71
AWV44563.1|1779639_1779936_-|holin	holin	holin	A0A0F7LA12	Escherichia_phage	76.1	1.4e-29
AWV44564.1|1779939_1780143_-|tail	phage tail protein	tail	U5N3E7	Enterobacteria_phage	74.6	5.7e-22
AWV44565.1|1780142_1780628_-|head	head completion/stabilization protein	head	M1SNN6	Escherichia_phage	61.3	2.3e-53
AWV44566.1|1780720_1781377_-	hypothetical protein	NA	A0A218M4L0	Erwinia_phage	67.3	2.7e-73
AWV44567.1|1781379_1782453_-|capsid	phage major capsid protein, P2 family	capsid	Q94MJ7	Enterobacteria_phage	70.9	4.5e-150
AWV44568.1|1782499_1783345_-|capsid	GPO family capsid scaffolding protein	capsid	Q01088	Escherichia_phage	62.1	2.2e-91
AWV44569.1|1783487_1785257_+	oxidoreductase	NA	Q9T0R3	Escherichia_phage	79.5	1.3e-279
AWV44570.1|1786184_1786409_-	hypothetical protein	NA	NA	NA	NA	NA
AWV44571.1|1786833_1787961_-	hypothetical protein	NA	NA	NA	NA	NA
AWV44572.1|1788134_1788320_-	hypothetical protein	NA	NA	NA	NA	NA
AWV44573.1|1788439_1790719_-	replication protein	NA	S4TTC1	Salmonella_phage	60.6	1.8e-260
AWV44574.1|1790715_1790934_-	hypothetical protein	NA	Q6K1F5	Salmonella_virus	53.5	7.6e-12
AWV44575.1|1791003_1791513_-	replication protein B	NA	A0A0F7LBQ6	Escherichia_phage	54.5	1.9e-45
AWV46867.1|1791694_1792213_-	hypothetical protein	NA	F1BUS6	Erwinia_phage	42.1	2.6e-26
AWV44576.1|1792588_1793152_+	Cro/Cl family transcriptional regulator	NA	Q6K1G0	Salmonella_virus	39.4	1.7e-26
AWV44577.1|1793160_1795266_+	hypothetical protein	NA	NA	NA	NA	NA
AWV44578.1|1795265_1795952_+	hypothetical protein	NA	NA	NA	NA	NA
AWV44579.1|1795998_1797003_+|integrase	integrase	integrase	Q94N03	Haemophilus_virus	61.1	1.7e-111
1805713:1805727	attR	AAATGCGCAAAGAAA	NA	NA	NA	NA
>prophage 3
CP021971	Hafnia alvei strain CBA7135 chromosome, complete genome	4498956	2149708	2163608	4498956	tRNA	Tupanvirus(33.33%)	13	NA	NA
AWV44874.1|2149708_2151646_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.7	1.6e-129
AWV44875.1|2151641_2152184_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	33.7	8.8e-17
AWV44876.1|2152282_2152480_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
AWV44877.1|2152522_2152879_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
AWV44878.1|2153345_2154329_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2H4UW22	Bodo_saltans_virus	38.0	1.7e-34
AWV44879.1|2154343_2156731_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	A0A1L3IZU3	BeAn_58058_virus	28.9	6.6e-08
AWV44880.1|2156735_2157032_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	3.2e-13
AWV44881.1|2157115_2157313_+	hypothetical protein	NA	NA	NA	NA	NA
AWV44882.1|2157371_2158397_+	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
AWV46899.1|2158399_2159185_+	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2K9L407	Tupanvirus	24.3	7.5e-09
AWV44883.1|2159468_2160617_+	UDP-4-amino-4-deoxy-L-arabinose--oxoglutarate aminotransferase	NA	C7U074	Ostreococcus_tauri_virus	27.8	1.2e-23
AWV44884.1|2160609_2161626_+	undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase	NA	A8CG95	Salmonella_phage	33.9	1.5e-38
AWV44885.1|2161625_2163608_+	bifunctional UDP-glucuronic acid oxidase/UDP-4-amino-4-deoxy-L-arabinose formyltransferase	NA	A0A2K9KZK0	Tupanvirus	25.4	9.6e-21
>prophage 4
CP021971	Hafnia alvei strain CBA7135 chromosome, complete genome	4498956	3278370	3296627	4498956	tRNA,tail,integrase	Cronobacter_phage(33.33%)	18	3282809:3282832	3296671:3296694
AWV45811.1|3278370_3279342_-	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	38.1	2.3e-44
AWV45812.1|3279352_3281209_-	protein translocase subunit SecD	NA	NA	NA	NA	NA
AWV45813.1|3281236_3281569_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	35.2	3.4e-11
AWV45814.1|3281670_3282798_-|tRNA	tRNA-guanine(34) transglycosylase	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	47.5	2.9e-91
3282809:3282832	attL	CAGCATCAGAAAAACAGTCTGATG	NA	NA	NA	NA
AWV45815.1|3283009_3283387_-	hypothetical protein	NA	Q6UAV9	Klebsiella_phage	48.0	2.1e-25
AWV45816.1|3283628_3283994_+	translocase	NA	F1C5B1	Cronobacter_phage	67.5	4.9e-40
AWV45817.1|3283990_3284911_+	glycosyltransferase	NA	F1C5B0	Cronobacter_phage	85.9	2.3e-150
AWV45818.1|3284907_3286368_+	hypothetical protein	NA	F1C5A9	Cronobacter_phage	28.3	1.0e-35
AWV45819.1|3288545_3291011_-|tail	phage tail protein	tail	F1C5A7	Cronobacter_phage	54.7	8.8e-266
AWV45820.1|3290958_3291390_-	hypothetical protein	NA	F1C5F2	Cronobacter_phage	64.8	5.1e-44
AWV45821.1|3291802_3292264_-	hypothetical protein	NA	M9NZB0	Enterobacteria_phage	49.7	2.5e-33
AWV45822.1|3293160_3293511_+	hypothetical protein	NA	H2BD37	Pseudomonas_phage	52.5	2.6e-22
AWV45823.1|3293512_3293734_+	hypothetical protein	NA	K7P6F8	Enterobacteria_phage	78.5	5.3e-21
AWV45824.1|3293777_3294098_+	hypothetical protein	NA	NA	NA	NA	NA
AWV45825.1|3294418_3294622_+	hypothetical protein	NA	A0A2I7R756	Vibrio_phage	40.3	2.2e-05
AWV45826.1|3294618_3295161_+	phage N-6-adenine-methyltransferase	NA	G9L688	Escherichia_phage	67.9	2.0e-61
AWV45827.1|3295162_3295381_+	hypothetical protein	NA	NA	NA	NA	NA
AWV45828.1|3295580_3296627_+|integrase	integrase	integrase	A0A077KGX2	Edwardsiella_phage	36.9	4.4e-57
3296671:3296694	attR	CAGCATCAGAAAAACAGTCTGATG	NA	NA	NA	NA
