The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP029800	Salmonella enterica subsp. enterica serovar Anatum strain R16.0676 chromosome, complete genome	4674190	310431	319513	4674190	protease,integrase	Ralstonia_phage(16.67%)	10	308824:308836	328010:328022
308824:308836	attL	CTGTTTTACCTTA	NA	NA	NA	NA
AWU80058.1|310431_311673_-|integrase	site-specific integrase	integrase	A0A077KET4	Ralstonia_phage	40.7	2.5e-75
AWU80059.1|311639_311828_-	hypothetical protein	NA	NA	NA	NA	NA
AWU80060.1|312200_312578_+|integrase	integrase	integrase	NA	NA	NA	NA
AWU80061.1|312739_312937_+	hypothetical protein	NA	NA	NA	NA	NA
AWU80062.1|313149_315426_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
AWU80063.1|315456_315777_-|protease	ATP-dependent Clp protease adaptor ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
AWU80064.1|316100_316322_+	cold shock domain protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
AWU80065.1|316276_316471_-	hypothetical protein	NA	NA	NA	NA	NA
AWU80066.1|316451_318398_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	42.3	9.1e-40
AWU80067.1|318394_319513_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.4e-08
328010:328022	attR	TAAGGTAAAACAG	NA	NA	NA	NA
>prophage 2
CP029800	Salmonella enterica subsp. enterica serovar Anatum strain R16.0676 chromosome, complete genome	4674190	1710059	1754837	4674190	tail,plate,tRNA	Burkholderia_phage(40.91%)	47	NA	NA
AWU81322.1|1710059_1711058_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
AWU81323.1|1711145_1712456_-	conjugal transfer protein	NA	NA	NA	NA	NA
AWU81324.1|1712702_1713218_+	transcriptional regulator Zur	NA	NA	NA	NA	NA
AWU81325.1|1713317_1713527_-	CsbD family protein	NA	NA	NA	NA	NA
AWU84116.1|1713548_1713662_-	hypothetical protein	NA	NA	NA	NA	NA
AWU81326.1|1713658_1714984_-	MATE family efflux transporter	NA	NA	NA	NA	NA
AWU81327.1|1715162_1715771_-	LexA repressor	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
AWU81328.1|1715879_1716248_-	diacylglycerol kinase	NA	NA	NA	NA	NA
AWU81329.1|1716418_1718839_+	glycerol-3-phosphate 1-O-acyltransferase	NA	NA	NA	NA	NA
AWU81330.1|1718937_1719810_-	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
AWU81331.1|1719823_1720321_-	chorismate--pyruvate lyase	NA	NA	NA	NA	NA
AWU81332.1|1720501_1721419_-	maltose operon protein MalM	NA	NA	NA	NA	NA
AWU81333.1|1721582_1722941_-	maltoporin	NA	NA	NA	NA	NA
AWU81334.1|1723029_1724139_-	maltose/maltodextrin import ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	47.2	6.2e-17
AWU81335.1|1724500_1725691_+	maltose/maltodextrin ABC transporter substrate-binding protein MalE	NA	NA	NA	NA	NA
AWU81336.1|1725822_1727367_+	maltose ABC transporter permease MalF	NA	NA	NA	NA	NA
AWU81337.1|1727381_1728272_+	maltose ABC transporter permease	NA	NA	NA	NA	NA
AWU81338.1|1728437_1728848_-	phosphate-starvation-inducible protein PsiE	NA	NA	NA	NA	NA
AWU81339.1|1728990_1731087_-	YjbH domain-containing protein	NA	NA	NA	NA	NA
AWU81340.1|1731086_1731824_-	hypothetical protein	NA	NA	NA	NA	NA
AWU81341.1|1731820_1732459_-	YjbF family lipoprotein	NA	NA	NA	NA	NA
AWU81342.1|1732522_1732765_-	outer membrane protein	NA	NA	NA	NA	NA
AWU81343.1|1733208_1734858_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
AWU81344.1|1735202_1736552_+	lysine-sensitive aspartokinase 3	NA	NA	NA	NA	NA
AWU81345.1|1736682_1737030_-	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.5	4.9e-21
AWU81346.1|1737605_1737893_+	hypothetical protein	NA	Q6QIC8	Burkholderia_phage	48.1	5.1e-16
AWU81347.1|1737895_1738501_+	lytic transglycosylase domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	60.4	6.5e-61
AWU81348.1|1738513_1738828_+	hypothetical protein	NA	Q6QIC4	Burkholderia_phage	49.1	6.4e-20
AWU81349.1|1738987_1739443_+	hypothetical protein	NA	NA	NA	NA	NA
AWU81350.1|1739439_1739637_+	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	52.9	6.6e-07
AWU81351.1|1739626_1741054_+|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	71.2	8.1e-195
AWU81352.1|1741053_1741578_+|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.5	8.1e-68
AWU81353.1|1741629_1741947_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
AWU81354.1|1741906_1742035_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
AWU81355.1|1742131_1744486_+|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	30.6	3.1e-66
AWU81356.1|1744485_1745439_+	chemotaxis protein	NA	A4JWL1	Burkholderia_virus	51.5	7.9e-37
AWU81357.1|1745438_1745648_+	hypothetical protein	NA	A4JWL2	Burkholderia_virus	60.3	9.8e-17
AWU81358.1|1745635_1746679_+	phage protein D	NA	Q6QIA2	Burkholderia_phage	45.1	4.2e-76
AWU81359.1|1746688_1747411_+|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	42.0	3.9e-12
AWU81360.1|1747738_1748101_+	GtrA family protein	NA	I1TED9	Salmonella_phage	70.8	1.2e-43
AWU81361.1|1748097_1749027_+	glycosyltransferase	NA	S5FKN0	Shigella_phage	84.1	1.4e-150
AWU81362.1|1749026_1750574_+	hypothetical protein	NA	B9UDL6	Salmonella_phage	29.9	3.8e-49
AWU81363.1|1750737_1751097_+|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	64.2	2.8e-35
AWU81364.1|1751087_1752203_+|plate	baseplate protein	plate	Q6QI99	Burkholderia_phage	52.0	4.1e-101
AWU81365.1|1752195_1752828_+|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	55.6	1.9e-23
AWU81366.1|1752830_1754312_+|tail	phage tail protein	tail	A0A0M3ULF6	Salmonella_phage	51.7	1.3e-51
AWU81367.1|1754321_1754837_+|tail	tail fiber assembly protein	tail	A0A0U2QV64	Escherichia_phage	41.2	3.4e-34
>prophage 3
CP029800	Salmonella enterica subsp. enterica serovar Anatum strain R16.0676 chromosome, complete genome	4674190	3760429	3769600	4674190	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
AWU83177.1|3760429_3761377_+	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.8	3.7e-10
AWU83178.1|3761360_3762092_+	ABC transporter permease	NA	NA	NA	NA	NA
AWU83179.1|3762072_3762180_-	hypothetical protein	NA	NA	NA	NA	NA
AWU83180.1|3762239_3762971_-	transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
AWU83181.1|3763193_3764879_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	6.9e-278
AWU83182.1|3764875_3765595_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AWU83183.1|3765641_3766109_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
AWU83184.1|3766165_3766696_-	DUF1307 domain-containing protein	NA	NA	NA	NA	NA
AWU83185.1|3766867_3767326_-	DUF1307 domain-containing protein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
AWU83186.1|3767566_3769600_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
>prophage 4
CP029800	Salmonella enterica subsp. enterica serovar Anatum strain R16.0676 chromosome, complete genome	4674190	3837692	3843989	4674190		Enterobacteria_phage(50.0%)	6	NA	NA
AWU83240.1|3837692_3839096_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	3.1e-21
AWU83241.1|3839273_3840167_+	UTP--glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
AWU83242.1|3840543_3841629_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.6e-102
AWU83243.1|3841628_3842528_+	NAD(P)-dependent oxidoreductase	NA	A0A291LA50	Escherichia_phage	36.3	1.4e-30
AWU84198.1|3842575_3843454_+	glucose-1-phosphate thymidylyltransferase	NA	I7I009	Enterobacteria_phage	64.1	2.3e-107
AWU83244.1|3843458_3843989_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	57.1	4.8e-52
>prophage 5
CP029800	Salmonella enterica subsp. enterica serovar Anatum strain R16.0676 chromosome, complete genome	4674190	3950143	3961528	4674190		Stenotrophomonas_phage(25.0%)	13	NA	NA
AWU83342.1|3950143_3951406_-	DUF4102 domain-containing protein	NA	B7SYF8	Stenotrophomonas_phage	41.3	1.5e-75
AWU83343.1|3952051_3952342_-	DUF4102 domain-containing protein	NA	B7SYF8	Stenotrophomonas_phage	47.4	8.8e-08
AWU83344.1|3952713_3953511_-	protein MtfA	NA	NA	NA	NA	NA
AWU83345.1|3953771_3954014_+	hypothetical protein	NA	NA	NA	NA	NA
AWU83346.1|3953991_3954153_+	hypothetical protein	NA	NA	NA	NA	NA
AWU83347.1|3954279_3954699_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
AWU83348.1|3954701_3955970_+	protein UmuC	NA	I6RSM4	Salmonella_phage	91.9	9.3e-227
AWU83349.1|3956424_3956637_+	cold-shock protein CspJ	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
AWU84205.1|3956647_3956836_+	cold-shock protein	NA	NA	NA	NA	NA
AWU83350.1|3957095_3958289_-	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	56.2	3.0e-110
AWU83351.1|3958937_3959249_+	hypothetical protein	NA	NA	NA	NA	NA
AWU83352.1|3959328_3960024_+	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.1	2.8e-07
AWU83353.1|3960097_3961528_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
>prophage 6
CP029800	Salmonella enterica subsp. enterica serovar Anatum strain R16.0676 chromosome, complete genome	4674190	4064796	4071410	4674190	integrase	Pectobacterium_phage(16.67%)	12	4067006:4067028	4079129:4079151
AWU83462.1|4064796_4065027_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	60.3	2.9e-14
AWU83463.1|4065164_4065539_+	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
AWU83464.1|4065539_4066415_+	hypothetical protein	NA	NA	NA	NA	NA
AWU83465.1|4066431_4066785_+	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
AWU84209.1|4066842_4066962_+	hypothetical protein	NA	NA	NA	NA	NA
4067006:4067028	attL	GGAATCGTATTCGGTCTCTTTTT	NA	NA	NA	NA
AWU83466.1|4067156_4068236_-|integrase	integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	52.0	6.3e-99
AWU83467.1|4068232_4069339_-	exodeoxyribonuclease 8	NA	Q9QF34	Lambdoid_phage	65.0	1.4e-53
AWU83468.1|4069369_4069600_+	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	93.7	6.1e-28
AWU83469.1|4069653_4070187_+	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	43.0	5.4e-11
AWU83470.1|4070443_4070611_-	lytic enzyme	NA	NA	NA	NA	NA
AWU83471.1|4070675_4070864_-	hypothetical protein	NA	NA	NA	NA	NA
AWU83472.1|4070918_4071410_+	DUF1441 family protein	NA	Q9EYD0	Enterobacteria_phage	56.2	7.1e-42
4079129:4079151	attR	GGAATCGTATTCGGTCTCTTTTT	NA	NA	NA	NA
>prophage 1
CP029802	Salmonella enterica subsp. enterica serovar Anatum strain R16.0676 plasmid pR16.0676_90k, complete sequence	90137	15132	51241	90137	transposase,integrase	Salmonella_phage(28.57%)	45	9539:9557	28927:28945
9539:9557	attL	AACTTTCACATGTGAAAGA	NA	NA	NA	NA
AWU84301.1|15132_16143_-|integrase	integrase	integrase	A0A0K0N6I5	Gordonia_phage	31.9	3.1e-07
AWU84302.1|16145_16682_-	hypothetical protein	NA	NA	NA	NA	NA
AWU84303.1|16674_16962_-	hypothetical protein	NA	NA	NA	NA	NA
AWU84304.1|16980_17301_-	hypothetical protein	NA	NA	NA	NA	NA
AWU84305.1|17523_18126_+	hypothetical protein	NA	NA	NA	NA	NA
AWU84306.1|18141_18594_-	hypothetical protein	NA	NA	NA	NA	NA
AWU84307.1|18760_19096_-	hypothetical protein	NA	NA	NA	NA	NA
AWU84308.1|19354_19627_-	hypothetical protein	NA	NA	NA	NA	NA
AWU84309.1|20070_20775_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AWU84310.1|21290_22718_-	DNA cytosine methyltransferase	NA	NA	NA	NA	NA
AWU84311.1|22721_23222_-	hypothetical protein	NA	I3UMJ0	Colwellia_phage	43.3	1.7e-19
AWU84312.1|23230_23563_-	hypothetical protein	NA	NA	NA	NA	NA
AWU84396.1|23547_23979_-	hypothetical protein	NA	NA	NA	NA	NA
AWU84313.1|24046_24721_-	thymidylate kinase	NA	NA	NA	NA	NA
AWU84314.1|24695_24977_-	hypothetical protein	NA	NA	NA	NA	NA
AWU84315.1|24969_25347_-	hypothetical protein	NA	A0A2H4P7P5	Pseudomonas_phage	49.6	2.2e-22
AWU84316.1|25900_26536_+	restriction endonuclease subunit M	NA	NA	NA	NA	NA
AWU84317.1|26588_26861_-	hypothetical protein	NA	NA	NA	NA	NA
AWU84318.1|26909_28091_-	ParB/RepB/Spo0J family partition protein	NA	I3NLC2	Bifidobacterium_phage	28.7	2.4e-11
AWU84319.1|28094_28880_-	ParA family protein	NA	A0A1X9IGI7	Lactococcus_phage	26.4	6.1e-11
AWU84320.1|29053_29365_-	hypothetical protein	NA	NA	NA	NA	NA
28927:28945	attR	AACTTTCACATGTGAAAGA	NA	NA	NA	NA
AWU84321.1|29671_30487_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	5.9e-09
AWU84322.1|30547_31351_+	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
AWU84323.1|31350_32187_+	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
AWU84324.1|32492_32735_+	relaxase	NA	NA	NA	NA	NA
AWU84325.1|32766_33444_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AWU84326.1|33522_34722_+	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
AWU84327.1|34988_35294_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AWU84328.1|35321_36536_-	chloramphenicol/florfenicol efflux MFS transporter FloR	NA	S4TR35	Salmonella_phage	28.7	5.5e-19
AWU84329.1|36752_37637_-	DUF3363 domain-containing protein	NA	NA	NA	NA	NA
AWU84330.1|37667_39161_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
AWU84331.1|39371_39596_-	hypothetical protein	NA	NA	NA	NA	NA
AWU84332.1|39592_40330_-	resolvase	NA	NA	NA	NA	NA
AWU84333.1|40436_40928_+	hypothetical protein	NA	NA	NA	NA	NA
AWU84334.1|40961_41666_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AWU84397.1|41891_42212_+|transposase	transposase	transposase	NA	NA	NA	NA
AWU84335.1|42249_42807_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	81.3	5.8e-48
AWU84336.1|42809_45782_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.1	0.0e+00
AWU84337.1|45860_46865_+|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
AWU84338.1|47046_47226_-	hypothetical protein	NA	NA	NA	NA	NA
AWU84398.1|47600_47948_+	hypothetical protein	NA	A0A1V0SB21	Catovirus	39.4	2.6e-06
AWU84339.1|47947_48508_+	trimethoprim-resistant dihydrofolate reductase DfrA23	NA	A0A076FMI9	Aureococcus_anophage	29.0	1.6e-05
AWU84340.1|48488_48935_+	hypothetical protein	NA	NA	NA	NA	NA
AWU84341.1|48960_49578_+	hypothetical protein	NA	G3BM17	Salmonella_phage	28.3	2.3e-05
AWU84342.1|49699_51241_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
