The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP029722	Klebsiella pneumoniae strain AR_0140 chromosome, complete genome	5223981	235407	246295	5223981		Escherichia_phage(87.5%)	10	NA	NA
AWS82332.1|235407_236028_-	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
AWS82333.1|236020_237286_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.3	6.6e-233
AWS82334.1|237297_238200_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.7	2.6e-159
AWS82335.1|238237_238471_-	hypothetical protein	NA	NA	NA	NA	NA
AWS82336.1|238461_239223_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
AWS82337.1|239243_240104_-	inhibitor-resistant class A broad-spectrum beta-lactamase SHV-26	NA	A0A077SL40	Escherichia_phage	99.3	1.7e-155
AWS82338.1|240401_240662_+	hypothetical protein	NA	A0A077SK33	Escherichia_phage	98.8	5.4e-41
AWS82339.1|240748_241837_+	chromosome segregation protein SMC	NA	A0A077SLJ9	Escherichia_phage	100.0	8.0e-211
AWS82340.1|241867_243133_-	MFS transporter	NA	NA	NA	NA	NA
AWS82341.1|243187_246295_-	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.6	0.0e+00
>prophage 2
CP029722	Klebsiella pneumoniae strain AR_0140 chromosome, complete genome	5223981	687777	743150	5223981	transposase,tRNA,capsid,terminase,plate,integrase,tail,portal	Enterobacteria_phage(52.94%)	64	693005:693022	729431:729448
AWS82740.1|687777_688278_+|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
AWS82741.1|688394_688841_+	DUF441 domain-containing protein	NA	NA	NA	NA	NA
AWS86874.1|688824_689616_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AWS82742.1|689717_690902_+	cyanate MFS transporter	NA	NA	NA	NA	NA
AWS82743.1|690933_691626_-	hypothetical protein	NA	NA	NA	NA	NA
AWS82744.1|691771_692281_+	DUF523 domain-containing protein	NA	NA	NA	NA	NA
AWS82745.1|692267_692624_+	DUF488 domain-containing protein	NA	NA	NA	NA	NA
AWS82746.1|692613_692853_-	DUF333 domain-containing protein	NA	NA	NA	NA	NA
693005:693022	attL	CCCGACGGGGCTTTTTTT	NA	NA	NA	NA
AWS86875.1|693117_693369_-	hypothetical protein	NA	A0A2I8TV89	Erwinia_phage	49.2	3.4e-08
AWS82747.1|693412_694552_-	phage late control D family protein	NA	B9A7A9	Serratia_phage	71.3	3.2e-146
AWS82748.1|694706_695879_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	70.2	3.2e-157
AWS82749.1|695878_696394_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	61.2	3.7e-57
AWS82750.1|696439_696757_+|tail	phage tail protein	tail	B9A7B2	Serratia_phage	54.8	1.0e-17
AWS86876.1|696756_696915_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	63.3	3.5e-11
AWS82751.1|696901_699877_+|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	46.8	9.5e-222
AWS86877.1|699891_700383_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	62.7	5.6e-55
AWS82752.1|700698_702186_+	hypothetical protein	NA	NA	NA	NA	NA
AWS82753.1|702435_703533_-|tail	phage tail protein	tail	A0A0M3ULH6	Salmonella_phage	29.0	1.3e-11
AWS82754.1|703532_703745_-	hypothetical protein	NA	NA	NA	NA	NA
AWS82755.1|703741_706768_-|tail	phage tail protein I	tail	D5LGZ2	Escherichia_phage	40.0	1.9e-23
AWS82756.1|706757_707681_-|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	43.2	2.2e-52
AWS82757.1|707682_708033_-|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	59.3	6.2e-24
AWS82758.1|708029_708617_-|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	60.0	5.9e-59
AWS82759.1|708613_709249_-	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	51.4	2.3e-56
AWS82760.1|709245_709713_-|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	58.8	2.7e-46
AWS86878.1|709894_710224_-	DUF2570 domain-containing protein	NA	NA	NA	NA	NA
AWS82761.1|710235_710781_-	lysozyme	NA	Q1I0Z1	Pasteurella_virus	43.0	6.3e-31
AWS82762.1|710777_711062_-|tail	phage tail protein	tail	NA	NA	NA	NA
AWS82763.1|711052_711253_-|tail	phage tail protein	tail	A0A0A7NV57	Enterobacteria_phage	63.1	1.6e-16
AWS82764.1|711252_711768_-|capsid	capsid assembly protein	capsid	A0A0A7NPU2	Enterobacteria_phage	49.4	4.1e-40
AWS82765.1|711880_712738_-|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	58.6	9.8e-71
AWS82766.1|712787_713822_-|capsid	phage major capsid protein, P2 family	capsid	A0A0M3ULA3	Salmonella_phage	50.0	6.2e-96
AWS82767.1|713831_714671_-|capsid	phage capsid protein	capsid	A0A0A7NRY7	Enterobacteria_phage	66.7	2.5e-95
AWS82768.1|714827_716555_+	oxidoreductase	NA	A0A0A7NV54	Enterobacteria_phage	68.6	1.5e-235
AWS82769.1|716548_717610_+|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	67.8	4.5e-142
AWS82770.1|717794_717980_+	hypothetical protein	NA	NA	NA	NA	NA
AWS82771.1|718209_719034_+	hypothetical protein	NA	NA	NA	NA	NA
AWS82772.1|719403_719763_-	hypothetical protein	NA	NA	NA	NA	NA
AWS82773.1|720012_721752_-	RNA-directed DNA polymerase	NA	NA	NA	NA	NA
AWS82774.1|724451_725468_-	hypothetical protein	NA	B7SYG0	Stenotrophomonas_phage	43.7	1.5e-65
AWS86879.1|725505_725733_-	hypothetical protein	NA	A0A286S1P6	Klebsiella_phage	39.7	1.9e-05
AWS82775.1|725741_726308_-	3'-5' exoribonuclease	NA	D4HTX2	Vibrio_phage	33.2	7.2e-14
AWS82776.1|726304_726529_-	hypothetical protein	NA	NA	NA	NA	NA
AWS82777.1|726597_726870_-	hypothetical protein	NA	NA	NA	NA	NA
AWS82778.1|726885_727263_-	hypothetical protein	NA	NA	NA	NA	NA
AWS82779.1|727278_727497_-	DUF4761 domain-containing protein	NA	A0A0M5M1I3	Salmonella_phage	49.1	3.6e-06
AWS82780.1|727517_727796_-	hypothetical protein	NA	Q1JS60	Enterobacteria_phage	88.9	6.2e-43
AWS82781.1|727916_728216_+	XRE family transcriptional regulator	NA	Q1JS61	Enterobacteria_phage	75.8	7.1e-37
AWS82782.1|728331_729345_+|integrase	integrase	integrase	Q83VS6	Escherichia_phage	79.4	2.2e-154
AWS82783.1|729579_730593_+	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	29.5	1.4e-12
729431:729448	attR	CCCGACGGGGCTTTTTTT	NA	NA	NA	NA
AWS82784.1|730650_730752_+	hypothetical protein	NA	NA	NA	NA	NA
AWS86880.1|730751_730826_+	hypothetical protein	NA	NA	NA	NA	NA
AWS82785.1|730943_731069_+	hypothetical protein	NA	NA	NA	NA	NA
AWS82786.1|731128_731392_-	DUF2534 domain-containing protein	NA	NA	NA	NA	NA
AWS82787.1|731522_732161_-	leucine efflux protein	NA	NA	NA	NA	NA
AWS82788.1|732250_733165_-	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	50.4	1.1e-72
AWS82789.1|733380_733572_+	hypothetical protein	NA	NA	NA	NA	NA
AWS82790.1|733825_734869_-	type II asparaginase	NA	NA	NA	NA	NA
AWS82791.1|735171_736380_+	phosphodiesterase	NA	NA	NA	NA	NA
AWS82792.1|736453_738238_+	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	36.1	5.8e-17
AWS82793.1|738244_739135_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AWS82794.1|739255_740764_+	3,4-dihydroxybenzoate decarboxylase	NA	NA	NA	NA	NA
AWS82795.1|741074_741761_-	diguanylate phosphodiesterase	NA	NA	NA	NA	NA
AWS82796.1|742226_743150_-|transposase	IS5-like element IS903B family transposase	transposase	Q9MCT5	Escherichia_phage	99.3	1.1e-176
>prophage 3
CP029722	Klebsiella pneumoniae strain AR_0140 chromosome, complete genome	5223981	994350	1003813	5223981	protease,tRNA	Bacillus_phage(16.67%)	9	NA	NA
AWS83022.1|994350_996072_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	22.6	1.2e-14
AWS83023.1|996116_996818_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
AWS83024.1|997171_997390_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
AWS83025.1|997509_999789_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
AWS83026.1|999819_1000137_-|protease	ATP-dependent Clp protease adaptor ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
AWS83027.1|1000462_1000684_+	cold shock domain protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
AWS83028.1|1000617_1000821_-	hypothetical protein	NA	NA	NA	NA	NA
AWS83029.1|1000760_1002701_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	1.9e-37
AWS83030.1|1002697_1003813_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
>prophage 4
CP029722	Klebsiella pneumoniae strain AR_0140 chromosome, complete genome	5223981	1453273	1528269	5223981	transposase,holin,tRNA,capsid,terminase,plate,integrase,tail,portal,head	Enterobacteria_phage(20.0%)	89	1475014:1475060	1520641:1520687
AWS83424.1|1453273_1454791_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.3	9.5e-85
AWS83425.1|1455122_1456598_-	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	29.0	6.9e-48
AWS83426.1|1456657_1458805_-	lysine decarboxylase CadA	NA	NA	NA	NA	NA
AWS83427.1|1458887_1460222_-	lysine:cadaverine antiporter	NA	NA	NA	NA	NA
AWS83428.1|1460587_1462156_-	transcriptional regulator CadC	NA	NA	NA	NA	NA
AWS83429.1|1462448_1462721_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
AWS83430.1|1462821_1463742_-	lipid A biosynthesis lauroyl acyltransferase	NA	A0A1W6JP29	Morganella_phage	40.1	5.4e-51
AWS83431.1|1464252_1465119_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AWS83432.1|1465141_1466167_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
AWS83433.1|1466168_1468604_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
AWS83434.1|1468614_1469310_-	molecular chaperone	NA	NA	NA	NA	NA
AWS83435.1|1469368_1469929_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
AWS83436.1|1470400_1471063_+	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
AWS83437.1|1471040_1471346_+	hypothetical protein	NA	NA	NA	NA	NA
AWS83438.1|1471398_1472703_-	citrate synthase	NA	NA	NA	NA	NA
AWS83439.1|1473213_1473384_+	ATP-NAD kinase	NA	NA	NA	NA	NA
AWS83440.1|1473462_1473864_-	hydroxyisourate hydrolase	NA	NA	NA	NA	NA
AWS83441.1|1474259_1474553_-	hypothetical protein	NA	NA	NA	NA	NA
1475014:1475060	attL	AATGGCACGCCCTACAGGATTCGAACCTGTGACCTACGGCTTAGAAG	NA	NA	NA	NA
AWS83442.1|1475215_1475422_-	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	47.7	1.6e-08
AWS83443.1|1476764_1477610_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
AWS86917.1|1479680_1480331_+	hypothetical protein	NA	NA	NA	NA	NA
AWS86918.1|1480748_1481063_-|tail	tail fiber assembly protein	tail	A0A218M4J2	Erwinia_phage	48.4	4.4e-13
AWS83444.1|1481746_1482778_-|transposase	IS630-like element ISEc33 family transposase	transposase	NA	NA	NA	NA
AWS83445.1|1483093_1483690_-	DUF2313 domain-containing protein	NA	A0A2P9JZK7	Alteromonadaceae_phage	36.4	3.6e-32
AWS83446.1|1483686_1484835_-|plate	phage baseplate protein	plate	B6SBU6	Clostridium_virus	26.1	1.7e-09
AWS83447.1|1484824_1485274_-	hypothetical protein	NA	A0A0C4UR04	Shigella_phage	39.7	2.3e-15
AWS83448.1|1485270_1485852_-|plate	baseplate assembly protein	plate	NA	NA	NA	NA
AWS83449.1|1485848_1486934_-|tail	phage tail protein	tail	Q8SBG7	Shigella_phage	30.6	1.5e-39
AWS83450.1|1486930_1488331_-	hypothetical protein	NA	A0A2P9JZK2	Alteromonadaceae_phage	39.1	4.0e-05
AWS83451.1|1488377_1490231_-	hypothetical protein	NA	A0A172JGI1	Citrobacter_phage	45.3	1.8e-21
AWS83452.1|1490372_1490651_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
AWS83453.1|1490652_1491024_-|tail	phage tail protein	tail	NA	NA	NA	NA
AWS83454.1|1491027_1492539_-|tail	phage tail protein	tail	B5TK67	Pseudomonas_phage	44.4	1.2e-103
AWS83455.1|1492543_1492720_-	DUF2635 domain-containing protein	NA	NA	NA	NA	NA
AWS83456.1|1492722_1493268_-	ATP-binding protein	NA	NA	NA	NA	NA
AWS83457.1|1493264_1493624_-	hypothetical protein	NA	NA	NA	NA	NA
AWS83458.1|1493628_1494009_-	hypothetical protein	NA	NA	NA	NA	NA
AWS83459.1|1494010_1495060_-|capsid	major capsid protein	capsid	V5Q8G6	Xylella_phage	33.7	8.1e-51
AWS83460.1|1495158_1495566_-|head	head decoration protein	head	NA	NA	NA	NA
AWS83461.1|1495565_1496156_-	hypothetical protein	NA	NA	NA	NA	NA
AWS83462.1|1496157_1497024_-	S49 family peptidase	NA	A0A248XD65	Klebsiella_phage	48.1	1.1e-48
AWS83463.1|1497020_1498655_-|portal	phage portal protein	portal	A0A291AUL8	Sinorhizobium_phage	35.5	1.4e-89
AWS83464.1|1498654_1498918_-|head,tail	phage head-tail adapter protein	head,tail	NA	NA	NA	NA
AWS83465.1|1498926_1501053_-|terminase	terminase	terminase	A0A0C5ABH4	Bacteriophage	34.5	6.1e-98
AWS83466.1|1500994_1501576_-	hypothetical protein	NA	NA	NA	NA	NA
AWS83467.1|1501837_1502476_-	hypothetical protein	NA	NA	NA	NA	NA
AWS83468.1|1502571_1502778_-	hypothetical protein	NA	NA	NA	NA	NA
AWS83469.1|1503011_1503401_-	DUF2570 domain-containing protein	NA	A0A192Y6H8	Salmonella_phage	50.0	1.1e-24
AWS86919.1|1503397_1503895_-	lysozyme	NA	A0A1V0E5Q7	Salmonella_phage	84.2	2.5e-79
AWS83470.1|1503872_1504142_-|holin	holin	holin	K7P6H9	Enterobacteria_phage	77.2	7.4e-33
AWS83471.1|1504685_1505369_-	antiterminator	NA	I6PDF8	Cronobacter_phage	52.8	3.4e-58
AWS83472.1|1505365_1505506_-	YlcG family protein	NA	NA	NA	NA	NA
AWS83473.1|1505502_1506141_-	hypothetical protein	NA	H6WRY9	Salmonella_phage	68.4	9.2e-74
AWS83474.1|1506133_1506802_-	serine/threonine protein phosphatase	NA	K7P6H8	Enterobacteria_phage	80.1	2.5e-106
AWS83475.1|1506798_1506966_-	NinE family protein	NA	K7P7K0	Enterobacteria_phage	62.5	3.5e-09
AWS83476.1|1506946_1507414_-	recombination protein NinB	NA	Q8VNP6	Enterobacteria_phage	46.5	3.4e-33
AWS83477.1|1507695_1507917_-	hypothetical protein	NA	NA	NA	NA	NA
AWS83478.1|1508097_1508946_-	DUF551 domain-containing protein	NA	A0A248SKW5	Klebsiella_phage	93.4	2.7e-49
AWS83479.1|1508942_1509323_-	HNH endonuclease	NA	K7P7B7	Enterobacteria_phage	94.2	1.6e-62
AWS83480.1|1509322_1510156_-	hypothetical protein	NA	A0A075B8K3	Enterobacteria_phage	43.9	1.1e-26
AWS83481.1|1510152_1510359_-	hypothetical protein	NA	R9TRD3	Aeromonas_phage	97.1	1.1e-31
AWS83482.1|1510355_1510757_-	hypothetical protein	NA	R9TME7	Aeromonas_phage	31.9	6.7e-06
AWS83483.1|1510753_1511056_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AWS83484.1|1511052_1511901_-	ATP-binding protein	NA	K7PLU3	Enterobacteria_phage	60.8	1.2e-89
AWS83485.1|1513064_1513385_-	hypothetical protein	NA	A0A0M4RU01	Salmonella_phage	67.9	6.5e-36
AWS83486.1|1513434_1513650_-	XRE family transcriptional regulator	NA	Q716D6	Shigella_phage	60.9	5.5e-15
AWS83487.1|1513749_1514382_+	helix-turn-helix domain-containing protein	NA	A0A1I9KG86	Aeromonas_phage	39.5	2.0e-33
AWS83488.1|1514818_1515025_+	cell division inhibitor protein	NA	A0A0M4S6W3	Salmonella_phage	94.1	1.4e-31
AWS83489.1|1515106_1515391_+	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	78.7	9.5e-39
AWS83490.1|1515407_1516154_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	67.2	7.0e-65
AWS83491.1|1516150_1516774_+	exonuclease	NA	A0A0S2SY31	Pseudomonas_phage	60.2	3.1e-58
AWS83492.1|1516802_1517330_+	phage N-6-adenine-methyltransferase	NA	Q9ZWX6	Enterobacteria_phage	61.6	1.1e-56
AWS83493.1|1517543_1517888_+	hypothetical protein	NA	NA	NA	NA	NA
AWS83494.1|1517880_1518558_+	morphogenetic protein	NA	H2BDG4	Pseudomonas_virus	47.4	1.7e-49
AWS83495.1|1518554_1518782_+	hypothetical protein	NA	S4TRP7	Salmonella_phage	43.2	1.8e-08
AWS83496.1|1518778_1519000_+	conjugal transfer protein TraR	NA	A0A0K2FI84	Escherichia_phage	52.2	2.0e-12
AWS83497.1|1518999_1519239_+	DUF4222 domain-containing protein	NA	Q6H9Z8	Enterobacteria_phage	43.6	7.8e-10
AWS86920.1|1519251_1519587_+	DNA-binding protein	NA	NA	NA	NA	NA
AWS86921.1|1519583_1520627_+|integrase	site-specific integrase	integrase	G8C7S0	Escherichia_phage	85.6	5.0e-178
AWS83498.1|1521057_1521924_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase	NA	A0A249XZQ2	Enterococcus_phage	34.8	1.3e-30
1520641:1520687	attR	AATGGCACGCCCTACAGGATTCGAACCTGTGACCTACGGCTTAGAAG	NA	NA	NA	NA
AWS83499.1|1521925_1522138_+	hypothetical protein	NA	NA	NA	NA	NA
AWS83500.1|1522183_1523569_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	35.4	3.5e-46
AWS83501.1|1523744_1524239_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
AWS83502.1|1524242_1524965_+	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
AWS83503.1|1525072_1525411_+	hypothetical protein	NA	NA	NA	NA	NA
AWS83504.1|1525407_1525575_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AWS83505.1|1525507_1526017_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	NA	NA	NA	NA
AWS83506.1|1526013_1527081_+	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
AWS83507.1|1527192_1528269_+|tRNA	tRNA 2-selenouridine(34) synthase MnmH	tRNA	NA	NA	NA	NA
>prophage 5
CP029722	Klebsiella pneumoniae strain AR_0140 chromosome, complete genome	5223981	1532768	1597909	5223981	protease,transposase,tRNA	Escherichia_phage(28.57%)	59	NA	NA
AWS86923.1|1532768_1533395_+|protease	multifunctional acyl-CoA thioesterase I/protease I/lysophospholipase L1	protease	NA	NA	NA	NA
AWS83510.1|1533423_1534194_+	oxidoreductase	NA	NA	NA	NA	NA
AWS83511.1|1534252_1535107_+	co-chaperone YbbN	NA	NA	NA	NA	NA
AWS83512.1|1535214_1535997_-	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
AWS83513.1|1535983_1536661_-	iron ABC transporter ATP-binding protein FetA	NA	G3M9Y6	Bacillus_virus	33.0	1.3e-22
AWS83514.1|1536801_1537719_+	SPFH/Band 7/PHB domain protein	NA	NA	NA	NA	NA
AWS83515.1|1537715_1538174_+	NfeD family protein	NA	NA	NA	NA	NA
AWS83516.1|1538170_1538581_-	HTH-type transcriptional regulator CueR	NA	NA	NA	NA	NA
AWS86924.1|1538687_1541189_+	copper-exporting P-type ATPase CopA	NA	A0A218MNH6	uncultured_virus	38.0	4.7e-113
AWS83517.1|1541320_1542115_+	conjugal transfer protein TraB	NA	NA	NA	NA	NA
AWS83518.1|1542317_1542797_+|tRNA	Cys-tRNA(Pro) deacylase	tRNA	NA	NA	NA	NA
AWS83519.1|1542902_1544555_-	bifunctional UDP-sugar hydrolase/5'-nucleotidase	NA	NA	NA	NA	NA
AWS83520.1|1544824_1546045_+	MFS transporter	NA	NA	NA	NA	NA
AWS83521.1|1546270_1547947_+	Kef family K(+) transporter	NA	NA	NA	NA	NA
AWS83522.1|1547982_1549287_-	inosine/guanosine kinase	NA	NA	NA	NA	NA
AWS83523.1|1549350_1550313_-	ferrochelatase	NA	NA	NA	NA	NA
AWS83524.1|1550441_1551086_-	adenylate kinase	NA	NA	NA	NA	NA
AWS83525.1|1551308_1553183_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	36.8	4.9e-115
AWS83526.1|1553294_1553900_-	recombination protein RecR	NA	NA	NA	NA	NA
AWS83527.1|1553899_1554232_-	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
AWS83528.1|1554289_1556197_-	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	38.2	3.0e-43
AWS83529.1|1556289_1556841_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	44.5	3.9e-28
AWS83530.1|1556991_1557369_-	DUF454 domain-containing protein	NA	NA	NA	NA	NA
AWS83531.1|1557438_1557966_+	primosomal replication protein N''	NA	NA	NA	NA	NA
AWS83532.1|1557978_1558152_+	DUF2496 domain-containing protein	NA	NA	NA	NA	NA
AWS83533.1|1558219_1559119_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	51.2	1.6e-63
AWS83534.1|1559154_1562502_-	mechanosensitive channel MscK	NA	NA	NA	NA	NA
AWS83535.1|1562631_1563282_-	DNA-binding transcriptional repressor AcrR	NA	NA	NA	NA	NA
AWS83536.1|1563424_1564618_+	MexE family multidrug efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AWS83537.1|1564640_1567787_+	multidrug efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	22.7	1.1e-47
AWS83538.1|1568272_1568647_+	Hha toxicity attenuator	NA	NA	NA	NA	NA
AWS83539.1|1568673_1568892_+	transcriptional regulator	NA	NA	NA	NA	NA
AWS83540.1|1569050_1569617_+	maltose O-acetyltransferase	NA	NA	NA	NA	NA
AWS83541.1|1569749_1570220_+	hypothetical protein	NA	NA	NA	NA	NA
AWS83542.1|1570194_1571646_-	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	25.1	4.6e-12
AWS83543.1|1571746_1572445_+	N-acetyltransferase	NA	NA	NA	NA	NA
AWS83544.1|1572441_1572582_-	50S ribosomal protein L36	NA	NA	NA	NA	NA
AWS83545.1|1572581_1572845_-	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
AWS83546.1|1572960_1574031_-	lac repressor	NA	C6ZCU4	Enterobacteria_phage	42.8	6.1e-70
AWS83547.1|1574301_1575573_+	maltoporin	NA	NA	NA	NA	NA
AWS83548.1|1575709_1576024_-	PTS sugar transporter	NA	NA	NA	NA	NA
AWS83549.1|1576088_1578146_-	beta-galactosidase	NA	NA	NA	NA	NA
AWS83550.1|1578177_1579380_-	galactosidase	NA	NA	NA	NA	NA
AWS83551.1|1579384_1580236_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
AWS83552.1|1580246_1581554_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
AWS83553.1|1581616_1582849_-	cyclodextrin-binding protein	NA	NA	NA	NA	NA
AWS83554.1|1583205_1584315_+	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	35.0	2.5e-26
AWS83555.1|1584548_1586108_+	EAL domain-containing protein	NA	NA	NA	NA	NA
AWS86925.1|1586142_1586415_-	metal/formaldehyde-sensitive transcriptional repressor	NA	NA	NA	NA	NA
AWS83556.1|1586579_1587443_+	nickel/cobalt efflux protein RcnA	NA	NA	NA	NA	NA
AWS83557.1|1587487_1588084_-	hypothetical protein	NA	NA	NA	NA	NA
AWS83558.1|1588127_1589051_-|transposase	IS5-like element IS903B family transposase	transposase	Q9MCT5	Escherichia_phage	99.3	1.1e-176
AWS83559.1|1589390_1590416_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AWS83560.1|1592044_1592260_-	hypothetical protein	NA	NA	NA	NA	NA
AWS83561.1|1592256_1592514_-	hypothetical protein	NA	NA	NA	NA	NA
AWS83562.1|1593422_1594448_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AWS83563.1|1594787_1595711_+|transposase	IS5-like element IS903B family transposase	transposase	Q9MCT5	Escherichia_phage	99.3	1.1e-176
AWS83564.1|1596012_1596936_+|transposase	IS5/IS1182 family transposase	transposase	Q9MCT5	Escherichia_phage	99.0	9.2e-176
AWS83565.1|1596979_1597909_+|transposase	IS5/IS1182 family transposase	transposase	Q9MCT5	Escherichia_phage	98.7	3.5e-175
>prophage 6
CP029722	Klebsiella pneumoniae strain AR_0140 chromosome, complete genome	5223981	3759473	3799232	5223981	transposase,integrase,tRNA	Bacillus_phage(22.22%)	40	3773134:3773148	3796967:3796981
AWS85541.1|3759473_3760283_+|tRNA	tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA	tRNA	S4VW33	Pandoravirus	31.7	9.4e-15
AWS85542.1|3760413_3760851_-	cysteine desulfurase sulfur acceptor subunit CsdE	NA	NA	NA	NA	NA
AWS85543.1|3760850_3762056_-	cysteine desulfurase CsdA	NA	Q2XUY6	environmental_halophage	36.8	8.9e-70
AWS87005.1|3762253_3762478_+	YgdI/YgdR family lipoprotein	NA	NA	NA	NA	NA
AWS85544.1|3762829_3763747_+	transcriptional regulator GcvA	NA	NA	NA	NA	NA
AWS85545.1|3763766_3764162_+	hypothetical protein	NA	NA	NA	NA	NA
AWS85546.1|3764154_3765255_+	23S rRNA (cytidine(2498)-2'-O)-methyltransferase RlmM	NA	NA	NA	NA	NA
AWS85547.1|3765309_3766020_-	L-fucose operon activator	NA	NA	NA	NA	NA
AWS85548.1|3766078_3766501_-	L-fucose mutarotase	NA	NA	NA	NA	NA
AWS85549.1|3766502_3767921_-	L-fuculokinase	NA	NA	NA	NA	NA
AWS85550.1|3768028_3769804_-	L-fucose isomerase	NA	NA	NA	NA	NA
AWS85551.1|3769836_3771147_-	L-fucose:H+ symporter permease	NA	NA	NA	NA	NA
AWS85552.1|3771713_3772361_+	L-fuculose-phosphate aldolase	NA	NA	NA	NA	NA
AWS85553.1|3772388_3773537_+	lactaldehyde reductase	NA	NA	NA	NA	NA
3773134:3773148	attL	CGGGGATGGGATTTT	NA	NA	NA	NA
AWS85554.1|3773584_3774340_-	flap endonuclease Xni	NA	F8WQ40	Bacillus_phage	33.6	1.3e-10
AWS85555.1|3774436_3776380_-	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
AWS85556.1|3776652_3777825_+	alkanesulfonate monooxygenase, FMNH(2)-dependent	NA	NA	NA	NA	NA
AWS85557.1|3777871_3779269_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
AWS85558.1|3779342_3780749_+	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
AWS85559.1|3780745_3781768_+	methionine ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.1	1.9e-25
AWS85560.1|3781764_3782463_+	ABC transporter permease	NA	NA	NA	NA	NA
AWS85561.1|3782459_3783338_+	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AWS85562.1|3784043_3785306_+|transposase	IS1380 family transposase ISEc9	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
AWS85563.1|3785561_3786437_+	class A extended-spectrum beta-lactamase CTX-M-15	NA	A0A1B0VBP7	Salmonella_phage	82.4	1.1e-125
AWS85564.1|3786483_3786858_-	cupin fold metalloprotein, WbuC family	NA	NA	NA	NA	NA
AWS85565.1|3786864_3788235_-|transposase	IS1182 family transposase ISCfr1	transposase	NA	NA	NA	NA
AWS85566.1|3788349_3789486_-	DUF3883 domain-containing protein	NA	NA	NA	NA	NA
AWS85567.1|3789536_3789782_-	hypothetical protein	NA	NA	NA	NA	NA
AWS85568.1|3789787_3789979_+	hypothetical protein	NA	NA	NA	NA	NA
AWS85569.1|3790460_3791003_-	tunicamycin resistance protein	NA	NA	NA	NA	NA
AWS85570.1|3791015_3791876_-	aminoglycoside N-acetyltransferase AAC(3)-IId	NA	NA	NA	NA	NA
AWS85571.1|3792108_3792813_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AWS85572.1|3792846_3793149_-|transposase	transposase	transposase	NA	NA	NA	NA
AWS85573.1|3793087_3794101_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
AWS85574.1|3794245_3794743_+	trimethoprim-resistant dihydrofolate reductase DfrA12	NA	A0A0A0PL85	Bacillus_phage	40.9	7.5e-23
AWS85575.1|3794854_3795145_+	hypothetical protein	NA	NA	NA	NA	NA
AWS85576.1|3795150_3795942_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
AWS85577.1|3796105_3796453_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
AWS85578.1|3796446_3797286_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	NA	NA	NA	NA
3796967:3796981	attR	CGGGGATGGGATTTT	NA	NA	NA	NA
AWS85579.1|3797690_3799232_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
>prophage 7
CP029722	Klebsiella pneumoniae strain AR_0140 chromosome, complete genome	5223981	4499571	4506476	5223981		Planktothrix_phage(33.33%)	6	NA	NA
AWS87031.1|4499571_4500435_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.5	5.7e-10
AWS86185.1|4500445_4501219_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.2	3.0e-26
AWS87032.1|4501460_4502354_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.8	6.1e-15
AWS86186.1|4502598_4503960_-	U32 family peptidase	NA	Q6DW11	Phage_TP	94.5	3.9e-207
AWS86187.1|4504278_4505001_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	8.3e-31
AWS86188.1|4504997_4506476_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	28.3	1.4e-29
>prophage 8
CP029722	Klebsiella pneumoniae strain AR_0140 chromosome, complete genome	5223981	4516940	4562870	5223981	transposase	Escherichia_phage(30.77%)	36	NA	NA
AWS86194.1|4516940_4517966_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AWS86195.1|4518284_4519208_-|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
AWS86196.1|4519547_4520573_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AWS86197.1|4520569_4520779_-	hypothetical protein	NA	NA	NA	NA	NA
AWS86198.1|4520990_4521602_-	transcriptional regulator	NA	NA	NA	NA	NA
AWS86199.1|4522041_4523022_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.8	5.2e-185
AWS86200.1|4523294_4523996_-	DNA-binding response regulator	NA	NA	NA	NA	NA
AWS86201.1|4524010_4525867_-	histidine kinase	NA	NA	NA	NA	NA
AWS86202.1|4526155_4527508_-	molecular chaperone	NA	NA	NA	NA	NA
AWS86203.1|4527524_4527635_+	DNA-3-methyladenine glycosidase	NA	NA	NA	NA	NA
AWS86204.1|4527645_4528494_+	DNA-3-methyladenine glycosylase 2	NA	NA	NA	NA	NA
AWS86205.1|4528608_4529250_+	uridine kinase	NA	A0A1V0SAA3	Catovirus	39.3	2.0e-36
AWS86206.1|4529340_4529922_+	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	41.6	5.1e-31
AWS86207.1|4529952_4531800_+	outer membrane assembly protein AsmA	NA	NA	NA	NA	NA
AWS86208.1|4532031_4533615_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	43.5	5.0e-36
AWS87033.1|4534380_4535271_+	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.6	3.3e-45
AWS86209.1|4535662_4536292_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
AWS86210.1|4537251_4538691_+	capsule assembly Wzi family protein	NA	NA	NA	NA	NA
AWS86211.1|4538836_4539970_+	polysaccharide export protein Wza	NA	NA	NA	NA	NA
AWS87034.1|4539975_4540410_+	protein tyrosine phosphatase	NA	NA	NA	NA	NA
AWS86212.1|4540426_4542589_+	tyrosine-protein kinase	NA	NA	NA	NA	NA
AWS86213.1|4542661_4544092_+	undecaprenyl-phosphate galactose phosphotransferase WbaP	NA	NA	NA	NA	NA
AWS86214.1|4544115_4545579_+	lipopolysaccharide biosynthesis protein	NA	NA	NA	NA	NA
AWS86215.1|4545571_4546702_+	glycosyltransferase family 1 protein	NA	NA	NA	NA	NA
AWS86216.1|4546710_4547805_+	glycosyltransferase family 1 protein	NA	NA	NA	NA	NA
AWS86217.1|4548349_4548661_-	hypothetical protein	NA	NA	NA	NA	NA
AWS86218.1|4549445_4550369_+|transposase	IS5-like element IS903B family transposase	transposase	Q9MCT5	Escherichia_phage	99.3	1.1e-176
AWS86219.1|4551935_4552358_+	hypothetical protein	NA	NA	NA	NA	NA
AWS86220.1|4552471_4553623_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
AWS86221.1|4553806_4554730_+|transposase	IS5-like element IS903B family transposase	transposase	Q9MCT5	Escherichia_phage	99.3	1.1e-176
AWS86222.1|4554834_4556241_+	phosphogluconate dehydrogenase (NADP(+)-dependent, decarboxylating)	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.7	3.6e-38
AWS86223.1|4556428_4557352_-|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	98.7	2.7e-175
AWS86224.1|4557532_4558948_+	mannose-1-phosphate guanylyltransferase	NA	A0A1V0SH58	Hokovirus	31.0	1.4e-53
AWS86225.1|4558969_4560340_+	phosphomannomutase	NA	A0A127AWJ1	Bacillus_phage	25.9	1.1e-31
AWS86226.1|4560503_4561670_+	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	54.7	9.1e-112
AWS86227.1|4561862_4562870_+	NAD-dependent epimerase	NA	E3T4Y8	Cafeteria_roenbergensis_virus	28.0	4.4e-30
>prophage 9
CP029722	Klebsiella pneumoniae strain AR_0140 chromosome, complete genome	5223981	4667664	4677211	5223981	transposase	Burkholderia_phage(33.33%)	9	NA	NA
AWS86311.1|4667664_4668588_+|transposase	IS5-like element IS903B family transposase	transposase	Q9MCT5	Escherichia_phage	99.3	1.1e-176
AWS86312.1|4668767_4669913_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	58.7	1.1e-117
AWS86313.1|4670451_4670733_+	hypothetical protein	NA	NA	NA	NA	NA
AWS86314.1|4670775_4671483_+	phosphohydrolase	NA	S4W232	Pandoravirus	27.7	2.8e-07
AWS86315.1|4671526_4672960_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	53.0	4.0e-101
AWS87042.1|4672940_4673435_+	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	50.7	5.7e-31
AWS86316.1|4673409_4674321_-	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
AWS86317.1|4674504_4675416_+	DUF808 domain-containing protein	NA	NA	NA	NA	NA
AWS86318.1|4675531_4677211_+	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	41.1	6.9e-20
>prophage 10
CP029722	Klebsiella pneumoniae strain AR_0140 chromosome, complete genome	5223981	4836419	4847706	5223981		Klebsiella_phage(40.0%)	17	NA	NA
AWS86470.1|4836419_4837715_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	36.8	9.6e-62
AWS86471.1|4837729_4838536_+	molybdenum ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AWS86472.1|4838776_4840039_-	DUF3596 domain-containing protein	NA	A0A286S1S8	Klebsiella_phage	94.8	1.5e-232
AWS86473.1|4840081_4840327_-	excisionase	NA	A0A286S2A4	Klebsiella_phage	93.4	3.8e-36
AWS86474.1|4840544_4841294_-	hypothetical protein	NA	A0A077KCB2	Edwardsiella_phage	60.3	2.3e-84
AWS86475.1|4841290_4841515_-	hypothetical protein	NA	A0A286S2B3	Klebsiella_phage	60.8	1.5e-18
AWS86476.1|4841511_4841739_-	hypothetical protein	NA	A0A291LBA3	Klebsiella_phage	48.4	2.1e-09
AWS86477.1|4842038_4842332_-	host cell division inhibitory peptide Kil	NA	NA	NA	NA	NA
AWS86478.1|4842525_4842714_-	hypothetical protein	NA	NA	NA	NA	NA
AWS86479.1|4843485_4844082_-	XRE family transcriptional regulator	NA	K7P850	Enterobacteria_phage	27.1	4.1e-07
AWS86480.1|4844190_4844403_+	transcriptional regulator	NA	NA	NA	NA	NA
AWS86481.1|4844423_4844744_+	hypothetical protein	NA	A0A0M4RU01	Salmonella_phage	68.9	5.0e-36
AWS86482.1|4844939_4845194_+	hypothetical protein	NA	NA	NA	NA	NA
AWS86483.1|4845190_4846285_+	hypothetical protein	NA	K7PLZ7	Enterobacterial_phage	40.3	9.7e-31
AWS86484.1|4846311_4846707_+	hypothetical protein	NA	NA	NA	NA	NA
AWS86485.1|4846706_4846928_+	hypothetical protein	NA	NA	NA	NA	NA
AWS86486.1|4846920_4847706_+	hypothetical protein	NA	C7BGF1	Burkholderia_phage	52.1	1.5e-62
>prophage 11
CP029722	Klebsiella pneumoniae strain AR_0140 chromosome, complete genome	5223981	4851968	4909557	5223981	transposase,holin,capsid,terminase,plate,protease,tail,portal,head	Vibrio_phage(33.33%)	77	NA	NA
AWS86491.1|4851968_4852562_+	hypothetical protein	NA	A0A0M4RU10	Salmonella_phage	63.2	1.2e-40
AWS86492.1|4852558_4853329_+	dcm methylase	NA	D5LH17	Escherichia_phage	51.2	3.0e-63
AWS86493.1|4853325_4853970_+	phage N-6-adenine-methyltransferase	NA	Q8HA94	Salmonella_phage	80.5	1.2e-102
AWS86494.1|4853966_4854566_+	hypothetical protein	NA	H9C175	Pectobacterium_phage	58.9	1.1e-65
AWS86495.1|4855203_4855473_+|holin	holin	holin	K7P6H9	Enterobacteria_phage	77.2	8.1e-32
AWS87052.1|4855450_4855951_+	lysozyme	NA	A0A1V0E5Q7	Salmonella_phage	84.4	5.9e-76
AWS86496.1|4855947_4856439_+	Fis family transcriptional regulator	NA	Q2NPG0	Xanthomonas_virus	43.9	7.4e-31
AWS86497.1|4856540_4856891_+	hypothetical protein	NA	H2EQH5	Salmonella_phage	39.7	5.5e-12
AWS86498.1|4857301_4857535_+	hypothetical protein	NA	NA	NA	NA	NA
AWS86499.1|4857522_4857873_+	HNH endonuclease	NA	K7PHK9	Enterobacteria_phage	78.4	4.6e-51
AWS86500.1|4858002_4858497_+|terminase	phage terminase small subunit P27 family	terminase	Q8HAD7	Salmonella_phage	92.0	1.2e-81
AWS86501.1|4858493_4860224_+|terminase	terminase large subunit	terminase	Q8HAD6	Salmonella_phage	83.0	2.3e-300
AWS86502.1|4860233_4860419_+	hypothetical protein	NA	A0A1B5FP99	Escherichia_phage	63.9	5.2e-14
AWS86503.1|4860418_4861648_+|portal	phage portal protein	portal	U5P411	Shigella_phage	81.7	1.3e-201
AWS86504.1|4861634_4862288_+|head,protease	HK97 family phage prohead protease	head,protease	Q8W628	Enterobacteria_phage	87.9	9.3e-106
AWS86505.1|4862302_4863511_+|capsid	phage major capsid protein	capsid	A0A192Y5T6	Salmonella_phage	84.2	2.2e-193
AWS86506.1|4863537_4863753_+	hypothetical protein	NA	M1FN89	Enterobacteria_phage	42.4	7.2e-07
AWS86507.1|4863749_4864070_+|head,tail	phage gp6-like head-tail connector protein	head,tail	K7PKT4	Enterobacteria_phage	39.8	1.7e-15
AWS86508.1|4864139_4864337_+	hypothetical protein	NA	A0A286S2A5	Klebsiella_phage	96.9	2.4e-25
AWS86509.1|4864338_4864671_+|head,tail	head-tail adaptor protein	head,tail	A0A286S2A2	Klebsiella_phage	98.2	2.9e-55
AWS86510.1|4864663_4865203_+	hypothetical protein	NA	A0A286S249	Klebsiella_phage	95.5	3.7e-92
AWS86511.1|4865199_4865565_+	DUF3168 domain-containing protein	NA	A0A286S1R1	Klebsiella_phage	95.0	5.4e-63
AWS86512.1|4865621_4866113_+|tail	phage tail protein	tail	A0A286S1Q8	Klebsiella_phage	100.0	2.3e-88
AWS86513.1|4866156_4866510_+|tail	phage tail protein	tail	A0A286S1N4	Klebsiella_phage	99.1	4.9e-61
AWS86514.1|4866542_4866806_+|tail	phage tail protein	tail	A0A286S1P2	Klebsiella_phage	96.6	1.0e-42
AWS86515.1|4866870_4867338_+	hypothetical protein	NA	NA	NA	NA	NA
AWS86516.1|4867382_4869827_+|tail	phage tail tape measure protein	tail	A0A286S1S3	Klebsiella_phage	61.3	1.1e-252
AWS86517.1|4869826_4870297_+	hypothetical protein	NA	A0A286S298	Klebsiella_phage	67.7	8.3e-64
AWS86518.1|4870293_4870776_+	DUF1833 domain-containing protein	NA	A0A286S2B1	Klebsiella_phage	90.6	2.1e-78
AWS86519.1|4870786_4871167_+	nitrite transporter	NA	A0A286S2A6	Klebsiella_phage	94.4	6.9e-69
AWS86520.1|4871530_4872094_-	transcriptional regulator	NA	NA	NA	NA	NA
AWS87053.1|4872275_4872500_+	transcriptional regulator	NA	M1PVU4	Vibrio_phage	57.1	1.5e-15
AWS86521.1|4874632_4875580_+	DNA transposition protein	NA	A0A0C4UQR3	Shigella_phage	79.4	2.9e-140
AWS86522.1|4875584_4875824_+	hypothetical protein	NA	NA	NA	NA	NA
AWS86523.1|4875826_4876114_+	HTH domain-containing protein	NA	C9DGL7	Escherichia_phage	48.3	3.5e-17
AWS86524.1|4876723_4877647_+|transposase	IS5-like element IS903B family transposase	transposase	Q9MCT5	Escherichia_phage	99.3	1.1e-176
AWS86525.1|4877893_4878391_+	hypothetical protein	NA	A0A0A7RUP4	Clostridium_phage	36.0	1.9e-05
AWS86526.1|4878350_4878827_+	hypothetical protein	NA	K7PHA5	Enterobacterial_phage	37.2	3.3e-12
AWS86527.1|4878823_4879378_+	regulatory protein GemA	NA	A0A0C4UQU3	Shigella_phage	46.7	2.4e-38
AWS86528.1|4879374_4879764_+	transcriptional regulator	NA	A0A0C4UR27	Shigella_phage	58.1	4.6e-36
AWS86529.1|4880040_4881057_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.7	9.8e-187
AWS87054.1|4881094_4881220_-	sugar kinase	NA	Q6QLL3	Human_immunodeficiency_virus	100.0	1.3e-13
AWS86530.1|4881552_4882131_+	peptidoglycan-binding protein	NA	A0A2I7S9B9	Vibrio_phage	46.0	5.1e-39
AWS86531.1|4882133_4882352_+	hypothetical protein	NA	A0A0C4UQR6	Shigella_phage	70.8	1.7e-24
AWS86532.1|4882344_4882752_+	hypothetical protein	NA	NA	NA	NA	NA
AWS86533.1|4882739_4883345_+	hypothetical protein	NA	M4MB79	Vibrio_phage	39.8	1.2e-22
AWS86534.1|4883341_4883572_+	conjugal transfer protein TraR	NA	NA	NA	NA	NA
AWS86535.1|4883552_4883855_+	DUF2730 domain-containing protein	NA	M1Q558	Vibrio_phage	42.6	4.3e-13
AWS86536.1|4883864_4884152_+	hypothetical protein	NA	A0A2I7S9D8	Vibrio_phage	64.5	8.4e-27
AWS86537.1|4884154_4884430_+	hypothetical protein	NA	NA	NA	NA	NA
AWS86538.1|4884419_4884998_+	DUF3486 domain-containing protein	NA	M4MCR3	Vibrio_phage	59.2	1.8e-52
AWS86539.1|4884994_4886584_+	hypothetical protein	NA	M4MHG0	Vibrio_phage	68.5	2.7e-199
AWS86540.1|4886583_4888155_+	DUF935 domain-containing protein	NA	A0A2I7S9K0	Vibrio_phage	56.2	4.6e-159
AWS86541.1|4888147_4888990_+	hypothetical protein	NA	M1PVV7	Vibrio_phage	56.9	1.7e-88
AWS86542.1|4889178_4890195_+	peptidase	NA	M1Q578	Vibrio_phage	49.1	3.9e-74
AWS86543.1|4890197_4891097_+|head	phage head protein	head	M4MB71	Vibrio_phage	59.4	1.5e-101
AWS86544.1|4891173_4891680_+	hypothetical protein	NA	NA	NA	NA	NA
AWS86545.1|4891679_4892120_+	DUF1320 domain-containing protein	NA	A0A2I7S9E9	Vibrio_phage	47.9	4.9e-34
AWS86546.1|4892119_4892662_+	phage morphogenesis protein	NA	A0A2I7S9D7	Vibrio_phage	64.2	2.9e-60
AWS86547.1|4892658_4893270_+	hypothetical protein	NA	M1PJ94	Vibrio_phage	40.8	1.4e-39
AWS86548.1|4893272_4893482_+	DUF2635 domain-containing protein	NA	NA	NA	NA	NA
AWS86549.1|4893483_4894965_+|tail	phage tail protein	tail	M1Q565	Vibrio_phage	60.2	9.6e-167
AWS86550.1|4894974_4895328_+|tail	phage tail protein	tail	A0A2P1A4D6	Alteromonadaceae_phage	34.2	7.7e-14
AWS86551.1|4895331_4895715_+	hypothetical protein	NA	A0A2P9JZJ9	Alteromonadaceae_phage	40.5	3.4e-15
AWS86552.1|4895617_4895836_+	hypothetical protein	NA	NA	NA	NA	NA
AWS86553.1|4895813_4897622_+|tail	phage tail protein	tail	M4MHE6	Vibrio_phage	31.4	3.8e-64
AWS86554.1|4897621_4898878_+	multidrug DMT transporter	NA	M4M9N2	Vibrio_phage	42.0	2.2e-87
AWS86555.1|4898870_4899962_+|tail	phage tail protein	tail	M4M9L5	Vibrio_phage	49.0	1.3e-91
AWS86556.1|4899952_4900492_+|plate	phage baseplate assembly protein V	plate	A0A2I7S9F6	Vibrio_phage	44.4	1.1e-32
AWS86557.1|4900488_4900941_+	hypothetical protein	NA	A0A2I7S9F0	Vibrio_phage	43.4	6.6e-26
AWS86558.1|4900927_4902004_+|plate	phage baseplate protein	plate	A0A2I7S9E5	Vibrio_phage	52.0	1.0e-101
AWS86559.1|4901988_4902573_+	DUF2313 domain-containing protein	NA	M4M9M8	Vibrio_phage	47.7	4.8e-45
AWS86560.1|4902575_4903388_+|tail	phage tail protein	tail	X2KTY7	Enterobacteria_phage	66.7	6.9e-26
AWS86561.1|4903387_4904263_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	37.0	2.2e-25
AWS86562.1|4904272_4906258_+	hypothetical protein	NA	A0A1J0MHZ5	Klebsiella_phage	45.2	1.7e-126
AWS86563.1|4906254_4906524_+	hypothetical protein	NA	NA	NA	NA	NA
AWS86564.1|4906623_4909557_+	kinase	NA	A0A286S259	Klebsiella_phage	90.9	0.0e+00
>prophage 1
CP029723	Klebsiella pneumoniae strain AR_0140 plasmid unnamed1, complete sequence	183663	174	24822	183663	protease,transposase,integrase	Escherichia_phage(45.45%)	28	12619:12634	31166:31181
AWS87071.1|174_879_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	9.9e-138
AWS87246.1|1022_1577_+	fluoroquinolone-acetylating aminoglycoside 6'-N-acetyltransferase AAC(6')-Ib-cr5	NA	NA	NA	NA	NA
AWS87072.1|1768_2473_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AWS87073.1|2618_2909_-	alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	40.6	4.8e-06
AWS87248.1|3003_3504_-	hypothetical protein	NA	NA	NA	NA	NA
AWS87247.1|3480_4185_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AWS87074.1|4413_5130_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	2.4e-139
AWS87075.1|7560_8565_+|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
AWS87076.1|8746_8923_-	DUF4102 domain-containing protein	NA	T1S9J3	Salmonella_phage	68.6	1.0e-06
AWS87077.1|9252_10068_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.0	4.5e-09
AWS87078.1|10221_10926_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AWS87079.1|11107_11371_-	hypothetical protein	NA	NA	NA	NA	NA
AWS87080.1|11465_11744_+	hypothetical protein	NA	NA	NA	NA	NA
AWS87081.1|11937_12282_+	hypothetical protein	NA	NA	NA	NA	NA
AWS87082.1|12389_13025_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
12619:12634	attL	ACAACACCTCTGAATA	NA	NA	NA	NA
AWS87083.1|13024_15133_-	peptidase domain-containing ABC transporter	NA	W8CYL7	Bacillus_phage	27.3	2.4e-38
AWS87084.1|15122_16400_-	colicin V secretion protein CvaA	NA	NA	NA	NA	NA
AWS87085.1|17976_18393_-	PIN domain-containing protein	NA	NA	NA	NA	NA
AWS87086.1|18389_18620_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
AWS87087.1|19284_19491_+	hypothetical protein	NA	NA	NA	NA	NA
AWS87088.1|19536_19845_+	hypothetical protein	NA	NA	NA	NA	NA
AWS87089.1|19872_20202_+	hypothetical protein	NA	NA	NA	NA	NA
AWS87090.1|20269_20626_+	hypothetical protein	NA	NA	NA	NA	NA
AWS87091.1|20632_20965_+	hypothetical protein	NA	NA	NA	NA	NA
AWS87092.1|20964_21747_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	90.2	4.6e-51
AWS87093.1|22601_22796_-	hypothetical protein	NA	NA	NA	NA	NA
AWS87094.1|22960_23434_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
AWS87095.1|23553_24822_-|transposase	ISL3 family transposase ISKpn25	transposase	Q6V7R1	Burkholderia_virus	34.7	5.2e-60
31166:31181	attR	TATTCAGAGGTGTTGT	NA	NA	NA	NA
>prophage 2
CP029723	Klebsiella pneumoniae strain AR_0140 plasmid unnamed1, complete sequence	183663	29397	41489	183663		Enterobacteria_phage(25.0%)	13	NA	NA
AWS87098.1|29397_31425_-	SAM-dependent DNA methyltransferase	NA	A0A220A2U5	Liberibacter_phage	26.6	2.1e-26
AWS87099.1|31536_31752_-	hypothetical protein	NA	NA	NA	NA	NA
AWS87100.1|31976_32309_-	hypothetical protein	NA	NA	NA	NA	NA
AWS87101.1|32328_32514_-	hypothetical protein	NA	NA	NA	NA	NA
AWS87102.1|32685_33660_-	ParB/RepB/Spo0J family partition protein	NA	Q1MVJ4	Enterobacteria_phage	62.3	1.4e-105
AWS87103.1|33656_34862_-	ParA family protein	NA	Q1MVJ3	Enterobacteria_phage	89.0	7.3e-205
AWS87104.1|35183_36080_-	replication initiation protein	NA	Q71TL8	Escherichia_phage	53.8	3.3e-69
AWS87105.1|36480_37752_-	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	63.7	3.6e-154
AWS87106.1|37751_38183_-	translesion error-prone DNA polymerase V subunit UmuD	NA	A0A1W6JNS2	Morganella_phage	52.5	1.0e-28
AWS87107.1|38414_39386_+	StbA family protein	NA	A0A222YXF2	Escherichia_phage	46.8	1.1e-73
AWS87108.1|39388_40060_+	Mediator of plasmid stability	NA	NA	NA	NA	NA
AWS87109.1|40120_40351_+	hypothetical protein	NA	NA	NA	NA	NA
AWS87110.1|40787_41489_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.7	7.1e-27
>prophage 3
CP029723	Klebsiella pneumoniae strain AR_0140 plasmid unnamed1, complete sequence	183663	53680	108826	183663	integrase,transposase	uncultured_Caudovirales_phage(25.0%)	58	69820:69843	108893:108916
AWS87128.1|53680_56698_-|transposase	Tn3-like element IS3000 family transposase	transposase	A0A125RQ78	Bacillus_phage	24.7	5.5e-52
AWS87129.1|61059_61785_+	type-F conjugative transfer system pilin acetylase TraX	NA	A0A1D6ZIU7	Xanthomonas_phage	28.8	7.1e-06
AWS87130.1|61856_62450_+	conjugal transfer protein	NA	NA	NA	NA	NA
AWS87131.1|62616_63213_+	hypothetical protein	NA	NA	NA	NA	NA
AWS87132.1|63262_63907_+	hypothetical protein	NA	NA	NA	NA	NA
AWS87133.1|63962_64613_+	DUF2726 domain-containing protein	NA	NA	NA	NA	NA
AWS87134.1|64609_64918_+	hypothetical protein	NA	K7PKY8	Enterobacterial_phage	31.7	1.1e-08
AWS87135.1|65294_65999_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AWS87136.1|66098_66464_-	transcriptional regulator	NA	NA	NA	NA	NA
AWS87137.1|68194_68620_-	mercury transport protein MerC	NA	NA	NA	NA	NA
AWS87138.1|68647_68923_-	mercuric transporter periplasmic component	NA	NA	NA	NA	NA
AWS87139.1|68938_69304_-	mercuric ion transporter MerT	NA	NA	NA	NA	NA
AWS87140.1|69375_69831_+	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
69820:69843	attL	ACTACGCCTTAGCGTGCTTTATTT	NA	NA	NA	NA
AWS87141.1|70090_70618_+	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	39.5	5.7e-21
AWS87142.1|70650_71082_-	hypothetical protein	NA	NA	NA	NA	NA
AWS87143.1|71561_72527_-	DUF1738 domain-containing protein	NA	A0A1V0EEV1	Caulobacter_phage	42.7	1.6e-58
AWS87144.1|72734_73004_-	hypothetical protein	NA	NA	NA	NA	NA
AWS87145.1|72996_74481_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
AWS87146.1|74480_74732_-	hypothetical protein	NA	NA	NA	NA	NA
AWS87147.1|74889_75321_+	peptidase	NA	A0A1W6JNS2	Morganella_phage	53.3	1.6e-29
AWS87148.1|75320_76592_+	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	63.3	4.9e-151
AWS87149.1|76673_77651_-	ParB/RepB/Spo0J family partition protein	NA	Q38420	Escherichia_phage	54.4	2.6e-88
AWS87150.1|77647_78853_-	ParA family protein	NA	A0A077SL49	Escherichia_phage	69.6	2.4e-163
AWS87151.1|79267_79537_+	hypothetical protein	NA	NA	NA	NA	NA
AWS87152.1|79569_79767_-	hypothetical protein	NA	NA	NA	NA	NA
AWS87153.1|79893_80760_-	RepB family plasmid replication initiator protein	NA	A0A222YYK1	Escherichia_phage	31.1	1.5e-23
AWS87154.1|81527_81785_+	hypothetical protein	NA	NA	NA	NA	NA
AWS87155.1|81842_82619_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	92.9	6.4e-53
AWS87156.1|82615_83359_-	hypothetical protein	NA	NA	NA	NA	NA
AWS87157.1|83409_83760_-	hypothetical protein	NA	NA	NA	NA	NA
AWS87250.1|83903_84338_-	hypothetical protein	NA	NA	NA	NA	NA
AWS87158.1|84321_84552_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
AWS87159.1|84844_85549_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AWS87160.1|86198_86531_+	QacE family quaternary ammonium compound efflux SMR transporter	NA	NA	NA	NA	NA
AWS87161.1|86884_88033_-	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	65.9	1.7e-123
AWS87162.1|88157_91175_-|transposase	Tn3-like element IS3000 family transposase	transposase	A0A125RQ78	Bacillus_phage	24.7	7.2e-52
AWS87163.1|91548_91923_-	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	56.0	4.5e-28
AWS87164.1|92451_93648_+	MFS transporter	NA	NA	NA	NA	NA
AWS87165.1|93719_94547_-	universal stress protein	NA	NA	NA	NA	NA
AWS87166.1|94565_96044_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	74.0	1.6e-198
AWS87167.1|96527_96881_+	transcriptional regulator	NA	A0A2H4J145	uncultured_Caudovirales_phage	57.1	5.9e-22
AWS87168.1|96976_98260_+	arsenical efflux pump membrane protein ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	74.6	2.9e-175
AWS87169.1|98309_98738_+	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.7	2.3e-52
AWS87170.1|99401_100406_-|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
AWS87171.1|100484_101042_-	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	63.2	3.3e-59
AWS87172.1|101035_101407_-	hypothetical protein	NA	NA	NA	NA	NA
AWS87173.1|101403_101904_-|transposase	transposase	transposase	NA	NA	NA	NA
AWS87174.1|101900_102227_-	hypothetical protein	NA	NA	NA	NA	NA
AWS87175.1|102481_102838_-	cupin domain-containing protein	NA	NA	NA	NA	NA
AWS87176.1|102827_103229_-	DUF86 domain-containing protein	NA	NA	NA	NA	NA
AWS87177.1|103225_103516_-	nucleotidyltransferase	NA	NA	NA	NA	NA
AWS87178.1|103578_103884_-|transposase	transposase	transposase	NA	NA	NA	NA
AWS87179.1|103822_104836_-|integrase	integron integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
AWS87251.1|104981_105773_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
AWS87180.1|105936_106284_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
AWS87181.1|106277_107117_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
AWS87182.1|107046_107226_-	hypothetical protein	NA	NA	NA	NA	NA
AWS87183.1|107821_108826_-|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
108893:108916	attR	AAATAAAGCACGCTAAGGCGTAGT	NA	NA	NA	NA
>prophage 4
CP029723	Klebsiella pneumoniae strain AR_0140 plasmid unnamed1, complete sequence	183663	120818	177829	183663	integrase,transposase	Escherichia_phage(21.74%)	50	157642:157686	171844:171888
AWS87197.1|120818_121640_+|transposase	heteromeric transposase endonuclease subunit TnsA	transposase	NA	NA	NA	NA
AWS87198.1|121629_123783_+|transposase	transposase	transposase	NA	NA	NA	NA
AWS87199.1|123772_125221_+	ATP-binding protein	NA	NA	NA	NA	NA
AWS87200.1|126292_126676_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	36.3	4.1e-13
AWS87201.1|126672_127020_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	95.7	2.7e-59
AWS87202.1|127069_128605_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	87.7	2.0e-260
AWS87252.1|129363_129573_+	DNA-binding protein	NA	A0A1B1IUF9	uncultured_Mediterranean_phage	50.9	2.9e-13
AWS87203.1|129640_132610_+	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	23.8	8.5e-21
AWS87204.1|132609_135249_+	histidinol-phosphatase	NA	A0A1B1IUG5	uncultured_Mediterranean_phage	20.5	1.9e-19
AWS87205.1|135230_136394_+	ATP-dependent DNA helicase RecG	NA	NA	NA	NA	NA
AWS87206.1|136390_137668_+	restriction endonuclease subunit S	NA	E3T4D5	Cafeteria_roenbergensis_virus	28.2	1.3e-13
AWS87207.1|137664_138780_+	anticodon nuclease	NA	NA	NA	NA	NA
AWS87208.1|138776_140411_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	41.6	1.7e-103
AWS87209.1|140590_141793_+	hypothetical protein	NA	NA	NA	NA	NA
AWS87210.1|142774_142963_+	hypothetical protein	NA	NA	NA	NA	NA
AWS87211.1|143266_144124_-	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
AWS87253.1|144116_144194_-	RepA leader peptide Tap	NA	NA	NA	NA	NA
AWS87254.1|144425_144677_-	transcriptional regulator	NA	NA	NA	NA	NA
AWS87212.1|144812_145175_-	endonuclease	NA	NA	NA	NA	NA
AWS87213.1|145214_145919_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AWS87255.1|147540_147783_+	relaxase	NA	NA	NA	NA	NA
AWS87214.1|147814_148492_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AWS87215.1|148570_149770_+	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
AWS87216.1|149801_150686_-	EamA family transporter	NA	NA	NA	NA	NA
AWS87256.1|150823_151216_-	cysteine hydrolase	NA	NA	NA	NA	NA
AWS87217.1|152481_155499_-|transposase	Tn3-like element IS3000 family transposase	transposase	A0A125RQ78	Bacillus_phage	24.7	5.5e-52
AWS87218.1|155631_155772_-	plasmid stabilization protein	NA	NA	NA	NA	NA
AWS87219.1|155780_156167_-	hypothetical protein	NA	NA	NA	NA	NA
AWS87220.1|156712_156973_+	hypothetical protein	NA	NA	NA	NA	NA
AWS87221.1|156918_157623_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	9.9e-138
157642:157686	attL	AAGGGGATGATAAGTTTATCACCACCGACTATTTGCAACAGTGCC	NA	NA	NA	NA
AWS87222.1|158007_158949_+	hypothetical protein	NA	NA	NA	NA	NA
AWS87223.1|159529_160216_+	NYN domain-containing protein	NA	NA	NA	NA	NA
AWS87224.1|160353_161091_+	hypothetical protein	NA	NA	NA	NA	NA
AWS87225.1|161610_163080_-	HNH endonuclease	NA	G0X580	Salmonella_phage	51.3	5.5e-21
AWS87226.1|163836_164406_-	recombinase family protein	NA	E5FFF9	Burkholderia_phage	43.2	5.2e-36
AWS87227.1|164545_164860_-|transposase	transposase	transposase	NA	NA	NA	NA
AWS87228.1|164798_165812_-|integrase	integron integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
AWS87229.1|165967_166441_+	trimethoprim-resistant dihydrofolate reductase DfrA14	NA	G3MBI7	Bacillus_virus	28.9	8.4e-16
AWS87230.1|166661_166928_+	plasmid mobilization relaxosome protein MobC	NA	NA	NA	NA	NA
AWS87231.1|167070_167835_+|transposase	IS6 family transposase IS6100	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
AWS87232.1|167876_168089_+	resolvase	NA	NA	NA	NA	NA
AWS87233.1|168101_169310_+	restriction endonuclease	NA	E5E3X4	Burkholderia_phage	42.5	1.2e-34
AWS87234.1|169343_170777_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	50.6	7.0e-106
AWS87235.1|171158_171365_-	hypothetical protein	NA	NA	NA	NA	NA
AWS87236.1|171369_171882_-	restriction endonuclease	NA	NA	NA	NA	NA
AWS87237.1|172683_173388_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
171844:171888	attR	GGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTT	NA	NA	NA	NA
AWS87238.1|173485_174605_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.2	6.0e-52
AWS87239.1|174652_175291_+	DUF4113 domain-containing protein	NA	F1C5A5	Cronobacter_phage	65.5	8.3e-75
AWS87240.1|175702_176578_+	replication initiation protein	NA	Q71TL8	Escherichia_phage	56.4	5.6e-82
AWS87257.1|177202_177829_+	cobyrinic acid ac-diamide synthase	NA	E5FFJ3	Burkholderia_phage	30.1	3.8e-16
>prophage 1
CP029724	Klebsiella pneumoniae strain AR_0140 plasmid unnamed2, complete sequence	178561	30729	95996	178561	holin,transposase	uncultured_Caudovirales_phage(29.41%)	58	NA	NA
AWS87285.1|30729_31653_+|transposase	IS5/IS1182 family transposase	transposase	Q9MCT5	Escherichia_phage	98.7	7.1e-176
AWS87286.1|32325_32583_-	hypothetical protein	NA	NA	NA	NA	NA
AWS87287.1|33202_34639_+	diguanylate cyclase	NA	NA	NA	NA	NA
AWS87288.1|35621_36899_-	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
AWS87289.1|36961_38965_-|holin	high-affinity choline transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	25.9	9.7e-21
AWS87422.1|39998_41206_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	63.2	1.7e-100
AWS87290.1|42634_43066_-	silver-binding protein SilE	NA	NA	NA	NA	NA
AWS87291.1|43316_44792_-	Cu(+)/Ag(+) sensor histidine kinase	NA	W8CYF6	Bacillus_phage	30.1	1.0e-27
AWS87292.1|44784_45465_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	35.6	2.1e-31
AWS87293.1|45654_47040_+	hypothetical protein	NA	NA	NA	NA	NA
AWS87294.1|47068_47422_+	copper ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AWS87295.1|47535_48828_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AWS87296.1|48838_51985_+	CusA/CzcA family heavy metal efflux RND transporter	NA	S5VTK5	Leptospira_phage	22.5	4.0e-61
AWS87297.1|52071_52512_+	hypothetical protein	NA	NA	NA	NA	NA
AWS87298.1|52638_55092_+	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	35.5	9.9e-84
AWS87299.1|55132_55330_+	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
AWS87300.1|55363_56101_-	peptidase M23	NA	A0A2H4JAF5	uncultured_Caudovirales_phage	32.5	1.2e-11
AWS87301.1|56389_56839_-	copper resistance protein	NA	NA	NA	NA	NA
AWS87302.1|57072_58890_+	multicopper oxidase PcoA	NA	NA	NA	NA	NA
AWS87303.1|58889_59786_+	copper resistance protein B	NA	NA	NA	NA	NA
AWS87304.1|59825_60206_+	copper resistance system chaperone PcoC	NA	NA	NA	NA	NA
AWS87305.1|60210_61140_+	copper resistance protein D	NA	NA	NA	NA	NA
AWS87306.1|61194_61875_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	34.4	8.7e-30
AWS87307.1|61871_63272_+	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	26.3	4.1e-18
AWS87308.1|63488_63923_+	copper-binding protein	NA	NA	NA	NA	NA
AWS87423.1|64154_64334_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
AWS87309.1|66076_66586_+	porin	NA	NA	NA	NA	NA
AWS87310.1|66635_67133_-	N-acetyltransferase	NA	NA	NA	NA	NA
AWS87311.1|67464_67791_+	transcriptional regulator	NA	NA	NA	NA	NA
AWS87424.1|67790_68501_+	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	77.0	2.9e-92
AWS87312.1|68509_69055_+	RNA polymerase subunit sigma-70	NA	NA	NA	NA	NA
AWS87313.1|69130_69493_+	arsenical resistance operon transcriptional repressor ArsD	NA	NA	NA	NA	NA
AWS87314.1|71389_71926_+	N-acetyltransferase	NA	NA	NA	NA	NA
AWS87315.1|71958_72384_-	arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	72.9	2.3e-52
AWS87316.1|72396_73686_-	arsenical efflux pump membrane protein ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	74.0	1.9e-171
AWS87317.1|73733_75485_-	arsenical pump-driving ATPase	NA	NA	NA	NA	NA
AWS87318.1|75502_75865_-	arsenical resistance operon transcriptional repressor ArsD	NA	NA	NA	NA	NA
AWS87319.1|75914_76265_-	transcriptional regulator	NA	A0A2H4J145	uncultured_Caudovirales_phage	50.9	1.4e-23
AWS87320.1|76622_76892_+	hypothetical protein	NA	NA	NA	NA	NA
AWS87321.1|76879_77455_+	hypothetical protein	NA	NA	NA	NA	NA
AWS87322.1|77485_77980_+	DNA-binding protein	NA	NA	NA	NA	NA
AWS87323.1|78023_78392_+	hypothetical protein	NA	NA	NA	NA	NA
AWS87324.1|78425_78629_+	hemolysin expression modulator Hha	NA	NA	NA	NA	NA
AWS87325.1|78677_78935_+	hypothetical protein	NA	NA	NA	NA	NA
AWS87326.1|79010_79265_+	hypothetical protein	NA	NA	NA	NA	NA
AWS87327.1|79440_79707_+	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
AWS87328.1|79694_80177_+	N-acetyltransferase	NA	NA	NA	NA	NA
AWS87425.1|80384_81731_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
AWS87329.1|81779_82175_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AWS87330.1|82363_83761_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
AWS87331.1|84000_84279_-	hypothetical protein	NA	NA	NA	NA	NA
AWS87332.1|84613_85180_-	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
AWS87333.1|85304_86948_-	alpha-D-glucose phosphate-specific phosphoglucomutase	NA	A0A1X9I671	Streptococcus_phage	25.0	1.5e-22
AWS87334.1|87061_89509_-	glycogen phosphorylase	NA	A0A140XAG6	Dickeya_phage	69.2	6.1e-25
AWS87335.1|89527_90961_-	glycogen synthase GlgA	NA	NA	NA	NA	NA
AWS87336.1|91049_92333_-	glucose-1-phosphate adenylyltransferase	NA	NA	NA	NA	NA
AWS87337.1|92462_94655_-	1,4-alpha-glucan branching enzyme	NA	NA	NA	NA	NA
AWS87338.1|95072_95996_+|transposase	IS5-like element IS903B family transposase	transposase	Q9MCT5	Escherichia_phage	99.3	1.1e-176
>prophage 2
CP029724	Klebsiella pneumoniae strain AR_0140 plasmid unnamed2, complete sequence	178561	101321	128783	178561	integrase,transposase	Escherichia_phage(41.67%)	25	108294:108353	124602:125422
AWS87340.1|101321_103418_+|transposase	transposase	transposase	NA	NA	NA	NA
AWS87341.1|103698_104814_+	hypothetical protein	NA	NA	NA	NA	NA
AWS87342.1|105024_108033_-|transposase	Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	62.8	0.0e+00
108294:108353	attL	GGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCTG	NA	NA	NA	NA
AWS87343.1|108356_109061_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AWS87344.1|109213_110647_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	50.6	7.0e-106
AWS87345.1|110680_111889_-	restriction endonuclease	NA	E5E3X4	Burkholderia_phage	42.5	1.2e-34
AWS87346.1|111901_112114_-	resolvase	NA	NA	NA	NA	NA
AWS87347.1|112155_112920_-|transposase	IS6 family transposase IS6100	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
AWS87348.1|114291_115296_+|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
AWS87349.1|115606_115984_+	N-acetyltransferase	NA	NA	NA	NA	NA
AWS87350.1|116184_116844_-	type A chloramphenicol O-acetyltransferase	NA	G3CFL0	Escherichia_phage	99.5	7.1e-130
AWS87351.1|116897_117089_+	hypothetical protein	NA	NA	NA	NA	NA
AWS87352.1|117467_117908_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	60.3	2.6e-19
AWS87353.1|117904_118255_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBY2	Stx2-converting_phage	63.8	5.2e-39
AWS87354.1|118285_119878_+|transposase	IS66-like element ISKox1 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	61.8	3.2e-176
AWS87355.1|120517_121774_-	EreA family erythromycin esterase	NA	NA	NA	NA	NA
AWS87356.1|122019_122472_-	NAD(+)--rifampin ADP-ribosyltransferase Arr-2	NA	NA	NA	NA	NA
AWS87357.1|122644_123658_+|integrase	integron integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
AWS87358.1|123626_123860_+|transposase	transposase	transposase	NA	NA	NA	NA
AWS87359.1|123893_124598_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AWS87427.1|124978_125935_+	hypothetical protein	NA	NA	NA	NA	NA
124602:125422	attR	CAGCTCCATCAGCAAAAGGGGATGATAAGTTTATCACCACCGACTATTTGCAACAGTGCCCTCTATTGCGTGACGTAGATTCGTGACGTATAGTTACTGCAACTTATTTGTTTATAACTACCGTCAGGTACAAAATTATGTCTCCCGTACAAGCTAAACAAAAGCAGCATGAACGCTACGAAGCCGTAGCGGTGCAGGTTTTGCGTGGTCGTGCCGGTTACAAACCTGCCGTGAAAAGCCGCTTCAGTAAGTCAGCTAGTAGCAAATTCGCTCATACTATCGCTTTTGCCTGATCCTGAACTTTGAGGCACAATAAACCATCATTCGCTGATGGTTTTTTTATGCCTGTTCAAGACGTTATTCCCCCCTATGAGCAGATGTACCTGCTAAATCAGCAGCTGATCTGCAACGCTGATCAGTTCAAACATGCCGTTATCACAGTTGGCGGTCAGGCTGTGCAATACTGGATATCCTATTATCATGCACAATACGGCGACAGATTGCCTGATGAGCGCCTCACCACATCTGTTGACTGCGACTACAGCGCCCGGAAAGATGATATTGCGGCTATAGCAAAAACGCTCAACGTTAAGACGTGGGAGAACAAAGACGGTCAGCCCCCATCCCTTGCGCAGTTTATGCTTATCGATCAGGATACACACGATATCAAACGGGATGATGGACGCTTATTTGCCGTACCGGATGCGCCTGACGAGCCAAATGTGGTGGATATTATCGACCGCCCCGGAGGCTTTGACCGTTCTGATTTTCAGGGGAAAAAGCTTTACCTGTATACCGCCCCGTTTTATGTAGAAGCAACC	NA	NA	NA	NA
AWS87360.1|126119_126731_-	DUF2913 domain-containing protein	NA	NA	NA	NA	NA
AWS87361.1|126784_127066_-	cytoplasmic protein	NA	NA	NA	NA	NA
AWS87362.1|127238_127574_+	C2H2-type zinc finger protein	NA	NA	NA	NA	NA
AWS87363.1|127802_128783_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	1.8e-185
