The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP029715	Serratia marcescens strain AR_0131 chromosome, complete genome	5140937	1933809	1968697	5140937	terminase,portal,capsid,tail,integrase,head,plate	Salmonella_phage(25.71%)	43	1934909:1934930	1967870:1967891
AWS68581.1|1933809_1934712_-	lipid A hydroxylase LpxO	NA	H8ZJK8	Ostreococcus_tauri_virus	38.8	5.7e-37
1934909:1934930	attL	AAAAAGGCCGCCGAAGCGGCCT	NA	NA	NA	NA
AWS68582.1|1935039_1935258_-	transcriptional regulator	NA	S4TNZ3	Salmonella_phage	62.5	6.8e-21
AWS68583.1|1935337_1936507_-	phage late control D family protein	NA	Q6K1G4	Salmonella_virus	74.7	3.0e-163
AWS71418.1|1936503_1936989_-|tail	phage tail protein	tail	A0A0F7LDE8	Escherichia_phage	60.5	3.5e-49
AWS68584.1|1937001_1939449_-|tail	phage tail tape measure protein	tail	U5N0T4	Enterobacteria_phage	64.9	1.7e-256
AWS68585.1|1939441_1939561_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	74.4	4.5e-11
AWS68586.1|1939593_1939896_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	79.3	1.9e-29
AWS68587.1|1939953_1940472_-|tail	phage major tail tube protein	tail	S4TNZ0	Salmonella_phage	77.3	1.0e-75
AWS68588.1|1940488_1941658_-|tail	phage tail protein	tail	S4TRX2	Salmonella_phage	81.4	6.2e-185
AWS68589.1|1942403_1942622_+	hypothetical protein	NA	NA	NA	NA	NA
AWS68590.1|1942790_1943315_-|tail	tail assembly chaperone	tail	F1BUK2	Cronobacter_phage	45.3	6.2e-36
AWS68591.1|1943316_1945413_-	hypothetical protein	NA	Q858V4	Yersinia_virus	55.5	7.0e-62
AWS68592.1|1945419_1945953_-|tail	phage tail protein I	tail	Q858V5	Yersinia_virus	76.0	6.3e-76
AWS68593.1|1945945_1946854_-|plate	baseplate assembly protein	plate	F1BUP3	Erwinia_phage	64.9	1.5e-101
AWS68594.1|1946858_1947209_-|plate	baseplate assembly protein	plate	A0A0M4RE59	Salmonella_phage	70.7	8.9e-39
AWS68595.1|1947205_1947847_-|plate	phage baseplate assembly protein V	plate	A0A0M4S6F6	Salmonella_phage	60.6	2.9e-67
AWS68596.1|1948093_1948534_+	hypothetical protein	NA	NA	NA	NA	NA
AWS68597.1|1948523_1948961_+	hypothetical protein	NA	NA	NA	NA	NA
AWS68598.1|1949036_1949483_-	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	73.6	2.9e-50
AWS68599.1|1949475_1949943_-|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	75.5	4.5e-62
AWS68600.1|1950032_1950470_-	hypothetical protein	NA	O80310	Escherichia_phage	42.4	1.2e-13
AWS68601.1|1950466_1950976_-	lysozyme	NA	A0A218M4K3	Erwinia_phage	73.7	1.5e-63
AWS68602.1|1950959_1951169_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	39.1	9.8e-09
AWS68603.1|1951171_1951375_-|tail	phage tail protein	tail	U5N3E7	Enterobacteria_phage	71.6	1.1e-20
AWS68604.1|1951374_1951881_-|head	head completion/stabilization protein	head	S4TNY1	Salmonella_phage	71.4	1.5e-63
AWS68605.1|1951974_1952718_-|terminase	terminase	terminase	Q6K1I5	Salmonella_virus	63.2	2.9e-71
AWS68606.1|1952720_1953920_-|capsid	phage major capsid protein, P2 family	capsid	Q778Y7	Enterobacteria_phage	75.9	9.3e-152
AWS68607.1|1953990_1954836_-|capsid	capsid scaffolding protein	capsid	Q94MB7	Escherichia_virus	66.7	9.6e-103
AWS68608.1|1954996_1956769_+	oxidoreductase	NA	A0A0M4RE51	Salmonella_phage	81.3	3.8e-287
AWS68609.1|1956765_1957797_+|portal	phage portal protein	portal	Q6K1J0	Salmonella_virus	81.3	6.3e-165
AWS68610.1|1958108_1959251_-	hypothetical protein	NA	NA	NA	NA	NA
AWS68611.1|1959247_1960897_-	ATP-dependent endonuclease	NA	NA	NA	NA	NA
AWS68612.1|1961082_1961811_-	hypothetical protein	NA	Q37850	Escherichia_phage	57.0	9.8e-72
AWS68613.1|1961900_1964189_-	replication endonuclease	NA	S4TTC1	Salmonella_phage	60.5	1.5e-267
AWS68614.1|1964185_1964467_-	hypothetical protein	NA	A0A218M4I8	Erwinia_phage	56.8	7.7e-25
AWS68615.1|1964469_1964685_-	hypothetical protein	NA	NA	NA	NA	NA
AWS68616.1|1964687_1964987_-	hypothetical protein	NA	NA	NA	NA	NA
AWS68617.1|1964979_1965237_-	DUF2732 domain-containing protein	NA	NA	NA	NA	NA
AWS68618.1|1965300_1965801_-	replication protein B	NA	A0A0F7LBQ6	Escherichia_phage	72.3	2.2e-67
AWS68619.1|1965992_1966268_-	hypothetical protein	NA	Q1JS60	Enterobacteria_phage	71.1	1.5e-33
AWS68620.1|1966393_1966693_+	XRE family transcriptional regulator	NA	Q1JS61	Enterobacteria_phage	77.8	2.2e-38
AWS68621.1|1966780_1967764_+|integrase	integrase	integrase	Q83VS6	Escherichia_phage	64.8	4.1e-121
AWS68622.1|1967908_1968697_-	phosphate starvation-inducible protein PhoH	NA	R4II13	Cronobacter_phage	76.3	9.2e-92
1967870:1967891	attR	AAAAAGGCCGCCGAAGCGGCCT	NA	NA	NA	NA
>prophage 2
CP029715	Serratia marcescens strain AR_0131 chromosome, complete genome	5140937	3373710	3415087	5140937	portal,capsid,lysis,tRNA,tail,integrase,head,plate	Erwinia_phage(46.15%)	50	3379891:3379941	3415180:3415230
AWS69828.1|3373710_3374724_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.5	4.3e-110
AWS69829.1|3375049_3375265_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
AWS69830.1|3375401_3377150_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.8	6.6e-74
AWS69831.1|3377307_3379149_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.3	1.9e-34
AWS69832.1|3379224_3379713_-	mismatch-specific DNA-glycosylase	NA	NA	NA	NA	NA
3379891:3379941	attL	CTCATAATCGCTTGGTCGTTGGTTCAAACCCAACAGGGGCCACCAAATTTT	NA	NA	NA	NA
AWS69833.1|3380136_3380367_-	transcriptional regulator	NA	Q37973	Salmonella_virus	64.5	9.4e-21
AWS69834.1|3380450_3381611_-	phage late control D family protein	NA	A0A0M5M5V5	Salmonella_phage	65.4	7.4e-138
AWS69835.1|3381607_3382093_-|tail	phage tail protein	tail	A0A0F7LDE8	Escherichia_phage	65.7	1.5e-47
AWS69836.1|3382092_3384921_-|tail	phage tail tape measure protein	tail	Q7Y4C8	Escherichia_virus	39.1	2.8e-106
AWS69837.1|3384913_3385036_-|tail	GpE family phage tail protein	tail	Q6K1G8	Salmonella_virus	72.5	1.5e-09
AWS69838.1|3385068_3385350_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	69.0	9.1e-26
AWS69839.1|3385404_3385914_-|tail	phage major tail tube protein	tail	A0A218M4J0	Erwinia_phage	76.2	1.7e-70
AWS69840.1|3385929_3387099_-|tail	phage tail protein	tail	F1BUU3	Erwinia_phage	81.7	4.0e-184
AWS69841.1|3387374_3387794_-|tail	tail fiber assembly protein	tail	U5P083	Shigella_phage	38.7	2.6e-16
AWS69842.1|3387799_3390460_-	hypothetical protein	NA	Q858V4	Yersinia_virus	54.6	9.8e-61
AWS69843.1|3390466_3391000_-|tail	phage tail protein I	tail	Q858V5	Yersinia_virus	76.0	1.6e-76
AWS69844.1|3390992_3391901_-|plate	baseplate assembly protein	plate	F1BUP3	Erwinia_phage	67.9	2.4e-107
AWS69845.1|3391905_3392256_-|plate	baseplate assembly protein	plate	F1BUP4	Erwinia_phage	65.5	2.4e-36
AWS69846.1|3392252_3392468_-	hypothetical protein	NA	NA	NA	NA	NA
AWS69847.1|3392534_3393164_-|plate	phage baseplate assembly protein V	plate	A0A0M4S6F6	Salmonella_phage	74.3	1.1e-76
AWS69848.1|3393245_3395075_-	hypothetical protein	NA	E5E3R2	Burkholderia_phage	24.7	3.7e-11
AWS69849.1|3395157_3395607_-	phage virion morphogenesis protein	NA	F1BUP7	Erwinia_phage	61.1	7.2e-41
AWS69850.1|3395593_3396070_-|tail	phage tail protein	tail	F1BUP9	Erwinia_phage	65.4	1.1e-50
AWS69851.1|3396165_3396594_-|lysis	LysB family phage lysis regulatory protein	lysis	F1BUQ1	Erwinia_phage	36.0	4.6e-13
AWS69852.1|3396590_3397103_-	lysozyme	NA	A0A218M4K3	Erwinia_phage	66.3	6.7e-59
AWS69853.1|3397086_3397296_-	hypothetical protein	NA	A0A218M4L5	Erwinia_phage	43.5	2.0e-09
AWS69854.1|3397300_3397504_-|tail	phage tail protein	tail	A0A0F7LCN2	Escherichia_phage	68.7	1.8e-20
AWS69855.1|3397503_3397992_-|head	head completion/stabilization protein	head	F1BUQ6	Erwinia_phage	54.3	1.1e-39
AWS69856.1|3398085_3398745_-	hypothetical protein	NA	F1BUQ7	Erwinia_phage	69.4	5.2e-80
AWS69857.1|3398747_3399932_-|capsid	phage major capsid protein, P2 family	capsid	F1BUQ8	Erwinia_phage	78.6	4.5e-159
AWS69858.1|3399974_3400790_-|capsid	phage capsid protein	capsid	S4TP53	Salmonella_phage	53.5	7.1e-71
AWS69859.1|3400932_3402705_+	oxidoreductase	NA	F1BUR2	Erwinia_phage	82.2	5.2e-292
AWS69860.1|3402704_3403739_+|portal	phage portal protein	portal	F1BUR7	Erwinia_phage	80.7	1.6e-163
AWS71484.1|3403783_3404125_-	type II toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
AWS69861.1|3404124_3404379_-	type II toxin-antitoxin system HicA family toxin	NA	R4JMD3	Burkholderia_phage	48.8	1.6e-16
AWS69862.1|3404763_3405846_-	restriction endonuclease	NA	NA	NA	NA	NA
AWS69863.1|3405842_3407639_-	methylase	NA	NA	NA	NA	NA
AWS69864.1|3407799_3408012_-	hypothetical protein	NA	NA	NA	NA	NA
AWS69865.1|3408050_3410267_-	replication endonuclease	NA	A0A0F7LBQ2	Escherichia_phage	58.3	3.1e-238
AWS69866.1|3410263_3410545_-	hypothetical protein	NA	A0A218M4I8	Erwinia_phage	51.2	4.5e-17
AWS69867.1|3410667_3411249_-	3'-5' exonuclease	NA	A0A1S6L012	Salmonella_phage	58.4	1.7e-58
AWS69868.1|3411254_3411473_-	hypothetical protein	NA	Q6K1F5	Salmonella_virus	56.9	5.6e-15
AWS69869.1|3411472_3411784_-	hypothetical protein	NA	NA	NA	NA	NA
AWS69870.1|3411783_3412026_-	DUF2732 domain-containing protein	NA	NA	NA	NA	NA
AWS71485.1|3412089_3412392_-	hypothetical protein	NA	NA	NA	NA	NA
AWS71486.1|3412403_3412583_-	DUF2724 domain-containing protein	NA	F1BUS5	Erwinia_phage	51.0	1.1e-05
AWS69871.1|3412593_3413103_-	hypothetical protein	NA	A0A1S6L008	Salmonella_phage	53.6	4.2e-45
AWS69872.1|3413133_3413355_-	regulator	NA	NA	NA	NA	NA
AWS69873.1|3413464_3414049_+	phage repressor protein CI	NA	F1BUS8	Erwinia_phage	40.2	6.3e-29
AWS69874.1|3414052_3415087_+|integrase	integrase	integrase	F1BUS9	Erwinia_phage	62.6	1.5e-121
3415180:3415230	attR	CTCATAATCGCTTGGTCGTTGGTTCAAACCCAACAGGGGCCACCAAATTTT	NA	NA	NA	NA
>prophage 3
CP029715	Serratia marcescens strain AR_0131 chromosome, complete genome	5140937	4989969	4998625	5140937		Enterobacteria_phage(66.67%)	9	NA	NA
AWS71200.1|4989969_4991073_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	43.4	2.6e-60
AWS71201.1|4991076_4992336_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	48.6	3.6e-98
AWS71202.1|4992754_4993945_+	DUF4102 domain-containing protein	NA	Q7M297	Enterobacteria_phage	61.1	2.8e-140
AWS71203.1|4994680_4994944_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	55.0	1.5e-17
AWS71204.1|4994940_4995156_+	hypothetical protein	NA	NA	NA	NA	NA
AWS71205.1|4995142_4995688_+	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	60.7	5.5e-27
AWS71206.1|4995684_4995948_+	hypothetical protein	NA	NA	NA	NA	NA
AWS71207.1|4995944_4996280_+	hypothetical protein	NA	NA	NA	NA	NA
AWS71208.1|4996291_4998625_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	60.2	3.3e-262
