The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP028483	Escherichia coli strain E41-1 chromosome, complete genome	5022609	1773962	1783407	5022609		Enterobacteria_phage(85.71%)	10	NA	NA
AWR73414.1|1773962_1774889_+	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	26.8	2.6e-08
AWR73415.1|1774893_1775625_+	ABC transporter permease	NA	NA	NA	NA	NA
AWR73416.1|1775605_1775713_-	hypothetical protein	NA	NA	NA	NA	NA
AWR73417.1|1775772_1776504_-	transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	98.5	6.3e-111
AWR73418.1|1776725_1778411_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
AWR73419.1|1778407_1779127_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AWR73420.1|1779173_1779644_+	DUF1456 domain-containing protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
AWR73421.1|1779684_1780146_-	hypothetical protein	NA	Q9EYF5	Enterobacteria_phage	99.3	3.2e-76
AWR73422.1|1780270_1782274_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	95.7	0.0e+00
AWR73423.1|1782270_1783407_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	96.7	6.1e-161
>prophage 2
CP028483	Escherichia coli strain E41-1 chromosome, complete genome	5022609	1877583	1883886	5022609		Enterobacteria_phage(66.67%)	6	NA	NA
AWR73493.1|1877583_1878978_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	33.0	6.3e-19
AWR73494.1|1879152_1880046_+	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.0	3.0e-46
AWR76522.1|1880418_1881504_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	8.8e-101
AWR73495.1|1881503_1882403_+	dTDP-4-dehydrorhamnose reductase	NA	I7HXC9	Enterobacteria_phage	34.8	1.7e-28
AWR73496.1|1882460_1883339_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.5	6.6e-107
AWR73497.1|1883343_1883886_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	61.8	6.0e-50
>prophage 3
CP028483	Escherichia coli strain E41-1 chromosome, complete genome	5022609	1906982	1940011	5022609	transposase	Stx2-converting_phage(21.43%)	40	NA	NA
AWR73521.1|1906982_1907492_+|transposase	IS200/IS605-like element IS200C family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.8e-11
AWR73522.1|1907602_1909030_-	exodeoxyribonuclease I	NA	NA	NA	NA	NA
AWR73523.1|1909238_1910405_+	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	99.5	5.9e-228
AWR73524.1|1910523_1910997_+	DNA gyrase inhibitor SbmC	NA	NA	NA	NA	NA
AWR73525.1|1911194_1912253_+	FUSC family protein	NA	NA	NA	NA	NA
AWR73526.1|1912424_1912754_+	DUF496 domain-containing protein	NA	NA	NA	NA	NA
AWR76525.1|1912854_1913037_-	ethanolamine utilization protein	NA	NA	NA	NA	NA
AWR76527.1|1913525_1913639_-	DUF957 domain-containing protein	NA	NA	NA	NA	NA
AWR76528.1|1913651_1913843_-	hypothetical protein	NA	NA	NA	NA	NA
AWR73527.1|1913842_1914217_-	toxin	NA	NA	NA	NA	NA
AWR73528.1|1914305_1914674_-	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
AWR73529.1|1914689_1915334_-	antitoxin of toxin-antitoxin stability system	NA	A0A2I6PI07	Pseudomonas_phage	32.9	1.8e-24
AWR73530.1|1915352_1915574_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.9e-10
AWR76526.1|1915636_1916083_-	hypothetical protein	NA	NA	NA	NA	NA
AWR73531.1|1916128_1916602_-	antirestriction protein	NA	A0A2D0W9W4	Bordetella_phage	33.1	4.3e-12
AWR73532.1|1916695_1916941_-	antirestriction protein	NA	NA	NA	NA	NA
AWR73533.1|1916940_1917759_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.6	8.8e-45
AWR73534.1|1917979_1918390_-	hypothetical protein	NA	NA	NA	NA	NA
AWR73535.1|1918838_1919585_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	31.6	3.5e-24
AWR73536.1|1919599_1921141_-|transposase	IS21 family transposase ISEc12	transposase	K4I413	Acidithiobacillus_phage	46.4	1.7e-129
AWR73537.1|1921255_1921669_-	hypothetical protein	NA	NA	NA	NA	NA
AWR73538.1|1921804_1922875_-	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
AWR73539.1|1922871_1923777_-	chemotaxis protein	NA	NA	NA	NA	NA
AWR76529.1|1923773_1924616_-	vimentin yjdA	NA	NA	NA	NA	NA
AWR73540.1|1924659_1926273_-|transposase	IS66 family transposase ISEc23	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.6	3.0e-182
AWR73541.1|1926303_1926654_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
AWR73542.1|1926650_1927076_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
AWR73543.1|1927090_1928698_-	dGTPase	NA	NA	NA	NA	NA
AWR73544.1|1928915_1929350_-	hypothetical protein	NA	NA	NA	NA	NA
AWR73545.1|1929778_1931944_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
AWR73546.1|1931954_1932944_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AWR73547.1|1932962_1934021_+	iron ABC transporter permease	NA	NA	NA	NA	NA
AWR73548.1|1934017_1934785_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	27.9	7.5e-14
AWR73549.1|1934838_1935096_+	hypothetical protein	NA	NA	NA	NA	NA
AWR76530.1|1935626_1936772_-	hypothetical protein	NA	NA	NA	NA	NA
AWR73550.1|1937181_1937442_-	hypothetical protein	NA	NA	NA	NA	NA
AWR76531.1|1937368_1937746_+	hypothetical protein	NA	NA	NA	NA	NA
AWR73551.1|1937971_1938151_-|transposase	transposase	transposase	NA	NA	NA	NA
AWR73552.1|1938296_1939319_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.1	1.0e-199
AWR73553.1|1939315_1940011_+|transposase	transposase	transposase	A0A2L1IVB6	Escherichia_phage	88.4	2.3e-118
>prophage 4
CP028483	Escherichia coli strain E41-1 chromosome, complete genome	5022609	2066474	2148984	5022609	tail,terminase,integrase,portal,capsid,tRNA,plate,head,holin	Pectobacterium_phage(23.81%)	98	2066289:2066348	2108901:2109025
2066289:2066348	attL	ATTTAAAATCCCTCGGCGTTCGCGCTGTGCGGGTTCAAGTCCCGCTCCGGGTACCATGGG	NA	NA	NA	NA
AWR73663.1|2066474_2067491_-|integrase	integrase	integrase	H9C152	Pectobacterium_phage	63.6	1.1e-126
AWR73664.1|2067459_2067723_-	DUF4224 domain-containing protein	NA	H9C153	Pectobacterium_phage	38.0	1.2e-06
AWR73665.1|2067658_2067883_-	hypothetical protein	NA	H9C154	Pectobacterium_phage	56.3	7.3e-10
AWR73666.1|2067932_2068115_-	hypothetical protein	NA	NA	NA	NA	NA
AWR73667.1|2068114_2068684_-	hypothetical protein	NA	H9C156	Pectobacterium_phage	49.2	6.1e-37
AWR73668.1|2068680_2070897_-	hypothetical protein	NA	H9C157	Pectobacterium_phage	35.6	4.7e-101
AWR73669.1|2070927_2071248_-	hypothetical protein	NA	NA	NA	NA	NA
AWR73670.1|2072258_2072672_-	transcriptional regulator	NA	A0A1B5FPF4	Escherichia_phage	49.1	8.7e-09
AWR73671.1|2072770_2073001_+	transcriptional regulator	NA	H6WRX5	Salmonella_phage	63.2	1.5e-21
AWR73672.1|2073059_2073536_+	hypothetical protein	NA	H9C162	Pectobacterium_phage	48.6	1.9e-23
AWR73673.1|2073575_2073800_+	hypothetical protein	NA	H9C163	Pectobacterium_phage	54.1	6.1e-17
AWR73674.1|2073796_2074552_+	replication protein	NA	H9C164	Pectobacterium_phage	68.5	2.4e-41
AWR73675.1|2074541_2075957_+	helicase DnaB	NA	H9C165	Pectobacterium_phage	66.7	6.6e-173
AWR73676.1|2075995_2076406_+	hypothetical protein	NA	NA	NA	NA	NA
AWR73677.1|2076407_2076644_+	hypothetical protein	NA	NA	NA	NA	NA
AWR73678.1|2076640_2076952_+	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	65.7	1.2e-34
AWR73679.1|2076948_2077173_+	hypothetical protein	NA	NA	NA	NA	NA
AWR73680.1|2077360_2077582_+	hypothetical protein	NA	NA	NA	NA	NA
AWR76540.1|2077854_2078643_+	hypothetical protein	NA	A0A0P0ZC44	Stx2-converting_phage	69.8	1.1e-39
AWR73681.1|2078817_2079741_-	hypothetical protein	NA	NA	NA	NA	NA
AWR73682.1|2080929_2081628_+	lysogenic protein	NA	Q858R8	Enterobacteria_phage	91.4	1.5e-117
AWR73683.1|2082090_2082696_-	hypothetical protein	NA	NA	NA	NA	NA
AWR73684.1|2082705_2083194_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A142KB62	Gordonia_phage	42.7	6.4e-27
AWR73685.1|2083592_2083826_-	hypothetical protein	NA	NA	NA	NA	NA
AWR73686.1|2084069_2084711_+	hypothetical protein	NA	NA	NA	NA	NA
AWR73687.1|2084862_2085042_+	hypothetical protein	NA	NA	NA	NA	NA
AWR73688.1|2085119_2085716_+	DUF1367 domain-containing protein	NA	H9C173	Pectobacterium_phage	64.1	1.5e-70
AWR73689.1|2085712_2086006_+	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	70.5	3.3e-34
AWR73690.1|2086005_2086677_+	antitermination protein	NA	Q7Y3X2	Yersinia_phage	33.5	1.9e-16
AWR73691.1|2086789_2087173_+	hypothetical protein	NA	NA	NA	NA	NA
AWR73692.1|2087172_2087445_+|holin	phage holin family protein	holin	A0A0A0YPY6	Escherichia_phage	42.9	9.8e-09
AWR73693.1|2087444_2087924_+	TIGR02594 family protein	NA	A0A222YWL8	Escherichia_phage	68.8	4.6e-62
AWR73694.1|2087931_2088126_+	hypothetical protein	NA	NA	NA	NA	NA
AWR76541.1|2088185_2088431_-	hypothetical protein	NA	NA	NA	NA	NA
AWR73695.1|2088799_2089366_+	hypothetical protein	NA	A0A1I9KFT4	Aeromonas_phage	46.2	2.9e-31
AWR73696.1|2089352_2091215_+|terminase	phage terminase large subunit family protein	terminase	A0A1I9KF19	Aeromonas_phage	53.2	1.1e-191
AWR73697.1|2091214_2091448_+	hypothetical protein	NA	NA	NA	NA	NA
AWR73698.1|2091444_2093019_+|portal	phage portal protein	portal	E4WL21	Enterobacteria_phage	64.0	8.6e-190
AWR73699.1|2093018_2094326_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.7	4.9e-106
AWR73700.1|2094325_2094655_+|head	head protein	head	A0A2R9YJN3	Escherichia_phage	39.5	2.0e-08
AWR73701.1|2094713_2095748_+|capsid	minor capsid protein E	capsid	A0A2I6TCE5	Escherichia_phage	56.5	6.6e-106
AWR73702.1|2095782_2096202_+	DNA-packaging protein	NA	NA	NA	NA	NA
AWR73703.1|2096198_2096579_+	hypothetical protein	NA	NA	NA	NA	NA
AWR73704.1|2096610_2097291_+	hypothetical protein	NA	NA	NA	NA	NA
AWR73705.1|2097287_2097824_+	hypothetical protein	NA	NA	NA	NA	NA
AWR73706.1|2097804_2098707_+|plate	phage baseplate assembly protein V	plate	NA	NA	NA	NA
AWR73707.1|2098709_2099051_+|plate	baseplate assembly protein	plate	D4HTV2	Vibrio_phage	51.6	1.1e-20
AWR73708.1|2099047_2099968_+|plate	baseplate assembly protein	plate	D5LGZ3	Escherichia_phage	47.8	6.4e-68
AWR73709.1|2099970_2100597_+|tail	phage tail protein I	tail	A0A193GYD1	Enterobacter_phage	38.8	2.0e-25
AWR73710.1|2100589_2101774_+	hypothetical protein	NA	J9QDX3	Clostridium_phage	35.2	2.5e-16
AWR73711.1|2101773_2102163_+	hypothetical protein	NA	A0A2H4EXG4	Aeromonas_phage	30.8	9.4e-05
AWR73712.1|2102159_2103662_+|tail	phage tail protein	tail	R9TMQ0	Vibrio_phage	33.5	5.5e-69
AWR73713.1|2103679_2104192_+|tail	phage tail protein	tail	NA	NA	NA	NA
AWR73714.1|2104204_2104486_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
AWR73715.1|2104594_2106235_+	hypothetical protein	NA	A0A2I7R3J9	Vibrio_phage	29.3	1.2e-19
AWR76542.1|2106270_2106660_+	hypothetical protein	NA	E5FFG4	Burkholderia_phage	37.9	1.0e-14
AWR73716.1|2106821_2107046_+|tail	phage tail protein	tail	NA	NA	NA	NA
AWR73717.1|2108260_2108680_+	hypothetical protein	NA	G8C7Q7	Escherichia_phage	68.8	1.8e-49
AWR73718.1|2109151_2109817_+	YecA family protein	NA	NA	NA	NA	NA
2108901:2109025	attR	ATTTAAAATCCCTCGGCGTTCGCGCTGTGCGGGTTCAAGTCCCGCTCCGGGTACCATGGGAAAGATAAGAATAAAATCAAAGCAATAAGCAGTGTCGTGAAACCACCTTCGGGTGGTTTTTTTGT	NA	NA	NA	NA
AWR73719.1|2109867_2111079_-	tyrosine transporter	NA	NA	NA	NA	NA
AWR73720.1|2111269_2111509_+	DUF2492 domain-containing protein	NA	NA	NA	NA	NA
AWR73721.1|2111546_2112044_-	non-heme ferritin	NA	NA	NA	NA	NA
AWR73722.1|2112215_2112539_-	hypothetical protein	NA	NA	NA	NA	NA
AWR73723.1|2112745_2112892_-	hypothetical protein	NA	NA	NA	NA	NA
AWR73724.1|2113003_2113255_+	DUF2766 domain-containing protein	NA	NA	NA	NA	NA
AWR73725.1|2113332_2113836_-	non-heme ferritin	NA	NA	NA	NA	NA
AWR73726.1|2114305_2114545_+	hypothetical protein	NA	NA	NA	NA	NA
AWR73727.1|2114630_2115620_+	arabinose ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AWR73728.1|2115689_2117204_+	arabinose import ATP-binding protein AraG	NA	A0A285PWH2	Cedratvirus	29.7	1.3e-12
AWR73729.1|2117218_2118205_+	L-arabinose ABC transporter permease AraH	NA	NA	NA	NA	NA
AWR73730.1|2118371_2119172_+	trehalose-phosphatase	NA	NA	NA	NA	NA
AWR73731.1|2119146_2120571_+	trehalose-6-phosphate synthase	NA	NA	NA	NA	NA
AWR73732.1|2120577_2121006_-	universal stress protein UspC	NA	NA	NA	NA	NA
AWR73733.1|2121785_2122136_+	flagellar transcriptional activator FlhD	NA	NA	NA	NA	NA
AWR73734.1|2122138_2122717_+	flagellar transcriptional regulator FlhC	NA	NA	NA	NA	NA
AWR73735.1|2122843_2123731_+	flagellar motor stator protein MotA	NA	NA	NA	NA	NA
AWR73736.1|2123727_2124654_+	motility protein MotB	NA	NA	NA	NA	NA
AWR73737.1|2124658_2126623_+	chemotaxis protein CheA	NA	NA	NA	NA	NA
AWR73738.1|2126643_2127147_+	chemotaxis protein CheW	NA	NA	NA	NA	NA
AWR73739.1|2127291_2128953_+	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.3	1.7e-10
AWR73740.1|2129243_2130104_+	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
AWR73741.1|2130106_2131156_+	chemotaxis response regulator protein-glutamate methylesterase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	1.0e-05
AWR73742.1|2131170_2131560_+	two-component system response regulator	NA	A0A2K9L4R0	Tupanvirus	32.0	1.3e-06
AWR73743.1|2131570_2132215_+	protein phosphatase CheZ	NA	NA	NA	NA	NA
AWR73744.1|2132403_2133552_+	flagellar type III secretion system protein FlhB	NA	NA	NA	NA	NA
AWR73745.1|2133544_2135623_+	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
AWR73746.1|2135622_2136015_+	flagellar protein FlhE	NA	NA	NA	NA	NA
AWR73747.1|2136067_2137801_-|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.7	8.8e-87
AWR76543.1|2138016_2138583_+	VOC family protein	NA	NA	NA	NA	NA
AWR73748.1|2138596_2139343_+	copper homeostasis protein CutC	NA	NA	NA	NA	NA
AWR73749.1|2139730_2140831_+	cytochrome C	NA	NA	NA	NA	NA
AWR73750.1|2140855_2143285_+	molybdopterin guanine dinucleotide-containing S/N-oxide reductase	NA	NA	NA	NA	NA
AWR73751.1|2143320_2144292_-|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
AWR73752.1|2144288_2145032_-	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.6e-24
AWR73753.1|2145072_2145468_-	hypothetical protein	NA	NA	NA	NA	NA
AWR73754.1|2145520_2146339_-	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	99.2	6.5e-72
AWR73755.1|2146335_2146902_-	hydrolase	NA	NA	NA	NA	NA
AWR73756.1|2147211_2148984_+|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
>prophage 5
CP028483	Escherichia coli strain E41-1 chromosome, complete genome	5022609	2646640	2717475	5022609	transposase,terminase,portal,capsid,protease,holin,head,lysis,tail	Enterobacteria_phage(26.67%)	85	NA	NA
AWR74219.1|2646640_2647690_-|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
AWR74220.1|2647909_2648668_+	NAD(P)-dependent oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.4	4.4e-06
AWR74221.1|2648664_2649255_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
AWR74222.1|2649311_2649620_-	hypothetical protein	NA	NA	NA	NA	NA
AWR76567.1|2649629_2650616_-	hypothetical protein	NA	NA	NA	NA	NA
AWR74223.1|2651910_2653806_-	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
AWR74224.1|2653833_2654454_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
AWR74225.1|2654450_2655332_-	phosphatase	NA	NA	NA	NA	NA
AWR76568.1|2655469_2655514_+	trp operon leader peptide	NA	NA	NA	NA	NA
AWR74226.1|2655605_2657168_+	anthranilate synthase component I	NA	NA	NA	NA	NA
AWR74227.1|2657167_2658763_+	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	3.8e-52
AWR74228.1|2658766_2660125_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	41.2	3.9e-37
AWR74229.1|2660136_2661330_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
AWR74230.1|2661329_2662136_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
AWR74231.1|2662511_2662787_+	hypothetical protein	NA	S5MQL6	Escherichia_phage	52.9	1.1e-10
AWR74232.1|2662783_2663341_+	Rha family transcriptional regulator	NA	Q8H9L9	Vibrio_phage	63.8	4.2e-30
AWR74233.1|2663752_2664022_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	79.4	9.3e-20
AWR76569.1|2664120_2664747_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AWR74234.1|2664691_2664829_-|capsid	nucleocapsid protein	capsid	NA	NA	NA	NA
AWR76570.1|2664945_2665128_-	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	95.0	1.4e-24
AWR74235.1|2665253_2666222_+|tail	phage tail protein	tail	A0A0F7LDR4	Escherichia_phage	38.8	6.5e-47
AWR74236.1|2666237_2666765_+|tail	tail fiber assembly protein	tail	A0A0C4UR05	Shigella_phage	77.7	8.4e-73
AWR74237.1|2666795_2667329_-|tail	tail fiber assembly protein	tail	A0A077SL44	Escherichia_phage	70.1	1.8e-67
AWR74238.1|2667330_2670156_-|tail	phage tail protein	tail	Q858V4	Yersinia_virus	63.6	9.0e-04
AWR74239.1|2670617_2671364_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	31.6	3.5e-24
AWR74240.1|2671378_2672920_-|transposase	IS21 family transposase ISEc12	transposase	K4I413	Acidithiobacillus_phage	46.4	1.7e-129
AWR74241.1|2673560_2677034_-	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	89.7	0.0e+00
AWR74242.1|2677376_2678057_-|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	97.8	3.8e-110
AWR74243.1|2677954_2678698_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	97.6	4.3e-147
AWR74244.1|2678708_2679407_-|tail	phage minor tail protein L	tail	B6DZB1	Enterobacteria_phage	97.4	5.8e-130
AWR74245.1|2679406_2679748_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	95.6	9.0e-60
AWR74246.1|2679740_2682983_-|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	91.6	0.0e+00
AWR74247.1|2683030_2683312_-	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	98.9	2.3e-45
AWR74248.1|2683335_2683710_-|tail	phage tail protein	tail	A0A0P0ZE84	Stx2-converting_phage	99.2	1.7e-64
AWR74249.1|2683724_2684441_-|tail	phage tail protein	tail	A0A0P0ZDV1	Stx2-converting_phage	99.6	3.6e-127
AWR74250.1|2684507_2684852_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
AWR74251.1|2684848_2685295_-	hypothetical protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
AWR74252.1|2685291_2685642_-|head,tail	head-tail adaptor protein	head,tail	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
AWR74253.1|2685651_2685978_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZBH1	Stx2-converting_phage	100.0	9.2e-54
AWR74254.1|2685974_2688560_-|portal	phage portal protein	portal	A0A0P0ZDD0	Stx2-converting_phage	100.0	0.0e+00
AWR74255.1|2688505_2688727_-	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
AWR74256.1|2688771_2690709_-|capsid	phage major capsid protein	capsid	H6WZL0	Escherichia_phage	100.0	0.0e+00
AWR74257.1|2690772_2692434_-|terminase	terminase large subunit	terminase	B6DZ98	Enterobacteria_phage	98.7	0.0e+00
AWR74258.1|2692430_2692994_-|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	92.0	1.6e-82
AWR74259.1|2693284_2693650_-	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	93.4	2.5e-60
AWR74260.1|2693691_2693892_+	DUF3950 domain-containing protein	NA	H6WZK6	Escherichia_phage	98.5	4.3e-30
AWR76571.1|2693929_2694094_-	hypothetical protein	NA	Q9T1L1	Enterobacteria_phage	77.8	3.3e-12
AWR74261.1|2694090_2694306_-	hypothetical protein	NA	NA	NA	NA	NA
AWR74262.1|2694302_2694797_-|lysis	lysis protein	lysis	Q9ZXB6	Enterobacteria_phage	87.7	1.7e-72
AWR76572.1|2694798_2694885_-	hypothetical protein	NA	NA	NA	NA	NA
AWR74263.1|2695149_2695362_-	hypothetical protein	NA	A0A0M4S639	Salmonella_phage	60.5	2.7e-06
AWR74264.1|2695439_2695973_-	lysozyme	NA	Q6H9V6	Enterobacteria_phage	95.5	4.8e-100
AWR74265.1|2696141_2696567_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
AWR74266.1|2696563_2696914_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
AWR74267.1|2696944_2698558_+|transposase	IS66 family transposase ISEc23	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.6	3.0e-182
AWR74268.1|2698618_2698891_+	hypothetical protein	NA	NA	NA	NA	NA
AWR74269.1|2698856_2699201_-	DUF1327 domain-containing protein	NA	K7PGU6	Enterobacteria_phage	95.2	2.8e-37
AWR74270.1|2699205_2699421_-|holin	holin	holin	G9L6J5	Escherichia_phage	100.0	9.0e-34
AWR74271.1|2699571_2701425_-	DUF1737 domain-containing protein	NA	Q08JA2	Stx2-converting_phage	90.3	0.0e+00
AWR74272.1|2701685_2702021_+	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	74.8	5.2e-44
AWR74273.1|2702301_2702433_-	DUF3927 domain-containing protein	NA	H6WZJ7	Escherichia_phage	100.0	1.1e-05
AWR76573.1|2702468_2702795_-	hypothetical protein	NA	NA	NA	NA	NA
AWR74274.1|2703234_2704284_-	site-specific DNA-methyltransferase	NA	A0A0N7KZF8	Stx2-converting_phage	95.4	4.4e-198
AWR74275.1|2704435_2704633_-	TrmB family transcriptional regulator	NA	Q9MC00	Enterobacteria_phage	98.5	6.1e-29
AWR74276.1|2704859_2705681_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	60.1	1.7e-80
AWR74277.1|2705677_2706058_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	64.5	2.9e-35
AWR74278.1|2706058_2707114_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	48.4	4.0e-90
AWR74279.1|2707115_2707388_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	49.2	5.5e-12
AWR76574.1|2707334_2707514_+	hypothetical protein	NA	NA	NA	NA	NA
AWR74280.1|2707555_2707768_-	Hok/Gef family protein	NA	A0A0U2QV81	Escherichia_phage	90.0	5.2e-26
AWR74281.1|2707948_2708614_-	hypothetical protein	NA	NA	NA	NA	NA
AWR74282.1|2708788_2709214_-	DUF977 domain-containing protein	NA	A0A0U2QQN3	Escherichia_phage	94.0	2.2e-63
AWR74283.1|2709229_2710000_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	64.5	1.6e-80
AWR74284.1|2710021_2710768_-	DNA replication protein DnaC	NA	A0A088CBP4	Shigella_phage	83.8	4.0e-113
AWR76575.1|2710774_2711737_-	DNA-binding protein	NA	S5FM81	Shigella_phage	56.4	1.4e-70
AWR74285.1|2711759_2712185_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
AWR74286.1|2712181_2712397_-	transcriptional regulator	NA	NA	NA	NA	NA
AWR74287.1|2712446_2713163_+	LexA family transcriptional repressor	NA	H9C160	Pectobacterium_phage	42.0	1.7e-52
AWR76576.1|2713435_2713591_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	51.1	8.8e-07
AWR74288.1|2713550_2713721_+	hypothetical protein	NA	NA	NA	NA	NA
AWR74289.1|2713750_2713969_+	hypothetical protein	NA	NA	NA	NA	NA
AWR74290.1|2714017_2714212_-	hypothetical protein	NA	NA	NA	NA	NA
AWR74291.1|2714534_2714723_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
AWR74292.1|2714719_2714911_+	DUF1482 domain-containing protein	NA	NA	NA	NA	NA
AWR74293.1|2715003_2717475_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.0	5.7e-55
>prophage 6
CP028483	Escherichia coli strain E41-1 chromosome, complete genome	5022609	2856855	2902564	5022609	terminase,integrase,portal,capsid,tRNA,holin,head,tail	Enterobacteria_phage(56.0%)	60	2875639:2875653	2904233:2904247
AWR74432.1|2856855_2857134_-	hypothetical protein	NA	A0A0E3JSQ1	Enterobacteria_phage	55.4	9.9e-25
AWR74433.1|2857130_2859152_-|tail	phage tail protein	tail	A0A0E3M0V5	Enterobacteria_phage	72.3	7.2e-181
AWR74434.1|2859210_2862693_-	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	90.3	0.0e+00
AWR74435.1|2862753_2863395_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	86.5	2.9e-96
AWR74436.1|2863292_2864036_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.2	5.0e-148
AWR74437.1|2864040_2864739_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	99.6	5.1e-134
AWR74438.1|2864738_2865068_-|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	99.1	2.8e-58
AWR74439.1|2865064_2867626_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	98.4	0.0e+00
AWR74440.1|2867618_2868053_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
AWR74441.1|2868034_2868457_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	94.3	2.2e-68
AWR76583.1|2868472_2869213_-|tail	phage tail protein	tail	A0A2I6TC77	Escherichia_phage	98.0	1.6e-130
AWR74442.1|2869220_2869616_-|tail	phage tail protein	tail	A0A2R9YJI2	Escherichia_phage	98.5	2.9e-70
AWR74443.1|2869612_2870191_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	92.7	5.9e-80
AWR74444.1|2870202_2870556_-|tail	phage tail protein	tail	A0A2R9YJJ5	Escherichia_phage	98.3	2.2e-61
AWR74445.1|2870567_2870966_-	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	1.0e-62
AWR74446.1|2871007_2872033_-|capsid	minor capsid protein E	capsid	C6ZCY2	Enterobacteria_phage	99.4	7.8e-192
AWR74447.1|2872088_2872421_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
AWR74448.1|2872430_2873750_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	97.7	1.1e-230
AWR74449.1|2873730_2875332_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.9	1.4e-309
AWR74450.1|2875328_2875535_-|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
AWR74451.1|2875531_2877457_-|terminase	terminase	terminase	A0A0K2FJ14	Enterobacteria_phage	98.9	0.0e+00
2875639:2875653	attL	GCTGCCAGCGGGAAA	NA	NA	NA	NA
AWR74452.1|2877431_2877977_-|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	98.3	6.8e-94
AWR74453.1|2878116_2878311_-	DNA-packaging protein	NA	NA	NA	NA	NA
AWR74454.1|2878245_2878566_+	hypothetical protein	NA	NA	NA	NA	NA
AWR74455.1|2878453_2878807_+	hypothetical protein	NA	NA	NA	NA	NA
AWR74456.1|2878929_2879310_-	hypothetical protein	NA	H6WZK5	Escherichia_phage	72.2	2.6e-39
AWR74457.1|2879736_2880030_+	lipoprotein bor	NA	K7PL54	Enterobacteria_phage	92.8	7.0e-45
AWR74458.1|2880120_2880303_-	hypothetical protein	NA	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
AWR74459.1|2880519_2880996_-	lysozyme	NA	K7PKV2	Enterobacteria_phage	94.9	7.3e-84
AWR74460.1|2880982_2881300_-|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	86.1	3.3e-40
AWR74461.1|2881609_2882299_-	antitermination protein	NA	I6PDF8	Cronobacter_phage	48.5	4.9e-57
AWR74462.1|2882295_2882436_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	68.9	8.5e-09
AWR74463.1|2882432_2882795_-	RusA family crossover junction endodeoxyribonuclease	NA	K7PM48	Enterobacteria_phage	95.7	1.6e-59
AWR74464.1|2882791_2883082_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	95.8	2.3e-48
AWR74465.1|2883074_2883245_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
AWR74466.1|2883244_2883700_-	hypothetical protein	NA	I6PD71	Cronobacter_phage	66.9	1.6e-59
AWR74467.1|2883696_2883798_-	hypothetical protein	NA	NA	NA	NA	NA
AWR74468.1|2884147_2885191_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
AWR74469.1|2885227_2889493_-	inverse autotransporter beta-barrel domain-containing protein	NA	NA	NA	NA	NA
AWR74470.1|2889742_2890444_-	Replication protein P	NA	M1FJ72	Enterobacteria_phage	97.0	1.5e-125
AWR74471.1|2890440_2891460_-	Replication protein O	NA	A0A0M5M7Y1	Salmonella_phage	64.1	8.8e-111
AWR74472.1|2891456_2891996_-	regulator	NA	K7PJT7	Enterobacteria_phage	67.0	2.6e-61
AWR74473.1|2892065_2892296_-	transcriptional regulator	NA	A0A2H4FNF3	Salmonella_phage	68.0	1.5e-21
AWR74474.1|2892334_2893090_+	hypothetical protein	NA	Q76H56	Enterobacteria_phage	74.6	4.0e-92
AWR74475.1|2893685_2893892_+	cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	85.3	3.2e-28
AWR74476.1|2893967_2894264_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	98.0	8.9e-48
AWR74477.1|2894269_2895055_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
AWR74478.1|2895051_2895732_+	exonuclease	NA	A0A0P0ZCD4	Stx2-converting_phage	100.0	1.6e-132
AWR74479.1|2895728_2895911_+	DUF1317 domain-containing protein	NA	A0A1U8QQC1	Enterobacteria_phage	98.3	1.8e-27
AWR74480.1|2895883_2896075_+	DUF1382 domain-containing protein	NA	A0A0P0ZC67	Stx2-converting_phage	93.7	1.8e-25
AWR74481.1|2896085_2896367_+	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	95.7	3.0e-45
AWR74482.1|2896465_2896687_+	conjugal transfer protein TraR	NA	A0A1I9LJM6	Stx_converting_phage	93.2	2.3e-32
AWR74483.1|2896686_2897013_+	ASCH domain-containing protein	NA	A5VWB6	Enterobacteria_phage	95.7	9.8e-48
AWR74484.1|2896996_2897236_+	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	96.2	4.7e-39
AWR74485.1|2897375_2897612_+	excisionase	NA	NA	NA	NA	NA
AWR74486.1|2897601_2898744_+|integrase	integrase	integrase	Q77Z02	Phage_21	100.0	3.6e-206
AWR74487.1|2898857_2900108_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
AWR74488.1|2900279_2900933_+	23S rRNA pseudouridine synthase E	NA	NA	NA	NA	NA
AWR74489.1|2900942_2901404_+	NUDIX hydrolase	NA	NA	NA	NA	NA
AWR74490.1|2901457_2902564_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
2904233:2904247	attR	TTTCCCGCTGGCAGC	NA	NA	NA	NA
>prophage 7
CP028483	Escherichia coli strain E41-1 chromosome, complete genome	5022609	3099672	3226221	5022609	transposase,plate,terminase,integrase,portal,capsid,protease,holin,tRNA,head,tail	Enterobacteria_phage(42.42%)	146	3169600:3169619	3208257:3208276
AWR74674.1|3099672_3100458_-|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
AWR74675.1|3100593_3101373_+	envelope biogenesis factor ElyC	NA	NA	NA	NA	NA
AWR74676.1|3101349_3102243_-	hypothetical protein	NA	NA	NA	NA	NA
AWR74677.1|3102396_3103143_-	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
AWR74678.1|3103139_3103322_-	protein YcaR	NA	NA	NA	NA	NA
AWR74679.1|3103373_3104606_-	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AWR74680.1|3104642_3105629_-	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
AWR74681.1|3105625_3107374_-	lipid A export ATP-binding/permease MsbA	NA	W8CYL7	Bacillus_phage	29.8	3.3e-57
AWR74682.1|3107410_3109675_-	ComEC family protein	NA	NA	NA	NA	NA
AWR74683.1|3109880_3110165_-	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	3.2e-10
AWR74684.1|3110324_3111998_-	30S ribosomal protein S1	NA	NA	NA	NA	NA
AWR74685.1|3112108_3112792_-	cytidylate kinase	NA	NA	NA	NA	NA
AWR74686.1|3112964_3113747_-|protease	metalloprotease	protease	NA	NA	NA	NA
AWR74687.1|3113890_3114280_-	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	54.2	1.5e-31
AWR74688.1|3114251_3114701_-	regulatory protein GemA	NA	A4JWM5	Burkholderia_virus	45.1	6.1e-24
AWR74689.1|3114702_3114909_-	hypothetical protein	NA	NA	NA	NA	NA
AWR74690.1|3114898_3115129_-	hypothetical protein	NA	NA	NA	NA	NA
AWR74691.1|3115125_3115809_-	DUF2786 domain-containing protein	NA	A0A2P9JZH4	Alteromonadaceae_phage	36.1	1.1e-32
AWR74692.1|3115805_3116021_-	hypothetical protein	NA	NA	NA	NA	NA
AWR74693.1|3116035_3116332_-	hypothetical protein	NA	NA	NA	NA	NA
AWR74694.1|3116341_3116614_-	hypothetical protein	NA	NA	NA	NA	NA
AWR74695.1|3116670_3116892_+	hypothetical protein	NA	NA	NA	NA	NA
AWR74696.1|3116902_3117433_-	host-nuclease inhibitor protein Gam	NA	L7P7T1	Pseudomonas_phage	66.7	1.2e-58
AWR74697.1|3117460_3117730_-	hypothetical protein	NA	NA	NA	NA	NA
AWR74698.1|3117732_3118899_-	hypothetical protein	NA	A4JWN1	Burkholderia_virus	59.4	2.2e-121
AWR74699.1|3118909_3120679_-|integrase	integrase	integrase	A4JWN2	Burkholderia_virus	69.4	1.5e-227
AWR74700.1|3120694_3121012_-	hypothetical protein	NA	NA	NA	NA	NA
AWR74701.1|3121011_3121932_-	DUF3102 domain-containing protein	NA	A4JWN3	Burkholderia_virus	56.2	1.6e-74
AWR74702.1|3121942_3122251_-	IclR family transcriptional regulator	NA	Q5ZR02	Pseudomonas_phage	55.9	2.7e-23
AWR74703.1|3122303_3122492_-	DNA-binding protein	NA	Q5ZQZ9	Pseudomonas_phage	71.0	3.9e-17
AWR74704.1|3122585_3122942_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AWR74705.1|3123058_3123823_-	DNA adenine methylase	NA	A2I2Y7	Vibrio_virus	64.4	5.2e-100
AWR74706.1|3124013_3124229_-	hypothetical protein	NA	NA	NA	NA	NA
AWR74707.1|3124227_3124632_+	hypothetical protein	NA	NA	NA	NA	NA
AWR74708.1|3124607_3125336_-	hypothetical protein	NA	NA	NA	NA	NA
AWR74709.1|3125466_3125817_+	hypothetical protein	NA	A4JWP3	Burkholderia_virus	53.0	1.5e-22
AWR74710.1|3125819_3126560_+	lytic transglycosylase domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	51.4	2.5e-62
AWR74711.1|3126543_3127194_+	hypothetical protein	NA	J9SVN7	Pseudomonas_phage	32.9	2.8e-09
AWR74712.1|3127190_3127517_+	hypothetical protein	NA	Q6QIC4	Burkholderia_phage	48.6	1.1e-17
AWR74713.1|3127516_3127828_+	hypothetical protein	NA	A0A0S4L0A3	Pseudomonas_phage	62.6	9.4e-32
AWR74714.1|3127827_3128373_+	DUF3486 domain-containing protein	NA	A4JWJ3	Burkholderia_virus	67.6	9.3e-59
AWR74715.1|3128752_3129178_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
AWR74716.1|3129174_3129525_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
AWR74717.1|3129555_3131169_+|transposase	IS66 family transposase ISEc23	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.6	3.0e-182
AWR74718.1|3132504_3134001_+	DUF935 domain-containing protein	NA	A4JWJ5	Burkholderia_virus	59.0	9.7e-167
AWR74719.1|3133981_3134803_+|head	phage head morphogenesis protein	head	A4JWJ6	Burkholderia_virus	61.9	1.8e-98
AWR74720.1|3134805_3135264_+	phage virion morphogenesis protein	NA	Q6QIB8	Burkholderia_phage	44.8	2.6e-30
AWR74721.1|3135478_3136594_+	peptidase	NA	A4JWJ9	Burkholderia_virus	51.6	9.4e-98
AWR74722.1|3136608_3137562_+	hypothetical protein	NA	A4JWK0	Burkholderia_virus	43.8	3.4e-64
AWR74723.1|3137571_3137910_+	DUF2190 domain-containing protein	NA	NA	NA	NA	NA
AWR74724.1|3137911_3138358_+	DUF1320 domain-containing protein	NA	A4JWK2	Burkholderia_virus	52.3	2.2e-34
AWR74725.1|3138357_3138822_+	hypothetical protein	NA	Q6QIB2	Burkholderia_phage	51.7	9.1e-39
AWR74726.1|3138818_3139073_+	hypothetical protein	NA	NA	NA	NA	NA
AWR74727.1|3139062_3140490_+|tail	phage tail protein	tail	A4JWK5	Burkholderia_virus	76.3	4.5e-214
AWR74728.1|3140489_3141011_+|tail	phage major tail tube protein	tail	A4JWK6	Burkholderia_virus	67.6	1.8e-67
AWR74729.1|3141013_3141295_+	hypothetical protein	NA	NA	NA	NA	NA
AWR74730.1|3141392_3141728_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
AWR74731.1|3141651_3141810_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
AWR74732.1|3141885_3144837_+|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	29.9	9.8e-86
AWR74733.1|3144836_3145721_+	hypothetical protein	NA	A4JWL1	Burkholderia_virus	47.9	6.8e-51
AWR74734.1|3145717_3145933_+	hypothetical protein	NA	Q6QIA3	Burkholderia_phage	57.1	1.2e-17
AWR74735.1|3145920_3147075_+	phage protein D	NA	Q6QIA2	Burkholderia_phage	47.6	1.9e-85
AWR74736.1|3147071_3147668_+|plate	phage baseplate assembly protein V	plate	A4JWL4	Burkholderia_virus	45.2	3.2e-36
AWR74737.1|3147722_3148070_+|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	62.4	5.9e-35
AWR74738.1|3148060_3149164_+|plate	baseplate protein	plate	Q6QI99	Burkholderia_phage	55.2	1.4e-106
AWR74739.1|3149156_3149735_+|tail	phage tail protein I	tail	A4JWL7	Burkholderia_virus	66.8	1.7e-66
AWR74740.1|3149737_3150985_+|tail	phage tail protein	tail	A0A0K2FIZ6	Escherichia_phage	43.7	2.0e-40
AWR74741.1|3150995_3151457_+|tail	phage tail protein	tail	A0A0F7LCR3	Escherichia_phage	50.0	3.9e-34
AWR74742.1|3151463_3152078_-|tail	phage tail protein	tail	Q9MCR5	Enterobacteria_phage	60.5	2.5e-60
AWR74743.1|3152077_3152602_-|tail	phage tail protein	tail	A0A0F7LCR3	Escherichia_phage	48.6	1.8e-35
AWR74744.1|3152661_3153234_+	DNA invertase	NA	A0A0A7NPV4	Enterobacteria_phage	85.2	4.6e-85
AWR74745.1|3153489_3154773_-	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
AWR74746.1|3154843_3155932_-	3-phosphoserine/phosphohydroxythreonine aminotransferase	NA	M1Q1P2	Streptococcus_phage	46.8	2.7e-81
AWR74747.1|3156130_3156823_-	DUF421 domain-containing protein	NA	NA	NA	NA	NA
AWR74748.1|3156952_3158713_+	30S ribosomal protein S12 methylthiotransferase accessory protein YcaO	NA	NA	NA	NA	NA
AWR74749.1|3159118_3159976_+	formate transporter FocA	NA	NA	NA	NA	NA
AWR74750.1|3160030_3162313_+	formate acetyltransferase 1	NA	A0A2P0VNR5	Tetraselmis_virus	41.5	1.0e-162
AWR74751.1|3162504_3163245_+	pyruvate formate lyase-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.5	8.0e-21
AWR74752.1|3163341_3164490_-	MFS transporter	NA	NA	NA	NA	NA
AWR74753.1|3164803_3165430_+	hydrolase	NA	NA	NA	NA	NA
AWR74754.1|3165465_3166329_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
AWR74755.1|3166330_3166948_-	dimethyl sulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.6	5.0e-77
AWR74756.1|3166958_3169403_-	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.8	6.6e-221
3169600:3169619	attL	AAAGCGCCCGCAGGCGCTTT	NA	NA	NA	NA
AWR74757.1|3169702_3170695_-|integrase	integrase	integrase	A0A0F7LBR0	Escherichia_phage	56.2	1.3e-103
AWR76599.1|3170764_3171106_-	XRE family transcriptional regulator	NA	Q1JS45	Enterobacteria_phage	51.2	4.7e-16
AWR74758.1|3171210_3171732_+	transcriptional regulator	NA	NA	NA	NA	NA
AWR74759.1|3171736_3172159_+	hypothetical protein	NA	NA	NA	NA	NA
AWR74760.1|3172165_3172357_-	hypothetical protein	NA	NA	NA	NA	NA
AWR74761.1|3172494_3172845_+	DUF4761 domain-containing protein	NA	A0A0A7NV42	Enterobacteria_phage	93.1	8.1e-56
AWR74762.1|3172855_3173134_+	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	79.3	3.1e-34
AWR74763.1|3173145_3173388_+	DUF4754 domain-containing protein	NA	A0A0A7NQ71	Enterobacteria_phage	100.0	2.3e-38
AWR74764.1|3173591_3174002_+	hypothetical protein	NA	NA	NA	NA	NA
AWR74765.1|3174025_3174229_+	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	83.6	2.5e-25
AWR74766.1|3174225_3174492_+	MarR family transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	75.9	2.0e-30
AWR74767.1|3174488_3174788_+	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	88.9	2.4e-40
AWR74768.1|3174838_3175054_-	hypothetical protein	NA	NA	NA	NA	NA
AWR74769.1|3175110_3175341_+	derepression protein	NA	A0A0A7NV48	Enterobacteria_phage	97.4	9.1e-32
AWR74770.1|3175413_3175779_+	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	97.5	1.7e-61
AWR76600.1|3175923_3178608_+	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	98.4	0.0e+00
AWR74771.1|3178684_3179644_+	recombinase	NA	A0A0A7NPX4	Enterobacteria_phage	99.1	4.2e-179
AWR74772.1|3179648_3179963_+	peptide transporter	NA	A0A0A7NPT5	Enterobacteria_phage	52.3	4.1e-19
AWR74773.1|3180046_3180889_-	hypothetical protein	NA	NA	NA	NA	NA
AWR74774.1|3180928_3181426_-	DUF4760 domain-containing protein	NA	NA	NA	NA	NA
AWR74775.1|3182149_3182674_+	hypothetical protein	NA	NA	NA	NA	NA
AWR74776.1|3182688_3183735_-|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	99.7	2.2e-202
AWR74777.1|3183734_3185486_-	oxidoreductase	NA	A0A0A7NV54	Enterobacteria_phage	97.8	0.0e+00
AWR74778.1|3185640_3186477_+|capsid	phage capsid protein	capsid	A0A0A7NRY7	Enterobacteria_phage	99.6	2.7e-150
AWR74779.1|3186500_3187553_+|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	94.3	1.4e-188
AWR74780.1|3187598_3188399_+|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	89.1	6.9e-127
AWR74781.1|3188500_3188995_+|capsid	capsid assembly protein	capsid	A0A0A7NPU2	Enterobacteria_phage	97.0	1.9e-87
AWR74782.1|3188994_3189195_+|tail	phage tail protein	tail	A0A0A7NV57	Enterobacteria_phage	100.0	3.5e-32
AWR74783.1|3189197_3189521_+|holin	holin	holin	A0A0A7NRY9	Enterobacteria_phage	93.5	1.7e-47
AWR74784.1|3189517_3189910_+	M15 family peptidase	NA	A0A0A7NQ86	Enterobacteria_phage	96.9	1.9e-69
AWR74785.1|3189906_3190302_+	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	93.3	1.0e-59
AWR74786.1|3190440_3192318_+	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	80.2	2.7e-299
AWR74787.1|3192341_3192809_+|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	95.5	3.5e-83
AWR74788.1|3192801_3193437_+	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	99.5	4.1e-114
AWR74789.1|3193433_3194015_+|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	98.4	3.3e-102
AWR74790.1|3194011_3194362_+|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	99.1	3.5e-59
AWR74791.1|3194365_3195262_+|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	97.7	3.3e-154
AWR74792.1|3195254_3195785_+|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	98.2	3.6e-92
AWR74793.1|3195787_3198010_+|tail	phage tail protein	tail	A0A0A7NV63	Enterobacteria_phage	65.0	3.8e-183
AWR74794.1|3198011_3198539_+|tail	tail fiber assembly protein	tail	A0A0C4UR05	Shigella_phage	93.7	2.6e-90
AWR74795.1|3198567_3199101_-|tail	tail fiber assembly protein	tail	C9DGR0	Escherichia_phage	98.9	4.2e-96
AWR74796.1|3199103_3199661_-|tail	phage tail protein	tail	A0A0A7NPY7	Enterobacteria_phage	88.5	5.0e-84
AWR74797.1|3199879_3200479_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	98.9	3.8e-98
AWR74798.1|3200507_3201002_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	99.4	2.1e-86
AWR74799.1|3201008_3203816_-|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	90.1	0.0e+00
AWR74800.1|3203802_3204039_-|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	94.1	4.3e-21
AWR74801.1|3203966_3204341_-|tail	phage tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	71.5	9.9e-36
AWR74802.1|3204396_3204909_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	97.1	1.5e-90
AWR74803.1|3204908_3206093_-|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	97.5	8.4e-222
AWR74804.1|3206250_3207360_+	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	94.9	1.3e-195
AWR74805.1|3207400_3207661_+	hypothetical protein	NA	NA	NA	NA	NA
AWR74806.1|3207852_3207993_+	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	97.8	1.5e-18
AWR74807.1|3208298_3209591_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
3208257:3208276	attR	AAAGCGCCCGCAGGCGCTTT	NA	NA	NA	NA
AWR74808.1|3209681_3211025_-	recombination factor protein RarA	NA	G3MBE0	Bacillus_virus	40.8	3.6e-80
AWR74809.1|3211035_3211647_-	outer membrane lipoprotein carrier protein LolA	NA	NA	NA	NA	NA
AWR74810.1|3211805_3215912_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
AWR74811.1|3217083_3218049_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	1.9e-62
AWR74812.1|3218171_3219938_+	thiol reductant ABC exporter subunit CydD	NA	W8CYL7	Bacillus_phage	24.3	4.1e-23
AWR74813.1|3219938_3221660_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	30.8	1.2e-14
AWR74814.1|3221701_3222406_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
AWR74815.1|3222690_3222909_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
AWR74816.1|3223593_3225870_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
AWR74817.1|3225900_3226221_-|protease	ATP-dependent Clp protease adaptor ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
>prophage 8
CP028483	Escherichia coli strain E41-1 chromosome, complete genome	5022609	3983044	4026180	5022609	transposase,bacteriocin,tRNA	Salmonella_phage(25.0%)	43	NA	NA
AWR75516.1|3983044_3983971_+|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
AWR75517.1|3984009_3985428_+	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	37.9	3.2e-26
AWR75518.1|3985424_3985904_+	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
AWR75519.1|3986251_3986836_+	fimbrial protein	NA	NA	NA	NA	NA
AWR75520.1|3986932_3987673_+	fimbrial chaperone	NA	NA	NA	NA	NA
AWR75521.1|3987707_3990308_+	outer membrane usher protein	NA	NA	NA	NA	NA
AWR75522.1|3990324_3990897_+	fimbrial protein	NA	NA	NA	NA	NA
AWR75523.1|3990911_3991544_+	fimbrial protein StaE	NA	NA	NA	NA	NA
AWR75524.1|3991696_3992959_+|transposase	IS1380 family transposase ISEc9	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
AWR75525.1|3993208_3994084_+	class A extended-spectrum beta-lactamase CTX-M-14	NA	A0A1B0VBP7	Salmonella_phage	99.6	6.1e-153
AWR75526.1|3994584_3995181_+	fimbrial protein StaF	NA	NA	NA	NA	NA
AWR75527.1|3995232_3996486_+	fimbrial protein	NA	NA	NA	NA	NA
AWR75528.1|3996598_3997393_+	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	NA	NA	NA	NA
AWR75529.1|3997404_3998256_+	pantoate--beta-alanine ligase	NA	NA	NA	NA	NA
AWR75530.1|3998337_3998535_-|transposase	transposase	transposase	NA	NA	NA	NA
AWR75531.1|3998603_3999524_-|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	48.8	4.9e-60
AWR75532.1|3999644_3999848_-	hypothetical protein	NA	NA	NA	NA	NA
AWR75533.1|3999797_4000178_+	aspartate 1-decarboxylase	NA	NA	NA	NA	NA
AWR75534.1|4000181_4001411_-	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
AWR75535.1|4001474_4001915_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
AWR75536.1|4002019_4002790_-	inner membrane transport permease YadH	NA	NA	NA	NA	NA
AWR75537.1|4002786_4003713_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	34.0	1.2e-21
AWR75538.1|4003821_4004484_+	carbonic anhydrase	NA	NA	NA	NA	NA
AWR75539.1|4004524_4005061_-	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	33.1	5.1e-17
AWR75540.1|4005266_4007657_+	glucose/quinate/shikimate family membrane-bound PQQ-dependent dehydrogenase	NA	NA	NA	NA	NA
AWR75541.1|4007703_4009254_-	multicopper oxidase CueO	NA	A0A0C6DWA2	Mamastrovirus	55.4	3.5e-18
AWR75542.1|4009419_4009767_+	hypothetical protein	NA	NA	NA	NA	NA
AWR75543.1|4009872_4010739_+	polyamine aminopropyltransferase	NA	NA	NA	NA	NA
AWR75544.1|4010754_4011549_+	S-adenosylmethionine decarboxylase proenzyme	NA	NA	NA	NA	NA
AWR75545.1|4011586_4011949_-	UPF0231 family protein	NA	NA	NA	NA	NA
AWR75546.1|4012123_4014721_-	aconitate hydratase B	NA	NA	NA	NA	NA
AWR75547.1|4014701_4014818_-	aconitate hydratase	NA	NA	NA	NA	NA
AWR75548.1|4015075_4016839_+	DUF3300 domain-containing protein	NA	NA	NA	NA	NA
AWR75549.1|4016909_4018334_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.8	4.2e-42
AWR75550.1|4018541_4020434_-	pyruvate dehydrogenase complex dihydrolipoyllysine-residue acetyltransferase	NA	NA	NA	NA	NA
AWR75551.1|4020448_4023112_-	pyruvate dehydrogenase E1 component	NA	NA	NA	NA	NA
AWR76625.1|4023093_4023276_+	hypothetical protein	NA	NA	NA	NA	NA
AWR75552.1|4023272_4024037_-	pyruvate dehydrogenase complex repressor	NA	NA	NA	NA	NA
AWR75553.1|4024492_4024783_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
AWR75554.1|4024783_4025023_-	hypothetical protein	NA	NA	NA	NA	NA
AWR75555.1|4025190_4025481_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
AWR75556.1|4025534_4025723_-	HNH endonuclease	NA	NA	NA	NA	NA
AWR75557.1|4025889_4026180_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
>prophage 9
CP028483	Escherichia coli strain E41-1 chromosome, complete genome	5022609	4282061	4328943	5022609	transposase,holin	Stx2-converting_phage(23.08%)	49	NA	NA
AWR75794.1|4282061_4283209_-|transposase	IS3-like element ISEc52 family transposase	transposase	Q716C2	Shigella_phage	96.3	2.4e-173
AWR75795.1|4283371_4283626_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
AWR75796.1|4284126_4284309_+	hypothetical protein	NA	NA	NA	NA	NA
AWR75797.1|4286277_4287424_+|transposase	IS3-like element ISEc52 family transposase	transposase	Q716C2	Shigella_phage	96.3	2.4e-173
AWR75798.1|4288051_4289338_+	restriction endonuclease	NA	NA	NA	NA	NA
AWR75799.1|4289447_4291187_+	Alw26I/Eco31I/Esp3I family type II restriction endonuclease	NA	NA	NA	NA	NA
AWR75800.1|4291199_4292390_-	DNA cytosine methyltransferase	NA	Q02778	Bacillus_phage	31.0	7.3e-16
AWR75801.1|4292382_4294023_-	Alw26I/Eco31I/Esp3I family type II restriction adenine-specific DNA-methyltransferase	NA	NA	NA	NA	NA
AWR75802.1|4295593_4295770_-	DUF957 domain-containing protein	NA	NA	NA	NA	NA
AWR75803.1|4295786_4296275_-	hypothetical protein	NA	NA	NA	NA	NA
AWR75804.1|4296271_4296649_-	toxin	NA	NA	NA	NA	NA
AWR75805.1|4296738_4297107_-	antitoxin	NA	NA	NA	NA	NA
AWR75806.1|4297269_4297491_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.9e-10
AWR76635.1|4297553_4298000_-	hypothetical protein	NA	NA	NA	NA	NA
AWR75807.1|4298045_4298519_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	30.3	8.7e-13
AWR75808.1|4298860_4299679_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	39.7	9.4e-47
AWR75809.1|4299699_4299834_-	cytoplasmic protein	NA	NA	NA	NA	NA
AWR75810.1|4299833_4300028_-	DUF905 domain-containing protein	NA	NA	NA	NA	NA
AWR75811.1|4300062_4302909_-	autotransporter adhesin Ag43	NA	NA	NA	NA	NA
AWR75812.1|4303281_4304154_-	50S ribosome-binding GTPase	NA	NA	NA	NA	NA
AWR75813.1|4304238_4305156_-	hypothetical protein	NA	NA	NA	NA	NA
AWR75814.1|4305288_4305504_+	hypothetical protein	NA	NA	NA	NA	NA
AWR75815.1|4305987_4306185_-	hypothetical protein	NA	NA	NA	NA	NA
AWR76636.1|4306253_4306451_+	hypothetical protein	NA	NA	NA	NA	NA
AWR75816.1|4306356_4306974_-	hypothetical protein	NA	NA	NA	NA	NA
AWR75817.1|4307054_4307315_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AWR75818.1|4307257_4307464_-	hypothetical protein	NA	NA	NA	NA	NA
AWR75819.1|4308034_4308184_+	hemolysin activation protein	NA	NA	NA	NA	NA
AWR75820.1|4308203_4308404_+	hypothetical protein	NA	NA	NA	NA	NA
AWR75821.1|4308516_4308714_-	hypothetical protein	NA	NA	NA	NA	NA
AWR75822.1|4308877_4309483_+	inovirus Gp2 family protein	NA	NA	NA	NA	NA
AWR75823.1|4309736_4310144_+	hypothetical protein	NA	NA	NA	NA	NA
AWR75824.1|4310044_4310566_+	hypothetical protein	NA	NA	NA	NA	NA
AWR75825.1|4310565_4310802_+	hypothetical protein	NA	NA	NA	NA	NA
AWR75826.1|4310920_4311301_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
AWR75827.1|4311297_4311645_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
AWR75828.1|4311694_4313080_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	89.3	3.4e-259
AWR75829.1|4313318_4314692_-	esterase-like activity of phytase family protein	NA	NA	NA	NA	NA
AWR75830.1|4316238_4316760_+	RNA polymerase sigma factor FecI	NA	NA	NA	NA	NA
AWR75831.1|4316756_4317710_+	protein FecR	NA	NA	NA	NA	NA
AWR75832.1|4317796_4320121_+	fe(3+) dicitrate transporter fecA	NA	NA	NA	NA	NA
AWR75833.1|4320165_4321068_+	Fe(3+)-dicitrate ABC transporter substrate-binding protein FecB	NA	NA	NA	NA	NA
AWR75834.1|4321064_4322063_+	Fe3+ dicitrate ABC transporter permease	NA	NA	NA	NA	NA
AWR75835.1|4322059_4323016_+	iron-dicitrate transporter subunit FecD	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.1	1.1e-17
AWR75836.1|4323016_4323784_+	Fe(3+) dicitrate transport ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	24.8	6.4e-13
AWR75837.1|4324340_4324754_-	hypothetical protein	NA	NA	NA	NA	NA
AWR75838.1|4325531_4326687_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
AWR75839.1|4326836_4328840_+|holin	high-affinity choline transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	25.9	4.4e-21
AWR75840.1|4328784_4328943_+|holin	choline transporter	holin	NA	NA	NA	NA
>prophage 1
CP028484	Escherichia coli strain E41-1 plasmid p1, complete sequence	128911	889	29122	128911	protease,transposase	Escherichia_phage(44.44%)	36	NA	NA
AWR76669.1|889_2503_+|transposase	IS66 family transposase ISEc23	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.6	3.0e-182
AWR76796.1|2938_3073_+	type I toxin-antitoxin system hok family toxin	NA	NA	NA	NA	NA
AWR76670.1|3369_3624_+	replication protein	NA	NA	NA	NA	NA
AWR76671.1|3666_3777_-	replication protein RepA	NA	NA	NA	NA	NA
AWR76797.1|3860_3935_+	RepA leader peptide Tap	NA	NA	NA	NA	NA
AWR76672.1|3915_4785_+	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
AWR76673.1|5724_6378_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
AWR76674.1|6597_7062_+	mRNA interferase PemK	NA	NA	NA	NA	NA
AWR76675.1|7058_7163_+	hypothetical protein	NA	NA	NA	NA	NA
AWR76676.1|7346_8657_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
AWR76677.1|8933_9794_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
AWR76678.1|10154_10859_+|transposase	IS6 family transposase IS15DI	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
AWR76679.1|11426_12287_+	EamA family transporter	NA	NA	NA	NA	NA
AWR76680.1|12318_13518_-	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
AWR76681.1|13596_14250_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AWR76798.1|14281_14518_-	relaxase	NA	NA	NA	NA	NA
AWR76682.1|14571_15408_-	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
AWR76683.1|15407_16211_-	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
AWR76684.1|16271_17087_-	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	5.9e-09
AWR76685.1|17394_17607_-	replication C family protein	NA	NA	NA	NA	NA
AWR76686.1|17631_18336_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AWR76687.1|18457_19363_+	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
AWR76688.1|19359_20598_+	MFS transporter	NA	NA	NA	NA	NA
AWR76689.1|20597_21182_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AWR76690.1|21127_21484_+	hypothetical protein	NA	NA	NA	NA	NA
AWR76799.1|21674_22439_-|transposase	IS6 family transposase IS6100	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
AWR76691.1|22467_22650_+	resolvase	NA	NA	NA	NA	NA
AWR76692.1|22665_22971_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
AWR76693.1|22981_24187_-	chromate transporter	NA	NA	NA	NA	NA
AWR76694.1|24342_24546_-	hypothetical protein	NA	NA	NA	NA	NA
AWR76695.1|24564_24744_+	hypothetical protein	NA	NA	NA	NA	NA
AWR76696.1|24673_25513_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
AWR76697.1|25506_25854_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
AWR76698.1|26059_26848_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA5	NA	NA	NA	NA	NA
AWR76800.1|26978_27452_-	trimethoprim-resistant dihydrofolate reductase DfrA17	NA	A0A1B2IAU3	Erwinia_phage	34.6	1.3e-16
AWR76699.1|28417_29122_+|transposase	IS6 family transposase IS15DI	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
>prophage 2
CP028484	Escherichia coli strain E41-1 plasmid p1, complete sequence	128911	57685	108635	128911	integrase,transposase	Escherichia_phage(33.33%)	51	83763:83779	101545:101561
AWR76731.1|57685_58708_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.7	3.2e-201
AWR76732.1|58704_59487_+|transposase	transposase	transposase	A0A2L1IVB6	Escherichia_phage	100.0	2.0e-139
AWR76733.1|60225_61017_-	DUF4198 domain-containing protein	NA	NA	NA	NA	NA
AWR76734.1|61023_62994_-	TonB-dependent hemoglobin/transferrin/lactoferrin family receptor	NA	NA	NA	NA	NA
AWR76735.1|64236_64509_+	transcriptional regulator	NA	NA	NA	NA	NA
AWR76736.1|65355_66525_-	hypothetical protein	NA	NA	NA	NA	NA
AWR76737.1|66891_67080_+	serine/threonine protein kinase	NA	NA	NA	NA	NA
AWR76738.1|67200_67941_+	site-specific recombinase	NA	I3WFA4	Macacine_betaherpesvirus	57.6	1.6e-24
AWR76739.1|68225_69203_-	repFIB replication protein A	NA	J9Q7H0	Salmonella_phage	59.2	1.4e-100
AWR76740.1|72545_73478_-	homocysteine S-methyltransferase	NA	NA	NA	NA	NA
AWR76801.1|73464_74868_-	S-methylmethionine permease	NA	NA	NA	NA	NA
AWR76741.1|75075_76092_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.4	4.9e-186
AWR76742.1|76319_76637_+	type I deoxyribonuclease HsdR	NA	NA	NA	NA	NA
AWR76743.1|76923_77283_-	pdcB	NA	A0A077SLM1	Escherichia_phage	98.9	5.0e-45
AWR76744.1|77310_77490_-	PdcA protein	NA	Q71TH5	Escherichia_phage	96.6	3.5e-23
AWR76745.1|77494_77875_-	type II toxin-antitoxin system death-on-curing family toxin	NA	A0A077SK56	Escherichia_phage	100.0	1.1e-63
AWR76746.1|77874_78096_-	type II toxin-antitoxin system prevent-host-death family antitoxin	NA	A0A222YXU1	Escherichia_phage	100.0	6.7e-32
AWR76802.1|78278_79835_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	42.7	3.2e-104
AWR76747.1|79831_81115_+	restriction endonuclease subunit S	NA	F2Y1N5	Organic_Lake_phycodnavirus	26.5	2.2e-10
AWR76748.1|83438_84371_-	hypothetical protein	NA	NA	NA	NA	NA
83763:83779	attL	ATTCAGCCCGGATTTCA	NA	NA	NA	NA
AWR76749.1|84597_85745_-|transposase	IS3-like element ISEc52 family transposase	transposase	Q716C2	Shigella_phage	95.9	7.0e-173
AWR76750.1|85801_86623_-	nucleotidyltransferase	NA	NA	NA	NA	NA
AWR76751.1|87330_87549_+	antitoxin CcdA	NA	NA	NA	NA	NA
AWR76752.1|87550_87856_+	toxin CcdB	NA	NA	NA	NA	NA
AWR76753.1|87856_88663_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	100.0	5.8e-57
AWR76754.1|89436_90192_+	replication initiation protein	NA	I3WF20	Macacine_betaherpesvirus	100.0	3.8e-143
AWR76755.1|90779_91946_+	protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	100.0	7.0e-229
AWR76756.1|91945_92917_+	ParB/RepB/Spo0J family partition protein	NA	I3WF22	Macacine_betaherpesvirus	99.4	7.0e-174
AWR76757.1|93473_93746_+	hypothetical protein	NA	NA	NA	NA	NA
AWR76803.1|93783_94686_+	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
AWR76758.1|95070_95754_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.9	5.1e-30
AWR76759.1|95754_95976_+	hypothetical protein	NA	NA	NA	NA	NA
AWR76760.1|95989_96424_+	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
AWR76761.1|97123_97696_+	DUF1472 domain-containing protein	NA	NA	NA	NA	NA
AWR76762.1|97668_98094_+	antirestriction protein	NA	NA	NA	NA	NA
AWR76763.1|98140_98563_+	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
AWR76764.1|98559_98751_+	hypothetical protein	NA	NA	NA	NA	NA
AWR76765.1|98683_98950_+	transporter	NA	NA	NA	NA	NA
AWR76766.1|99102_99525_-	hypothetical protein	NA	NA	NA	NA	NA
AWR76767.1|99785_100016_+	hypothetical protein	NA	NA	NA	NA	NA
AWR76768.1|100067_101429_+	DUF3560 domain-containing protein	NA	NA	NA	NA	NA
AWR76769.1|101476_102040_+	class I SAM-dependent methyltransferase	NA	A8HNV9	Thalassomonas_phage	37.3	1.0e-20
101545:101561	attR	TGAAATCCGGGCTGAAT	NA	NA	NA	NA
AWR76770.1|102065_102314_+	hypothetical protein	NA	NA	NA	NA	NA
AWR76804.1|102534_102723_+	hypothetical protein	NA	NA	NA	NA	NA
AWR76771.1|102724_102931_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
AWR76772.1|102956_103496_+	single-stranded DNA-binding protein	NA	I3PGW4	Xanthomonas_phage	73.9	1.2e-45
AWR76773.1|103558_103792_+	DUF905 domain-containing protein	NA	NA	NA	NA	NA
AWR76774.1|103857_105816_+	hypothetical protein	NA	G8DH78	Emiliania_huxleyi_virus	27.4	1.3e-22
AWR76775.1|105870_106305_+	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
AWR76776.1|106301_107021_+	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
AWR76777.1|107266_108635_+|transposase	IS3-like element IS150 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	100.0	1.3e-112
