The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP021462	Salmonella enterica subsp. enterica serovar Typhimurium strain UGA14 chromosome, complete genome	4879285	364951	408364	4879285	protease,terminase,integrase,tail,portal,lysis,coat	Salmonella_virus(67.69%)	65	355721:355737	417625:417641
355721:355737	attL	GATATTGAAATTCGCGT	NA	NA	NA	NA
AWR36284.1|364951_366004_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	58.5	1.7e-112
AWR36285.1|366286_367390_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	39.8	6.9e-61
AWR36286.1|367401_368652_+	gamma-glutamyl-phosphate reductase	NA	A0A1X9I5D4	Streptococcus_phage	47.5	1.6e-98
AWR40521.1|368857_369526_-|integrase	integrase	integrase	A0A192Y6Q1	Salmonella_phage	100.0	6.1e-129
AWR36287.1|369897_370248_-	DNA-binding protein	NA	A0A1R3Y5Z5	Salmonella_virus	100.0	8.3e-61
AWR36288.1|370258_370852_-	hypothetical protein	NA	A0A1R3Y5P7	Salmonella_virus	100.0	3.2e-113
AWR36289.1|370923_371262_-	RNA-binding protein	NA	A0A1R3Y5R3	Salmonella_virus	98.9	1.1e-49
AWR36290.1|371200_372166_-	hypothetical protein	NA	A0A1R3Y5Q8	Salmonella_virus	100.0	2.9e-172
AWR36291.1|372176_372932_-	hypothetical protein	NA	A0A1R3Y5Q7	Salmonella_virus	100.0	2.9e-151
AWR36292.1|372931_373576_-	hypothetical protein	NA	A0A1R3Y5T1	Salmonella_virus	100.0	2.3e-117
AWR36293.1|373572_373983_-	hypothetical protein	NA	A0A1R3Y5S0	Salmonella_virus	100.0	5.9e-74
AWR36294.1|373979_374150_-	DUF2737 domain-containing protein	NA	A0A220NQV6	Salmonella_phage	100.0	6.1e-25
AWR36295.1|374160_374454_-	RecBCD nuclease inhibitor	NA	A0A1R3Y5T7	Salmonella_virus	100.0	3.2e-50
AWR36296.1|374500_374785_-	sigma-70 family RNA polymerase sigma factor	NA	Q76H41	Enterobacteria_phage	100.0	1.4e-45
AWR36297.1|374784_375492_-	recombinase	NA	A0A1R3Y600	Salmonella_virus	100.0	4.1e-139
AWR36298.1|375621_375810_-	protein kil	NA	A0A1R3Y5S5	Salmonella_virus	100.0	1.6e-31
AWR36299.1|375790_375943_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	A0A1R3Y5R2	Salmonella_virus	100.0	2.7e-24
AWR36300.1|376266_376566_-	hypothetical protein	NA	A0A1R3Y5U4	Salmonella_virus	100.0	2.3e-51
AWR36301.1|376605_376806_-	restriction endonuclease	NA	A0A1R3Y5S4	Salmonella_virus	100.0	1.0e-31
AWR36302.1|376884_377217_-	hypothetical protein	NA	A0A1R3Y5R1	Salmonella_virus	100.0	2.2e-55
AWR36303.1|377236_377434_+	hypothetical protein	NA	A0A075B8J1	Enterobacteria_phage	94.3	2.2e-10
AWR36304.1|377580_377790_+	hypothetical protein	NA	I6R0R9	Salmonella_phage	91.3	5.5e-28
AWR36305.1|377825_378749_-	hypothetical protein	NA	A0A1R3Y6Z6	Salmonella_virus	100.0	1.5e-181
AWR36306.1|378837_379527_-	hypothetical protein	NA	Q76H56	Enterobacteria_phage	100.0	1.3e-126
AWR36307.1|379637_379853_+	transcriptional regulator	NA	Q76H55	Enterobacteria_phage	100.0	1.3e-32
AWR36308.1|379963_380245_+	hypothetical protein	NA	Q76H54	Enterobacteria_phage	100.0	4.3e-44
AWR36309.1|380279_380426_+	hypothetical protein	NA	A0A075B8K7	Enterobacteria_phage	100.0	1.5e-19
AWR36310.1|380418_381252_+	DNA replication protein	NA	A0A1R3Y5R9	Salmonella_virus	100.0	3.8e-152
AWR36311.1|381248_382625_+	replicative DNA helicase	NA	A0A1R3Y5T0	Salmonella_virus	100.0	1.5e-254
AWR36312.1|382621_382891_+	hypothetical protein	NA	A0A1R3Y5U7	Salmonella_virus	100.0	6.4e-45
AWR36313.1|382962_383235_+	DUF4752 domain-containing protein	NA	A0A1R3Y5T8	Salmonella_virus	100.0	7.2e-44
AWR36314.1|383244_383454_+	hypothetical protein	NA	A0A1R3Y5S8	Salmonella_virus	100.0	1.1e-31
AWR36315.1|383465_383759_+	hypothetical protein	NA	A0A1R3Y5V7	Salmonella_virus	100.0	1.2e-47
AWR36316.1|383761_383950_+	hypothetical protein	NA	A0A1R3Y6Z7	Salmonella_virus	100.0	4.2e-27
AWR36317.1|383906_384353_+	recombination protein NinB	NA	A0A1R3Y605	Salmonella_virus	100.0	7.1e-81
AWR36318.1|384349_384523_+	protein ninD	NA	C6ZR56	Salmonella_phage	100.0	5.2e-32
AWR36319.1|384489_384672_+	NinE family protein	NA	C6ZR57	Salmonella_phage	100.0	5.7e-29
AWR36320.1|384668_384839_+	protein ninF	NA	A0A1R3Y5V0	Salmonella_virus	100.0	2.5e-26
AWR36321.1|384831_385443_+	recombination protein NinG	NA	A3EYW8	Salmonella_phage	100.0	9.3e-100
AWR36322.1|385439_385664_+	protein ninY	NA	A0A1R3Y5U5	Salmonella_virus	100.0	1.3e-38
AWR36323.1|385660_385864_+	protein ninH	NA	A0A1R3Y5V4	Salmonella_virus	100.0	1.6e-32
AWR36324.1|385844_386024_+	hypothetical protein	NA	E7C9S6	Salmonella_phage	94.9	1.3e-22
AWR36325.1|386020_386539_+	antiterminator	NA	A0A1R3Y5U9	Salmonella_virus	100.0	2.0e-95
AWR36326.1|387003_387207_+	hypothetical protein	NA	I6R0S9	Salmonella_phage	100.0	1.1e-33
AWR40522.1|387184_387682_+	lysozyme	NA	A0A1R3Y5W5	Salmonella_virus	100.0	1.7e-91
AWR36327.1|387770_388208_+|lysis	lysis protein	lysis	A0A1R3Y6Z8	Salmonella_virus	100.0	1.8e-73
AWR36328.1|388357_388963_+	Rha family transcriptional regulator	NA	A0A1R3Y613	Salmonella_virus	100.0	1.4e-111
AWR36329.1|389224_389539_-	hypothetical protein	NA	A0A1R3Y5U0	Salmonella_virus	100.0	1.0e-49
AWR36330.1|389792_390035_+	hypothetical protein	NA	A0A1R3Y5V5	Salmonella_virus	100.0	1.7e-36
AWR36331.1|390036_390216_+	hypothetical protein	NA	A0A2H4A350	Salmonella_phage	100.0	1.1e-24
AWR36332.1|390239_390728_+	DNA-packaging protein	NA	A3EYX3	Salmonella_phage	100.0	2.9e-88
AWR36333.1|390705_392205_+|terminase	terminase	terminase	A0A1R3Y5N2	Salmonella_virus	100.0	2.8e-307
AWR36334.1|392204_394382_+|portal	portal protein	portal	A0A1R3Y5N6	Salmonella_virus	100.0	0.0e+00
AWR36335.1|394395_395307_+	scaffolding protein	NA	A0A1R3Y5R6	Salmonella_virus	100.0	4.9e-161
AWR36336.1|395306_396599_+|coat	coat protein	coat	A0A1R3Y5Q0	Salmonella_virus	100.0	1.1e-243
AWR36337.1|396639_397200_+	hypothetical protein	NA	A0A1R3Y5P2	Salmonella_virus	100.0	1.1e-102
AWR36338.1|397183_397684_+	hypothetical protein	NA	Q76H19	Enterobacteria_phage	100.0	4.2e-90
AWR36339.1|397643_399062_+	hypothetical protein	NA	E7C9U1	Salmonella_phage	99.4	4.6e-275
AWR36340.1|399065_399767_+|tail	phage tail protein	tail	A0A1R3Y5X6	Salmonella_virus	100.0	1.2e-74
AWR36341.1|399766_400222_+	hypothetical protein	NA	A0A1R3Y5P3	Salmonella_virus	100.0	1.8e-87
AWR36342.1|400224_400914_+	DNA transfer protein	NA	A0A1R3Y5P8	Salmonella_virus	100.0	4.0e-91
AWR40523.1|400956_402294_+	DNA transfer protein	NA	A0A1R3Y5Q4	Salmonella_virus	100.0	1.0e-244
AWR36343.1|402293_404261_+	DNA transfer protein	NA	A0A1R3Y5Q1	Salmonella_virus	100.0	0.0e+00
AWR36344.1|404416_406402_+	endorhamnosidase	NA	A0A1R3Y5S2	Salmonella_virus	100.0	0.0e+00
AWR36345.1|406441_408364_-	acyltransferase	NA	A0A1R3Y5Q6	Salmonella_virus	100.0	0.0e+00
417625:417641	attR	GATATTGAAATTCGCGT	NA	NA	NA	NA
>prophage 2
CP021462	Salmonella enterica subsp. enterica serovar Typhimurium strain UGA14 chromosome, complete genome	4879285	1015292	1022306	4879285	transposase,protease	Dickeya_phage(16.67%)	8	NA	NA
AWR36899.1|1015292_1016411_+	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.4e-08
AWR36900.1|1016407_1018354_+	macrolide ABC transporter permease/ATP-binding protein MacB	NA	G9BWD6	Planktothrix_phage	43.1	2.0e-39
AWR36901.1|1018334_1018529_+	hypothetical protein	NA	NA	NA	NA	NA
AWR36902.1|1018483_1018705_-	cold shock domain protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
AWR36903.1|1019028_1019349_+|protease	ATP-dependent Clp protease adaptor ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
AWR36904.1|1019379_1021656_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
AWR36905.1|1021708_1021891_+	hypothetical protein	NA	NA	NA	NA	NA
AWR36906.1|1021847_1022306_+|transposase	IS200/IS605 family transposase IS200F	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.0e-13
>prophage 3
CP021462	Salmonella enterica subsp. enterica serovar Typhimurium strain UGA14 chromosome, complete genome	4879285	1074117	1153275	4879285	transposase,protease,holin,integrase,tail,portal,lysis,tRNA	Salmonella_phage(45.28%)	83	1077026:1077045	1145136:1145155
AWR36945.1|1074117_1074921_+|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
AWR36946.1|1074913_1076236_+	chromosome partition protein MukF	NA	NA	NA	NA	NA
AWR36947.1|1076216_1076921_+	condensin subunit E	NA	NA	NA	NA	NA
AWR36948.1|1076920_1081387_+	chromosome partition protein MukB	NA	NA	NA	NA	NA
1077026:1077045	attL	AACGGCGCCGGGAAATCCAC	NA	NA	NA	NA
AWR36949.1|1081731_1083573_+	L,D-transpeptidase	NA	NA	NA	NA	NA
AWR36950.1|1083832_1084381_+	outer membrane protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	1.2e-05
AWR36951.1|1084408_1085056_+	MBL fold hydrolase	NA	NA	NA	NA	NA
AWR36952.1|1085117_1086308_-	aspartate aminotransferase	NA	NA	NA	NA	NA
AWR36953.1|1086492_1087584_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	51.7	2.2e-99
AWR36954.1|1088190_1089591_-|tRNA	asparagine--tRNA ligase	tRNA	A0A167RLM0	Powai_lake_megavirus	35.1	4.5e-81
AWR36955.1|1089791_1090253_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
AWR36956.1|1090249_1090483_-	hypothetical protein	NA	NA	NA	NA	NA
AWR36957.1|1090569_1091784_+	PLP-dependent lyase/thiolase	NA	NA	NA	NA	NA
AWR36958.1|1092028_1093465_+	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
AWR36959.1|1093542_1094745_-	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
AWR36960.1|1094939_1096280_-|integrase	integrase	integrase	S4TSP2	Salmonella_phage	99.6	3.6e-261
AWR36961.1|1096276_1096525_-	excisionase	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
AWR36962.1|1096565_1096805_-	hypothetical protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
AWR36963.1|1096847_1098005_-	enterohemolysin	NA	S4TTE8	Salmonella_phage	100.0	1.6e-217
AWR36964.1|1097967_1100853_-	exodeoxyribonuclease	NA	S4TNL0	Salmonella_phage	97.2	0.0e+00
AWR36965.1|1100979_1101279_-	DNA breaking-rejoining protein	NA	S4TSN6	Salmonella_phage	84.5	8.1e-49
AWR36966.1|1101300_1101459_-	hypothetical protein	NA	H6WRX3	Salmonella_phage	98.1	1.2e-22
AWR36967.1|1101451_1101712_-	hypothetical protein	NA	NA	NA	NA	NA
AWR36968.1|1101761_1102172_-	transcriptional regulator	NA	A0A1B5FPF4	Escherichia_phage	42.4	8.1e-07
AWR36969.1|1102291_1102531_+	helix-turn-helix domain-containing protein	NA	H6WRX5	Salmonella_phage	47.2	8.3e-12
AWR36970.1|1102496_1102871_+	hypothetical protein	NA	S4TTD7	Salmonella_phage	99.2	3.9e-64
AWR36971.1|1103880_1104630_+	DNA replication protein DnaC	NA	S4TNF5	Salmonella_phage	99.6	3.6e-138
AWR36972.1|1104640_1104988_+	DNA-binding protein	NA	H6WRX9	Salmonella_phage	89.6	5.4e-52
AWR36973.1|1104984_1105296_+	hypothetical protein	NA	A0A220NQV2	Salmonella_phage	97.2	7.2e-32
AWR36974.1|1105373_1105664_+	hypothetical protein	NA	NA	NA	NA	NA
AWR36975.1|1105955_1106189_+	DinI family protein	NA	H6WRY5	Salmonella_phage	98.7	2.1e-36
AWR36976.1|1106300_1106522_+	hypothetical protein	NA	NA	NA	NA	NA
AWR36977.1|1106604_1107207_+	hypothetical protein	NA	S4TTI0	Salmonella_phage	98.5	8.3e-109
AWR36978.1|1107206_1107413_+	hypothetical protein	NA	S4TNP0	Salmonella_phage	100.0	3.5e-35
AWR36979.1|1107415_1108027_+	protein NinG	NA	A0A0M4RU10	Salmonella_phage	91.6	6.9e-79
AWR36980.1|1108023_1108170_+	hypothetical protein	NA	A0A0M5M7B2	Salmonella_phage	97.9	4.3e-19
AWR36981.1|1108159_1108957_+	antitermination protein	NA	A0A0M4S661	Salmonella_phage	99.6	2.3e-151
AWR40555.1|1109121_1109340_+	hypothetical protein	NA	NA	NA	NA	NA
AWR36982.1|1109513_1109639_+	hypothetical protein	NA	NA	NA	NA	NA
AWR36983.1|1109774_1110224_-	hypothetical protein	NA	NA	NA	NA	NA
AWR36984.1|1110584_1111271_-	PipA/GogA/GtgA family type III secretion system effector	NA	Q9MBM0	Phage_Gifsy-2	100.0	2.1e-132
AWR40556.1|1111546_1111876_+|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
AWR36985.1|1111859_1112312_+	muraminidase	NA	A0A0M4R365	Salmonella_phage	96.6	5.1e-79
AWR40557.1|1112329_1112809_+|lysis	lysis protein	lysis	Q56118	Enterobacteria_phage	77.0	1.4e-55
AWR36986.1|1113016_1113550_+	DNA breaking-rejoining protein	NA	A0A291AWV8	Escherichia_phage	48.1	1.3e-33
AWR36987.1|1113506_1115645_+	DNA packaging protein	NA	A5LH27	Enterobacteria_phage	72.6	3.4e-290
AWR36988.1|1115641_1115848_+	primosomal replication protein PriB/PriC domain protein	NA	A0A1W6JT66	Pseudomonas_phage	53.3	2.9e-05
AWR40558.1|1115874_1117392_+|portal	phage portal protein	portal	A0A291AWU2	Escherichia_phage	65.1	1.5e-175
AWR40559.1|1117315_1119397_+	peptidase S14	NA	A0A291AWT6	Escherichia_phage	69.5	4.8e-265
AWR36989.1|1119487_1119811_+	recombinase RecA	NA	K7PLV6	Enterobacteria_phage	61.3	7.7e-29
AWR36990.1|1119803_1120103_+	ATP-binding protein	NA	K7PH43	Enterobacteria_phage	45.1	4.5e-15
AWR36991.1|1120083_1120650_+|tail	phage tail protein	tail	Q9G063	Phage_Gifsy-2	97.8	9.5e-14
AWR36992.1|1120646_1121048_+|tail	phage tail protein	tail	K7PHM6	Enterobacterial_phage	60.2	2.6e-42
AWR36993.1|1121059_1121809_+|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	68.6	3.7e-90
AWR36994.1|1121854_1122253_+|tail	phage minor tail protein G	tail	A5LH36	Enterobacteria_phage	56.1	6.6e-30
AWR36995.1|1122249_1122579_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	50.9	5.0e-23
AWR40560.1|1122658_1125646_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	62.1	8.2e-266
AWR36996.1|1125642_1125975_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	61.5	3.3e-35
AWR36997.1|1126073_1126571_+	Ail/OmpX	NA	A0A1B0VBR9	Salmonella_phage	36.6	1.4e-16
AWR36998.1|1126687_1127221_-	superoxide dismutase [Cu-Zn] SodC1	NA	Q9MC02	Salmonella_phage	54.0	1.8e-46
AWR36999.1|1127310_1128006_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	66.7	1.3e-89
AWR37000.1|1128015_1128753_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	76.1	1.6e-114
AWR37001.1|1128650_1129355_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	62.6	9.2e-67
AWR37002.1|1129426_1129618_+	hypothetical protein	NA	S5MW25	Escherichia_phage	68.9	1.6e-18
AWR37003.1|1129651_1130356_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AWR37004.1|1131105_1131687_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	89.5	1.7e-95
AWR37005.1|1133084_1133789_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AWR37006.1|1134606_1135233_-	DUF159 family protein	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	63.2	1.4e-66
AWR37007.1|1135301_1135601_-	hypothetical protein	NA	NA	NA	NA	NA
AWR37008.1|1135585_1136272_-	virulence protein	NA	NA	NA	NA	NA
AWR37009.1|1136542_1136734_-	DNA-damage-inducible protein I	NA	S4TNM0	Salmonella_phage	95.2	6.2e-26
AWR37010.1|1137160_1139773_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.6	6.3e-20
AWR37011.1|1139980_1140991_+	dihydroorotate dehydrogenase (quinone)	NA	NA	NA	NA	NA
AWR37012.1|1141156_1141699_+	cell division protein ZapC	NA	NA	NA	NA	NA
AWR37013.1|1141695_1142805_-	hypothetical protein	NA	NA	NA	NA	NA
AWR37014.1|1142903_1145012_+	23S rRNA (guanine(2445)-N(2))/(guanine(2069)-N(7))- methyltransferase	NA	NA	NA	NA	NA
AWR37015.1|1145024_1146932_+	ABC transporter ATPase	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
1145136:1145155	attR	AACGGCGCCGGGAAATCCAC	NA	NA	NA	NA
AWR37016.1|1146946_1148200_+	paraquat-inducible protein A	NA	NA	NA	NA	NA
AWR37017.1|1148204_1149845_+	paraquat-inducible protein B	NA	NA	NA	NA	NA
AWR37018.1|1149841_1150405_+	hypothetical protein	NA	NA	NA	NA	NA
AWR37019.1|1150660_1150828_+	ribosome modulation factor	NA	NA	NA	NA	NA
AWR37020.1|1150927_1151446_-	beta-hydroxydecanoyl-ACP dehydratase	NA	NA	NA	NA	NA
AWR37021.1|1151514_1153275_-|protease	Lon protease	protease	NA	NA	NA	NA
>prophage 4
CP021462	Salmonella enterica subsp. enterica serovar Typhimurium strain UGA14 chromosome, complete genome	4879285	2025567	2104909	4879285	transposase,terminase,capsid,holin,integrase,tail,plate,portal,lysis,head	Salmonella_phage(85.07%)	107	2032105:2032120	2106532:2106547
AWR37893.1|2025567_2026026_-|transposase	IS200/IS605 family transposase IS200F	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.0e-13
AWR40595.1|2025982_2026165_-	hypothetical protein	NA	NA	NA	NA	NA
AWR37894.1|2026206_2027412_-	lysine-N-methylase	NA	NA	NA	NA	NA
AWR37895.1|2027490_2028978_-	flagellin FliC	NA	NA	NA	NA	NA
AWR37896.1|2029234_2030638_+	flagellar hook-associated protein 2	NA	NA	NA	NA	NA
AWR37897.1|2030652_2031060_+	flagellar protein FliS	NA	NA	NA	NA	NA
AWR37898.1|2031059_2031428_+	flagellar protein FliT	NA	NA	NA	NA	NA
AWR37899.1|2031499_2032984_+	alpha-amylase	NA	NA	NA	NA	NA
2032105:2032120	attL	TGAAAATATCGATTTT	NA	NA	NA	NA
AWR37900.1|2033023_2033437_-	hypothetical protein	NA	NA	NA	NA	NA
AWR37901.1|2033562_2034828_+	hypothetical protein	NA	NA	NA	NA	NA
AWR37902.1|2034824_2035058_+	SirA-like protein	NA	NA	NA	NA	NA
AWR37903.1|2035322_2035709_+	hypothetical protein	NA	NA	NA	NA	NA
AWR37904.1|2035828_2036143_-	flagellar hook-basal body complex protein FliE	NA	NA	NA	NA	NA
AWR37905.1|2036359_2038042_+	flagellar M-ring protein	NA	NA	NA	NA	NA
AWR37906.1|2038034_2039030_+	flagellar motor switch protein FliG	NA	NA	NA	NA	NA
AWR37907.1|2039022_2039730_+	flagellar assembly protein FliH	NA	NA	NA	NA	NA
AWR37908.1|2039729_2041100_+	flagellum-specific ATP synthase	NA	NA	NA	NA	NA
AWR37909.1|2041121_2041565_+	flagellar protein FliJ	NA	NA	NA	NA	NA
AWR37910.1|2041561_2042779_+	flagellar hook-length control protein FliK	NA	NA	NA	NA	NA
AWR37911.1|2042883_2043351_+	flagellar basal body-associated protein FliL	NA	NA	NA	NA	NA
AWR37912.1|2043355_2044360_+	flagellar motor switch protein FliM	NA	NA	NA	NA	NA
AWR37913.1|2044356_2044770_+	flagellar motor switch protein FliN	NA	NA	NA	NA	NA
AWR37914.1|2044769_2045147_+	flagellar protein FliO	NA	NA	NA	NA	NA
AWR37915.1|2045146_2045884_+	flagellar biosynthetic protein FliP	NA	NA	NA	NA	NA
AWR37916.1|2045893_2046163_+	flagellar biosynthetic protein FliQ	NA	NA	NA	NA	NA
AWR37917.1|2046171_2046966_+	flagellar biosynthesis protein FliR	NA	NA	NA	NA	NA
AWR37918.1|2047247_2047871_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
AWR37919.1|2047909_2048158_-	DsrB protein	NA	NA	NA	NA	NA
AWR37920.1|2048232_2048460_+	hypothetical protein	NA	NA	NA	NA	NA
AWR37921.1|2048769_2049585_+	mannosyl-3-phosphoglycerate phosphatase-related protein	NA	NA	NA	NA	NA
AWR37922.1|2049563_2051276_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	37.4	1.2e-19
AWR37923.1|2051440_2051686_-	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
AWR37924.1|2051702_2052620_-	hypothetical protein	NA	NA	NA	NA	NA
AWR37925.1|2052789_2053710_+	amino acid exporter	NA	NA	NA	NA	NA
AWR37926.1|2053698_2054169_-	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	46.9	1.2e-30
AWR37927.1|2054149_2055580_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
AWR37928.1|2055653_2056349_-	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.1	2.8e-07
AWR37929.1|2056440_2056740_-	hypothetical protein	NA	NA	NA	NA	NA
AWR37930.1|2057390_2058596_+	porin	NA	Q1MVN1	Enterobacteria_phage	54.9	2.8e-108
AWR40596.1|2058856_2059045_-	cold-shock protein	NA	NA	NA	NA	NA
AWR37931.1|2059055_2059268_-	cold-shock protein CspJ	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
AWR37932.1|2059722_2060991_-	protein UmuC	NA	I6RSM4	Salmonella_phage	92.2	4.2e-227
AWR37933.1|2060993_2061413_-	protein UmuD	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
AWR37934.1|2061539_2061701_-	hypothetical protein	NA	NA	NA	NA	NA
AWR37935.1|2061678_2061921_-	hypothetical protein	NA	NA	NA	NA	NA
AWR37936.1|2062331_2062553_-	DNA-binding protein	NA	Q8HAB1	Salmonella_phage	100.0	1.2e-36
AWR37937.1|2062765_2063773_+	non-LEE encoded effector protein NleB	NA	Q8HAB2	Salmonella_phage	100.0	7.9e-197
AWR37938.1|2064057_2064657_-|tail	tail fiber assembly protein	tail	Q8HAB3	Salmonella_phage	100.0	5.9e-107
AWR37939.1|2064626_2066189_-|tail	phage tail protein	tail	Q8HAB4	Salmonella_phage	100.0	2.6e-287
AWR37940.1|2066175_2066763_-|tail	phage tail protein	tail	A0A192Y5V3	Salmonella_phage	100.0	2.9e-114
AWR37941.1|2066765_2067287_-|tail	phage tail protein	tail	Q8HAB6	Salmonella_phage	100.0	2.9e-94
AWR37942.1|2067321_2067867_-|head	head assembly protein	head	Q8HAB7	Salmonella_phage	100.0	9.2e-99
AWR37943.1|2067838_2068252_-	hypothetical protein	NA	Q8HAB8	Salmonella_phage	100.0	1.1e-75
AWR37944.1|2068256_2068790_-|plate	baseplate assembly protein	plate	Q8HAB9	Salmonella_phage	100.0	1.4e-96
AWR37945.1|2068789_2069848_-|plate	baseplate protein	plate	Q8HAC0	Salmonella_phage	100.0	1.3e-202
AWR37946.1|2069844_2071185_-	DNA circularization protein	NA	A0A192Y5U9	Salmonella_phage	99.6	5.7e-251
AWR37947.1|2071218_2073147_-|tail	phage tail tape measure protein	tail	Q8HAC2	Salmonella_phage	99.8	0.0e+00
AWR37948.1|2073231_2073558_-|tail	phage tail assembly protein	tail	Q8HAC3	Salmonella_phage	99.1	2.3e-52
AWR37949.1|2073554_2073911_-|tail	phage tail protein	tail	A0A192Y8K0	Salmonella_phage	100.0	2.6e-62
AWR37950.1|2073910_2075407_-|tail	phage tail protein	tail	Q8HAC5	Salmonella_phage	100.0	2.7e-278
AWR37951.1|2075396_2075561_-	DUF2635 domain-containing protein	NA	Q8HAC6	Salmonella_phage	100.0	1.0e-24
AWR37952.1|2075564_2076125_-	hypothetical protein	NA	Q8HAC7	Salmonella_phage	100.0	3.0e-105
AWR37953.1|2076121_2076634_-	hypothetical protein	NA	Q8HAC8	Salmonella_phage	100.0	4.6e-92
AWR37954.1|2076605_2077010_-|head,tail	head-tail adaptor protein	head,tail	Q8HAC9	Salmonella_phage	100.0	1.4e-72
AWR37955.1|2077006_2077330_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A192Y8J4	Salmonella_phage	100.0	6.3e-55
AWR37956.1|2077332_2077533_-	hypothetical protein	NA	Q8HAD1	Salmonella_phage	100.0	1.4e-28
AWR37957.1|2077583_2078789_-|capsid	phage major capsid protein	capsid	Q8HAD2	Salmonella_phage	100.0	1.6e-223
AWR37958.1|2078803_2079490_-	primosome assembly protein PriA	NA	Q8HAD3	Salmonella_phage	100.0	6.5e-126
AWR37959.1|2079431_2080673_-|portal	phage portal protein	portal	Q8HAD4	Salmonella_phage	99.8	2.0e-242
AWR37960.1|2080672_2080855_-	hypothetical protein	NA	Q8HAD5	Salmonella_phage	100.0	1.0e-25
AWR37961.1|2080866_2082600_-|terminase	terminase	terminase	Q8HAD6	Salmonella_phage	100.0	0.0e+00
AWR37962.1|2082596_2083100_-|terminase	terminase	terminase	Q8HAD7	Salmonella_phage	100.0	3.6e-89
AWR37963.1|2083216_2083567_-	HNH endonuclease	NA	Q8HA82	Salmonella_phage	100.0	2.5e-65
AWR37964.1|2083627_2083930_-	hypothetical protein	NA	Q8HA83	Salmonella_phage	100.0	3.6e-52
AWR37965.1|2084149_2084569_-	hypothetical protein	NA	Q8HA84	Salmonella_phage	100.0	4.8e-71
AWR37966.1|2084781_2085267_-|lysis	lysis protein	lysis	Q8HA85	Salmonella_phage	100.0	5.9e-81
AWR37967.1|2085263_2085878_-	endolysin	NA	Q8HA86	Salmonella_phage	100.0	9.3e-116
AWR37968.1|2085880_2086225_-|holin	phage holin, lambda family	holin	Q8HA87	Salmonella_phage	100.0	5.3e-44
AWR37969.1|2086386_2086821_+	hypothetical protein	NA	NA	NA	NA	NA
AWR40597.1|2086750_2087008_-	hypothetical protein	NA	Q8HA88	Salmonella_phage	100.0	5.2e-44
AWR37970.1|2087140_2087764_-	hypothetical protein	NA	Q8HA89	Salmonella_phage	100.0	9.1e-119
AWR40598.1|2087774_2088764_-	hypothetical protein	NA	A0A1C9IHZ5	Salmonella_phage	97.6	4.9e-191
AWR37971.1|2088771_2089677_-	DNA-binding protein	NA	Q8HA92	Salmonella_phage	100.0	3.9e-163
AWR37972.1|2089648_2090038_-	hypothetical protein	NA	Q8HA93	Salmonella_phage	100.0	3.7e-70
AWR37973.1|2090034_2090928_-	phage N-6-adenine-methyltransferase	NA	Q8HA94	Salmonella_phage	100.0	7.6e-175
AWR37974.1|2090927_2091452_-	hypothetical protein	NA	Q8HA95	Salmonella_phage	100.0	2.4e-96
AWR37975.1|2091411_2092230_-	helix-turn-helix domain-containing protein	NA	Q8HA96	Salmonella_phage	100.0	2.8e-136
AWR37976.1|2092226_2092451_-	hypothetical protein	NA	A0A1C9II64	Salmonella_phage	100.0	3.3e-39
AWR37977.1|2092447_2093605_-	peptidase	NA	Q8HA97	Salmonella_phage	100.0	4.2e-218
AWR37978.1|2093601_2094156_-	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	100.0	6.9e-102
AWR37979.1|2094184_2094409_-	transcriptional regulator	NA	A0A1C9IHV8	Salmonella_phage	100.0	1.9e-34
AWR37980.1|2094347_2094533_-	hypothetical protein	NA	NA	NA	NA	NA
AWR37981.1|2094506_2095202_+	transcriptional regulator	NA	Q8HAA0	Salmonella_phage	100.0	3.2e-128
AWR37982.1|2095733_2095919_-	hypothetical protein	NA	NA	NA	NA	NA
AWR37983.1|2096016_2096388_+	hypothetical protein	NA	Q8HAA1	Salmonella_phage	100.0	1.1e-63
AWR37984.1|2096445_2097273_+	hypothetical protein	NA	Q8HAA2	Salmonella_phage	100.0	7.5e-153
AWR37985.1|2097409_2097949_+	hypothetical protein	NA	A0A192Y8M4	Salmonella_phage	100.0	2.6e-98
AWR37986.1|2098019_2098250_+	hypothetical protein	NA	Q8HAA4	Salmonella_phage	100.0	2.0e-34
AWR37987.1|2098246_2098762_+	hypothetical protein	NA	Q8HAA5	Salmonella_phage	100.0	7.4e-98
AWR37988.1|2098758_2099376_+	hypothetical protein	NA	Q8HAA6	Salmonella_phage	100.0	2.6e-113
AWR37989.1|2099372_2100206_+	hypothetical protein	NA	Q8HAA7	Salmonella_phage	100.0	4.7e-163
AWR37990.1|2100209_2100779_+	3'-5' exoribonuclease	NA	A0A192Y6E0	Salmonella_phage	100.0	7.1e-110
AWR37991.1|2100803_2101046_+	hypothetical protein	NA	Q8HAA9	Salmonella_phage	100.0	9.5e-40
AWR37992.1|2101047_2102037_+|integrase	integrase	integrase	A0A192Y7M7	Salmonella_phage	100.0	8.6e-196
AWR37993.1|2102328_2103126_+	protein MtfA	NA	NA	NA	NA	NA
AWR37994.1|2103497_2103788_+|integrase	integrase	integrase	H2BDA3	Pseudomonas_phage	49.1	3.0e-08
AWR37995.1|2104435_2104909_+	peptidase	NA	A0A0F6TJ61	Escherichia_coli_O157_typing_phage	77.6	7.1e-39
2106532:2106547	attR	TGAAAATATCGATTTT	NA	NA	NA	NA
>prophage 5
CP021462	Salmonella enterica subsp. enterica serovar Typhimurium strain UGA14 chromosome, complete genome	4879285	2190903	2201409	4879285		Enterobacteria_phage(37.5%)	10	NA	NA
AWR38082.1|2190903_2192217_-	LPS biosynthesis protein	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
AWR38083.1|2192243_2193323_-	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.1	6.6e-16
AWR38084.1|2193327_2194101_-	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
AWR38085.1|2194097_2195090_-	protein RfbI	NA	NA	NA	NA	NA
AWR38086.1|2195095_2195647_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	2.2e-52
AWR38087.1|2195647_2196526_-	glucose-1-phosphate thymidylyltransferase	NA	I7I009	Enterobacteria_phage	65.5	9.3e-109
AWR38088.1|2196573_2197473_-	NAD(P)-dependent oxidoreductase	NA	A0A291LA50	Escherichia_phage	36.3	1.4e-30
AWR38089.1|2197472_2198558_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.2e-102
AWR38090.1|2198934_2199828_-	UTP--glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
AWR38091.1|2200005_2201409_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	27.1	3.1e-21
>prophage 6
CP021462	Salmonella enterica subsp. enterica serovar Typhimurium strain UGA14 chromosome, complete genome	4879285	2269717	2278888	4879285	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
AWR38147.1|2269717_2271751_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
AWR38148.1|2271991_2272450_+	hypothetical protein	NA	Q9EYF5	Enterobacteria_phage	71.9	3.2e-52
AWR38149.1|2272621_2273152_+	hypothetical protein	NA	NA	NA	NA	NA
AWR38150.1|2273208_2273676_-	hypothetical protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
AWR38151.1|2273722_2274442_-	DNA-binding response regulator	NA	NA	NA	NA	NA
AWR40603.1|2274438_2276124_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	6.2e-279
AWR38152.1|2276346_2277078_+	transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
AWR38153.1|2277137_2277245_+	hypothetical protein	NA	NA	NA	NA	NA
AWR38154.1|2277225_2277957_-	osmoprotectant uptake system permease	NA	NA	NA	NA	NA
AWR38155.1|2277940_2278888_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	1.7e-23
>prophage 7
CP021462	Salmonella enterica subsp. enterica serovar Typhimurium strain UGA14 chromosome, complete genome	4879285	2354778	2364018	4879285	holin,tail	Salmonella_phage(37.5%)	8	NA	NA
AWR38226.1|2354778_2355222_-|tail	tail assembly chaperone	tail	A0A0F7LDZ0	Escherichia_phage	43.9	1.4e-28
AWR38227.1|2355599_2356127_-|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	31.3	3.1e-11
AWR38228.1|2356129_2357371_-	hypothetical protein	NA	Q8HAB4	Salmonella_phage	95.3	1.0e-52
AWR38229.1|2357431_2357950_-	peptidase	NA	Q8SBH9	Shigella_phage	88.0	5.2e-75
AWR38230.1|2357963_2358293_-|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	94.6	3.9e-36
AWR38231.1|2359950_2360319_-	antitermination protein Q	NA	A5LH77	Enterobacteria_phage	81.7	7.4e-52
AWR40606.1|2360333_2361323_-	hypothetical protein	NA	A0A1C9IHZ5	Salmonella_phage	97.3	6.0e-189
AWR38232.1|2361651_2364018_-	E3 ubiquitin--protein ligase	NA	Q9MBL9	Phage_Gifsy-2	88.0	3.2e-71
>prophage 8
CP021462	Salmonella enterica subsp. enterica serovar Typhimurium strain UGA14 chromosome, complete genome	4879285	2705064	2806558	4879285	transposase,terminase,capsid,holin,integrase,tail,portal,lysis,head,tRNA	Salmonella_phage(36.07%)	109	2731208:2731223	2801647:2801662
AWR38539.1|2705064_2705796_-|tRNA	tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ	tRNA	NA	NA	NA	NA
AWR38540.1|2705914_2706718_+	inositol monophosphatase	NA	NA	NA	NA	NA
AWR38541.1|2706862_2707741_+	alpha/beta hydrolase	NA	A0A1C9C5K3	Heterosigma_akashiwo_virus	24.7	3.5e-15
AWR38542.1|2707922_2708966_+	sulfite reductase subunit alpha	NA	NA	NA	NA	NA
AWR38543.1|2708969_2709788_+	anaerobic sulfite reductase subunit B	NA	NA	NA	NA	NA
AWR38544.1|2709798_2710812_+	sulfite reductase subunit C	NA	NA	NA	NA	NA
AWR38545.1|2710812_2711799_-	nickel transporter	NA	NA	NA	NA	NA
AWR40615.1|2711789_2712428_-	hypothetical protein	NA	NA	NA	NA	NA
AWR38546.1|2712553_2713831_+	stationary phase inducible protein CsiE	NA	NA	NA	NA	NA
AWR38547.1|2713825_2714965_-	3-phenylpropionic acid transporter	NA	NA	NA	NA	NA
AWR38548.1|2715160_2716414_-	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	53.0	1.3e-100
AWR38549.1|2716738_2717929_+	flavohemoprotein	NA	NA	NA	NA	NA
AWR38550.1|2718110_2719655_+	transcriptional regulator CadC	NA	NA	NA	NA	NA
AWR38551.1|2720015_2721347_+	lysine:cadaverine antiporter	NA	NA	NA	NA	NA
AWR38552.1|2721429_2723574_+	lysine decarboxylase inducible	NA	NA	NA	NA	NA
AWR38553.1|2723629_2725090_+	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	28.8	1.7e-46
AWR38554.1|2725138_2725477_-	nitrogen regulatory protein P-II 1	NA	NA	NA	NA	NA
AWR38555.1|2725553_2726891_-	transcriptional regulator	NA	W8CYM9	Bacillus_phage	29.2	1.8e-10
AWR38556.1|2726887_2727652_-	hypothetical protein	NA	NA	NA	NA	NA
AWR38557.1|2727653_2729039_-	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	26.1	1.9e-15
AWR38558.1|2729733_2733621_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	57.6	1.4e-127
2731208:2731223	attL	AACGCGGAAATCACCA	NA	NA	NA	NA
AWR38559.1|2733642_2733876_+	hypothetical protein	NA	NA	NA	NA	NA
AWR38560.1|2733876_2735421_+	lytic transglycosylase F	NA	NA	NA	NA	NA
AWR38561.1|2735471_2736023_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
AWR38562.1|2736047_2736683_-	phosphatidylglycerophosphatase C	NA	NA	NA	NA	NA
AWR38563.1|2736686_2738048_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
AWR38564.1|2738058_2738952_-	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
AWR38565.1|2739067_2739916_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
AWR38566.1|2739954_2740872_-	2-dehydropantoate 2-reductase	NA	NA	NA	NA	NA
AWR38567.1|2740893_2742090_-	MFS transporter	NA	NA	NA	NA	NA
AWR38568.1|2742205_2743132_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	24.4	3.0e-09
AWR38569.1|2743169_2743430_+	ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	52.3	1.4e-17
AWR38570.1|2743541_2743922_-	holo-ACP synthase	NA	NA	NA	NA	NA
AWR38571.1|2743921_2744653_-	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
AWR38572.1|2744664_2745393_-	DNA repair protein RecO	NA	NA	NA	NA	NA
AWR38573.1|2745404_2746310_-	GTPase Era	NA	NA	NA	NA	NA
AWR40616.1|2746306_2746987_-	ribonuclease 3	NA	A0A2K9L5P0	Tupanvirus	31.8	7.4e-21
AWR38574.1|2747260_2748235_-	S26 family signal peptidase	NA	NA	NA	NA	NA
AWR38575.1|2748251_2750051_-	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	24.9	7.2e-23
AWR38576.1|2750455_2751949_+	type III secretion system protein	NA	Q9MBM1	Phage_Gifsy-1	100.0	3.4e-260
AWR38577.1|2752457_2752595_+	hypothetical protein	NA	NA	NA	NA	NA
AWR38578.1|2752841_2753387_+|transposase	transposase	transposase	NA	NA	NA	NA
AWR38579.1|2754179_2754392_-	hypothetical protein	NA	S4TTF2	Salmonella_phage	90.6	3.8e-08
AWR38580.1|2754498_2754726_+	phage virulence factor	NA	NA	NA	NA	NA
AWR38581.1|2754822_2755401_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	88.9	3.6e-93
AWR38582.1|2755390_2756215_-|tail	phage tail protein	tail	A0A0M4QWS3	Salmonella_phage	92.0	1.2e-145
AWR38583.1|2756211_2758584_-|tail	phage tail protein	tail	A0A0K2FIZ6	Escherichia_phage	65.6	4.8e-91
AWR38584.1|2758637_2758880_-	hypothetical protein	NA	NA	NA	NA	NA
AWR38585.1|2758918_2762281_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	79.6	0.0e+00
AWR38586.1|2762342_2762990_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	77.7	2.1e-89
AWR38587.1|2762887_2763625_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	85.0	5.2e-129
AWR38588.1|2763631_2764330_-|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	76.3	5.5e-104
AWR38589.1|2764339_2764669_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	70.4	1.3e-42
AWR38590.1|2764671_2767767_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	62.3	1.7e-274
AWR38591.1|2767738_2768077_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	62.4	1.3e-31
AWR38592.1|2768073_2768469_-|tail	phage minor tail protein G	tail	A5LH36	Enterobacteria_phage	56.5	2.3e-30
AWR38593.1|2768519_2769266_-|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	76.9	1.9e-99
AWR38594.1|2769273_2769675_-|tail	phage tail protein	tail	Q9G0F3	Phage_Gifsy-1	100.0	8.1e-52
AWR38595.1|2769663_2770914_+|transposase	transposase	transposase	Q9G0F2	Phage_Gifsy-1	100.0	7.8e-218
AWR38596.1|2770962_2771541_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	80.2	3.7e-82
AWR38597.1|2771568_2771952_-|tail	phage tail protein	tail	A0A0K2FJB7	Enterobacteria_phage	55.6	9.2e-29
AWR38598.1|2771962_2772322_-	DNA packaging protein	NA	NA	NA	NA	NA
AWR38599.1|2772379_2773408_-|capsid	major capsid protein E	capsid	C6ZCY2	Enterobacteria_phage	60.8	1.9e-113
AWR38600.1|2773462_2773810_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	52.7	9.2e-20
AWR38601.1|2773822_2775319_-	scaffolding protein	NA	A0A0K2FI53	Enterobacteria_phage	52.2	8.1e-97
AWR38602.1|2775308_2776889_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	62.8	9.6e-189
AWR38603.1|2776885_2777089_-|tail	phage tail protein	tail	K7PM10	Enterobacteria_phage	73.8	1.9e-17
AWR38604.1|2777072_2779004_-|terminase	terminase	terminase	A0A0K2FJ14	Enterobacteria_phage	65.7	6.3e-259
AWR38605.1|2778975_2779521_-|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	80.6	1.5e-56
AWR38606.1|2779807_2780209_+	inhibitor of g-type lysozyme	NA	NA	NA	NA	NA
AWR40617.1|2780444_2780897_-|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	92.7	2.9e-66
AWR38607.1|2780914_2781367_-	lysozyme	NA	A0A0M4R365	Salmonella_phage	97.3	5.1e-79
AWR40618.1|2781350_2781680_-|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
AWR38608.1|2781955_2782642_+	PipA/GogA/GtgA family type III secretion system effector	NA	Q9MBM2	Phage_Gifsy-1	99.1	1.4e-131
AWR38609.1|2782856_2783045_-	hypothetical protein	NA	NA	NA	NA	NA
AWR38610.1|2783551_2784115_-	hypothetical protein	NA	A0A0P0ZC44	Stx2-converting_phage	92.2	7.6e-56
AWR38611.1|2784205_2784391_-	hypothetical protein	NA	NA	NA	NA	NA
AWR38612.1|2784387_2785065_-	antiterminator	NA	I6PDF8	Cronobacter_phage	54.0	7.7e-63
AWR38613.1|2785061_2785202_-	hypothetical protein	NA	A0A0M5M7B2	Salmonella_phage	78.9	7.2e-08
AWR38614.1|2785198_2785810_-	protein NinG	NA	A0A0M4RU10	Salmonella_phage	99.0	1.2e-91
AWR38615.1|2785812_2786019_-	hypothetical protein	NA	S4TNP0	Salmonella_phage	97.1	1.7e-34
AWR38616.1|2786018_2786621_-	hypothetical protein	NA	S4TTI0	Salmonella_phage	98.5	1.4e-108
AWR38617.1|2786655_2786904_-	hypothetical protein	NA	A0A0U2C0C8	Salmonella_phage	100.0	1.6e-42
AWR38618.1|2787020_2787254_-	DinI family protein	NA	H6WRY5	Salmonella_phage	100.0	5.6e-37
AWR38619.1|2787496_2788129_-	hypothetical protein	NA	NA	NA	NA	NA
AWR38620.1|2788236_2788935_-	hypothetical protein	NA	A0A0M4RTV1	Salmonella_phage	85.7	2.1e-63
AWR38621.1|2788948_2789644_-	phage replication protein	NA	G8C7U6	Escherichia_phage	45.4	2.1e-55
AWR38622.1|2789640_2790525_-	replication protein	NA	K7PGT1	Enterobacteria_phage	47.2	1.3e-46
AWR38623.1|2790616_2790991_-	hypothetical protein	NA	S4TTD7	Salmonella_phage	98.4	1.9e-63
AWR38624.1|2790950_2791193_-	Rha family transcriptional regulator	NA	A0A0M4QX15	Salmonella_phage	64.1	2.1e-23
AWR38625.1|2791292_2791688_+	transcriptional regulator	NA	K7PM35	Enterobacteria_phage	61.4	1.9e-37
AWR38626.1|2791746_2792586_+	chromosome partitioning protein ParA	NA	A0A1X9IGI7	Lactococcus_phage	33.3	1.5e-31
AWR38627.1|2792578_2792965_+	hypothetical protein	NA	NA	NA	NA	NA
AWR38628.1|2792964_2793627_+	hypothetical protein	NA	NA	NA	NA	NA
AWR38629.1|2794083_2794242_+	hypothetical protein	NA	H6WRX3	Salmonella_phage	98.1	9.0e-23
AWR38630.1|2794263_2794614_+	DNA breaking-rejoining protein	NA	S4TSN6	Salmonella_phage	97.4	1.1e-60
AWR38631.1|2794740_2797668_+	exodeoxyribonuclease	NA	S4TNL0	Salmonella_phage	99.0	0.0e+00
AWR38632.1|2797630_2798788_+	enterohemolysin	NA	S4TTE8	Salmonella_phage	99.5	3.9e-216
AWR38633.1|2798830_2799070_+	hypothetical protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
AWR38634.1|2799110_2799395_+	excisionase	NA	H6WRW8	Salmonella_phage	86.2	3.1e-42
AWR38635.1|2799372_2800602_-|integrase	integrase	integrase	H6WRW7	Salmonella_phage	94.4	2.9e-233
AWR38636.1|2800953_2801070_-	transcriptional regulator	NA	NA	NA	NA	NA
AWR38637.1|2801099_2801579_-	SoxR reducing system protein RseC	NA	NA	NA	NA	NA
AWR38638.1|2801575_2802532_-	sigma-E factor regulatory protein RseB	NA	NA	NA	NA	NA
2801647:2801662	attR	TGGTGATTTCCGCGTT	NA	NA	NA	NA
AWR38639.1|2802531_2803182_-	anti-sigma-E factor RseA	NA	NA	NA	NA	NA
AWR38640.1|2803213_2803789_-	ECF RNA polymerase sigma-E factor	NA	NA	NA	NA	NA
AWR38641.1|2803949_2804129_-	hypothetical protein	NA	NA	NA	NA	NA
AWR38642.1|2804213_2805836_+	L-aspartate oxidase	NA	NA	NA	NA	NA
AWR38643.1|2805820_2806558_-|tRNA	tRNA (adenosine(37)-N6)-methyltransferase TrmM	tRNA	NA	NA	NA	NA
>prophage 9
CP021462	Salmonella enterica subsp. enterica serovar Typhimurium strain UGA14 chromosome, complete genome	4879285	3358371	3403477	4879285	terminase,capsid,holin,integrase,plate,tail,portal,lysis,head,tRNA	Salmonella_phage(50.0%)	57	3398343:3398360	3400053:3400070
AWR39142.1|3358371_3359613_+|tRNA	multifunctional CCA tRNA nucleotidyl transferase/2'3'-cyclic phosphodiesterase/2'nucleotidase/phosphatase	tRNA	A0A0F6YPT7	Sinorhizobium_phage	47.7	5.5e-91
AWR39143.1|3359717_3360539_-	undecaprenyl-diphosphatase	NA	NA	NA	NA	NA
AWR39144.1|3360636_3360996_-	bifunctional dihydroneopterin aldolase/7,8-dihydroneopterin epimerase	NA	NA	NA	NA	NA
AWR39145.1|3361102_3361714_+	acyl-phosphate--glycerol-3-phosphate O-acyltransferase	NA	NA	NA	NA	NA
AWR40644.1|3361791_3362061_+	hypothetical protein	NA	NA	NA	NA	NA
AWR39146.1|3361964_3362978_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.5	2.8e-109
AWR39147.1|3363205_3363421_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
AWR39148.1|3363656_3365402_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.4	2.1e-72
AWR39149.1|3365416_3367399_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	9.0e-35
AWR39150.1|3367522_3368029_-	mismatch-specific DNA-glycosylase	NA	NA	NA	NA	NA
AWR39151.1|3368388_3368607_-	transcriptional regulator	NA	A0A2I8TV89	Erwinia_phage	98.6	9.5e-39
AWR39152.1|3368673_3369843_-	hypothetical protein	NA	A0A0M5M5V5	Salmonella_phage	97.7	6.6e-211
AWR39153.1|3369839_3370325_-|tail	phage tail protein	tail	Q6K1G5	Salmonella_virus	99.4	3.9e-85
AWR39154.1|3370339_3372781_-|tail	phage tail tape measure protein	tail	S4TP64	Salmonella_phage	91.6	0.0e+00
AWR39155.1|3372773_3372929_-|tail	GpE family phage tail protein	tail	Q6K1G8	Salmonella_virus	98.0	8.8e-23
AWR39156.1|3372925_3373261_-|tail	phage tail assembly protein	tail	S4TTB2	Salmonella_phage	100.0	1.4e-52
AWR39157.1|3373323_3373842_-|tail	phage major tail tube protein	tail	S4TNZ0	Salmonella_phage	100.0	6.5e-94
AWR39158.1|3373857_3375045_-|tail	phage tail protein	tail	Q6K1H0	Salmonella_virus	99.5	2.9e-222
AWR39159.1|3375213_3375834_-|tail	phage tail protein	tail	A0A1B0VCD0	Salmonella_phage	86.7	6.8e-98
AWR39160.1|3375803_3377897_-|tail	phage tail protein	tail	A0A1B0VFW4	Salmonella_phage	94.5	5.8e-218
AWR39161.1|3377907_3378438_-|tail	phage tail protein I	tail	S4TTA8	Salmonella_phage	100.0	9.2e-104
AWR39162.1|3378430_3379339_-|plate	baseplate assembly protein	plate	S4TNY7	Salmonella_phage	100.0	2.6e-162
AWR39163.1|3379345_3379693_-|plate	baseplate assembly protein	plate	S4TRW8	Salmonella_phage	99.1	1.6e-56
AWR39164.1|3379689_3380331_-|plate	baseplate assembly protein	plate	Q6K1H6	Salmonella_virus	100.0	4.8e-115
AWR39165.1|3380399_3380849_-	phage virion morphogenesis protein	NA	A0A0M3UL83	Salmonella_phage	98.7	5.5e-73
AWR39166.1|3380841_3381309_-|tail	phage tail protein	tail	S4TTA5	Salmonella_phage	100.0	1.1e-84
AWR39167.1|3381271_3381445_-|lysis	phage lysis protein	lysis	S4TNY4	Salmonella_phage	96.5	3.1e-24
AWR39168.1|3381416_3381830_-	protein lysB	NA	S4TRW3	Salmonella_phage	99.3	2.9e-44
AWR39169.1|3381826_3382324_-	lysozyme	NA	S4TUB1	Salmonella_phage	98.8	5.8e-92
AWR39170.1|3382310_3382607_-|holin	holin	holin	S4TP56	Salmonella_phage	100.0	4.4e-47
AWR39171.1|3382610_3382814_-|tail	phage tail protein	tail	A0A0M3ULF4	Salmonella_phage	100.0	3.6e-32
AWR39172.1|3382813_3383320_-|head	head completion/stabilization protein	head	S4TNY1	Salmonella_phage	99.4	3.8e-91
AWR39173.1|3383413_3384163_-|terminase	terminase	terminase	Q6K1I5	Salmonella_virus	97.2	6.4e-127
AWR39174.1|3384166_3385234_-|capsid	phage major capsid protein, P2 family	capsid	A0A0M4R4W2	Salmonella_phage	99.2	1.3e-197
AWR39175.1|3385310_3386165_-|capsid	capsid scaffolding protein	capsid	S4TP53	Salmonella_phage	98.6	1.2e-156
AWR39176.1|3386330_3388100_+	oxidoreductase	NA	S4TT96	Salmonella_phage	99.0	0.0e+00
AWR39177.1|3388099_3389146_+|portal	phage portal protein	portal	S4TNX7	Salmonella_phage	98.6	4.8e-189
AWR39178.1|3389279_3389462_-	hypothetical protein	NA	NA	NA	NA	NA
AWR39179.1|3389578_3390517_+	hypothetical protein	NA	Q2P9W7	Enterobacteria_phage	77.6	9.8e-141
AWR39180.1|3391368_3391578_-	hypothetical protein	NA	Q6K1F0	Salmonella_virus	94.2	8.2e-32
AWR39181.1|3391757_3392489_-	hypothetical protein	NA	Q37850	Escherichia_phage	94.7	1.8e-129
AWR39182.1|3392568_3393009_-	DinI family protein	NA	A0A218M4I0	Erwinia_phage	92.0	1.8e-65
AWR39183.1|3393125_3395369_-	replication endonuclease	NA	A0A218M4H2	Erwinia_phage	95.3	0.0e+00
AWR39184.1|3395359_3395641_-	hypothetical protein	NA	A0A0P0I3U9	Klebsiella_phage	52.6	2.0e-12
AWR39185.1|3395637_3395910_-	hypothetical protein	NA	A0A218M4I8	Erwinia_phage	78.9	2.1e-35
AWR39186.1|3395906_3396491_-	DNA polymerase III subunit epsilon	NA	A0A1S6L012	Salmonella_phage	67.7	4.0e-68
AWR39187.1|3396487_3396715_-	hypothetical protein	NA	A0A0M4S5Q7	Salmonella_phage	91.7	2.0e-31
AWR40645.1|3396714_3396897_-	hypothetical protein	NA	Q6K1F6	Salmonella_virus	85.0	6.9e-19
AWR39188.1|3397012_3397351_-	hypothetical protein	NA	A0A218M4I7	Erwinia_phage	94.6	7.3e-54
AWR39189.1|3397314_3397515_-	hypothetical protein	NA	Q6K1F7	Salmonella_virus	100.0	1.2e-32
AWR39190.1|3397522_3398032_-	hypothetical protein	NA	A0A0M4QWN1	Salmonella_phage	98.8	6.2e-89
AWR39191.1|3398062_3398326_-	hypothetical protein	NA	A0A218M4I5	Erwinia_phage	90.8	8.5e-42
3398343:3398360	attL	TTTGCCAATATTTGCCAT	NA	NA	NA	NA
AWR39192.1|3398448_3399030_+	phage repressor protein CI	NA	A0A218M4J1	Erwinia_phage	93.1	1.2e-99
AWR39193.1|3399029_3400052_+|integrase	integrase	integrase	A0A218M4I3	Erwinia_phage	87.9	3.5e-176
AWR39194.1|3400268_3401036_-	siderophore-interacting protein	NA	NA	NA	NA	NA
3400053:3400070	attR	ATGGCAAATATTGGCAAA	NA	NA	NA	NA
AWR39195.1|3401267_3401915_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
AWR39196.1|3401911_3403477_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	33.9	1.0e-12
>prophage 10
CP021462	Salmonella enterica subsp. enterica serovar Typhimurium strain UGA14 chromosome, complete genome	4879285	4441836	4459730	4879285	plate,tail	Burkholderia_phage(47.37%)	22	NA	NA
AWR40123.1|4441836_4443582_-|tail	phage tail protein	tail	A0A0M3ULF6	Salmonella_phage	52.2	3.2e-52
AWR40124.1|4443584_4444217_-|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	56.4	6.6e-24
AWR40125.1|4444209_4445325_-|plate	baseplate protein	plate	Q6QI99	Burkholderia_phage	52.2	1.8e-101
AWR40126.1|4445315_4445675_-|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	64.2	2.8e-35
AWR40127.1|4445838_4447386_-	hypothetical protein	NA	B9UDL6	Salmonella_phage	29.9	1.9e-48
AWR40128.1|4447385_4448315_-	glycosyltransferase	NA	S5FKN0	Shigella_phage	83.8	8.8e-150
AWR40129.1|4448311_4448674_-	GtrA family protein	NA	I1TED9	Salmonella_phage	70.8	1.2e-43
AWR40130.1|4449001_4449724_-|plate	baseplate protein	plate	A0A067ZIM2	Vibrio_phage	41.0	3.3e-11
AWR40131.1|4449733_4450777_-	phage protein D	NA	Q6QIA2	Burkholderia_phage	45.1	2.5e-76
AWR40132.1|4450764_4450974_-	hypothetical protein	NA	A4JWL2	Burkholderia_virus	60.3	9.8e-17
AWR40133.1|4450973_4451927_-	methyl-accepting chemotaxis protein	NA	A4JWL1	Burkholderia_virus	50.8	2.3e-36
AWR40134.1|4451926_4454281_-|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	30.6	6.9e-66
AWR40135.1|4454377_4454506_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
AWR40136.1|4454465_4454783_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
AWR40137.1|4454834_4455359_-|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.5	2.8e-68
AWR40138.1|4455358_4456786_-|tail	phage tail protein	tail	A4JWK5	Burkholderia_virus	70.9	1.1e-194
AWR40139.1|4456775_4456973_-	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	52.9	8.6e-07
AWR40140.1|4456969_4457425_-	hypothetical protein	NA	NA	NA	NA	NA
AWR40141.1|4457584_4457899_-	hypothetical protein	NA	Q6QIC4	Burkholderia_phage	49.1	6.4e-20
AWR40142.1|4457911_4458517_-	lytic murein transglycosylase	NA	Q5ZQZ1	Pseudomonas_phage	59.9	2.5e-60
AWR40143.1|4458519_4458807_-	hypothetical protein	NA	Q6QIC8	Burkholderia_phage	49.1	2.3e-16
AWR40144.1|4459382_4459730_+	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.5	4.9e-21
>prophage 1
CP021463	Salmonella enterica subsp. enterica serovar Typhimurium strain UGA14 plasmid pUGA14_1, complete sequence	352906	0	950	352906		Pacmanvirus(100.0%)	1	NA	NA
AWR40706.1|434_950_+	nuclease	NA	A0A1X6WF84	Pacmanvirus	38.6	2.1e-07
>prophage 2
CP021463	Salmonella enterica subsp. enterica serovar Typhimurium strain UGA14 plasmid pUGA14_1, complete sequence	352906	4633	9902	352906		uncultured_Caudovirales_phage(100.0%)	6	NA	NA
AWR40714.1|4633_6112_+	sodium-independent anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	74.4	7.3e-199
AWR40715.1|6130_6958_+	universal stress protein	NA	A0A2H4J154	uncultured_Caudovirales_phage	37.2	4.9e-43
AWR40716.1|7017_7443_-	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.7	1.6e-50
AWR40717.1|7455_8745_-	arsenical efflux pump membrane protein ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	71.4	9.9e-168
AWR40718.1|8790_9111_-	transcriptional regulator	NA	A0A2H4J145	uncultured_Caudovirales_phage	53.7	1.7e-20
AWR40719.1|9197_9902_+	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	72.9	8.8e-86
>prophage 3
CP021463	Salmonella enterica subsp. enterica serovar Typhimurium strain UGA14 plasmid pUGA14_1, complete sequence	352906	27548	29226	352906		Cronobacter_phage(100.0%)	2	NA	NA
AWR40735.1|27548_27983_+	peptidase	NA	F1C5A6	Cronobacter_phage	48.8	2.5e-22
AWR40736.1|27966_29226_+	hypothetical protein	NA	F1C5A5	Cronobacter_phage	44.5	1.5e-96
>prophage 4
CP021463	Salmonella enterica subsp. enterica serovar Typhimurium strain UGA14 plasmid pUGA14_1, complete sequence	352906	52935	54117	352906		Erwinia_phage(100.0%)	1	NA	NA
AWR40755.1|52935_54117_+	S49 family peptidase	NA	B8QTU8	Erwinia_phage	29.2	7.5e-13
>prophage 5
CP021463	Salmonella enterica subsp. enterica serovar Typhimurium strain UGA14 plasmid pUGA14_1, complete sequence	352906	63733	64333	352906		Salmonella_phage(100.0%)	1	NA	NA
AWR40769.1|63733_64333_+	hypothetical protein	NA	A0A1V0E5L6	Salmonella_phage	42.6	1.7e-08
>prophage 6
CP021463	Salmonella enterica subsp. enterica serovar Typhimurium strain UGA14 plasmid pUGA14_1, complete sequence	352906	69631	69925	352906		Escherichia_phage(100.0%)	1	NA	NA
AWR40780.1|69631_69925_-	hypothetical protein	NA	I7B2L9	Escherichia_phage	38.6	4.1e-05
>prophage 7
CP021463	Salmonella enterica subsp. enterica serovar Typhimurium strain UGA14 plasmid pUGA14_1, complete sequence	352906	76323	76857	352906		Edwardsiella_phage(100.0%)	1	NA	NA
AWR40790.1|76323_76857_-	HNH endonuclease	NA	E7EKU5	Edwardsiella_phage	65.2	6.8e-46
>prophage 8
CP021463	Salmonella enterica subsp. enterica serovar Typhimurium strain UGA14 plasmid pUGA14_1, complete sequence	352906	86153	87263	352906		Synechococcus_phage(100.0%)	1	NA	NA
AWR40798.1|86153_87263_+	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	28.3	4.9e-30
>prophage 9
CP021463	Salmonella enterica subsp. enterica serovar Typhimurium strain UGA14 plasmid pUGA14_1, complete sequence	352906	90303	91629	352906		Erysipelothrix_phage(100.0%)	1	NA	NA
AWR40802.1|90303_91629_+	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	48.1	6.5e-114
>prophage 10
CP021463	Salmonella enterica subsp. enterica serovar Typhimurium strain UGA14 plasmid pUGA14_1, complete sequence	352906	99650	111051	352906	transposase	Shigella_phage(28.57%)	10	NA	NA
AWR40809.1|99650_100418_+	ferric citrate ABC transporter ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	25.2	9.8e-14
AWR41048.1|100516_100810_+|transposase	transposase	transposase	A0A0P0ZDM8	Stx2-converting_phage	95.9	4.7e-49
AWR40810.1|101140_101419_-	EAL domain-containing protein	NA	NA	NA	NA	NA
AWR40811.1|101765_102848_+	lac repressor	NA	C6ZCU4	Enterobacteria_phage	98.1	6.5e-189
AWR40812.1|102969_106044_+	beta-D-galactosidase	NA	L0N6M2	Herpes_simplex_virus	96.8	0.0e+00
AWR40813.1|106095_107349_+	MFS transporter	NA	NA	NA	NA	NA
AWR40814.1|107405_107576_+	galactoside O-acetyltransferase	NA	NA	NA	NA	NA
AWR40815.1|108430_109564_-	aldehyde dehydrogenase	NA	E3SJ82	Synechococcus_phage	28.9	1.7e-09
AWR40816.1|109915_110770_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	56.2	8.0e-81
AWR40817.1|110766_111051_-|transposase	IS3 family transposase	transposase	U5P4I9	Shigella_phage	44.8	8.9e-13
>prophage 11
CP021463	Salmonella enterica subsp. enterica serovar Typhimurium strain UGA14 plasmid pUGA14_1, complete sequence	352906	123658	127534	352906		Caulobacter_phage(50.0%)	6	NA	NA
AWR40829.1|123658_124267_-	hypothetical protein	NA	K4JV11	Caulobacter_phage	38.5	4.4e-25
AWR40830.1|124422_124680_-	hypothetical protein	NA	NA	NA	NA	NA
AWR40831.1|124744_125173_-	hypothetical protein	NA	NA	NA	NA	NA
AWR40832.1|125264_125642_-	hypothetical protein	NA	NA	NA	NA	NA
AWR40833.1|126047_127229_-	hypothetical protein	NA	NA	NA	NA	NA
AWR40834.1|127237_127534_-	toxin-plasmid maintenance system killer protein	NA	A0A222YWE2	Escherichia_phage	35.1	3.2e-05
>prophage 12
CP021463	Salmonella enterica subsp. enterica serovar Typhimurium strain UGA14 plasmid pUGA14_1, complete sequence	352906	131989	135966	352906		Salmonella_phage(25.0%)	6	NA	NA
AWR40840.1|131989_132421_-	hypothetical protein	NA	A0A1V0E5M6	Salmonella_phage	49.6	4.2e-22
AWR40841.1|132524_133049_-	hypothetical protein	NA	NA	NA	NA	NA
AWR40842.1|133371_134136_+	hypothetical protein	NA	NA	NA	NA	NA
AWR40843.1|134216_134978_+	SAM-dependent methyltransferase	NA	A0A2I7RNS1	Vibrio_phage	32.4	1.3e-18
AWR40844.1|135071_135335_+	hypothetical protein	NA	M9UXL5	Escherichia_phage	46.5	3.2e-09
AWR40845.1|135378_135966_+	hypothetical protein	NA	A0A248SKW5	Klebsiella_phage	71.1	1.1e-09
>prophage 13
CP021463	Salmonella enterica subsp. enterica serovar Typhimurium strain UGA14 plasmid pUGA14_1, complete sequence	352906	140928	141984	352906		Salmonella_phage(100.0%)	1	NA	NA
AWR41049.1|140928_141984_-	replication protein RepA	NA	J9Q7H0	Salmonella_phage	50.9	2.1e-83
>prophage 14
CP021463	Salmonella enterica subsp. enterica serovar Typhimurium strain UGA14 plasmid pUGA14_1, complete sequence	352906	147582	156302	352906		Salmonella_phage(80.0%)	8	NA	NA
AWR40853.1|147582_149274_-	restriction endonuclease subunit M	NA	J9Q747	Salmonella_phage	31.1	5.8e-67
AWR40854.1|149521_150685_-	DNA-binding protein	NA	A0A1P8DTT7	Salmonella_phage	32.1	1.3e-17
AWR40855.1|151054_151867_+	DNA modification methylase	NA	A0A1C9II58	Salmonella_phage	38.9	1.2e-46
AWR40856.1|151875_152730_-	hypothetical protein	NA	NA	NA	NA	NA
AWR40857.1|152964_153681_-	hypothetical protein	NA	NA	NA	NA	NA
AWR40858.1|153677_153878_-	hypothetical protein	NA	NA	NA	NA	NA
AWR40859.1|153897_154950_-	hypothetical protein	NA	A0A2P9HXK7	Yersinia_phage	31.2	1.1e-12
AWR40860.1|155426_156302_+	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	42.7	7.9e-60
>prophage 15
CP021463	Salmonella enterica subsp. enterica serovar Typhimurium strain UGA14 plasmid pUGA14_1, complete sequence	352906	172148	173153	352906		Aeromonas_phage(100.0%)	1	NA	NA
AWR40871.1|172148_173153_+	peptide transporter	NA	A0A1I9KFW9	Aeromonas_phage	33.8	2.7e-11
>prophage 16
CP021463	Salmonella enterica subsp. enterica serovar Typhimurium strain UGA14 plasmid pUGA14_1, complete sequence	352906	176258	178810	352906	transposase	Enterobacteria_phage(50.0%)	3	NA	NA
AWR40876.1|176258_177296_+	stbA family protein	NA	A0A0A7NPX4	Enterobacteria_phage	35.0	3.6e-43
AWR40877.1|177307_177820_+	hypothetical protein	NA	NA	NA	NA	NA
AWR40878.1|177841_178810_+|transposase	IS5/IS1182 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	99.1	1.5e-184
>prophage 17
CP021463	Salmonella enterica subsp. enterica serovar Typhimurium strain UGA14 plasmid pUGA14_1, complete sequence	352906	193044	194829	352906		Bacillus_virus(100.0%)	1	NA	NA
AWR40887.1|193044_194829_+	DNA helicase	NA	G3MA40	Bacillus_virus	23.1	6.0e-22
>prophage 18
CP021463	Salmonella enterica subsp. enterica serovar Typhimurium strain UGA14 plasmid pUGA14_1, complete sequence	352906	227076	236005	352906		Acinetobacter_phage(33.33%)	10	NA	NA
AWR40921.1|227076_228156_-	hypothetical protein	NA	A0A172Q0S8	Acinetobacter_phage	34.1	2.8e-38
AWR40922.1|228157_228931_-	hypothetical protein	NA	NA	NA	NA	NA
AWR40923.1|228923_230066_-	adenine/guanine phosphoribosyltransferase	NA	A0A172Q0Y1	Acinetobacter_phage	34.5	6.5e-30
AWR40924.1|230075_231134_-	carbamoyl-phosphate synthase large chain	NA	NA	NA	NA	NA
AWR40925.1|231454_232036_+	tellurium resistance protein TerZ	NA	K4JRX3	Caulobacter_phage	30.0	6.3e-13
AWR40926.1|232035_233193_+	tellurium resistance protein TerA	NA	NA	NA	NA	NA
AWR40927.1|233215_233671_+	Tellurium resistance protein TerB	NA	NA	NA	NA	NA
AWR40928.1|233693_234734_+	tellurium resistance protein TerC	NA	K7QKE8	Escherichia_phage	48.0	2.2e-77
AWR40929.1|234782_235361_+	tellurium resistance protein TerD	NA	A0A2P1N0L4	Streptomyces_phage	40.0	2.5e-06
AWR40930.1|235429_236005_+	tellurium resistance protein TerE	NA	K4JRX3	Caulobacter_phage	41.6	8.7e-31
>prophage 19
CP021463	Salmonella enterica subsp. enterica serovar Typhimurium strain UGA14 plasmid pUGA14_1, complete sequence	352906	240986	335380	352906	transposase,integrase	Escherichia_phage(25.93%)	95	323623:323682	338410:339231
AWR40937.1|240986_241991_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AWR40938.1|241953_242094_-	NTP-binding protein	NA	NA	NA	NA	NA
AWR40939.1|242140_243823_+|transposase	transposase	transposase	M4T586	Rhodobacter_phage	24.7	3.7e-05
AWR40940.1|243825_244734_+|transposase	transposase	transposase	NA	NA	NA	NA
AWR40941.1|244730_245948_+|transposase	transposase	transposase	NA	NA	NA	NA
AWR40942.1|246008_246623_+	resolvase	NA	A0A0A7NPV4	Enterobacteria_phage	51.0	5.1e-37
AWR40943.1|246661_246982_-|transposase	transposase	transposase	NA	NA	NA	NA
AWR40944.1|246997_247234_-	mercury resistance protein	NA	NA	NA	NA	NA
AWR40945.1|247230_247596_-	mercuric resistance transcriptional repressor protein MerD	NA	NA	NA	NA	NA
AWR40946.1|247707_248346_-	alkylmercury lyase	NA	NA	NA	NA	NA
AWR40947.1|248360_248714_-	hypothetical protein	NA	NA	NA	NA	NA
AWR40948.1|248643_249078_+	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
AWR40949.1|249156_250161_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AWR40950.1|250605_250896_+	nucleotidyltransferase	NA	NA	NA	NA	NA
AWR40951.1|250892_251294_+	DUF86 domain-containing protein	NA	NA	NA	NA	NA
AWR40952.1|251283_251640_+	cupin	NA	NA	NA	NA	NA
AWR40953.1|251894_252221_+	hypothetical protein	NA	NA	NA	NA	NA
AWR40954.1|252217_252718_+|transposase	transposase	transposase	NA	NA	NA	NA
AWR40955.1|252714_253086_+	hypothetical protein	NA	NA	NA	NA	NA
AWR40956.1|253079_253637_+	DNA invertase	NA	A0A0C4UR34	Shigella_phage	63.2	3.3e-59
AWR40957.1|253715_254720_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AWR40958.1|256658_257645_-	hypothetical protein	NA	NA	NA	NA	NA
AWR40959.1|258565_258958_+	hypothetical protein	NA	NA	NA	NA	NA
AWR40960.1|259716_259899_+|transposase	transposase	transposase	Q9G0F2	Phage_Gifsy-1	58.3	5.7e-13
AWR40961.1|260026_260779_+	hypothetical protein	NA	NA	NA	NA	NA
AWR40962.1|261341_261641_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AWR40963.1|262623_263775_+|transposase	IS30 family transposase IS30	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
AWR40964.1|264788_265706_+	hypothetical protein	NA	NA	NA	NA	NA
AWR40965.1|268197_269160_-	aminoimidazole riboside kinase	NA	NA	NA	NA	NA
AWR40966.1|269273_270287_-	hypothetical protein	NA	NA	NA	NA	NA
AWR40967.1|270299_271793_-	glycosyl hydrolase	NA	NA	NA	NA	NA
AWR40968.1|271807_273073_-	hypothetical protein	NA	NA	NA	NA	NA
AWR40969.1|273165_274599_-	glycosyl hydrolase family 32	NA	S6ATV4	Bacillus_phage	26.9	1.2e-36
AWR40970.1|274618_275857_-	MFS transporter	NA	NA	NA	NA	NA
AWR40971.1|276097_277093_+	transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	26.3	1.2e-16
AWR40972.1|278010_278436_+	hypothetical protein	NA	NA	NA	NA	NA
AWR40973.1|278581_278971_+	hypothetical protein	NA	NA	NA	NA	NA
AWR40974.1|280781_281777_-	hypothetical protein	NA	NA	NA	NA	NA
AWR40975.1|281805_283269_-	hypothetical protein	NA	NA	NA	NA	NA
AWR40976.1|283271_285392_-	hypothetical protein	NA	NA	NA	NA	NA
AWR40977.1|285378_286227_-	hypothetical protein	NA	NA	NA	NA	NA
AWR40978.1|287076_287733_+	hypothetical protein	NA	NA	NA	NA	NA
AWR40979.1|287935_288433_+	hypothetical protein	NA	NA	NA	NA	NA
AWR40980.1|288437_289826_+	hypothetical protein	NA	NA	NA	NA	NA
AWR41053.1|290226_290520_+	transcriptional regulator	NA	NA	NA	NA	NA
AWR40981.1|290524_291850_+	toxin HipA	NA	NA	NA	NA	NA
AWR40982.1|291910_292117_+	hypothetical protein	NA	NA	NA	NA	NA
AWR40983.1|292217_292628_+	hypothetical protein	NA	NA	NA	NA	NA
AWR40984.1|292640_293456_+	HNH endonuclease	NA	G0X580	Salmonella_phage	37.2	2.5e-15
AWR40985.1|293708_294134_+	hypothetical protein	NA	NA	NA	NA	NA
AWR40986.1|294682_294991_+	hypothetical protein	NA	NA	NA	NA	NA
AWR40987.1|295006_295864_+	HNH endonuclease	NA	G0X580	Salmonella_phage	34.2	3.9e-11
AWR40988.1|295925_296129_+	hypothetical protein	NA	NA	NA	NA	NA
AWR40989.1|296470_296875_-	DNA-binding protein	NA	NA	NA	NA	NA
AWR40990.1|297052_297346_-	hypothetical protein	NA	NA	NA	NA	NA
AWR40991.1|297371_297608_-	hypothetical protein	NA	NA	NA	NA	NA
AWR40992.1|297648_298104_-	hypothetical protein	NA	NA	NA	NA	NA
AWR40993.1|298379_299360_-|transposase	IS5/IS1182 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	1.8e-185
AWR40994.1|299405_300029_-	hypothetical protein	NA	NA	NA	NA	NA
AWR40995.1|300086_300467_-	hypothetical protein	NA	NA	NA	NA	NA
AWR40996.1|301221_301404_+	hypothetical protein	NA	NA	NA	NA	NA
AWR40997.1|304376_305081_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AWR40998.1|305362_305539_+	hypothetical protein	NA	Q716C2	Shigella_phage	58.0	6.7e-11
AWR40999.1|305606_305822_-	hypothetical protein	NA	NA	NA	NA	NA
AWR41000.1|305902_306571_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AWR41001.1|306671_307871_+	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
AWR41002.1|308385_308889_+	hypothetical protein	NA	NA	NA	NA	NA
AWR41003.1|308925_309630_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AWR41004.1|309688_310156_+	restriction endonuclease	NA	NA	NA	NA	NA
AWR41005.1|310160_310367_+	hypothetical protein	NA	NA	NA	NA	NA
AWR41006.1|310748_312182_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	50.6	7.0e-106
AWR41007.1|312215_313424_-	restriction endonuclease	NA	E5E3X4	Burkholderia_phage	42.5	1.2e-34
AWR41008.1|313436_313649_-	resolvase	NA	NA	NA	NA	NA
AWR41009.1|313690_314455_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
AWR41010.1|314597_314864_-	plasmid mobilization relaxosome protein MobC	NA	NA	NA	NA	NA
AWR41011.1|315084_315567_-	trimethoprim-resistant dihydrofolate reductase DfrA14	NA	G3MBI7	Bacillus_virus	28.9	6.6e-16
AWR41012.1|315713_316727_+|integrase	integron integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
AWR41013.1|316665_316980_+|transposase	transposase	transposase	NA	NA	NA	NA
AWR41014.1|317260_317965_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AWR41054.1|318108_318663_+	fluoroquinolone-acetylating aminoglycoside 6'-N-acetyltransferase AAC(6')-Ib-cr5	NA	NA	NA	NA	NA
AWR41055.1|318793_319624_+	oxacillin-hydrolyzing class D beta-lactamase OXA-1	NA	NA	NA	NA	NA
AWR41015.1|320255_320960_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AWR41016.1|321066_321927_+	aminoglycoside N-acetyltransferase AAC(3)-IIa	NA	NA	NA	NA	NA
AWR41017.1|321939_322482_+	tunicamycin resistance protein	NA	NA	NA	NA	NA
323623:323682	attL	TGGCACTGTTGCAAAGTTAGCGATGAGGCAGCCTTTTGTCTTATTCAAAGGCCTTACATT	NA	NA	NA	NA
AWR41018.1|323675_324380_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AWR41019.1|326701_327034_+	tryptophan synthase subunit beta like protein	NA	NA	NA	NA	NA
AWR41020.1|327080_327956_-	class A extended-spectrum beta-lactamase CTX-M-15	NA	A0A1B0VBP7	Salmonella_phage	82.4	1.1e-125
AWR41021.1|328211_329474_-|transposase	IS1380 family transposase	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
AWR41022.1|330037_330595_+|transposase	transposase	transposase	Q1MVP4	Enterobacteria_phage	100.0	7.0e-94
AWR41023.1|330777_331638_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
AWR41024.1|331847_332387_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
AWR41025.1|332358_333195_-	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
AWR41026.1|333194_333998_-	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
AWR41027.1|334058_334874_-	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	5.9e-09
AWR41028.1|335203_335380_+|integrase	integrase	integrase	T1S9J3	Salmonella_phage	68.6	1.0e-06
338410:339231	attR	TGGCACTGTTGCAAAGTTAGCGATGAGGCAGCCTTTTGTCTTATTCAAAGGCCTTACATTTCAAAAACTCTGCTTACCAGGCGCATTTCGCCCAGGGGATCACCATAATAAAATGCTGAGGCCTGGCCTTTGCGTAGTGCACGCATCACCTCAATACCTTTGATGGTGGCGTAAGCCGTCTTCATGGATTTAAATCCCAGCGTGGCGCCGATTATCCGTTTCAGTTTGCCATGATCGCATTCAATCACGTTGTTCCGGTACTTAATCTGTCGGTGTTCAACGTCAGACGGGCACCGGCCTTCGCGTTTGAGCAGAGCAAGCGCGCGACCATAGGCGGGCGCTTTATCCGTGTTGATGAATCGCGGGATCTGCCACTTCTTCACGTTGTTGAGGATTTTACCCAGAAACCGGTATGCAGCTTTGCTGTTACGACGGGAGGAGAGATAAAAATCGACAGTGCGGCCCCGGCTGTCGACGGCCCGGTACAGATACGCCCAGCGGCCATTGACCTTCACGTAGGTTTCATCCATGTGCCACGGGCAAAGATCGGAAGGGTTACGCCAGTACCAGCGCAGCCGTTTTTCCATTTCAGGCGCATAACGCTGAACCCAGCGGTAAATCGTGGAGTGATCGACATTCACTCCGCGTTCAGCCAGCATCTCCTGCAGCTCACGGTAACTGATGCCGTATTTGCAGTACCAGCGTACGGCCCACAGAATGATGTCACGCTGAAAATGCCGGCCTTTGAATGGGTTCATGTGCAGCTCCATCAGCAAAAGGGGATGATAAGTTTATCACCACCGACTATTTGCAACAGTGCCC	NA	NA	NA	NA
>prophage 20
CP021463	Salmonella enterica subsp. enterica serovar Typhimurium strain UGA14 plasmid pUGA14_1, complete sequence	352906	338462	344943	352906	transposase,integrase	Escherichia_phage(50.0%)	6	331170:331184	342064:342078
331170:331184	attL	TGCTGCCAACTTACT	NA	NA	NA	NA
AWR41030.1|338462_339167_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AWR41031.1|339237_340251_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
AWR41056.1|340396_341188_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
AWR41032.1|342061_342253_-	hypothetical protein	NA	NA	NA	NA	NA
342064:342078	attR	AGTAAGTTGGCAGCA	NA	NA	NA	NA
AWR41033.1|342306_342981_+	type A chloramphenicol O-acetyltransferase	NA	G3CFL0	Escherichia_phage	100.0	2.5e-130
AWR41034.1|343713_344943_+	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	26.6	8.1e-18
>prophage 21
CP021463	Salmonella enterica subsp. enterica serovar Typhimurium strain UGA14 plasmid pUGA14_1, complete sequence	352906	351470	351638	352906		Escherichia_phage(100.0%)	1	NA	NA
AWR41042.1|351470_351638_-	hypothetical protein	NA	A0A2D2W2Z9	Escherichia_phage	50.9	7.3e-07
>prophage 1
CP021464	Salmonella enterica subsp. enterica serovar Typhimurium strain UGA14 plasmid pUGA14_2, complete sequence	115864	26832	51382	115864	integrase,transposase	Salmonella_phage(42.86%)	26	24824:24838	43105:43119
24824:24838	attL	CAGAAATAAAGTCAG	NA	NA	NA	NA
AWR41082.1|26832_27015_+|integrase	integrase	integrase	NA	NA	NA	NA
AWR41083.1|27273_28251_-	protein RepA	NA	J9Q7H0	Salmonella_phage	62.6	1.0e-100
AWR41084.1|28756_29053_-	cytoplasmic protein	NA	NA	NA	NA	NA
AWR41085.1|29536_30058_-	hypothetical protein	NA	NA	NA	NA	NA
AWR41086.1|30733_30952_+	plasmid maintenance protein CcdA	NA	NA	NA	NA	NA
AWR41087.1|30953_31259_+	plasmid maintenance protein CcdB	NA	NA	NA	NA	NA
AWR41088.1|31260_31551_+	cytoplasmic protein	NA	NA	NA	NA	NA
AWR41089.1|31547_32069_+	cytoplasmic protein	NA	NA	NA	NA	NA
AWR41090.1|32103_32886_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	91.1	1.6e-51
AWR41091.1|32894_33446_+	EAL domain-containing protein	NA	NA	NA	NA	NA
AWR41183.1|33458_33608_+	diguanylate phosphodiesterase	NA	NA	NA	NA	NA
AWR41092.1|33611_34121_+	CaiF/GrlA family transcriptional regulator	NA	NA	NA	NA	NA
AWR41093.1|34114_34600_+	hypothetical protein	NA	NA	NA	NA	NA
AWR41094.1|35319_35880_+	inverse autotransporter beta-barrel domain-containing protein	NA	NA	NA	NA	NA
AWR41095.1|35946_36297_-|transposase	transposase	transposase	A0A077SLN2	Escherichia_phage	80.5	1.9e-44
AWR41096.1|37816_38542_-	MAPK phosphothreonine lyase	NA	NA	NA	NA	NA
AWR41097.1|38822_40598_-	mono(ADP-ribosyl)transferase SpvB	NA	NA	NA	NA	NA
AWR41098.1|40779_41547_-	virulence protein SpvA	NA	NA	NA	NA	NA
AWR41099.1|41720_41885_-	lysozyme	NA	A0A0M4R365	Salmonella_phage	63.0	3.3e-12
AWR41100.1|42058_42952_-	virulence genes transcriptional activator	NA	NA	NA	NA	NA
AWR41101.1|43560_44598_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
43105:43119	attR	CTGACTTTATTTCTG	NA	NA	NA	NA
AWR41102.1|44786_45812_-	AAA family ATPase	NA	NA	NA	NA	NA
AWR41103.1|45744_47409_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
AWR41184.1|47392_47932_-	DNA invertase	NA	E5FFF9	Burkholderia_phage	33.9	5.8e-21
AWR41104.1|47956_48661_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AWR41105.1|48670_51382_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	74.3	0.0e+00
>prophage 2
CP021464	Salmonella enterica subsp. enterica serovar Typhimurium strain UGA14 plasmid pUGA14_2, complete sequence	115864	55659	82833	115864	integrase,transposase	Escherichia_phage(35.29%)	31	47894:47953	69117:69937
47894:47953	attL	GGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCTG	NA	NA	NA	NA
AWR41111.1|55659_57183_+|transposase	IS21 family transposase IS1326	transposase	A0A2L1IVA1	Escherichia_phage	24.2	1.2e-15
AWR41187.1|57172_57955_+	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	35.0	2.5e-33
AWR41112.1|58130_58631_-	N-acetyltransferase	NA	NA	NA	NA	NA
AWR41113.1|58649_58829_+	hypothetical protein	NA	NA	NA	NA	NA
AWR41114.1|58758_59598_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
AWR41115.1|59591_59939_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
AWR41116.1|60102_60894_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
AWR41117.1|60986_61460_-	trimethoprim-resistant dihydrofolate reductase DfrA1	NA	G3MBI7	Bacillus_virus	32.1	3.7e-19
AWR41118.1|61616_62735_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.7	1.5e-71
AWR41119.1|62706_63543_-	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
AWR41120.1|63542_64346_-	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
AWR41121.1|64406_65222_-	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	3.5e-09
AWR41188.1|65529_66381_-	replication protein	NA	NA	NA	NA	NA
AWR41122.1|66432_67137_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AWR41123.1|67183_67585_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
AWR41124.1|67734_68595_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
AWR41189.1|68777_69155_-	resolvase	NA	Q1MVP4	Enterobacteria_phage	100.0	2.4e-53
AWR41125.1|69179_69884_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AWR41126.1|70194_70935_-	carbonic anhydrase	NA	NA	NA	NA	NA
69117:69937	attR	GGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCTGCACATGAACCCATTCAAAGGCCGGCATTTTCAGCGTGACATCATTCTGTGGGCCGTACGCTGGTACTGCAAATACGGCATCAGTTACCGTGAGCTGCAGGAGATGCTGGCTGAACGCGGAGTGAATGTCGATCACTCCACGATTTACCGCTGGGTTCAGCGTTATGCGCCTGAAATGGAAAAACGGCTGCGCTGGTACTGGCGTAACCCTTCCGATCTTTGCCCGTGGCACATGGATGAAACCTACGTGAAGGTCAATGGCCGCTGGGCGTATCTGTACCGGGCCGTCGACAGCCGGGGCCGCACTGTCGATTTTTATCTCTCCTCCCGTCGTAACAGCAAAGCTGCATACCGGTTTCTGGGTAAAATCCTCAACAACGTGAAGAAGTGGCAGATCCCGCGATTCATCAACACGGATAAAGCGCCCGCCTATGGTCGCGCGCTTGCTCTGCTCAAACGCGAAGGCCGGTGCCCGTCTGACGTTGAACACCGACAGATTAAGTACCGGAACAACGTGATTGAATGCGATCATGGCAAACTGAAACGGATAATCGGCGCCACGCTGGGATTTAAATCCATGAAGACGGCTTACGCCACCATCAAAGGTATTGAGGTGATGCGTGCACTACGCAAAGGCCAGGCCTCAGCATTTTATTATGGTGATCCCCTGGGCGAAATGCGCCTGGTAAGCAGAGTTTTTGAAATGTAAGGCCTTTGAATAAGACAAAAGGCTGCCTCATCGCTAACTTTGCAACAGTGCCG	NA	NA	NA	NA
AWR41127.1|71589_72078_-	cytoplasmic protein	NA	NA	NA	NA	NA
AWR41128.1|72336_73452_+	hypothetical protein	NA	NA	NA	NA	NA
AWR41190.1|73537_73954_+	hypothetical protein	NA	O64348	Escherichia_phage	42.9	8.2e-07
AWR41129.1|74137_74473_+	hypothetical protein	NA	NA	NA	NA	NA
AWR41130.1|75127_76069_-|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	54.3	2.0e-72
AWR41131.1|76483_77689_+	ParA family protein	NA	A0A077SL49	Escherichia_phage	69.3	1.5e-162
AWR41132.1|77685_78663_+	chromosome partitioning protein ParB	NA	A0A1B0V750	Salmonella_phage	53.2	5.2e-84
AWR41133.1|78744_80019_-	DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	64.5	3.0e-156
AWR41134.1|80018_80441_-	protein SamA	NA	A0A1W6JNS2	Morganella_phage	51.6	1.0e-28
AWR41135.1|80951_81422_+	hypothetical protein	NA	NA	NA	NA	NA
AWR41136.1|81414_81771_+	hypothetical protein	NA	NA	NA	NA	NA
AWR41137.1|82152_82833_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.4	1.6e-28
