The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP029653	Staphylococcus aureus strain AR_0470 chromosome, complete genome	2963657	787856	795676	2963657		Hokovirus(16.67%)	10	NA	NA
AWQ88400.1|787856_788912_-	histidine protein kinase SaeS	NA	A0A1V0SGX0	Hokovirus	29.8	3.6e-14
AWQ88813.1|788911_789598_-	response regulator	NA	NA	NA	NA	NA
AWQ88106.1|789572_790046_-	doxX family protein	NA	NA	NA	NA	NA
AWQ88607.1|790387_790828_-	electron transfer DM13 family protein	NA	NA	NA	NA	NA
AWQ88293.1|791107_791692_-	putative membrane protein	NA	NA	NA	NA	NA
AWQ89289.1|791790_792504_-	7-cyano-7-deazaguanosine (preQ0) biosynthesis protein QueE	NA	A0A1U9WRB6	Streptococcus_virus	43.5	6.5e-52
AWQ87547.1|792507_792927_-	queuosine biosynthesis protein QueD	NA	S4U060	uncultured_phage	28.7	6.3e-07
AWQ87539.1|792928_793597_-	queuosine biosynthesis protein QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	57.5	9.6e-66
AWQ89524.1|793947_794541_+	glutamine amidotransferase of anthranilate synthase/aminodeoxychorismate synthase family protein	NA	A0A0P0IKJ1	Acinetobacter_phage	44.0	6.8e-39
AWQ89341.1|794524_795676_+	chorismate binding enzyme family protein	NA	S4VNU7	Pandoravirus	36.1	2.1e-23
>prophage 2
CP029653	Staphylococcus aureus strain AR_0470 chromosome, complete genome	2963657	807648	821786	2963657		uncultured_Caudovirales_phage(50.0%)	12	NA	NA
AWQ88749.1|807648_808707_+	histidinol-phosphate transaminase	NA	A0A0H3TLT9	Faustovirus	26.5	5.7e-20
AWQ89273.1|808865_809408_+	putative 5'(3')-deoxyribonucleotidase	NA	NA	NA	NA	NA
AWQ89470.1|809959_810877_-	putative lipid kinase	NA	A0A1V0SBJ0	Catovirus	22.0	8.2e-07
AWQ89771.1|811146_812652_-	H+ symporter family protein	NA	A0A0P0IY73	Acinetobacter_phage	32.2	2.0e-58
AWQ88723.1|812991_813492_-	7-cyano-7-deazaguanine reductase	NA	E7DN65	Pneumococcus_phage	66.2	2.7e-52
AWQ87903.1|813511_814378_-	eamA-like transporter family protein	NA	NA	NA	NA	NA
AWQ87529.1|815179_815578_+	nrdI protein	NA	A0A2H4J545	uncultured_Caudovirales_phage	72.0	1.2e-52
AWQ87450.1|815540_817646_+	ribonucleoside-diphosphate reductase, alpha subunit	NA	A0A2H4J2N6	uncultured_Caudovirales_phage	91.6	0.0e+00
AWQ87830.1|817765_818737_+	ribonucleoside-diphosphate reductase subunit beta	NA	A0A2H4J4P3	uncultured_Caudovirales_phage	91.3	4.2e-171
AWQ88942.1|819113_820085_+	fecCD transport family protein	NA	A0A2H4IY97	uncultured_Caudovirales_phage	80.2	7.8e-141
AWQ88210.1|820071_821028_+	fecCD transport family protein	NA	A0A2H4J116	uncultured_Caudovirales_phage	60.0	5.5e-06
AWQ87574.1|821024_821786_+	ABC transporter family protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	30.1	7.2e-17
>prophage 3
CP029653	Staphylococcus aureus strain AR_0470 chromosome, complete genome	2963657	838075	902522	2963657	coat,integrase,terminase,transposase	Staphylococcus_phage(42.42%)	58	839926:839942	895205:895221
AWQ89504.1|838075_839746_-|transposase	transposase DDE domain protein	transposase	A0ZS58	Staphylococcus_virus	77.4	5.5e-243
839926:839942	attL	CAATACGAAGTATTGTA	NA	NA	NA	NA
AWQ87630.1|840393_842925_+	preprotein translocase, SecA subunit	NA	NA	NA	NA	NA
AWQ88150.1|843357_844350_+	peptide chain release factor 2	NA	NA	NA	NA	NA
AWQ89439.1|845118_845958_+	staphyloxanthin biosynthesis protein, putative	NA	A0A2H4J675	uncultured_Caudovirales_phage	42.2	3.5e-12
AWQ89403.1|846131_846782_+	HD containing hydrolase-like enzyme family protein	NA	NA	NA	NA	NA
AWQ89031.1|846778_847015_+	hypothetical protein	NA	NA	NA	NA	NA
AWQ88741.1|847283_849269_+	excinuclease ABC subunit B	NA	NA	NA	NA	NA
AWQ89476.1|849276_852123_+	excinuclease ABC subunit A	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	57.2	0.0e+00
AWQ88487.1|852733_853666_+	HPr(Ser) kinase/phosphatase	NA	NA	NA	NA	NA
AWQ89331.1|853671_854514_+	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
AWQ88141.1|854521_855007_+	bacterial transferase hexapeptide family protein	NA	NA	NA	NA	NA
AWQ89964.1|855014_856454_+	TPR repeat family protein	NA	NA	NA	NA	NA
AWQ89452.1|856520_857456_+	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	49.2	2.9e-84
AWQ88960.1|858107_859019_+	hypothetical protein	NA	A0A0R8VB27	Thermobifida_phage	36.1	1.1e-08
AWQ88847.1|859015_860011_+	hypothetical protein	NA	A1IMD5	Streptococcus_phage	41.9	4.8e-53
AWQ89337.1|860119_861064_+	sporulation Regulator WhiA C terminal domain protein	NA	Q7AWZ3	Streptococcus_phage	40.6	2.4e-54
AWQ88676.1|861122_862070_-|integrase	integrase core domain protein	integrase	Q9MBM9	Staphylococcus_prophage	100.0	1.1e-184
AWQ87975.1|862706_863294_+	ATP-dependent Clp endopeptidase, proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	55.3	8.2e-53
AWQ87961.1|863475_865110_+	malic enzyme, NAD binding domain protein	NA	NA	NA	NA	NA
AWQ88153.1|865316_866219_-	NAD dependent epimerase/dehydratase family protein	NA	NA	NA	NA	NA
AWQ89182.1|866921_867551_+	hypothetical protein	NA	NA	NA	NA	NA
AWQ87660.1|868044_869058_+	glycolytic operon regulator	NA	NA	NA	NA	NA
AWQ87847.1|869110_870121_+	glyceraldehyde-3-phosphate dehydrogenase, type I	NA	NA	NA	NA	NA
AWQ87478.1|870259_871450_+	phosphoglycerate kinase	NA	NA	NA	NA	NA
AWQ89432.1|871571_872333_+	triose-phosphate isomerase	NA	NA	NA	NA	NA
AWQ88146.1|872335_873853_+	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
AWQ89007.1|873982_875287_+	phosphopyruvate hydratase	NA	W6LP63	Streptococcus_phage	80.7	6.7e-196
AWQ89510.1|875623_876082_+	putative membrane protein	NA	NA	NA	NA	NA
AWQ90002.1|876148_876382_+	preprotein translocase, SecG subunit	NA	NA	NA	NA	NA
AWQ88510.1|876510_877251_+	carboxylesterase	NA	NA	NA	NA	NA
AWQ89280.1|877284_879657_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	38.8	1.9e-92
AWQ88213.1|879678_880143_+	ssrA-binding protein	NA	W5RAM5	Staphylococcus_phage	100.0	1.5e-81
AWQ89808.1|880705_881824_-|integrase	phage integrase family protein	integrase	H0UST3	Bacillus_phage	44.9	4.1e-77
AWQ89246.1|881804_882734_-	hypothetical protein	NA	Q9AZH9	Lactococcus_phage	35.6	2.2e-12
AWQ89939.1|882921_883140_+	helix-turn-helix family protein	NA	NA	NA	NA	NA
AWQ88250.1|883152_883290_+	putative membrane protein	NA	NA	NA	NA	NA
AWQ89645.1|883291_883702_+	hypothetical protein	NA	A0A2H4JBF1	uncultured_Caudovirales_phage	85.8	2.4e-59
AWQ88263.1|883702_883996_+	hypothetical protein	NA	A0A1W6JQH0	Staphylococcus_phage	61.8	8.9e-24
AWQ88833.1|884083_884953_+	primase C terminal 1 family protein	NA	A0A1W6JQL5	Staphylococcus_phage	96.2	2.7e-161
AWQ90044.1|884969_886427_+	virulence-associated E family protein	NA	A0A1W6JQD6	Staphylococcus_phage	96.3	1.0e-277
AWQ89232.1|886727_887090_+	putative interference protein with phage growth	NA	A0A1W6JQD5	Staphylococcus_phage	99.2	8.9e-66
AWQ88169.1|887091_887376_+	putative pathogenicity island protein	NA	A0A1W6JQE4	Staphylococcus_phage	92.6	1.0e-45
AWQ88369.1|887372_888014_+	putative saPI1 ORF9-like protein	NA	Q4ZE67	Staphylococcus_phage	94.4	5.9e-113
AWQ90060.1|888530_888872_+	putative saPI1 ORF8-like protein	NA	Q4ZE66	Staphylococcus_phage	97.3	9.3e-57
AWQ88465.1|888883_889462_+	putative pathogenicity island protein	NA	A0A2H4JBG0	uncultured_Caudovirales_phage	38.4	2.4e-28
AWQ87829.1|889479_889698_+	hypothetical protein	NA	NA	NA	NA	NA
AWQ87937.1|889748_890276_+|coat	putative spore coat protein	coat	Q4ZE87	Staphylococcus_phage	90.9	6.4e-81
AWQ89388.1|890278_890620_+	putative pathogenicity island protein	NA	Q4ZE86	Staphylococcus_phage	91.2	8.7e-55
AWQ89437.1|890616_891186_+|terminase	terminase small subunit	terminase	Q4ZE85	Staphylococcus_phage	96.3	4.3e-99
AWQ89167.1|891326_892319_+	abi-like family protein	NA	A0A0S2MYH0	Enterococcus_phage	29.5	2.6e-27
AWQ88496.1|892372_893161_+	hypothetical protein	NA	NA	NA	NA	NA
AWQ89415.1|893376_895023_-|transposase	transposase DDE domain protein	transposase	Q9MBP7	Staphylococcus_prophage	99.6	3.0e-294
AWQ89627.1|895312_895867_-	putative penicillin binding protein	NA	A0A1W6JQE5	Staphylococcus_phage	98.9	1.8e-94
895205:895221	attR	CAATACGAAGTATTGTA	NA	NA	NA	NA
AWQ88185.1|896655_897456_+	enterotoxin type C-3	NA	A0A097PAT7	Streptococcus_pyogenes_phage	47.5	6.1e-51
AWQ88135.1|897622_898345_-	enterotoxin type E	NA	A0A1X9H080	Staphylococcus_phage	34.9	1.2e-26
AWQ88537.1|899184_899799_+	hypothetical protein	NA	NA	NA	NA	NA
AWQ88554.1|900086_900815_-	putative lipoprotein	NA	H9A0X8	Staphylococcus_phage	36.8	4.8e-18
AWQ90039.1|900875_902522_-|transposase	transposase DDE domain protein	transposase	A0ZS58	Staphylococcus_virus	100.0	3.5e-295
>prophage 4
CP029653	Staphylococcus aureus strain AR_0470 chromosome, complete genome	2963657	1016250	1069592	2963657	bacteriocin,protease,integrase,tRNA,transposase	Paenibacillus_phage(33.33%)	48	1037826:1037846	1060820:1060840
AWQ89648.1|1016250_1017198_-|integrase	integrase core domain protein	integrase	Q9MBM9	Staphylococcus_prophage	100.0	1.1e-184
AWQ89736.1|1017426_1018782_+	bacterial extracellular solute-binding, 5 Middle family protein	NA	NA	NA	NA	NA
AWQ87831.1|1018832_1019819_+	oligopeptide/dipeptide ABC transporter, ATP-binding, C-terminal domain protein	NA	G3M9Y6	Bacillus_virus	30.0	1.8e-15
AWQ88219.1|1019821_1020802_+	oligopeptide/dipeptide ABC transporter, ATP-binding, C-terminal domain protein	NA	G9BWD6	Planktothrix_phage	31.6	2.7e-16
AWQ87956.1|1020794_1021445_+	binding-protein-dependent transport system inner membrane component family protein	NA	NA	NA	NA	NA
AWQ89843.1|1021456_1022338_+	binding-protein-dependent transport system inner membrane component family protein	NA	NA	NA	NA	NA
AWQ89575.1|1022426_1023215_-|integrase	integrase core domain protein	integrase	A0A0C5AEA5	Paenibacillus_phage	51.8	5.1e-50
AWQ88566.1|1023238_1023967_-	helix-turn-helix domain protein	NA	A0A0C5AJ29	Paenibacillus_phage	35.8	4.5e-24
AWQ88054.1|1024289_1025936_+|transposase	transposase DDE domain protein	transposase	A0ZS58	Staphylococcus_virus	99.1	6.9e-291
AWQ87424.1|1025962_1026952_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
AWQ89592.1|1027246_1027642_+	regulatory protein spx	NA	NA	NA	NA	NA
AWQ90052.1|1028012_1028732_+	adapter protein MecA	NA	NA	NA	NA	NA
AWQ88257.1|1028852_1029839_+	competence CoiA-like family protein	NA	NA	NA	NA	NA
AWQ88747.1|1029886_1031695_+	oligoendopeptidase F	NA	A0A1X9I5X5	Streptococcus_phage	24.5	9.3e-47
AWQ87677.1|1032154_1032940_-	thioredoxin family protein	NA	NA	NA	NA	NA
AWQ89441.1|1032983_1033349_-	globin family protein	NA	NA	NA	NA	NA
AWQ89957.1|1033452_1034046_-	CYTH domain protein	NA	NA	NA	NA	NA
AWQ88023.1|1034231_1034579_+	hypothetical protein	NA	NA	NA	NA	NA
AWQ89048.1|1034595_1035231_+	putative RelA/SpoT domain protein	NA	NA	NA	NA	NA
AWQ90123.1|1035247_1036057_+	ATP-NAD kinase family protein	NA	NA	NA	NA	NA
AWQ87362.1|1036053_1036908_+	RNA pseudouridylate synthase family protein	NA	NA	NA	NA	NA
AWQ89372.1|1036928_1038314_+	magnesium transporter	NA	NA	NA	NA	NA
1037826:1037846	attL	ATTTTAACATTTTTAGGAATG	NA	NA	NA	NA
AWQ89340.1|1038323_1040168_+	sodium/hydrogen exchanger family protein	NA	NA	NA	NA	NA
AWQ88853.1|1040445_1041216_+	enoyl-[acyl-carrier-protein] reductase [NADPH] FabI	NA	NA	NA	NA	NA
AWQ87485.1|1041363_1042092_+	helix-turn-helix domain protein	NA	A0A0C5AJ29	Paenibacillus_phage	35.8	4.5e-24
AWQ88448.1|1042115_1042904_+|integrase	integrase core domain protein	integrase	A0A0C5AEA5	Paenibacillus_phage	51.8	5.1e-50
AWQ87488.1|1043074_1044160_-	hypothetical protein	NA	NA	NA	NA	NA
AWQ89389.1|1044515_1045994_+	amino acid carrier family protein	NA	NA	NA	NA	NA
AWQ88919.1|1046136_1046895_+	esterase family protein	NA	NA	NA	NA	NA
AWQ89801.1|1047060_1047786_+	hypothetical protein	NA	NA	NA	NA	NA
AWQ88273.1|1047787_1048639_+	hhH-GPD superbase excision DNA repair family protein	NA	NA	NA	NA	NA
AWQ89192.1|1049381_1049891_+	hypothetical protein	NA	NA	NA	NA	NA
AWQ90012.1|1050003_1050864_-	putative glycolipid permease LtaA	NA	NA	NA	NA	NA
AWQ89260.1|1050874_1051090_+	hypothetical protein	NA	NA	NA	NA	NA
AWQ89564.1|1051171_1052347_-	processive diacylglycerol glucosyltransferase	NA	NA	NA	NA	NA
AWQ88163.1|1052778_1054263_+	UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--L- lysine ligase	NA	NA	NA	NA	NA
AWQ89924.1|1054252_1054504_+	yueH-like family protein	NA	NA	NA	NA	NA
AWQ88119.1|1054503_1056066_+	peptide chain release factor 3	NA	A0A1S5SF82	Streptococcus_phage	28.2	2.2e-36
AWQ89698.1|1056373_1057171_+	integral membrane, YkoY family protein	NA	S5MAL1	Bacillus_phage	40.5	1.6e-30
AWQ88024.1|1057404_1059714_+	trypsin-like peptidase domain protein	NA	W5SAB9	Pithovirus	27.1	1.4e-10
AWQ88315.1|1059730_1061089_+	cation transport family protein	NA	NA	NA	NA	NA
1060820:1060840	attR	ATTTTAACATTTTTAGGAATG	NA	NA	NA	NA
AWQ88101.1|1061227_1062739_+	5'-nucleotidase, C-terminal domain protein	NA	NA	NA	NA	NA
AWQ89545.1|1063227_1063797_-	comK family protein	NA	NA	NA	NA	NA
AWQ88677.1|1064006_1064225_+	IDEAL domain protein	NA	NA	NA	NA	NA
AWQ87822.1|1064305_1065292_-	lipoyltransferase and lipoate-ligase family protein	NA	NA	NA	NA	NA
AWQ88721.1|1065490_1065667_+	hypothetical protein	NA	NA	NA	NA	NA
AWQ89405.1|1065681_1066284_+|protease	CAAX protease self-immunity family protein	protease	NA	NA	NA	NA
AWQ87427.1|1067627_1069592_+|bacteriocin	bacteriocin-associated integral membrane family protein	bacteriocin	NA	NA	NA	NA
>prophage 5
CP029653	Staphylococcus aureus strain AR_0470 chromosome, complete genome	2963657	1163505	1247848	2963657	portal,holin,tail,head,integrase,terminase,capsid,tRNA,transposase	Staphylococcus_phage(64.29%)	103	1158147:1158162	1242802:1242817
1158147:1158162	attL	AATTTGTTTGTTTTTA	NA	NA	NA	NA
AWQ88701.1|1163505_1163988_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	45.6	5.7e-28
AWQ89747.1|1164049_1165189_-	HIGH Nucleotidyl Transferase family protein	NA	NA	NA	NA	NA
AWQ89542.1|1165315_1165873_+	hypothetical protein	NA	NA	NA	NA	NA
AWQ87608.1|1165952_1166126_+	ribosomal protein L32	NA	NA	NA	NA	NA
AWQ88311.1|1166242_1167628_-	recombinase family protein	NA	I1W625	Staphylococcus_phage	100.0	2.5e-265
AWQ89085.1|1167834_1168515_-	pemK-like family protein	NA	A0A2H4PQQ5	Staphylococcus_phage	99.6	1.9e-122
AWQ89831.1|1168550_1169321_-	peptidase S24-like family protein	NA	A0A1X9H0P5	Staphylococcus_phage	96.5	1.2e-136
AWQ89949.1|1169725_1170169_+	hypothetical protein	NA	A0A0H3U2S6	Staphylococcus_phage	100.0	8.9e-76
AWQ87438.1|1170183_1170327_+	hypothetical protein	NA	Q4ZAL7	Staphylococcus_virus	100.0	1.9e-16
AWQ88786.1|1170316_1170526_-	hypothetical protein	NA	W5R9J5	Staphylococcus_phage	98.6	5.9e-30
AWQ88447.1|1170582_1171326_+	phage antirepressor KilAC domain protein	NA	S4SW96	Staphylococcus_phage	100.0	2.3e-137
AWQ88620.1|1171350_1171527_+	hypothetical protein	NA	Q4ZB00	Staphylococcus_virus	100.0	3.1e-24
AWQ88160.1|1171501_1171732_-	hypothetical protein	NA	C8CGY3	Staphylococcus_phage	100.0	2.3e-35
AWQ87925.1|1171781_1171919_+	hypothetical protein	NA	S4SX85	Staphylococcus_phage	100.0	3.2e-16
AWQ89616.1|1172166_1172427_+	hypothetical protein	NA	Q4ZDR5	Staphylococcus_virus	98.8	5.8e-43
AWQ88674.1|1172436_1172658_+	hypothetical protein	NA	A0A1X9H047	Staphylococcus_phage	100.0	1.2e-33
AWQ87560.1|1172650_1173439_+	AAA domain protein	NA	Q4ZBM5	Staphylococcus_phage	100.0	2.6e-142
AWQ88881.1|1173467_1174019_+	putative single-strand DNA-binding protein	NA	Q4ZBM4	Staphylococcus_phage	100.0	3.4e-101
AWQ87809.1|1174031_1174703_+	hypothetical protein	NA	W5R8I8	Staphylococcus_phage	100.0	5.2e-128
AWQ88083.1|1174809_1175658_-	hypothetical protein	NA	W5R9J9	Staphylococcus_phage	100.0	3.8e-160
AWQ88502.1|1175722_1176493_+	conserved phage family protein	NA	W5R8N2	Staphylococcus_phage	99.2	6.9e-116
AWQ89235.1|1176503_1177283_+	istB-like ATP binding family protein	NA	A0A1X9H042	Staphylococcus_phage	100.0	1.4e-145
AWQ87889.1|1177276_1177435_+	hypothetical protein	NA	Q4ZBL5	Staphylococcus_phage	96.2	9.9e-22
AWQ89927.1|1177447_1177669_+	hypothetical protein	NA	A0A1W6JQ35	Staphylococcus_phage	100.0	1.7e-35
AWQ89663.1|1177679_1178084_+	hypothetical protein	NA	A0A1W6JPX0	Staphylococcus_phage	100.0	3.6e-68
AWQ88797.1|1178088_1178274_+	hypothetical protein	NA	Q4ZAY3	Staphylococcus_virus	100.0	1.4e-27
AWQ87990.1|1178274_1178646_+	PVL ORF-50-like family protein	NA	Q4ZAY2	Staphylococcus_virus	99.2	2.2e-56
AWQ88434.1|1178646_1178895_+	phage family protein	NA	Q4ZAY1	Staphylococcus_virus	100.0	1.4e-41
AWQ87621.1|1178908_1179154_+	hypothetical protein	NA	Q8SDV5	Staphylococcus_phage	95.1	1.7e-36
AWQ89774.1|1179150_1179687_+	dUTPase family protein	NA	Q9MBR0	Staphylococcus_prophage	99.4	4.6e-95
AWQ88826.1|1179723_1179897_+	hypothetical protein	NA	A0A1W6JQ45	Staphylococcus_phage	98.2	1.1e-24
AWQ88557.1|1180030_1180159_+	hypothetical protein	NA	A0A2H4PQJ7	Staphylococcus_phage	100.0	1.2e-14
AWQ89333.1|1180155_1180362_+	hypothetical protein	NA	A0A2I6PEA2	Staphylococcus_phage	95.6	3.0e-18
AWQ89001.1|1180358_1180532_+	transcriptional activator RinB family protein	NA	A0A0H3U4U1	Staphylococcus_phage	98.2	1.4e-21
AWQ89956.1|1180532_1180679_+	hypothetical protein	NA	B2ZYX7	Staphylococcus_phage	97.9	3.7e-15
AWQ88299.1|1180702_1181125_+	phage transcriptional regulator, RinA family protein	NA	S4V7K2	Staphylococcus_phage	100.0	1.6e-74
AWQ89380.1|1181311_1181752_+|terminase	terminase small subunit	terminase	I1W650	Staphylococcus_phage	100.0	4.8e-74
AWQ89579.1|1181738_1183016_+|terminase	phage terminase, large subunit, PBSX family	terminase	A0EWS5	Staphylococcus_virus	100.0	3.0e-249
AWQ89652.1|1183026_1184565_+|portal	phage portal protein, SPP1 family	portal	S4V6D8	Staphylococcus_phage	99.0	1.9e-290
AWQ88290.1|1184571_1185564_+|head	phage head morphogenesis, SPP1 gp7 family domain protein	head	E0Y3K7	Staphylococcus_virus	97.2	3.2e-174
AWQ88927.1|1185649_1185823_+	hypothetical protein	NA	NA	NA	NA	NA
AWQ88819.1|1185954_1186569_+	hypothetical protein	NA	I1W646	Staphylococcus_phage	100.0	2.9e-40
AWQ87420.1|1186582_1187557_+|capsid	phage major capsid protein, HK97 family	capsid	Q8SDU5	Staphylococcus_phage	99.4	1.1e-182
AWQ89585.1|1187578_1187866_+	hypothetical protein	NA	S4V6D9	Staphylococcus_phage	100.0	4.7e-46
AWQ89787.1|1187874_1188207_+|head,tail	phage gp6-like head-tail connector family protein	head,tail	E0Y3L2	Staphylococcus_virus	100.0	7.1e-54
AWQ88488.1|1188203_1188506_+	hypothetical protein	NA	E0Y3L3	Staphylococcus_virus	96.0	2.8e-49
AWQ87390.1|1188505_1188853_+	hypothetical protein	NA	I1W643	Staphylococcus_phage	100.0	5.3e-60
AWQ87502.1|1188864_1189248_+	hypothetical protein	NA	E0Y3L5	Staphylococcus_virus	100.0	2.6e-68
AWQ89986.1|1189266_1189848_+|tail	phage major tail protein, TP901-1 family	tail	Q8SDU0	Staphylococcus_phage	100.0	4.9e-106
AWQ88081.1|1189910_1190276_+	phage family protein	NA	A0A0F6N4J9	Staphylococcus_phage	100.0	3.6e-59
AWQ88525.1|1190305_1190650_+	hypothetical protein	NA	A0A0F6N3F7	Staphylococcus_phage	100.0	2.5e-57
AWQ87595.1|1190666_1194131_+	putative membrane protein	NA	Q4ZDU6	Staphylococcus_virus	95.1	6.0e-268
AWQ87631.1|1194143_1195091_+|tail	phage tail family protein	tail	Q8SDT6	Staphylococcus_phage	99.7	6.1e-183
AWQ89666.1|1195099_1197001_+|tail	prophage endopeptidase tail family protein	tail	I1W634	Staphylococcus_phage	99.7	0.0e+00
AWQ87801.1|1197015_1198926_+	putative minor structural protein	NA	Q4ZDD6	Staphylococcus_virus	97.3	0.0e+00
AWQ88806.1|1198925_1200749_+	hypothetical protein	NA	W5R8J5	Staphylococcus_phage	99.0	1.3e-293
AWQ89720.1|1200748_1201126_+	hypothetical protein	NA	Q4ZDT8	Staphylococcus_virus	99.2	8.1e-54
AWQ87415.1|1201129_1201303_+	hypothetical protein	NA	A0A059T7K6	Staphylococcus_phage	100.0	1.3e-27
AWQ89350.1|1201343_1201643_+	hypothetical protein	NA	A0A0F6N3M6	Staphylococcus_phage	87.9	5.3e-40
AWQ88979.1|1201779_1203678_+	CHAP domain protein	NA	S4V9N2	Staphylococcus_phage	98.6	0.0e+00
AWQ88435.1|1203690_1204863_+	hypothetical protein	NA	A0EWN2	Staphylococcus_virus	99.2	2.7e-196
AWQ88389.1|1204868_1205264_+	hypothetical protein	NA	Q8SDS9	Staphylococcus_phage	100.0	1.6e-68
AWQ89030.1|1205319_1205757_+|holin	holin, phage phi LC3 family	holin	B2ZZ05	Staphylococcus_phage	98.6	5.9e-72
AWQ87740.1|1205737_1207183_+	CHAP domain protein	NA	Q4ZB16	Staphylococcus_virus	99.2	5.0e-293
AWQ88090.1|1207475_1208201_+	hypothetical protein	NA	NA	NA	NA	NA
AWQ88682.1|1208610_1210539_-	heme uptake protein IsdB	NA	NA	NA	NA	NA
AWQ88277.1|1210740_1211805_-	iron-regulated surface determinant protein A	NA	NA	NA	NA	NA
AWQ87435.1|1212013_1212697_+	heme uptake protein IsdC	NA	NA	NA	NA	NA
AWQ88508.1|1212696_1213773_+	putative iron-regulated protein	NA	NA	NA	NA	NA
AWQ88318.1|1213901_1214648_+	heme ABC transporter, heme-binding protein isdE	NA	NA	NA	NA	NA
AWQ88064.1|1214657_1215626_+	fecCD transport family protein	NA	NA	NA	NA	NA
AWQ89657.1|1215687_1216422_+	sortase, SrtB family	NA	NA	NA	NA	NA
AWQ88953.1|1216440_1216764_+	antibiotic biosynthesis monooxygenase family protein	NA	NA	NA	NA	NA
AWQ87634.1|1217147_1217888_+	RNA 2'-O ribose methyltransferase substrate binding family protein	NA	NA	NA	NA	NA
AWQ89463.1|1218268_1219327_+|tRNA	phenylalanine--tRNA ligase, alpha subunit	tRNA	A0A2I2L4E3	Orpheovirus	35.5	1.9e-31
AWQ87752.1|1219326_1221729_+|tRNA	phenylalanine--tRNA ligase, beta subunit	tRNA	NA	NA	NA	NA
AWQ88501.1|1222030_1222969_-	ribonuclease HIII	NA	NA	NA	NA	NA
AWQ89002.1|1223102_1223219_+	hypothetical protein	NA	NA	NA	NA	NA
AWQ89422.1|1223344_1223611_+	cell division ZapA family protein	NA	NA	NA	NA	NA
AWQ88203.1|1223611_1224133_+	colicin V production family protein	NA	NA	NA	NA	NA
AWQ88689.1|1224205_1225918_+	PHP domain protein	NA	A0A2H4UV14	Bodo_saltans_virus	24.3	1.8e-15
AWQ88680.1|1225927_1228276_+	mutS2 protein	NA	F2QAF8	Phaeocystis_pouchetii_virus	25.1	7.2e-15
AWQ87623.1|1228448_1228763_+	thioredoxin	NA	A0A1X9I9P5	Staphylococcus_phage	46.6	6.6e-25
AWQ90092.1|1229086_1230868_+	excinuclease ABC subunit C	NA	NA	NA	NA	NA
AWQ90022.1|1231191_1231806_+	succinate dehydrogenase, cytochrome b556 subunit	NA	NA	NA	NA	NA
AWQ89653.1|1231857_1233624_+	succinate dehydrogenase/fumarate reductase, flavoprotein subunit	NA	NA	NA	NA	NA
AWQ90017.1|1233623_1234439_+	succinate dehydrogenase and fumarate reductase iron-sulfur family protein	NA	NA	NA	NA	NA
AWQ89685.1|1234677_1235478_+	glutamate racemase	NA	NA	NA	NA	NA
AWQ89010.1|1235489_1236077_+	non-canonical purine NTP pyrophosphatase, RdgB/HAM1 family	NA	NA	NA	NA	NA
AWQ88704.1|1236069_1236573_+	phosphodiesterase, MJ0936 family protein	NA	NA	NA	NA	NA
AWQ88102.1|1237063_1237381_+	fibrinogen-binding protein	NA	NA	NA	NA	NA
AWQ87457.1|1237728_1238115_-	FPRL1 inhibitory protein	NA	NA	NA	NA	NA
AWQ89268.1|1238885_1239185_+	putative membrane protein	NA	NA	NA	NA	NA
AWQ89973.1|1239241_1240030_-|integrase	integrase core domain protein	integrase	A0A0C5AEA5	Paenibacillus_phage	51.8	5.1e-50
AWQ88125.1|1240053_1240782_-|transposase	transposase family protein	transposase	A0A0C5AJ29	Paenibacillus_phage	35.8	4.5e-24
AWQ90006.1|1241212_1241710_+	fibrinogen-binding protein	NA	NA	NA	NA	NA
AWQ89240.1|1241861_1242212_+	complement inhibitor	NA	A7TWS0	Staphylococcus_phage	50.0	4.2e-20
AWQ87699.1|1242460_1242646_-	hypothetical protein	NA	NA	NA	NA	NA
AWQ87709.1|1243255_1243489_-	hypothetical protein	NA	NA	NA	NA	NA
1242802:1242817	attR	AATTTGTTTGTTTTTA	NA	NA	NA	NA
AWQ89143.1|1243942_1244902_-	alpha-hemolysin	NA	A0A2H4PQH7	Staphylococcus_phage	30.6	1.9e-35
AWQ88459.1|1245569_1245716_+	putative membrane protein	NA	NA	NA	NA	NA
AWQ89827.1|1245699_1245900_+	hypothetical protein	NA	Q4ZBW5	Staphylococcus_virus	67.7	1.7e-18
AWQ88414.1|1246201_1247848_+|transposase	transposase DDE domain protein	transposase	A0ZS58	Staphylococcus_virus	99.6	1.8e-294
>prophage 6
CP029653	Staphylococcus aureus strain AR_0470 chromosome, complete genome	2963657	1416341	1426283	2963657	head,integrase,transposase	Staphylococcus_phage(60.0%)	18	1409710:1409727	1430096:1430113
1409710:1409727	attL	ATTCAATCATTAATATAT	NA	NA	NA	NA
AWQ89898.1|1416341_1416539_+	cro/C1-type HTH DNA-binding domain protein	NA	A0A1W6JNK0	Staphylococcus_phage	48.4	1.7e-10
AWQ88683.1|1417240_1417453_+	cro/C1-type HTH DNA-binding domain protein	NA	A0A1W6JNK0	Staphylococcus_phage	72.5	3.6e-19
AWQ88785.1|1417749_1417956_+	hypothetical protein	NA	A0A2H4PQT0	Staphylococcus_phage	56.7	1.9e-12
AWQ89930.1|1419160_1419346_+	hypothetical protein	NA	A0A0F6N3H3	Staphylococcus_phage	78.7	2.4e-19
AWQ88271.1|1419557_1420505_-|integrase	integrase core domain protein	integrase	Q9MBM9	Staphylococcus_prophage	99.7	1.6e-183
AWQ88456.1|1420931_1421348_+	hypothetical protein	NA	NA	NA	NA	NA
AWQ87481.1|1421779_1421986_-	istB-like ATP binding family protein	NA	A0A059NT77	Lactococcus_phage	58.1	4.5e-14
AWQ87774.1|1422251_1422455_-|transposase	putative transposase	transposase	NA	NA	NA	NA
AWQ87770.1|1422470_1422602_-|transposase	putative transposase	transposase	A0A059NT83	Lactococcus_phage	58.1	1.8e-08
AWQ89893.1|1422869_1423121_+	hypothetical protein	NA	NA	NA	NA	NA
AWQ88012.1|1423325_1423847_+	hypothetical protein	NA	A0A1J0MF61	Staphylococcus_phage	51.1	3.1e-43
AWQ88793.1|1423848_1424046_+	hypothetical protein	NA	NA	NA	NA	NA
AWQ90053.1|1424205_1424790_+	hypothetical protein	NA	NA	NA	NA	NA
AWQ88188.1|1425116_1425314_+	hypothetical protein	NA	A0A1J0MFV1	Staphylococcus_phage	61.5	2.3e-15
AWQ89465.1|1425363_1425477_+	hypothetical protein	NA	NA	NA	NA	NA
AWQ90034.1|1425458_1425632_+	hypothetical protein	NA	NA	NA	NA	NA
AWQ88648.1|1425642_1425837_+	hypothetical protein	NA	NA	NA	NA	NA
AWQ88656.1|1426049_1426283_+|head	putative phage head morphogenesis protein	head	Q4ZE35	Staphylococcus_virus	76.9	2.1e-12
1430096:1430113	attR	ATATATTAATGATTGAAT	NA	NA	NA	NA
>prophage 7
CP029653	Staphylococcus aureus strain AR_0470 chromosome, complete genome	2963657	1641750	1647801	2963657	integrase,transposase	Streptococcus_phage(100.0%)	6	1638758:1638771	1643853:1643866
1638758:1638771	attL	ATTCTACATCATTA	NA	NA	NA	NA
AWQ89597.1|1641750_1642968_-|integrase	phage integrase family protein	integrase	A0A1S5SEW7	Streptococcus_phage	100.0	3.7e-233
AWQ89212.1|1643049_1643253_-	hypothetical protein	NA	A0A1S5SF07	Streptococcus_phage	100.0	4.0e-31
AWQ89780.1|1643940_1644363_-	RNA polymerase sigma factor, sigma-70 family protein	NA	A0A1S5SEW0	Streptococcus_phage	100.0	2.5e-72
1643853:1643866	attR	TAATGATGTAGAAT	NA	NA	NA	NA
AWQ88097.1|1644867_1645221_+	helix-turn-helix family protein	NA	A0A1S5SFA6	Streptococcus_phage	100.0	1.3e-58
AWQ87966.1|1645880_1647131_+|transposase	transposase IS116/IS110/IS902 family protein	transposase	M1NSC9	Streptococcus_phage	59.4	2.0e-109
AWQ87701.1|1647363_1647801_-	replication family protein	NA	A0A286QS97	Streptococcus_phage	62.0	2.7e-08
>prophage 8
CP029653	Staphylococcus aureus strain AR_0470 chromosome, complete genome	2963657	1652018	1665726	2963657		Streptococcus_phage(100.0%)	12	NA	NA
AWQ89974.1|1652018_1653938_-	tetracycline resistance protein TetM from transposon TnFO1	NA	A0A1S5SF82	Streptococcus_phage	95.0	0.0e+00
AWQ88520.1|1654314_1655247_-	conjugative transposon TcpC family protein	NA	A0A1S5SF22	Streptococcus_phage	100.0	1.1e-171
AWQ88473.1|1655243_1656245_-	lysozyme-like family protein	NA	A0A1S5SEZ8	Streptococcus_phage	99.7	2.5e-190
AWQ90103.1|1656241_1658419_-	putative membrane protein	NA	A0A1S5SF30	Streptococcus_phage	85.4	5.3e-307
AWQ87932.1|1658421_1660869_-	AAA-like domain protein	NA	A0A1S5SF64	Streptococcus_phage	100.0	0.0e+00
AWQ89176.1|1660852_1661245_-	tcpE family protein	NA	A0A1S5SEX7	Streptococcus_phage	100.0	3.2e-69
AWQ87697.1|1661333_1661831_-	antirestriction family protein	NA	A0A1S5SF25	Streptococcus_phage	100.0	1.7e-91
AWQ89826.1|1661947_1662169_-	putative membrane protein	NA	A0A1S5SEY0	Streptococcus_phage	100.0	4.3e-31
AWQ89370.1|1662211_1663417_-	helix-turn-helix family protein	NA	A0A1S5SEX3	Streptococcus_phage	100.0	2.8e-233
AWQ88340.1|1663595_1664981_-	ftsK/SpoIIIE family protein	NA	A0A1S5SFB5	Streptococcus_phage	100.0	1.1e-265
AWQ89873.1|1665009_1665393_-	hypothetical protein	NA	A0A1S5SF96	Streptococcus_phage	100.0	2.3e-64
AWQ89790.1|1665411_1665726_-	hypothetical protein	NA	A0A1S5SF38	Streptococcus_phage	100.0	5.2e-54
>prophage 9
CP029653	Staphylococcus aureus strain AR_0470 chromosome, complete genome	2963657	1743608	1751920	2963657		Staphylococcus_phage(16.67%)	7	NA	NA
AWQ87367.1|1743608_1744394_-	ABC transporter family protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.3	8.0e-19
AWQ87814.1|1744519_1745410_-	putative endonuclease 4	NA	A0A2H4UU70	Bodo_saltans_virus	33.1	2.0e-26
AWQ88058.1|1745419_1746766_-	DEAD/DEAH box helicase family protein	NA	A0A1V0SIR5	Klosneuvirus	34.0	1.4e-55
AWQ89517.1|1746879_1747980_-	NIF3 family protein	NA	A0A1S5V250	Saudi_moumouvirus	30.6	3.0e-08
AWQ87538.1|1747982_1748660_-	hypothetical protein	NA	NA	NA	NA	NA
AWQ88441.1|1748790_1749897_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	38.1	1.1e-37
AWQ88841.1|1750120_1751920_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	36.0	3.5e-54
>prophage 10
CP029653	Staphylococcus aureus strain AR_0470 chromosome, complete genome	2963657	1834526	1843569	2963657	tRNA	uncultured_Mediterranean_phage(50.0%)	7	NA	NA
AWQ87724.1|1834526_1835045_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	46.5	5.6e-29
AWQ88009.1|1835066_1837340_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	29.3	6.2e-64
AWQ89499.1|1837542_1839822_-	protein-export membrane protein SecD	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	35.8	1.8e-31
AWQ89636.1|1840096_1840357_-	preprotein translocase, YajC subunit	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	35.3	8.2e-05
AWQ89667.1|1840375_1841515_-|tRNA	queuine tRNA-ribosyltransferase	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	44.7	5.4e-85
AWQ88864.1|1841537_1842563_-|tRNA	tRNA ribosyltransferase-isomerase	tRNA	NA	NA	NA	NA
AWQ89354.1|1842552_1843569_-	holliday junction DNA helicase RuvB	NA	B3GAM6	uncultured_virus	29.1	1.7e-05
>prophage 11
CP029653	Staphylococcus aureus strain AR_0470 chromosome, complete genome	2963657	1973433	2042361	2963657	protease,tRNA	Staphylococcus_phage(93.18%)	65	NA	NA
AWQ87443.1|1973433_1980003_-	sasC/Mrp/FmtB intercellular aggregation domain protein	NA	A0A2H4PQU6	Staphylococcus_phage	88.6	6.4e-295
AWQ88346.1|1980326_1980638_-	rhodanese-like domain protein	NA	A0A2H4PQR9	Staphylococcus_phage	96.1	4.5e-50
AWQ89990.1|1980659_1983074_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	98.8	0.0e+00
AWQ88147.1|1983365_1984508_-	major Facilitator Superfamily protein	NA	A0A2H4PQR6	Staphylococcus_phage	99.7	3.5e-209
AWQ89947.1|1984656_1985610_+	radical SAM superfamily protein	NA	A0A2H4PQV5	Staphylococcus_phage	99.3	6.4e-79
AWQ89065.1|1985606_1986170_+	rRNA methylase family protein	NA	A0A2H4PQV0	Staphylococcus_phage	95.7	1.1e-99
AWQ88548.1|1986288_1986690_-	HTH-type transcriptional regulator rot	NA	NA	NA	NA	NA
AWQ87758.1|1987262_1988090_-	alpha/beta hydrolase family protein	NA	NA	NA	NA	NA
AWQ87856.1|1988323_1989325_+	proline dehydrogenase family protein	NA	A0A2H4PQT6	Staphylococcus_phage	99.1	5.0e-183
AWQ89281.1|1989446_1989911_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	98.1	4.9e-69
AWQ88214.1|1989923_1991105_-	riboflavin biosynthesis protein RibBA	NA	A0A2H4PQS2	Staphylococcus_phage	99.7	6.6e-227
AWQ87721.1|1991115_1991748_-	riboflavin synthase, alpha subunit	NA	A0A2H4PQS5	Staphylococcus_phage	99.0	8.4e-112
AWQ89118.1|1991754_1992798_-	riboflavin biosynthesis protein RibD	NA	A0A2H4PQS8	Staphylococcus_phage	98.3	5.9e-195
AWQ87374.1|1993278_1994781_-	FAD-NAD(P)-binding family protein	NA	A0A2H4PQX2	Staphylococcus_phage	98.6	5.0e-30
AWQ87811.1|1995737_1997030_+	arsenite/antimonite efflux pump membrane family protein	NA	A0A2H4PQU3	Staphylococcus_phage	94.7	2.9e-215
AWQ88269.1|1997116_1997971_-	mannosyl-glycoendo-beta-N-acetylglucosaminidase family protein	NA	Q4ZCC7	Staphylococcus_virus	38.6	9.8e-39
AWQ88131.1|1998246_1998471_-	hypothetical protein	NA	NA	NA	NA	NA
AWQ87991.1|1998669_1999140_+	RNA polymerase sigma factor SigS	NA	A0A2H4PQT5	Staphylococcus_phage	85.8	7.7e-70
AWQ89486.1|1999456_1999696_+	comK family protein	NA	NA	NA	NA	NA
AWQ89765.1|1999682_2000126_-	putative membrane protein	NA	A0A2H4PQT8	Staphylococcus_phage	77.4	2.4e-49
AWQ88121.1|2000423_2001059_+|protease	CAAX protease self-immunity family protein	protease	NA	NA	NA	NA
AWQ89233.1|2001225_2001846_+|protease	CAAX protease self-immunity family protein	protease	NA	NA	NA	NA
AWQ87433.1|2002303_2003017_-	transaldolase	NA	M1PR54	Cyanophage	35.3	5.5e-19
AWQ88391.1|2003428_2003578_+	putative membrane protein	NA	NA	NA	NA	NA
AWQ87751.1|2003832_2004198_+	crcB-like family protein	NA	A0A2H4PQR0	Staphylococcus_phage	100.0	3.6e-59
AWQ89740.1|2004194_2004548_+	crcB-like family protein	NA	A0A2H4PQQ7	Staphylococcus_phage	97.4	4.2e-20
AWQ88876.1|2004797_2005631_-	aldo/keto reductase family protein	NA	A0A2H4PQR8	Staphylococcus_phage	99.3	7.8e-158
AWQ89707.1|2005842_2006751_-	nuclease-related domain protein	NA	A0A2H4PQQ8	Staphylococcus_phage	99.7	9.8e-138
AWQ88776.1|2006875_2008069_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	99.5	4.3e-218
AWQ88914.1|2008440_2010033_+	phosphoenolpyruvate carboxykinase	NA	A0A2H4PQN1	Staphylococcus_phage	99.8	0.0e+00
AWQ88696.1|2010325_2011096_-	prolyl oligopeptidase family protein	NA	A0A2H4PQM6	Staphylococcus_phage	97.2	3.4e-139
AWQ88621.1|2011076_2011556_-	nucleoside triphosphatase YtkD	NA	A0A2H4PQM4	Staphylococcus_phage	98.7	3.0e-85
AWQ89317.1|2011615_2011873_+	putative membrane protein insertion efficiency factor	NA	A0A2H4PQM5	Staphylococcus_phage	100.0	7.2e-46
AWQ88625.1|2011869_2012871_-	o-succinylbenzoate synthase	NA	A0A2H4PQM0	Staphylococcus_phage	96.7	8.5e-183
AWQ88988.1|2012875_2014354_-	O-succinylbenzoate-CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	97.2	2.4e-282
AWQ88821.1|2014512_2014995_-	hypothetical protein	NA	A0A2H4PQN7	Staphylococcus_phage	94.5	2.8e-75
AWQ88912.1|2015306_2015921_+	excalibur calcium-binding domain protein	NA	A0A2H4PQM8	Staphylococcus_phage	87.3	3.6e-43
AWQ89329.1|2016001_2017018_+	hypothetical protein	NA	A0A2H4PQN2	Staphylococcus_phage	97.2	6.6e-74
AWQ88486.1|2017093_2017720_+	putative lipoprotein	NA	A0A2H4PQM7	Staphylococcus_phage	84.1	4.5e-81
AWQ88651.1|2017760_2018105_+	hypothetical protein	NA	A0A2H4PQN6	Staphylococcus_phage	94.7	5.1e-55
AWQ89805.1|2018202_2018775_+	hypothetical protein	NA	A0A2H4PQN4	Staphylococcus_phage	94.8	3.2e-25
AWQ89297.1|2018923_2020291_-	FRG domain protein	NA	NA	NA	NA	NA
AWQ89229.1|2020290_2020860_-	hypothetical protein	NA	A0A2H4PQN8	Staphylococcus_phage	54.8	2.2e-39
AWQ88498.1|2021052_2021499_-	hypothetical protein	NA	NA	NA	NA	NA
AWQ88348.1|2022442_2022886_-	hypothetical protein	NA	NA	NA	NA	NA
AWQ88574.1|2022885_2023329_-	hypothetical protein	NA	NA	NA	NA	NA
AWQ90093.1|2023328_2023583_-	hypothetical protein	NA	NA	NA	NA	NA
AWQ88523.1|2023651_2023771_-	hypothetical protein	NA	NA	NA	NA	NA
AWQ89103.1|2024295_2026716_+	polysaccharide lyase family 8, N terminal alpha-helical domain protein	NA	NA	NA	NA	NA
AWQ89054.1|2026841_2027219_-	hypothetical protein	NA	NA	NA	NA	NA
AWQ89023.1|2027428_2027806_-	hypothetical protein	NA	NA	NA	NA	NA
AWQ89958.1|2027959_2029531_+	hypothetical protein	NA	NA	NA	NA	NA
AWQ87429.1|2029545_2029845_+	virulence factor EsxB family protein	NA	NA	NA	NA	NA
AWQ88932.1|2030106_2031924_-	AAA domain protein	NA	NA	NA	NA	NA
AWQ89644.1|2031960_2033115_-	type I restriction modification DNA specificity domain protein	NA	A0A2H4PQP5	Staphylococcus_phage	36.3	7.8e-39
AWQ88175.1|2033107_2034664_-	type I restriction-modification system, M subunit	NA	A0A2H4PQP4	Staphylococcus_phage	98.6	2.2e-286
AWQ89419.1|2035026_2035746_-|protease	serine protease SplF	protease	A0A2H4PQP1	Staphylococcus_phage	98.3	1.0e-129
AWQ90007.1|2035915_2036632_-|protease	serine protease SplF	protease	A0A2H4PQN5	Staphylococcus_phage	97.1	6.6e-129
AWQ89185.1|2036795_2037512_-|protease	serine protease SplB	protease	A0A2H4PQN5	Staphylococcus_phage	64.7	2.4e-86
AWQ88514.1|2037678_2038395_-|protease	serine protease SplF	protease	A0A2H4PQN5	Staphylococcus_phage	62.6	5.5e-83
AWQ89723.1|2038518_2039238_-|protease	serine protease SplC	protease	A0A2H4PQP7	Staphylococcus_phage	93.7	6.4e-124
AWQ87589.1|2039295_2039445_-|protease	serine protease SplB domain protein	protease	A0A2H4PQN0	Staphylococcus_phage	97.7	5.3e-17
AWQ89288.1|2040037_2040154_+	hypothetical protein	NA	NA	NA	NA	NA
AWQ89335.1|2040252_2040768_+	hypothetical protein	NA	NA	NA	NA	NA
AWQ87825.1|2041014_2042361_+	hypothetical protein	NA	M1NRY5	Streptococcus_phage	51.3	6.7e-66
>prophage 12
CP029653	Staphylococcus aureus strain AR_0470 chromosome, complete genome	2963657	2161692	2236875	2963657	portal,holin,tail,protease,head,integrase,capsid,transposase	Staphylococcus_phage(91.78%)	94	2201814:2201831	2226640:2226657
AWQ88972.1|2161692_2163372_-|transposase	transposase DDE domain protein	transposase	A0ZS58	Staphylococcus_virus	77.1	1.8e-238
AWQ89695.1|2163860_2164271_+	yolD-like family protein	NA	U3PG23	Staphylococcus_phage	54.2	1.4e-30
AWQ88006.1|2164299_2164665_-	putative cTP synthase	NA	NA	NA	NA	NA
AWQ87823.1|2164673_2166737_-|integrase	phage integrase family protein	integrase	NA	NA	NA	NA
AWQ89829.1|2166739_2167852_-|integrase	phage integrase family protein	integrase	P97010	Streptococcus_pyogenes_phage	30.5	9.6e-10
AWQ87391.1|2168129_2168342_+	yolD-like family protein	NA	NA	NA	NA	NA
AWQ87681.1|2168398_2168572_-	hypothetical protein	NA	NA	NA	NA	NA
AWQ88710.1|2169022_2170063_+	6-aminopenicillanic acid acyl-transferase family protein	NA	NA	NA	NA	NA
AWQ87365.1|2170119_2170962_-	hypothetical protein	NA	NA	NA	NA	NA
AWQ89985.1|2170958_2171516_-	hypothetical protein	NA	NA	NA	NA	NA
AWQ89356.1|2171575_2172100_-	hypothetical protein	NA	NA	NA	NA	NA
AWQ87711.1|2172220_2172784_+	putative thioredoxin	NA	NA	NA	NA	NA
AWQ89374.1|2172847_2173588_-	ABC-2 transporter family protein	NA	NA	NA	NA	NA
AWQ88046.1|2173587_2174460_-	ABC transporter family protein	NA	A0A2H4PQG7	Staphylococcus_phage	35.2	6.1e-28
AWQ88142.1|2174456_2175137_-	ABC-2 transporter family protein	NA	NA	NA	NA	NA
AWQ88584.1|2175137_2176034_-	AAA domain protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.2	1.1e-16
AWQ88022.1|2176030_2176411_-	bacterial regulatory, gntR family protein	NA	NA	NA	NA	NA
AWQ88136.1|2176668_2176845_-	putative membrane protein	NA	NA	NA	NA	NA
AWQ87605.1|2177384_2178671_+	aminotransferase class I and II family protein	NA	NA	NA	NA	NA
AWQ89287.1|2178941_2180681_-	protein map	NA	NA	NA	NA	NA
AWQ89110.1|2181066_2181267_+	phospholipase C domain protein	NA	A0A1P8L6A7	Staphylococcus_phage	95.4	3.8e-26
AWQ89485.1|2182197_2182389_+	putative membrane protein	NA	M9NS66	Staphylococcus_phage	100.0	1.7e-23
AWQ87959.1|2182441_2182792_-	complement inhibitor	NA	A7TWS0	Staphylococcus_phage	100.0	7.5e-54
AWQ89201.1|2183474_2183924_+	chemotaxis inhibitory protein	NA	A0A075LZI2	Staphylococcus_phage	100.0	8.7e-79
AWQ89913.1|2184018_2184225_-	bacterial SH3 domain protein	NA	A0A2I6PF47	Staphylococcus_phage	97.1	2.1e-32
AWQ89066.1|2185003_2185495_-	staphylokinase	NA	A0A075LYD3	Staphylococcus_phage	100.0	8.0e-86
AWQ89074.1|2185685_2186441_-	CHAP domain protein	NA	A0A075LZV3	Staphylococcus_phage	100.0	1.2e-152
AWQ88567.1|2186452_2186707_-|holin	holin, phage phi LC3 family	holin	D2JLG4	Staphylococcus_phage	100.0	4.1e-41
AWQ89127.1|2186918_2187053_-	putative membrane protein	NA	D2JLG3	Staphylococcus_phage	100.0	9.3e-13
AWQ90036.1|2187297_2188080_-	enterotoxin type E	NA	A0A075M4C7	Staphylococcus_phage	99.6	1.6e-149
AWQ88946.1|2188491_2188866_-	putative membrane protein	NA	G4KNR3	Staphylococcus_phage	100.0	3.3e-39
AWQ89820.1|2188921_2189209_-	hypothetical protein	NA	A0A1X9H0N7	Staphylococcus_phage	100.0	7.6e-44
AWQ87559.1|2189254_2189407_-	putative phage protein	NA	A0A1W6JPL6	Staphylococcus_phage	100.0	7.6e-19
AWQ88802.1|2189399_2193182_-	phage minor structural, N-terminal region domain protein	NA	A0A068A201	Staphylococcus_phage	99.8	0.0e+00
AWQ88529.1|2193197_2194682_-|tail	phage tail family protein	tail	A0A2I6PDJ0	Staphylococcus_phage	100.0	1.2e-297
AWQ87447.1|2194678_2199208_-|tail	phage tail tape measure protein, TP901 family, core region	tail	A0A2I6PDK2	Staphylococcus_phage	99.3	0.0e+00
AWQ89858.1|2199264_2199402_-	hypothetical protein	NA	A0A2I6PDX7	Staphylococcus_phage	100.0	3.4e-18
AWQ88291.1|2199452_2199803_-	hypothetical protein	NA	G4KNQ8	Staphylococcus_phage	100.0	7.8e-59
AWQ89859.1|2199852_2199993_-	bacterial Ig-like domain family protein	NA	A0A2I6PDK6	Staphylococcus_phage	100.0	2.5e-16
AWQ89306.1|2200118_2200763_-|tail	phage major tail, phi13 family protein	tail	G4KNQ7	Staphylococcus_phage	100.0	6.5e-120
AWQ87995.1|2200763_2201171_-	hypothetical protein	NA	G4KNQ6	Staphylococcus_phage	100.0	7.1e-72
AWQ89933.1|2201167_2201572_-	hypothetical protein	NA	G4KNQ5	Staphylococcus_phage	100.0	4.3e-69
AWQ89713.1|2201568_2201931_-|head,tail	phage head-tail joining family protein	head,tail	G4KNQ4	Staphylococcus_phage	100.0	4.4e-65
2201814:2201831	attL	ATAATTTTTCTTCTTTTT	NA	NA	NA	NA
AWQ88835.1|2201914_2202199_-|head,tail	phage gp6-like head-tail connector family protein	head,tail	A0A2I6PDJ5	Staphylococcus_phage	100.0	2.3e-45
AWQ88532.1|2202188_2202473_-	hypothetical protein	NA	A0A2I6PDJ3	Staphylococcus_phage	100.0	1.8e-45
AWQ87742.1|2202492_2203638_-|capsid	phage major capsid protein, HK97 family	capsid	G4KNQ3	Staphylococcus_phage	99.7	3.6e-214
AWQ87723.1|2203661_2204399_-|protease	clp protease family protein	protease	G4KNQ2	Staphylococcus_phage	100.0	1.8e-129
AWQ89377.1|2204382_2205570_-|portal	phage portal protein, HK97 family	portal	A0A2I6PDI1	Staphylococcus_phage	100.0	1.0e-219
AWQ89420.1|2205585_2207247_-	phage Terminase family protein	NA	A0A2I6PDJ8	Staphylococcus_phage	100.0	0.0e+00
AWQ88354.1|2207243_2207588_-	hypothetical protein	NA	G4KNP9	Staphylococcus_phage	100.0	9.4e-57
AWQ89809.1|2207717_2208017_-	HNH endonuclease family protein	NA	A0A2I6PDH9	Staphylococcus_phage	100.0	3.5e-52
AWQ89455.1|2208248_2208665_-	phage transcriptional regulator, RinA family protein	NA	G4KNP7	Staphylococcus_phage	100.0	1.3e-76
AWQ89472.1|2208692_2208893_-	hypothetical protein	NA	D2JLD9	Staphylococcus_phage	98.5	5.3e-28
AWQ90013.1|2208892_2209042_-	transcriptional activator RinB family protein	NA	A0A1W6JPZ2	Staphylococcus_phage	100.0	4.8e-18
AWQ87799.1|2209038_2209245_-	hypothetical protein	NA	A0A2I6PEA2	Staphylococcus_phage	94.1	1.1e-17
AWQ88711.1|2209241_2209376_-	hypothetical protein	NA	A0A2H4PQJ7	Staphylococcus_phage	97.7	9.9e-15
AWQ88208.1|2209523_2210060_-	dUTPase family protein	NA	Q9MBR0	Staphylococcus_prophage	100.0	1.6e-95
AWQ88663.1|2210056_2210302_-	hypothetical protein	NA	Q8SDV5	Staphylococcus_phage	95.1	1.7e-36
AWQ87512.1|2210316_2210559_-	phage family protein	NA	Q4ZDP7	Staphylococcus_virus	97.5	1.2e-39
AWQ89436.1|2210561_2210819_-	hypothetical protein	NA	A0A1X9H067	Staphylococcus_phage	98.8	6.3e-42
AWQ89999.1|2210818_2211190_-	PVL ORF-50-like family protein	NA	A0A2I6PDG3	Staphylococcus_phage	91.1	1.4e-50
AWQ89133.1|2211202_2211607_-	endodeoxyribonuclease RusA family protein	NA	A0A075M042	Staphylococcus_phage	100.0	8.4e-73
AWQ89578.1|2211615_2211834_-	hypothetical protein	NA	A0A1P8L6E4	Staphylococcus_phage	98.6	8.9e-37
AWQ88774.1|2211840_2212074_-	initiator Replication family protein	NA	A0A2I6PDG7	Staphylococcus_phage	98.7	4.0e-35
AWQ88868.1|2212300_2212465_-	replication initiation and membrane attachment protein, DnaB/DnaD family	NA	A0A2I6PDG7	Staphylococcus_phage	100.0	1.3e-13
AWQ88583.1|2212752_2213223_-	single-stranded DNA-binding family protein	NA	A0A1P8L6D9	Staphylococcus_phage	100.0	5.7e-81
AWQ89153.1|2213223_2213709_-	beta-lactamase superfamily domain protein	NA	A0A1P8L6F7	Staphylococcus_phage	100.0	9.4e-87
AWQ89835.1|2213921_2214842_-	recT family protein	NA	A0A1P8L6F6	Staphylococcus_phage	100.0	5.1e-166
AWQ88381.1|2214843_2216787_-	hypothetical protein	NA	A0A1P8L6F1	Staphylococcus_phage	99.7	0.0e+00
AWQ89016.1|2217067_2217328_-	hypothetical protein	NA	A0A1P8L6F5	Staphylococcus_phage	100.0	5.2e-44
AWQ89175.1|2217332_2217635_-	hypothetical protein	NA	A0A1P8L6F8	Staphylococcus_phage	100.0	7.0e-48
AWQ88251.1|2217887_2218211_-	hypothetical protein	NA	A0A075LYF5	Staphylococcus_phage	100.0	3.0e-57
AWQ88579.1|2218265_2218646_+	hypothetical protein	NA	Q9T1Z5	Staphylococcus_phage	100.0	1.2e-68
AWQ88481.1|2218632_2218830_-	putative phi PVL orf 35-like protein	NA	O80075	Staphylococcus_phage	100.0	2.5e-30
AWQ88668.1|2218845_2219598_-	phage antirepressor KilAC domain protein	NA	M9NTH5	Staphylococcus_phage	100.0	1.1e-139
AWQ90125.1|2219648_2219978_+	hypothetical protein	NA	M9NS98	Staphylococcus_phage	98.2	5.1e-52
AWQ89552.1|2220197_2220461_-	helix-turn-helix family protein	NA	A0A2I6PF09	Staphylococcus_phage	100.0	7.2e-41
AWQ87446.1|2220594_2221308_+	peptidase S24-like family protein	NA	M9NUL0	Staphylococcus_phage	100.0	1.2e-130
AWQ89087.1|2221323_2222256_+	exonuclease family protein	NA	A0A2I6PEZ7	Staphylococcus_phage	100.0	5.7e-173
AWQ87558.1|2222261_2222603_+	hypothetical protein	NA	A0A2I6PF04	Staphylococcus_phage	100.0	4.6e-56
AWQ89351.1|2222806_2222989_+	hypothetical protein	NA	A0A2I6PDF8	Staphylococcus_phage	100.0	6.9e-27
AWQ87361.1|2223088_2224072_+	glycosyl transferase 2 family protein	NA	NA	NA	NA	NA
AWQ87815.1|2224082_2224325_+	hypothetical protein	NA	NA	NA	NA	NA
AWQ87796.1|2224387_2225425_+|integrase	integrase	integrase	Q38086	Staphylococcus_phage	98.3	6.7e-175
AWQ88304.1|2225481_2226306_+	sphingomyelin phosphodiesterase	NA	A0A1P8L6H7	Staphylococcus_phage	99.6	9.8e-161
AWQ88661.1|2226562_2227582_-	leucotoxin LukDv	NA	A0A2I6PEU3	Staphylococcus_phage	39.6	3.4e-54
2226640:2226657	attR	ATAATTTTTCTTCTTTTT	NA	NA	NA	NA
AWQ87395.1|2227603_2228659_-	hypothetical protein	NA	A0A2I6PER8	Staphylococcus_phage	34.6	7.9e-38
AWQ87843.1|2229090_2229774_+	putative succinyl-diaminopimelate desuccinylase	NA	NA	NA	NA	NA
AWQ88503.1|2229785_2230313_+	peptidase dimerization domain protein	NA	NA	NA	NA	NA
AWQ88705.1|2230751_2232059_+	ktr system potassium uptake protein B	NA	NA	NA	NA	NA
AWQ88870.1|2232636_2232978_-	putative phage-like protein	NA	C8CH40	Staphylococcus_phage	46.0	4.1e-20
AWQ88286.1|2233980_2235597_-	chaperonin GroL	NA	A0A240F779	uncultured_virus	54.7	2.6e-157
AWQ88140.1|2235672_2235957_-	10 kDa chaperonin	NA	A0A221S386	uncultured_virus	46.2	4.7e-14
AWQ89418.1|2236131_2236875_+|protease	CAAX protease self-immunity family protein	protease	NA	NA	NA	NA
