The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP029660	Pseudomonas aeruginosa strain AR_0446 chromosome, complete genome	6475581	1305628	1398229	6475581	transposase,protease,integrase,capsid,tRNA,tail	Pseudomonas_phage(28.95%)	92	1300977:1300992	1398321:1398336
1300977:1300992	attL	TGGCCGGCAGGTCGGC	NA	NA	NA	NA
AWQ86798.1|1305628_1306708_-|tRNA	tRNA (5-methylaminomethyl-2-thiouridylate)-methyltransferase	tRNA	NA	NA	NA	NA
AWQ85433.1|1306799_1307270_-	NUDIX domain protein	NA	NA	NA	NA	NA
AWQ82422.1|1307356_1309582_-	isocitrate dehydrogenase, NADP-dependent	NA	NA	NA	NA	NA
AWQ85613.1|1309940_1311197_+	isocitrate dehydrogenase, NADP-dependent	NA	Q77Z09	Phage_21	81.5	3.1e-17
AWQ83179.1|1311269_1311545_-	cold shock domain protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	58.8	1.4e-15
AWQ83542.1|1311902_1312139_+|protease	ATP-dependent Clp protease adaptor ClpS family protein	protease	A0A1B1IT64	uncultured_Mediterranean_phage	42.1	4.5e-10
AWQ86363.1|1312166_1314443_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.8	3.4e-163
AWQ87027.1|1314524_1314743_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
AWQ81176.1|1314847_1315555_-|tRNA	putative arginine-tRNA-transferase	tRNA	NA	NA	NA	NA
AWQ86128.1|1315609_1316290_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
AWQ82110.1|1316327_1317278_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	42.7	2.0e-61
AWQ82768.1|1317452_1317575_-	putative cell division protein FtsK	NA	NA	NA	NA	NA
AWQ83829.1|1317527_1319942_+	DNA translocase FtsK	NA	G1D482	Mycobacterium_virus	52.8	1.9e-87
AWQ83626.1|1319967_1320594_+	outer membrane lipocarrier protein LolA	NA	NA	NA	NA	NA
AWQ83936.1|1320678_1321929_+	ATPase associated with various cellular activities family protein	NA	G3MBE0	Bacillus_virus	38.7	1.9e-75
AWQ86926.1|1322050_1323331_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	45.4	8.2e-98
AWQ81560.1|1323332_1324730_+	uroporphyrinogen-III C-methyltransferase	NA	NA	NA	NA	NA
AWQ83339.1|1324734_1325709_-	glutathione S-transferase, N-terminal domain protein	NA	NA	NA	NA	NA
AWQ82241.1|1325796_1326780_-	glycosyl transferase family, helical bundle domain protein	NA	A0A2H4JBY5	uncultured_Caudovirales_phage	74.0	9.3e-142
AWQ86720.1|1326776_1327112_-	sulfur relay, TusE/DsrC/DsvC family protein	NA	A0A2H4J8B6	uncultured_Caudovirales_phage	69.4	3.3e-38
AWQ82100.1|1327108_1327414_-	sulfur relay protein TusB/DsrH	NA	NA	NA	NA	NA
AWQ86992.1|1327413_1327773_-	sulfur relay protein TusC/DsrF	NA	A0A2H4J8C0	uncultured_Caudovirales_phage	61.7	1.4e-34
AWQ86292.1|1327769_1328165_-	dsrE/DsrF-like family protein	NA	A0A2H4JA39	uncultured_Caudovirales_phage	71.3	1.0e-46
AWQ84066.1|1328275_1328944_-	inhibitor of apoptosis-promoting Bax1 family protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	82.1	1.9e-90
AWQ85243.1|1329279_1329873_-|integrase	phage integrase family protein	integrase	A0A2H4JDJ8	uncultured_Caudovirales_phage	67.7	2.7e-67
AWQ81214.1|1331067_1331487_-	hypothetical protein	NA	A0A0K2FKP4	Mycobacterium_phage	51.3	3.3e-32
AWQ86607.1|1332359_1332605_-	putative transcriptional regulator domain protein	NA	H2BD63	Pseudomonas_phage	96.3	7.4e-40
AWQ86672.1|1333224_1333365_+	hypothetical protein	NA	NA	NA	NA	NA
AWQ82539.1|1333491_1333674_+	hypothetical protein	NA	NA	NA	NA	NA
AWQ87332.1|1333696_1333876_-	putative mRNA interferase HicA	NA	A0A2H4JDU5	uncultured_Caudovirales_phage	55.0	2.4e-08
AWQ82813.1|1334095_1334452_+|tail	putative tail length tape measure protein	tail	NA	NA	NA	NA
AWQ86425.1|1334448_1334766_+|tail	putative tail component domain protein	tail	A0A2H4J9A1	uncultured_Caudovirales_phage	62.4	6.2e-23
AWQ82801.1|1334762_1335686_+|tail	phage tail tape measure protein, lambda family	tail	A0A0S2SYD9	Pseudomonas_phage	70.3	5.4e-91
AWQ86782.1|1335691_1336030_+|tail	phage minor tail family protein	tail	A0A0S2SYI2	Pseudomonas_phage	96.4	2.2e-58
AWQ86486.1|1335987_1336128_-	hypothetical protein	NA	NA	NA	NA	NA
AWQ83469.1|1336130_1336256_-	hypothetical protein	NA	NA	NA	NA	NA
AWQ85797.1|1336463_1336772_+|tail	phage minor tail protein L	tail	A0A0S2SY57	Pseudomonas_phage	98.0	7.6e-58
AWQ84804.1|1336774_1337530_+	hypothetical protein	NA	A0A0S2SY75	Pseudomonas_phage	96.8	1.5e-144
AWQ82943.1|1337555_1337804_+	hypothetical protein	NA	A0A0S2SYE8	Pseudomonas_phage	95.1	3.5e-37
AWQ81437.1|1337826_1338606_-	P63C domain protein	NA	Q8HA04	Enterobacteria_phage	65.9	2.3e-71
AWQ85459.1|1338618_1338732_+	hypothetical protein	NA	NA	NA	NA	NA
AWQ83761.1|1339517_1340543_+|transposase	transposase IS116/IS110/IS902 family protein	transposase	NA	NA	NA	NA
AWQ82198.1|1341591_1341738_+	ribbon-helix-helix, copG family protein	NA	NA	NA	NA	NA
AWQ81295.1|1341739_1342750_+	hypothetical protein	NA	Q8VNP5	Enterobacteria_phage	60.3	4.0e-31
AWQ84683.1|1343977_1344160_+|tail	putative phage tail assembly protein	tail	A0A0S2SYS2	Pseudomonas_phage	100.0	1.2e-26
AWQ86461.1|1345228_1346611_+	reverse transcriptase family protein	NA	H7BVN7	unidentified_phage	28.1	1.1e-20
AWQ86514.1|1346694_1348080_+|tail	phage tail family protein	tail	A0A0S2SYC5	Pseudomonas_phage	98.6	6.9e-260
AWQ85363.1|1348307_1350140_+	carbohydrate binding domain protein	NA	A0A0S2SYC5	Pseudomonas_phage	98.5	0.0e+00
AWQ87346.1|1351928_1352231_+	hypothetical protein	NA	A0A0S2SY61	Pseudomonas_phage	93.0	8.5e-46
AWQ84558.1|1352227_1352467_+	hypothetical protein	NA	A0A1B0YZV9	Pseudomonas_phage	89.9	1.1e-32
AWQ86035.1|1352529_1354173_-	D-glucuronyl C5-epimerase family protein	NA	NA	NA	NA	NA
AWQ84369.1|1354226_1354340_+	hypothetical protein	NA	NA	NA	NA	NA
AWQ81776.1|1354525_1355347_-|integrase	integrase core domain protein	integrase	Q716C2	Shigella_phage	55.7	3.8e-80
AWQ81169.1|1355737_1356961_-|transposase	transposase DDE domain protein	transposase	NA	NA	NA	NA
AWQ82945.1|1357150_1358734_-	rhodanese-like domain protein	NA	NA	NA	NA	NA
AWQ82252.1|1358730_1359336_-	cysteine dioxygenase type I	NA	NA	NA	NA	NA
AWQ82723.1|1359448_1360345_+	lysR substrate binding domain protein	NA	NA	NA	NA	NA
AWQ83153.1|1360663_1361752_+	luciferase-like monooxygenase family protein	NA	NA	NA	NA	NA
AWQ85384.1|1361761_1362706_+	ABC transporter, substrate-binding, aliphatic sulfonates family protein	NA	NA	NA	NA	NA
AWQ81879.1|1362715_1363798_+	luciferase-like monooxygenase family protein	NA	NA	NA	NA	NA
AWQ81714.1|1363802_1364954_+	acyl-CoA dehydrogenase, N-terminal domain protein	NA	NA	NA	NA	NA
AWQ84759.1|1365061_1366048_+	ABC transporter, substrate-binding, aliphatic sulfonates family protein	NA	NA	NA	NA	NA
AWQ86426.1|1366059_1367016_+	ABC transporter, substrate-binding, aliphatic sulfonates family protein	NA	NA	NA	NA	NA
AWQ85138.1|1367151_1368111_+	ABC transporter, substrate-binding, aliphatic sulfonates family protein	NA	NA	NA	NA	NA
AWQ81658.1|1368177_1368750_-	hypothetical protein	NA	NA	NA	NA	NA
AWQ87313.1|1368956_1370060_-	bacterial extracellular solute-binding family protein	NA	NA	NA	NA	NA
AWQ81311.1|1370212_1371019_+	bacterial regulatory, luxR family protein	NA	NA	NA	NA	NA
AWQ83262.1|1371138_1373793_+	tonB-dependent Receptor Plug domain protein	NA	A0A0P0I887	Acinetobacter_phage	34.8	8.4e-12
AWQ86812.1|1373803_1375018_+	major Facilitator Superfamily protein	NA	NA	NA	NA	NA
AWQ82486.1|1375033_1376062_-	bacterial regulatory helix-turn-helix, AraC family protein	NA	NA	NA	NA	NA
AWQ85279.1|1376679_1377828_+	FAD binding domain protein	NA	NA	NA	NA	NA
AWQ81873.1|1377881_1378199_-	response regulator	NA	NA	NA	NA	NA
AWQ83177.1|1378226_1378814_+	bacterial regulatory, luxR family protein	NA	NA	NA	NA	NA
AWQ82748.1|1378814_1380641_+	excinuclease ABC subunit C	NA	NA	NA	NA	NA
AWQ86418.1|1380674_1381235_+	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
AWQ85252.1|1381802_1382141_+	response regulator	NA	NA	NA	NA	NA
AWQ82061.1|1382275_1382815_+	proQ/FINO family protein	NA	NA	NA	NA	NA
AWQ86913.1|1383545_1384586_-	hypothetical protein	NA	NA	NA	NA	NA
AWQ83973.1|1384851_1385880_+	tipAS antibiotic-recognition domain protein	NA	NA	NA	NA	NA
AWQ83898.1|1386153_1386741_+	flavodoxin-like fold family protein	NA	NA	NA	NA	NA
AWQ81207.1|1387065_1387932_+	tryptophan 2,3-dioxygenase	NA	NA	NA	NA	NA
AWQ82889.1|1387963_1388524_-	putative acetyltransferase	NA	NA	NA	NA	NA
AWQ85617.1|1388538_1388976_-	asnC family protein	NA	NA	NA	NA	NA
AWQ86059.1|1389108_1390008_+	eamA-like transporter family protein	NA	NA	NA	NA	NA
AWQ81645.1|1390070_1390673_-	nitroreductase family protein	NA	NA	NA	NA	NA
AWQ81247.1|1391019_1392168_+	alkane 1-monooxygenase 1	NA	A0A1V0SBK9	Catovirus	33.5	5.4e-40
AWQ87182.1|1392280_1393888_+	methyl-accepting chemotaxis (MCP) signaling domain protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	58.7	1.2e-16
AWQ85582.1|1393898_1395194_-	response regulator	NA	NA	NA	NA	NA
AWQ81613.1|1395522_1396731_+	his Kinase A domain protein	NA	NA	NA	NA	NA
AWQ81704.1|1397016_1397292_-|integrase	phage integrase family protein	integrase	C8CLF4	Xylella_phage	57.4	4.3e-20
AWQ85620.1|1397242_1397671_-	hypothetical protein	NA	Q5QF27	Pseudomonas_virus	54.3	5.1e-20
AWQ84997.1|1397848_1398229_+|capsid	phage major capsid E family protein	capsid	A0A2H4J890	uncultured_Caudovirales_phage	79.6	1.6e-20
1398321:1398336	attR	TGGCCGGCAGGTCGGC	NA	NA	NA	NA
>prophage 2
CP029660	Pseudomonas aeruginosa strain AR_0446 chromosome, complete genome	6475581	2335612	2415956	6475581	protease,tRNA,coat,integrase,terminase,head,tail	Pseudomonas_phage(67.16%)	95	2359127:2359186	2408541:2408601
AWQ82527.1|2335612_2337160_+|coat	spore coat assembly SafA domain protein	coat	M1HNA7	Bacillus_virus	27.8	2.1e-07
AWQ86693.1|2337350_2339180_+	bacterial extracellular solute-binding, 5 Middle family protein	NA	NA	NA	NA	NA
AWQ81805.1|2339176_2341024_+	bacterial extracellular solute-binding, 5 Middle family protein	NA	NA	NA	NA	NA
AWQ85277.1|2341030_2342113_+	binding-protein-dependent transport system inner membrane component family protein	NA	NA	NA	NA	NA
AWQ81266.1|2342117_2343137_+	binding-protein-dependent transport system inner membrane component family protein	NA	NA	NA	NA	NA
AWQ84193.1|2343138_2344749_+	nickel import ATP-binding protein NikE	NA	G9BWD6	Planktothrix_phage	35.8	3.0e-20
AWQ84126.1|2344770_2345568_+	enoyl-(Acyl carrier) reductase family protein	NA	NA	NA	NA	NA
AWQ85979.1|2345663_2347529_-	surA N-terminal domain protein	NA	NA	NA	NA	NA
AWQ83359.1|2347760_2348033_-	DNA-binding protein HU-beta	NA	A4JWM7	Burkholderia_virus	60.7	2.5e-20
AWQ83176.1|2348168_2350565_-|protease	ATP-dependent protease La	protease	A0A0R6PGP8	Moraxella_phage	52.5	2.0e-222
AWQ86978.1|2350696_2351977_-|protease	ATP-dependent Clp protease, ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	59.2	1.1e-137
AWQ81657.1|2352081_2352723_-	ATP-dependent Clp endopeptidase, proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	57.0	1.3e-56
AWQ84320.1|2352816_2354127_-	trigger factor	NA	NA	NA	NA	NA
AWQ81766.1|2354139_2354352_+	hypothetical protein	NA	NA	NA	NA	NA
AWQ82924.1|2354358_2355066_+	transcriptional regulatory, C terminal family protein	NA	W8CYM9	Bacillus_phage	33.6	2.1e-34
AWQ86797.1|2355066_2356353_+	his Kinase A domain protein	NA	W8CYF6	Bacillus_phage	26.0	6.1e-16
AWQ84423.1|2356457_2358269_+	beta-lactamase family protein	NA	NA	NA	NA	NA
AWQ84733.1|2358289_2358406_+	putative mltA-interacting protein	NA	NA	NA	NA	NA
AWQ82441.1|2358579_2358801_-	hypothetical protein	NA	NA	NA	NA	NA
2359127:2359186	attL	GAAGGTGGTGCGGACGGAGAGACTCGAACTCTCACGCCTTGCGGCGCTGGAACCTAAATC	NA	NA	NA	NA
AWQ86068.1|2359317_2359581_-	hypothetical protein	NA	J7I447	Pseudomonas_phage	96.6	1.4e-44
AWQ86727.1|2359616_2359880_-	hypothetical protein	NA	B5WZU5	Pseudomonas_phage	93.1	1.3e-37
AWQ84593.1|2359876_2360245_-	hypothetical protein	NA	H2BDA0	Pseudomonas_phage	86.9	4.2e-47
AWQ85102.1|2360241_2360601_-	phage lysozyme family protein	NA	A0A0S2SYD0	Pseudomonas_phage	95.8	9.4e-60
AWQ84046.1|2360744_2360861_-	putative membrane protein	NA	A0A127KNH8	Pseudomonas_phage	100.0	2.8e-05
AWQ86863.1|2361006_2361246_-	HIRAN domain protein	NA	A0A127KNU7	Pseudomonas_phage	98.7	3.2e-40
AWQ83405.1|2362034_2362895_+	BRO family, N-terminal domain protein	NA	B5WZU1	Pseudomonas_phage	93.0	3.5e-153
AWQ82372.1|2363284_2363566_+	helix-turn-helix family protein	NA	NA	NA	NA	NA
AWQ83213.1|2363634_2365824_-	pectate lyase superfamily protein	NA	H2BD96	Pseudomonas_phage	59.4	1.1e-44
AWQ86831.1|2365890_2368440_-|tail	phage tail family protein	tail	A0A0H5ART3	Pseudomonas_phage	48.9	9.3e-226
AWQ84299.1|2368603_2369017_-	hypothetical protein	NA	B5WZT7	Pseudomonas_phage	60.7	1.1e-40
AWQ85680.1|2369020_2369506_-	hypothetical protein	NA	A0A2H4J983	uncultured_Caudovirales_phage	45.0	5.4e-34
AWQ81809.1|2369507_2369978_-	putative alkanesulfonate ABC transporter membrane protein	NA	A0A125RNN3	Pseudomonas_phage	41.1	5.1e-29
AWQ86531.1|2369977_2373172_-|tail	prophage tail length tape measure family protein	tail	A0A2H4J107	uncultured_Caudovirales_phage	35.4	1.2e-92
AWQ87258.1|2373209_2373485_-	hypothetical protein	NA	NA	NA	NA	NA
AWQ86778.1|2373604_2374093_-	hypothetical protein	NA	NA	NA	NA	NA
AWQ84734.1|2374151_2375321_-	bacterial Ig-like domain family protein	NA	A0A059VG08	Pseudomonas_phage	42.4	6.2e-60
AWQ82043.1|2375379_2375784_-	bacteriophage related domain of unknown function family protein	NA	NA	NA	NA	NA
AWQ86941.1|2375780_2376152_-	hypothetical protein	NA	A0A059VF88	Pseudomonas_phage	51.8	4.6e-17
AWQ83251.1|2376337_2376718_-	putative glutamate 5-kinase	NA	A0A059VA70	Pseudomonas_phage	55.2	1.2e-31
AWQ86849.1|2376721_2377114_-	hypothetical protein	NA	A0A0H5AUF0	Pseudomonas_phage	33.8	5.6e-05
AWQ84463.1|2377153_2377747_-	hypothetical protein	NA	A0A1B0VMF7	Pseudomonas_phage	41.8	5.4e-12
AWQ86151.1|2377795_2378773_-	hypothetical protein	NA	R9TJ64	Synechococcus_phage	65.4	2.0e-112
AWQ81531.1|2378787_2379498_-	hypothetical protein	NA	A0A2H4J0Y0	uncultured_Caudovirales_phage	50.5	1.6e-34
AWQ84918.1|2379867_2380092_+	hypothetical protein	NA	NA	NA	NA	NA
AWQ86091.1|2380106_2381150_-|head	phage head morphogenesis, SPP1 gp7 family domain protein	head	A0A1B0VMF3	Pseudomonas_phage	34.2	1.6e-46
AWQ85142.1|2381139_2382564_-	hypothetical protein	NA	A0A2H4J5M6	uncultured_Caudovirales_phage	36.0	8.6e-72
AWQ86841.1|2382572_2383673_-|terminase	terminase-like family protein	terminase	A0A1B1P9C9	Acinetobacter_phage	54.9	7.8e-113
AWQ85101.1|2384459_2384648_+	putative hNH endonuclease	NA	NA	NA	NA	NA
AWQ85228.1|2384862_2385462_-|terminase	terminase small subunit	terminase	H2BD75	Pseudomonas_phage	61.9	8.1e-48
AWQ85079.1|2385470_2385755_-	hypothetical protein	NA	H2BD74	Pseudomonas_phage	100.0	1.2e-41
AWQ83341.1|2385747_2386137_-	putative membrane protein	NA	J7I0R6	Pseudomonas_phage	100.0	1.3e-62
AWQ86801.1|2386251_2387145_-	hypothetical protein	NA	J7HXH6	Pseudomonas_phage	81.6	8.5e-134
AWQ81935.1|2387173_2387599_-	endodeoxyribonuclease RusA family protein	NA	H2BD71	Pseudomonas_phage	68.6	6.1e-50
AWQ85299.1|2387609_2387771_-	hypothetical protein	NA	NA	NA	NA	NA
AWQ81191.1|2387763_2387949_-	hypothetical protein	NA	NA	NA	NA	NA
AWQ85118.1|2387941_2388550_-	putative replication protein P	NA	A0A2H4J6S4	uncultured_Caudovirales_phage	45.3	5.2e-42
AWQ81595.1|2388599_2388983_-	hypothetical protein	NA	NA	NA	NA	NA
AWQ83348.1|2389484_2389718_-	putative cI-like protein	NA	NA	NA	NA	NA
AWQ82170.1|2390540_2390792_+	repressor protein C2	NA	A0A127KNC7	Pseudomonas_phage	100.0	2.0e-40
AWQ87280.1|2390845_2391004_-	hypothetical protein	NA	J7I426	Pseudomonas_phage	86.0	2.1e-16
AWQ82159.1|2391113_2391242_-	hypothetical protein	NA	NA	NA	NA	NA
AWQ82751.1|2391997_2392339_+	hypothetical protein	NA	A1YZS0	Burkholderia_virus	48.6	3.8e-26
AWQ81836.1|2392650_2393022_+	carbon storage regulator	NA	J7I430	Pseudomonas_phage	96.7	1.8e-61
AWQ83525.1|2393499_2394525_+	hypothetical protein	NA	A0A0U4B0I3	Pseudomonas_phage	97.4	4.9e-77
AWQ83976.1|2394634_2394784_+	hypothetical protein	NA	J7HXJ0	Pseudomonas_phage	93.8	1.8e-09
AWQ85761.1|2394767_2394989_+	hypothetical protein	NA	H2BD53	Pseudomonas_phage	98.6	2.7e-33
AWQ85903.1|2394985_2395168_+	hypothetical protein	NA	Q9MC67	Pseudomonas_phage	98.3	5.0e-25
AWQ87281.1|2395501_2395636_+	putative membrane protein	NA	J7I432	Pseudomonas_phage	70.0	2.2e-06
AWQ84099.1|2395844_2396114_+	HNH endonuclease family protein	NA	J7I0T2	Pseudomonas_phage	95.5	1.5e-46
AWQ83423.1|2396110_2396914_+	PD-(D/E)XK nuclease superfamily protein	NA	J7HXJ4	Pseudomonas_phage	95.9	3.4e-150
AWQ82273.1|2397003_2397744_+	recT family protein	NA	H2BD49	Pseudomonas_phage	100.0	4.1e-142
AWQ84428.1|2397750_2397951_+	hypothetical protein	NA	J7I437	Pseudomonas_phage	98.5	4.3e-30
AWQ84672.1|2397963_2398944_+	ftsk gamma domain protein	NA	H2BD47	Pseudomonas_phage	61.2	3.6e-93
AWQ83343.1|2398947_2400693_+	recF/RecN/SMC N terminal domain protein	NA	H2BD46	Pseudomonas_phage	95.2	2.9e-295
AWQ82665.1|2401271_2401841_+	putative upf86.8	NA	H2BDG4	Pseudomonas_virus	48.4	1.8e-41
AWQ85249.1|2402226_2402364_-	hypothetical protein	NA	NA	NA	NA	NA
AWQ81419.1|2402697_2402946_+	hypothetical protein	NA	H2BD39	Pseudomonas_phage	89.0	1.1e-35
AWQ85778.1|2402957_2403128_-	hypothetical protein	NA	NA	NA	NA	NA
AWQ84946.1|2403379_2404069_+	hypothetical protein	NA	A0A2H5BQE8	Pseudomonas_phage	37.9	1.0e-17
AWQ85487.1|2404068_2404341_+	hypothetical protein	NA	W6MYA5	Pseudomonas_phage	100.0	1.1e-49
AWQ82286.1|2404344_2404563_+	hypothetical protein	NA	D4FUN0	Pseudomonas_phage	94.4	4.3e-31
AWQ84688.1|2404559_2404769_+	hypothetical protein	NA	NA	NA	NA	NA
AWQ85599.1|2404798_2405092_+	dual specificity phosphatase, catalytic domain protein	NA	A0A0A1IW26	Pseudomonas_phage	99.0	5.0e-51
AWQ86516.1|2405238_2405400_+	hypothetical protein	NA	NA	NA	NA	NA
AWQ83155.1|2405396_2405663_+	hypothetical protein	NA	NA	NA	NA	NA
AWQ86482.1|2405655_2406096_+	hypothetical protein	NA	W6MVL6	Pseudomonas_phage	91.7	8.9e-44
AWQ83106.1|2406719_2407052_+	hypothetical protein	NA	A0A0U4IIZ7	Pseudomonas_phage	100.0	2.1e-58
AWQ85120.1|2407226_2407541_+	DNA binding, excisionase family domain protein	NA	Q9MC86	Pseudomonas_phage	100.0	5.0e-49
AWQ82018.1|2407585_2408536_+|integrase	phage integrase, N-terminal SAM-like domain protein	integrase	A0A0S2SYQ7	Pseudomonas_phage	98.7	5.8e-181
AWQ84027.1|2409166_2410021_+	bifunctional protein FolD	NA	A0A249XZQ2	Enterococcus_phage	33.2	7.8e-28
2408541:2408601	attR	GAAGGTGGTGCGGACGGAGAGACTCGAACTCTCACGCCTTGCGGCGCTGGAACCTAAATCC	NA	NA	NA	NA
AWQ82174.1|2410082_2411465_-|tRNA	cysteine--tRNA ligase	tRNA	A0A2K9L6B7	Tupanvirus	31.6	9.0e-42
AWQ82379.1|2411474_2413145_-|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	60.1	2.4e-198
AWQ83749.1|2413267_2413765_+	peptidyl-prolyl cis-trans isomerase	NA	A0A076FI46	Aureococcus_anophage	32.9	1.4e-13
AWQ83904.1|2413769_2414492_+	UDP-2,3-diacylglucosamine hydrolase	NA	NA	NA	NA	NA
AWQ83491.1|2414624_2415956_+	SPFH domain / Band 7 family protein	NA	A0A0F6WCV7	Sinorhizobium_phage	28.3	2.4e-39
>prophage 3
CP029660	Pseudomonas aeruginosa strain AR_0446 chromosome, complete genome	6475581	3323889	3343057	6475581	tRNA,plate	Haemophilus_phage(44.44%)	23	NA	NA
AWQ83912.1|3323889_3324504_-	methyltransferase, FkbM family domain protein	NA	A0A0A0V284	uncultured_virus	36.4	1.3e-05
AWQ86636.1|3325018_3325972_-	phage Tail Collar domain protein	NA	B5TAB1	Burkholderia_phage	44.1	1.1e-30
AWQ83047.1|3325968_3326622_-	hypothetical protein	NA	D0UIH4	Aggregatibacter_phage	50.5	4.4e-47
AWQ85368.1|3326618_3327764_-|plate	baseplate J-like family protein	plate	Q7Y5S4	Haemophilus_phage	50.3	2.2e-94
AWQ83147.1|3327861_3328215_-	hypothetical protein	NA	Q7Y5S5	Haemophilus_phage	53.6	3.2e-28
AWQ85023.1|3328211_3328853_-	putative translation initiation factor IF-2	NA	D0UIH7	Aggregatibacter_phage	41.4	5.1e-40
AWQ87265.1|3328845_3329688_-	hypothetical protein	NA	Q7Y5S8	Haemophilus_phage	45.4	3.6e-70
AWQ83818.1|3329684_3330002_-	hypothetical protein	NA	Q7Y5S9	Haemophilus_phage	57.4	3.2e-27
AWQ81959.1|3329998_3330742_-	hypothetical protein	NA	Q7Y5T0	Haemophilus_phage	36.0	1.5e-27
AWQ85022.1|3330751_3332626_-	putative membrane protein	NA	D0UII2	Aggregatibacter_phage	35.0	1.0e-19
AWQ83214.1|3332612_3332750_-	hypothetical protein	NA	NA	NA	NA	NA
AWQ84162.1|3332776_3333175_-	hypothetical protein	NA	Q776V6	Haemophilus_phage	49.2	1.6e-23
AWQ83403.1|3333177_3333609_-	hypothetical protein	NA	Q7Y5T4	Haemophilus_phage	60.6	6.0e-45
AWQ82485.1|3333679_3335179_-	hypothetical protein	NA	Q7Y5T5	Haemophilus_phage	53.3	7.3e-138
AWQ81596.1|3335180_3335714_-	hypothetical protein	NA	NA	NA	NA	NA
AWQ82825.1|3335813_3336089_-	hypothetical protein	NA	A0A0U4J8T9	Pseudomonas_phage	52.1	2.2e-16
AWQ84409.1|3336081_3336456_-	putative membrane protein	NA	H2BD73	Pseudomonas_phage	51.9	3.5e-25
AWQ81375.1|3336416_3336581_+	hypothetical protein	NA	NA	NA	NA	NA
AWQ85913.1|3336620_3337151_-	hypothetical protein	NA	NA	NA	NA	NA
AWQ85236.1|3337325_3338045_+	helix-turn-helix family protein	NA	A0A1B0VRI7	Pseudomonas_phage	48.6	7.2e-59
AWQ83852.1|3338676_3338862_-	carbon storage regulator	NA	A0A2I7RT00	Vibrio_phage	68.6	9.9e-13
AWQ81230.1|3339046_3340285_-	aspartate kinase, monofunctional class	NA	NA	NA	NA	NA
AWQ86123.1|3340432_3343057_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	37.6	4.0e-75
>prophage 4
CP029660	Pseudomonas aeruginosa strain AR_0446 chromosome, complete genome	6475581	3429161	3436782	6475581	integrase,capsid	Pseudomonas_phage(100.0%)	9	3427851:3427866	3443570:3443585
3427851:3427866	attL	GGCGGAACGCCAAGGC	NA	NA	NA	NA
AWQ85776.1|3429161_3430154_-|integrase	phage integrase family protein	integrase	Q56VN7	Pseudomonas_phage	51.1	2.6e-91
AWQ85816.1|3430153_3431446_-	hypothetical protein	NA	Q56VN8	Pseudomonas_phage	94.0	4.8e-247
AWQ82071.1|3431675_3432950_-	zonular occludens toxin family protein	NA	Q56VN9	Pseudomonas_phage	88.5	5.0e-204
AWQ87328.1|3432953_3433310_-	hypothetical protein	NA	Q56VP0	Pseudomonas_phage	100.0	7.9e-59
AWQ86027.1|3433314_3434601_-	putative attachment protein G3P	NA	Q56VP1	Pseudomonas_phage	56.4	1.1e-49
AWQ82143.1|3434775_3435024_-|capsid	capsid protein G8P	capsid	Q56VP2	Pseudomonas_phage	92.7	2.0e-32
AWQ85925.1|3435036_3435288_-	hypothetical protein	NA	NA	NA	NA	NA
AWQ81670.1|3435409_3435844_-	DNA-Binding protein G5P	NA	Q56VP5	Pseudomonas_phage	97.9	2.1e-61
AWQ85738.1|3436653_3436782_-	hypothetical protein	NA	Q56VP8	Pseudomonas_phage	90.5	1.0e-13
3443570:3443585	attR	GGCGGAACGCCAAGGC	NA	NA	NA	NA
>prophage 5
CP029660	Pseudomonas aeruginosa strain AR_0446 chromosome, complete genome	6475581	4594885	4678621	6475581	lysis,protease,tRNA,portal,integrase,capsid,terminase,plate,head,tail,holin	uncultured_Caudovirales_phage(43.48%)	95	4640331:4640375	4674955:4674999
AWQ81423.1|4594885_4596340_-|tRNA	tRNA sulfurtransferase ThiI	tRNA	NA	NA	NA	NA
AWQ86105.1|4596675_4598085_+	glutamine synthetase, type I	NA	NA	NA	NA	NA
AWQ83478.1|4598230_4598635_+	hypothetical protein	NA	NA	NA	NA	NA
AWQ86401.1|4598631_4600839_-	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
AWQ84491.1|4601125_4601647_+	hypothetical protein	NA	NA	NA	NA	NA
AWQ81789.1|4601643_4602216_+	hypothetical protein	NA	NA	NA	NA	NA
AWQ87180.1|4602486_4603563_+	his Kinase A domain protein	NA	Q8QKV7	Ectocarpus_siliculosus_virus	21.8	2.4e-05
AWQ86016.1|4603565_4604996_+	nitrogen regulation protein NR	NA	NA	NA	NA	NA
AWQ87352.1|4605951_4606419_-	hypothetical protein	NA	NA	NA	NA	NA
AWQ83103.1|4606417_4606879_+|tRNA	tRNA (cytidine(34)-2'-O)-methyltransferase	tRNA	NA	NA	NA	NA
AWQ82465.1|4606937_4607429_-	protein-export chaperone SecB	NA	NA	NA	NA	NA
AWQ85967.1|4607465_4607720_-	glutaredoxin 3	NA	V9QKN6	Rhizobium_phage	43.4	1.6e-13
AWQ83592.1|4607721_4608141_-	rhodanese-like domain protein	NA	NA	NA	NA	NA
AWQ86226.1|4608465_4610013_+	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
AWQ86829.1|4610326_4611145_+|protease	CAAX protease self-immunity family protein	protease	NA	NA	NA	NA
AWQ84876.1|4611129_4611258_-	hypothetical protein	NA	NA	NA	NA	NA
AWQ84131.1|4611294_4612581_+	peptidase M23 family protein	NA	G9BW84	Planktothrix_phage	39.8	2.9e-10
AWQ85004.1|4612609_4613920_+	C-terminal processing peptidase family protein	NA	A0A0R6PIZ1	Moraxella_phage	29.0	3.9e-26
AWQ82444.1|4613919_4614693_+	divergent polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
AWQ84118.1|4614782_4616243_+	hypothetical protein	NA	NA	NA	NA	NA
AWQ84524.1|4616279_4617035_-	bacterial extracellular solute-binding, 3 family protein	NA	NA	NA	NA	NA
AWQ83839.1|4617185_4617938_-	bacterial extracellular solute-binding, 3 family protein	NA	NA	NA	NA	NA
AWQ85411.1|4618028_4618775_-	bacterial extracellular solute-binding, 3 family protein	NA	NA	NA	NA	NA
AWQ83876.1|4618946_4619717_-	imidazoleglycerol phosphate synthase, cyclase subunit	NA	NA	NA	NA	NA
AWQ82580.1|4619727_4620465_-	1-(5-phosphoribosyl)-5-[(5- phosphoribosylamino)methylideneamino]imidazole-4- carboxamide isomerase	NA	NA	NA	NA	NA
AWQ86872.1|4620511_4620772_-	hypothetical protein	NA	NA	NA	NA	NA
AWQ83331.1|4620775_4621414_-	imidazole glycerol phosphate synthase, glutamine amidotransferase subunit	NA	NA	NA	NA	NA
AWQ86086.1|4621413_4622007_-	imidazoleglycerol-phosphate dehydratase family protein	NA	NA	NA	NA	NA
AWQ81183.1|4622167_4622566_+	acetyltransferase family protein	NA	NA	NA	NA	NA
AWQ83279.1|4622602_4622839_+	hypothetical protein	NA	NA	NA	NA	NA
AWQ82244.1|4622835_4623942_+	FAD dependent oxidoreductase family protein	NA	NA	NA	NA	NA
AWQ84163.1|4624035_4626288_+	asmA family protein	NA	NA	NA	NA	NA
AWQ85479.1|4626284_4627352_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
AWQ82635.1|4627395_4627668_+	bacterial Fe(2+) trafficking family protein	NA	NA	NA	NA	NA
AWQ83871.1|4627695_4628778_+	putative oxidoreductase	NA	NA	NA	NA	NA
AWQ85175.1|4629023_4629761_-	short chain dehydrogenase family protein	NA	NA	NA	NA	NA
AWQ86346.1|4629919_4630609_+	hypothetical protein	NA	NA	NA	NA	NA
AWQ84736.1|4630857_4631631_+	ABC transporter family protein	NA	G3M9Y6	Bacillus_virus	31.1	9.3e-20
AWQ81791.1|4631645_4632398_+	bacterial extracellular solute-binding, 3 family protein	NA	NA	NA	NA	NA
AWQ85076.1|4632458_4633154_+	amino ABC transporter, permease, 3-TM region, His/Glu/Gln/Arg/opine family domain protein	NA	NA	NA	NA	NA
AWQ86386.1|4633150_4633843_+	amino ABC transporter, permease, 3-TM region, His/Glu/Gln/Arg/opine family domain protein	NA	NA	NA	NA	NA
AWQ87172.1|4633911_4635132_+	methyltransferase domain protein	NA	NA	NA	NA	NA
AWQ87185.1|4635534_4636005_+	marR family protein	NA	NA	NA	NA	NA
AWQ83299.1|4636008_4637487_+	efflux transporter, outer membrane factor (OMF) lipo, NodT family protein	NA	NA	NA	NA	NA
AWQ82612.1|4637483_4638686_+	efflux transporter, RND family, MFP subunit	NA	NA	NA	NA	NA
AWQ86690.1|4638696_4640226_+	H+ antiporter-2 family protein	NA	NA	NA	NA	NA
4640331:4640375	attL	CTTGTAATCAGTAGGTCCCGGGTTCGACTCCTGGTGCCGGCACCA	NA	NA	NA	NA
AWQ81556.1|4641457_4641778_+	hypothetical protein	NA	NA	NA	NA	NA
AWQ85789.1|4641763_4642822_-|portal	phage portal protein, PBSX family	portal	A0A2H4J922	uncultured_Caudovirales_phage	77.2	1.6e-147
AWQ81746.1|4642818_4644576_-|terminase	terminase-like family protein	terminase	Q9ZXM5	Pseudomonas_virus	80.7	2.3e-284
AWQ82977.1|4644730_4645552_+|capsid	phage capsid scaffolding (GPO) serine peptidase family protein	capsid	A0A2H4J928	uncultured_Caudovirales_phage	59.6	1.8e-82
AWQ82554.1|4645593_4646115_+|capsid	phage major capsid, P2 family protein	capsid	A0A2H4JCR7	uncultured_Caudovirales_phage	68.2	6.6e-62
AWQ84044.1|4646118_4646940_-|integrase	integrase core domain protein	integrase	Q716C2	Shigella_phage	55.7	3.8e-80
AWQ84097.1|4647348_4647846_+|capsid	phage major capsid, P2 family protein	capsid	A0A2H4JCR7	uncultured_Caudovirales_phage	69.1	2.5e-58
AWQ82449.1|4647848_4648547_+|terminase	phage small terminase subunit	terminase	Q9ZXM2	Pseudomonas_virus	66.4	3.8e-73
AWQ84351.1|4648651_4649116_+|head	phage head completion family protein	head	A0A2H4JCS4	uncultured_Caudovirales_phage	56.4	1.1e-39
AWQ81495.1|4649115_4649325_+	phage Tail Protein X family protein	NA	A0A2H4J946	uncultured_Caudovirales_phage	75.4	2.8e-24
AWQ86592.1|4649400_4649715_+|holin	phage holin, lambda family	holin	A0A2H4JFM8	uncultured_Caudovirales_phage	61.5	1.5e-29
AWQ82535.1|4649711_4650551_+	putative peptidoglycan binding domain protein	NA	A0A2H4JGJ9	uncultured_Caudovirales_phage	58.6	1.6e-78
AWQ83785.1|4650547_4651006_+|lysis	phage lysis regulatory, LysB family protein	lysis	Q9ZXL5	Pseudomonas_virus	52.3	2.5e-28
AWQ81475.1|4651099_4651627_+|tail	P2 phage tail completion R family protein	tail	A0A2H4J906	uncultured_Caudovirales_phage	66.9	2.1e-52
AWQ85011.1|4651586_4652069_+	phage virion morphogenesis protein	NA	A0A2H4J927	uncultured_Caudovirales_phage	68.0	2.1e-46
AWQ83419.1|4652142_4652709_+|plate	phage baseplate assembly V family protein	plate	Q9ZXL0	Pseudomonas_virus	63.7	2.8e-50
AWQ81432.1|4652705_4653059_+	lysozyme family protein	NA	A0A2H4JE52	uncultured_Caudovirales_phage	51.8	1.1e-20
AWQ84976.1|4653055_4653967_+|plate	baseplate J-like family protein	plate	Q9ZXK8	Pseudomonas_virus	90.0	4.4e-146
AWQ86384.1|4653975_4654503_+|tail	phage tail protein I	tail	Q9ZXK7	Pseudomonas_virus	96.6	3.5e-95
AWQ82587.1|4654504_4654666_+|tail	phage tail-collar fiber family protein	tail	Q9ZXK6	Pseudomonas_virus	97.9	3.3e-20
AWQ87209.1|4654744_4656775_+|tail	phage tail-collar fiber family protein	tail	Q9ZXK6	Pseudomonas_virus	74.9	6.8e-288
AWQ84095.1|4657317_4658490_+|tail	phage tail sheath family protein	tail	A0A2H4JCP8	uncultured_Caudovirales_phage	85.9	3.6e-193
AWQ82750.1|4658538_4659054_+|tail	phage major tail tube protein	tail	A0A2H4J916	uncultured_Caudovirales_phage	76.6	6.3e-73
AWQ82950.1|4659130_4659457_+	mu-like prophage FluMu gp41 family protein	NA	Q9ZXK2	Pseudomonas_virus	58.3	5.6e-27
AWQ81779.1|4659465_4659588_+	phage P2 GpE family protein	NA	E5FFG6	Burkholderia_phage	69.7	2.6e-06
AWQ83321.1|4659577_4662166_+|tail	phage tail tape measure protein, TP901 family, core region	tail	A0A2H4JE61	uncultured_Caudovirales_phage	39.0	1.2e-111
AWQ85681.1|4662171_4662615_+	phage P2 GpU family protein	NA	A0A2H4JG54	uncultured_Caudovirales_phage	84.8	1.1e-65
AWQ81947.1|4662611_4663877_+	phage late control D family protein	NA	A0A2H4JAV0	uncultured_Caudovirales_phage	72.7	7.2e-179
AWQ86911.1|4665051_4665225_-	hypothetical protein	NA	NA	NA	NA	NA
AWQ84306.1|4665382_4665808_-	hypothetical protein	NA	NA	NA	NA	NA
AWQ84218.1|4665837_4666188_-	xRE family transcriptional regulator	NA	K4NXA8	Burkholderia_phage	47.4	2.5e-12
AWQ85782.1|4666327_4666474_+	phage-associated protein, BcepMu gp16 family	NA	A0A2H4JE67	uncultured_Caudovirales_phage	52.2	1.2e-05
AWQ84271.1|4666587_4666989_+	hypothetical protein	NA	Q9ZXJ2	Pseudomonas_virus	54.9	2.3e-30
AWQ87231.1|4667050_4667329_+	ogr/Delta-like zinc finger family protein	NA	Q9ZXJ1	Pseudomonas_virus	47.3	9.3e-15
AWQ85203.1|4667325_4667685_+	hypothetical protein	NA	A0A2H4J947	uncultured_Caudovirales_phage	44.4	1.0e-13
AWQ82026.1|4667752_4667986_+	hypothetical protein	NA	NA	NA	NA	NA
AWQ85483.1|4668004_4670722_+	toprim domain protein	NA	A0A2H4J936	uncultured_Caudovirales_phage	51.8	1.5e-277
AWQ86034.1|4670775_4670922_+	hypothetical protein	NA	NA	NA	NA	NA
AWQ85360.1|4670954_4671269_+	hypothetical protein	NA	Q9ZXI7	Pseudomonas_virus	64.6	5.2e-30
AWQ86262.1|4671338_4671581_+	hypothetical protein	NA	Q9ZXI5	Pseudomonas_virus	68.7	1.1e-22
AWQ83924.1|4671666_4673301_+	C-5 cytosine-specific DNA methylase family protein	NA	Q9ZXI4	Pseudomonas_virus	63.2	2.0e-181
AWQ86595.1|4673293_4673500_+	hypothetical protein	NA	A0A2H4J958	uncultured_Caudovirales_phage	54.8	7.9e-11
AWQ85171.1|4673578_4673788_+	hypothetical protein	NA	NA	NA	NA	NA
AWQ85920.1|4674441_4674837_+	putative site-specific recombinase	NA	V9IQN0	Stenotrophomonas_phage	43.6	3.9e-22
AWQ85987.1|4674961_4675159_-	hypothetical protein	NA	NA	NA	NA	NA
4674955:4674999	attR	CTTGTAATCAGTAGGTCCCGGGTTCGACTCCTGGTGCCGGCACCA	NA	NA	NA	NA
AWQ86502.1|4675234_4676293_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	47.9	7.8e-86
AWQ86621.1|4676289_4677198_+	dTDP-4-dehydrorhamnose reductase	NA	NA	NA	NA	NA
AWQ87260.1|4677194_4678076_+	glucose-1-phosphate thymidylyltransferase	NA	I7I009	Enterobacteria_phage	60.6	5.5e-101
AWQ84133.1|4678075_4678621_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	54.5	4.9e-52
>prophage 6
CP029660	Pseudomonas aeruginosa strain AR_0446 chromosome, complete genome	6475581	4916042	4935478	6475581	holin	Catovirus(33.33%)	19	NA	NA
AWQ85341.1|4916042_4917728_-|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.4	2.1e-56
AWQ86854.1|4917863_4919336_-	betaine aldehyde dehydrogenase	NA	NA	NA	NA	NA
AWQ82520.1|4919396_4919990_-	transcriptional repressor BetI	NA	NA	NA	NA	NA
AWQ83940.1|4919951_4920068_+	putative transcriptional regulator BetI	NA	NA	NA	NA	NA
AWQ83781.1|4920268_4921873_+|holin	transporter, betaine/carnitine/choline transporter family protein	holin	A0A2I7QNT1	Vibrio_phage	26.0	3.5e-21
AWQ84884.1|4921914_4922034_+	hypothetical protein	NA	NA	NA	NA	NA
AWQ81640.1|4922091_4923270_-|holin	choline ABC transporter, ATP-binding protein	holin	G3M9Y6	Bacillus_virus	35.1	1.9e-24
AWQ82497.1|4923273_4924113_-|holin	choline ABC transporter, permease protein	holin	NA	NA	NA	NA
AWQ83515.1|4924154_4925093_-|holin	choline ABC transporter, periplasmic binding family protein	holin	NA	NA	NA	NA
AWQ84966.1|4925285_4925522_-	hypothetical protein	NA	NA	NA	NA	NA
AWQ82371.1|4925561_4926938_+	L-serine ammonia-lyase	NA	NA	NA	NA	NA
AWQ85885.1|4927357_4928461_+	amidotransferase family protein	NA	NA	NA	NA	NA
AWQ87337.1|4928507_4928756_-	hypothetical protein	NA	NA	NA	NA	NA
AWQ84340.1|4929024_4929918_-	lysR substrate binding domain protein	NA	NA	NA	NA	NA
AWQ83492.1|4930025_4931093_+	hypothetical protein	NA	NA	NA	NA	NA
AWQ81748.1|4932037_4932517_-	hypothetical protein	NA	NA	NA	NA	NA
AWQ85353.1|4932567_4933533_-	L-carnitine dehydrogenase	NA	NA	NA	NA	NA
AWQ82051.1|4933583_4934468_-	hypothetical protein	NA	NA	NA	NA	NA
AWQ83215.1|4934539_4935478_-|holin	choline ABC transporter, periplasmic binding family protein	holin	NA	NA	NA	NA
>prophage 7
CP029660	Pseudomonas aeruginosa strain AR_0446 chromosome, complete genome	6475581	5777415	5839226	6475581	integrase,tRNA,plate,head,tail,holin	uncultured_Caudovirales_phage(25.0%)	63	5766606:5766622	5800379:5800395
5766606:5766622	attL	CCGCTCGGCCGGCGACA	NA	NA	NA	NA
AWQ86573.1|5777415_5777571_-|integrase	site-specific recombinase, phage integrase family	integrase	NA	NA	NA	NA
AWQ87164.1|5777816_5781554_-	sensory box protein	NA	A0A127AWB9	Bacillus_phage	35.4	4.8e-13
AWQ83261.1|5781660_5783514_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.8	1.2e-36
AWQ86428.1|5783593_5785588_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	40.7	3.8e-73
AWQ82601.1|5785670_5786120_-	yqey-like family protein	NA	A0A292GL36	Xanthomonas_phage	38.8	6.6e-18
AWQ85045.1|5786189_5786405_-	ribosomal protein S21	NA	NA	NA	NA	NA
AWQ85390.1|5786605_5787631_+|tRNA	tRNA threonylcarbamoyl adenosine modification protein YgjD	tRNA	A0A0R6PI74	Moraxella_phage	58.1	3.7e-109
AWQ82313.1|5787709_5788279_-	acyl-phosphate glycerol 3-phosphate acyltransferase	NA	NA	NA	NA	NA
AWQ81934.1|5788362_5788716_+	dihydroneopterin aldolase	NA	NA	NA	NA	NA
AWQ86081.1|5788706_5789249_+	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
AWQ83270.1|5789221_5790454_-|head	poly A polymerase head domain protein	head	A0A076G5T8	Escherichia_phage	43.1	5.9e-77
AWQ82536.1|5790497_5791004_-	hypothetical protein	NA	NA	NA	NA	NA
AWQ84903.1|5791098_5792652_-	spoVR like family protein	NA	NA	NA	NA	NA
AWQ81692.1|5792648_5793920_-	hypothetical protein	NA	A0A140HLI1	Bacillus_phage	37.2	4.2e-09
AWQ84707.1|5794020_5795943_-	prkA AAA domain protein	NA	NA	NA	NA	NA
AWQ87021.1|5796221_5796554_-	rhodanese-like domain protein	NA	NA	NA	NA	NA
AWQ86339.1|5796597_5797449_-	bis(5'-nucleosyl)-tetraphosphatase	NA	A0A2H4J0P0	uncultured_Caudovirales_phage	33.3	1.1e-08
AWQ83572.1|5797448_5797829_-	hypothetical protein	NA	NA	NA	NA	NA
AWQ86419.1|5797865_5798672_-	dimethyladenosine transferase	NA	NA	NA	NA	NA
AWQ84228.1|5798787_5799774_-	4-hydroxythreonine-4-phosphate dehydrogenase PdxA	NA	NA	NA	NA	NA
AWQ82933.1|5799770_5800985_-	chaperone SurA	NA	NA	NA	NA	NA
5800379:5800395	attR	TGTCGCCGGCCGAGCGG	NA	NA	NA	NA
AWQ86602.1|5801043_5803800_-	organic solvent tolerance family protein	NA	NA	NA	NA	NA
AWQ83602.1|5804031_5804961_+	phosphotransferase enzyme family protein	NA	NA	NA	NA	NA
AWQ82756.1|5804957_5805632_+	nucleotidyl transferase family protein	NA	NA	NA	NA	NA
AWQ83455.1|5805633_5806392_+	dnaJ domain protein	NA	NA	NA	NA	NA
AWQ81302.1|5806392_5807454_-	hypothetical protein	NA	NA	NA	NA	NA
AWQ86912.1|5807680_5809999_+	sensory box protein	NA	NA	NA	NA	NA
AWQ83575.1|5810047_5810677_+	bacterial regulatory, luxR family protein	NA	NA	NA	NA	NA
AWQ83677.1|5810883_5811840_+	bacterial extracellular solute-binding family protein	NA	NA	NA	NA	NA
AWQ86466.1|5812073_5813183_+	polyamine ABC transporter, ATP-binding family protein	NA	G3M9Y6	Bacillus_virus	34.4	7.8e-28
AWQ85960.1|5813238_5814285_+	bacterial extracellular solute-binding family protein	NA	NA	NA	NA	NA
AWQ83010.1|5814417_5815647_+	binding-protein-dependent transport system inner membrane component family protein	NA	NA	NA	NA	NA
AWQ85771.1|5815752_5816583_+	binding-protein-dependent transport system inner membrane component family protein	NA	NA	NA	NA	NA
AWQ82107.1|5816706_5817381_+	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
AWQ86903.1|5817380_5818199_+	phosphoglycolate phosphatase, bacterial	NA	NA	NA	NA	NA
AWQ84655.1|5818271_5819750_+	anthranilate synthase component I	NA	NA	NA	NA	NA
AWQ85604.1|5819924_5820239_-	pyocin activator PrtN family protein	NA	NA	NA	NA	NA
AWQ84412.1|5820338_5821109_-	repressor protein CI	NA	A0A1B0Z078	Pseudomonas_phage	59.1	2.3e-71
AWQ84841.1|5821193_5821364_-	hypothetical protein	NA	NA	NA	NA	NA
AWQ86309.1|5821382_5821517_-	hypothetical protein	NA	NA	NA	NA	NA
AWQ82009.1|5821566_5821767_+	phage/conjugal plasmid C-4 type zinc finger, TraR family protein	NA	W6ATC1	Enterobacter_phage	58.3	3.7e-05
AWQ82037.1|5821814_5822174_+	hypothetical protein	NA	NA	NA	NA	NA
AWQ86139.1|5822627_5822981_+|holin	putative holin	holin	B5TK61	Pseudomonas_phage	53.3	3.0e-26
AWQ83728.1|5823002_5823518_+	hypothetical protein	NA	A0A2H4J881	uncultured_Caudovirales_phage	42.9	2.4e-32
AWQ82098.1|5823514_5824072_+|plate	phage baseplate assembly V family protein	plate	A0A2H4JG06	uncultured_Caudovirales_phage	71.1	4.6e-45
AWQ81830.1|5824224_5824551_+	lysozyme family protein	NA	A0A2H4JA09	uncultured_Caudovirales_phage	60.2	1.9e-30
AWQ83066.1|5824547_5825435_+|plate	baseplate J-like family protein	plate	S4TNY7	Salmonella_phage	60.1	3.1e-88
AWQ84161.1|5825553_5825961_+|tail	phage tail protein I	tail	Q9ZXK7	Pseudomonas_virus	71.1	5.1e-54
AWQ84000.1|5825962_5828071_+|tail	phage tail-collar fiber family protein	tail	Q9ZXK6	Pseudomonas_virus	53.5	3.9e-230
AWQ86254.1|5828045_5828234_-	hypothetical protein	NA	NA	NA	NA	NA
AWQ81489.1|5828561_5829722_+|tail	phage tail sheath family protein	tail	Q38068	Phage_PS17	83.4	7.0e-189
AWQ85519.1|5829734_5830238_+|tail	phage major tail tube protein	tail	Q7M2A5	Pseudomonas_phage	73.5	8.0e-65
AWQ86652.1|5830252_5830597_+	mu-like prophage FluMu gp41 family protein	NA	NA	NA	NA	NA
AWQ84368.1|5830778_5833004_+	hypothetical protein	NA	NA	NA	NA	NA
AWQ86450.1|5833013_5833886_+	phage P2 GpU family protein	NA	A0A2H4J875	uncultured_Caudovirales_phage	51.7	1.8e-75
AWQ85540.1|5833893_5834067_+	phage Tail Protein X family protein	NA	A0A2H4J9Z9	uncultured_Caudovirales_phage	58.9	6.0e-12
AWQ84580.1|5834124_5835114_+	phage late control D family protein	NA	A0A2H4JBF6	uncultured_Caudovirales_phage	55.5	4.9e-106
AWQ85600.1|5835146_5835776_+	chitinase class I family protein	NA	A0A125RNP1	Pseudomonas_phage	78.0	7.1e-87
AWQ84680.1|5835772_5836135_+	hypothetical protein	NA	NA	NA	NA	NA
AWQ83787.1|5836248_5836389_+	hypothetical protein	NA	H2BDD7	Pseudomonas_virus	69.8	1.6e-07
AWQ84551.1|5836736_5837342_+	anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	65.3	8.7e-74
AWQ83768.1|5837343_5838393_+	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	57.8	2.4e-111
AWQ85850.1|5838389_5839226_+	indole-3-glycerol phosphate synthase family protein	NA	A0A0P0IR83	Acinetobacter_phage	56.5	1.1e-69
>prophage 8
CP029660	Pseudomonas aeruginosa strain AR_0446 chromosome, complete genome	6475581	6364152	6409763	6475581	protease,tRNA,portal,integrase,capsid,terminase,head,holin	Pseudomonas_phage(72.73%)	53	6367872:6367888	6413315:6413331
AWQ85568.1|6364152_6367005_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	37.0	1.3e-148
AWQ83232.1|6367125_6367458_-	hypothetical protein	NA	NA	NA	NA	NA
AWQ87126.1|6367505_6367934_-	DNA polymerase III chi subunit, HolC family protein	NA	NA	NA	NA	NA
6367872:6367888	attL	GGCGACCTGCAGGCGCG	NA	NA	NA	NA
AWQ85610.1|6367930_6369418_-	cytosol aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	36.1	1.0e-51
AWQ83865.1|6369754_6370567_+	cupin domain protein	NA	NA	NA	NA	NA
AWQ83948.1|6370650_6371574_+	alpha/beta hydrolase family protein	NA	NA	NA	NA	NA
AWQ81201.1|6371765_6372884_+	putative permease YjgP/YjgQ family protein	NA	NA	NA	NA	NA
AWQ86080.1|6372876_6373944_+	putative permease YjgP/YjgQ family protein	NA	NA	NA	NA	NA
AWQ87297.1|6374083_6374581_-	RDD family protein	NA	NA	NA	NA	NA
AWQ85870.1|6374710_6376291_+	EAL domain protein	NA	NA	NA	NA	NA
AWQ84842.1|6376830_6377787_+|integrase	phage integrase family protein	integrase	A0A0A0YR56	Pseudomonas_phage	97.2	1.8e-153
AWQ86104.1|6378056_6378806_+	DNA recombination-mediator A family protein	NA	S6BFL3	Thermus_phage	41.0	1.5e-38
AWQ83149.1|6379504_6379807_-	hypothetical protein	NA	A0A0A0YRS6	Pseudomonas_phage	91.0	9.1e-48
AWQ85184.1|6379803_6380145_-	hypothetical protein	NA	NA	NA	NA	NA
AWQ81635.1|6380149_6380839_-	hypothetical protein	NA	A0A0A0YUE3	Pseudomonas_phage	36.0	3.3e-29
AWQ86238.1|6381011_6381134_-	hypothetical protein	NA	A0A1W6JTB8	Pseudomonas_phage	94.4	1.4e-12
AWQ83752.1|6381202_6381325_-	putative membrane protein	NA	A0A0A0YWF9	Pseudomonas_phage	97.4	4.6e-11
AWQ85741.1|6381321_6382008_-	hypothetical protein	NA	J9SNC1	Pseudomonas_phage	60.1	1.8e-43
AWQ82168.1|6382010_6382241_-	arc-like DNA binding domain protein	NA	A0A1W6JTB4	Pseudomonas_phage	86.5	4.7e-28
AWQ85238.1|6382338_6382572_-	hypothetical protein	NA	A0A0A0YQ28	Pseudomonas_phage	93.5	4.0e-35
AWQ86981.1|6382574_6382958_-	bacterial regulatory, luxR family protein	NA	A0A1W6JTA9	Pseudomonas_phage	96.6	1.8e-53
AWQ84303.1|6383133_6383502_-	hypothetical protein	NA	NA	NA	NA	NA
AWQ84221.1|6385429_6386170_-	peptidase S24-like family protein	NA	A0A1B0Z078	Pseudomonas_phage	56.3	1.5e-72
AWQ82116.1|6386166_6386298_-	hypothetical protein	NA	NA	NA	NA	NA
AWQ86078.1|6386499_6386694_-	hypothetical protein	NA	NA	NA	NA	NA
AWQ83643.1|6387486_6387654_+	hypothetical protein	NA	A0A1W6JTC3	Pseudomonas_phage	94.5	1.1e-18
AWQ87329.1|6387650_6387959_+	hypothetical protein	NA	NA	NA	NA	NA
AWQ83609.1|6388095_6388248_+	hypothetical protein	NA	NA	NA	NA	NA
AWQ82349.1|6388364_6388574_+	hypothetical protein	NA	NA	NA	NA	NA
AWQ83350.1|6388566_6389367_+	phage regulatory Rha family protein	NA	A0A1W6JTB2	Pseudomonas_phage	83.5	2.9e-117
AWQ85108.1|6389363_6389594_+	hypothetical protein	NA	A0A1W6JTF8	Pseudomonas_phage	98.7	9.0e-40
AWQ81316.1|6390217_6390430_+	putative replication domain protein	NA	A0A1W6JTD5	Pseudomonas_phage	82.9	7.3e-28
AWQ86099.1|6390929_6391226_+	istB-like ATP binding family protein	NA	A0A1W6JTD8	Pseudomonas_phage	99.0	5.2e-48
AWQ81165.1|6391222_6392620_+	dnaB-like helicase N terminal domain protein	NA	A0A1W6JTB3	Pseudomonas_phage	98.9	5.2e-263
AWQ85874.1|6392634_6392895_+	hypothetical protein	NA	A0A1W6JTC1	Pseudomonas_phage	98.8	5.4e-41
AWQ82156.1|6392912_6393281_+	phage antitermination Q family protein	NA	A0A1W6JTD2	Pseudomonas_phage	98.4	9.0e-66
AWQ84892.1|6394787_6395087_+	phage regulatory, Rha family protein	NA	A0A1R3Y613	Salmonella_virus	46.2	1.8e-16
AWQ84035.1|6395177_6395507_+|holin	phage holin, lambda family	holin	A0A1W6JTC7	Pseudomonas_phage	100.0	3.1e-57
AWQ86325.1|6395503_6396121_+	chitinase class I family protein	NA	A0A1B0Z086	Pseudomonas_phage	92.2	3.9e-106
AWQ86958.1|6396195_6396360_+	hypothetical protein	NA	A0A0H5AWC3	Pseudomonas_phage	48.1	2.6e-09
AWQ87094.1|6396398_6396614_-	hypothetical protein	NA	NA	NA	NA	NA
AWQ83458.1|6396983_6397640_+	hypothetical protein	NA	A0A1B0Z000	Pseudomonas_phage	46.7	1.3e-43
AWQ85506.1|6398054_6398399_+	phage DNA packaging Nu1 family protein	NA	A0A1B0Z033	Pseudomonas_phage	63.6	1.2e-30
AWQ81573.1|6398427_6400311_+|terminase	phage terminase large subunit family protein	terminase	A0A1B0Z2K0	Pseudomonas_phage	55.1	1.9e-207
AWQ84338.1|6400550_6402026_+|portal	phage portal protein, lambda family	portal	A0A2H4JFL5	uncultured_Caudovirales_phage	70.3	9.5e-199
AWQ85140.1|6402022_6403219_+|protease	clp protease family protein	protease	A0A2H4JDI2	uncultured_Caudovirales_phage	58.0	3.1e-115
AWQ81312.1|6403218_6403578_+|head	bacteriophage lambda head decoration D family protein	head	A0A2H4JF15	uncultured_Caudovirales_phage	52.3	2.6e-17
AWQ83942.1|6403644_6404640_+|capsid	phage major capsid E family protein	capsid	A0A2H4J890	uncultured_Caudovirales_phage	69.9	5.7e-131
AWQ86764.1|6404639_6404951_+	hypothetical protein	NA	NA	NA	NA	NA
AWQ81354.1|6404947_6405385_+	hypothetical protein	NA	NA	NA	NA	NA
AWQ83460.1|6405435_6405639_+	hypothetical protein	NA	NA	NA	NA	NA
AWQ82638.1|6405666_6406419_+	hypothetical protein	NA	NA	NA	NA	NA
AWQ85461.1|6406502_6409763_+	tape measure domain protein	NA	A0A2I7S9D9	Vibrio_phage	46.6	7.3e-50
6413315:6413331	attR	GGCGACCTGCAGGCGCG	NA	NA	NA	NA
