The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP021164	Serratia marcescens strain 332 chromosome, complete genome	5059456	2067444	2083355	5059456	protease,coat,tail	Moraxella_phage(100.0%)	13	NA	NA
AWQ47633.1|2067444_2068377_-|coat	spore coat protein	coat	NA	NA	NA	NA
AWQ50385.1|2068396_2070739_-	hypothetical protein	NA	NA	NA	NA	NA
AWQ47634.1|2070890_2071658_-	molecular chaperone	NA	NA	NA	NA	NA
AWQ50386.1|2071679_2072195_-|coat	spore coat protein U	coat	NA	NA	NA	NA
AWQ47635.1|2072215_2072719_-|coat	spore coat protein U	coat	NA	NA	NA	NA
AWQ47636.1|2072721_2073258_-|coat	spore coat protein	coat	NA	NA	NA	NA
AWQ47637.1|2073532_2074069_-|coat	spore coat protein	coat	NA	NA	NA	NA
AWQ47638.1|2074341_2075778_-	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
AWQ50388.1|2075880_2078511_-	MCE family protein	NA	NA	NA	NA	NA
AWQ50387.1|2078479_2079727_-	paraquat-inducible membrane protein A	NA	NA	NA	NA	NA
AWQ47639.1|2079982_2080480_+	Free methionine-R-sulfoxide reductase	NA	NA	NA	NA	NA
AWQ47640.1|2080576_2081287_+	RNA chaperone ProQ	NA	NA	NA	NA	NA
AWQ47641.1|2081306_2083355_+|tail,protease	tail-specific protease	tail,protease	A0A0R6PIZ1	Moraxella_phage	34.0	6.8e-86
>prophage 2
CP021164	Serratia marcescens strain 332 chromosome, complete genome	5059456	2523444	2561608	5059456	head,holin,terminase	Edwardsiella_phage(23.08%)	54	NA	NA
AWQ48027.1|2523444_2523867_-	hypothetical protein	NA	F1BUP0	Erwinia_phage	42.5	6.0e-13
AWQ48028.1|2523896_2525225_-	hypothetical protein	NA	H9C0Y2	Aeromonas_phage	50.0	3.3e-25
AWQ48029.1|2525226_2525814_-	hypothetical protein	NA	A0A2R3UAM9	Myoviridae_environmental_samples	38.7	3.5e-35
AWQ48030.1|2525815_2527066_-	hypothetical protein	NA	A0A077KGW9	Edwardsiella_phage	49.4	3.6e-98
AWQ50409.1|2527062_2527419_-	hypothetical protein	NA	A0A077KCA1	Edwardsiella_phage	50.0	9.1e-23
AWQ48031.1|2527427_2528105_-	oxidoreductase	NA	A0A077KAY0	Edwardsiella_phage	39.4	5.6e-37
AWQ48032.1|2528106_2528952_-	hypothetical protein	NA	A0A077KC17	Edwardsiella_phage	32.6	2.5e-34
AWQ48033.1|2528948_2529251_-	hypothetical protein	NA	A0A077K9U4	Edwardsiella_phage	52.5	1.3e-25
AWQ48034.1|2529250_2530057_-	hypothetical protein	NA	A0A077KGW3	Edwardsiella_phage	37.4	1.6e-27
AWQ48035.1|2530053_2531982_-	hypothetical protein	NA	A0A0M4REK7	Salmonella_phage	53.0	1.1e-53
AWQ48036.1|2531987_2532194_-	transcription elongation factor GreA	NA	NA	NA	NA	NA
AWQ48037.1|2532196_2532601_-	hypothetical protein	NA	H9C0W7	Aeromonas_phage	44.5	4.1e-19
AWQ48038.1|2532600_2533038_-	hypothetical protein	NA	A0A077K9T0	Edwardsiella_phage	38.1	2.3e-20
AWQ48039.1|2533037_2534522_-	hypothetical protein	NA	A0A077KGV4	Edwardsiella_phage	38.2	2.3e-91
AWQ48040.1|2534502_2535054_-	hypothetical protein	NA	NA	NA	NA	NA
AWQ48041.1|2535038_2535404_-	hypothetical protein	NA	NA	NA	NA	NA
AWQ48042.1|2535400_2535880_-	hypothetical protein	NA	A0A2I7QV48	Vibrio_phage	30.1	2.5e-07
AWQ48043.1|2535880_2536351_-	hypothetical protein	NA	K4HYQ8	Acinetobacter_phage	37.0	4.8e-11
AWQ48044.1|2536354_2536699_-	hypothetical protein	NA	A0A1X9SFA9	Acinetobacter_phage	40.5	7.5e-14
AWQ48045.1|2536702_2537731_-	DUF2184 domain-containing protein	NA	A0A219YBB0	Aeromonas_phage	49.7	3.5e-83
AWQ48046.1|2537730_2538213_-	hypothetical protein	NA	E2GLV4	Acinetobacter_phage	50.9	5.2e-29
AWQ48047.1|2538214_2539540_-	hypothetical protein	NA	A0A219YCD3	Aeromonas_phage	40.7	1.1e-68
AWQ50410.1|2539543_2540227_-|head	phage head morphogenesis protein	head	H9C0V1	Aeromonas_phage	49.1	5.4e-56
AWQ48048.1|2540267_2541809_-	hypothetical protein	NA	A0A2R3UAL5	Myoviridae_environmental_samples	42.5	9.0e-99
AWQ50411.1|2541808_2543227_-|terminase	terminase	terminase	A0A077KAW0	Edwardsiella_phage	69.9	1.4e-186
AWQ48049.1|2543150_2544176_-|terminase	terminase	terminase	A0A0U2RXW9	Escherichia_phage	49.5	1.3e-50
AWQ48050.1|2544313_2544553_-	hypothetical protein	NA	NA	NA	NA	NA
AWQ48051.1|2544577_2544796_-	hypothetical protein	NA	NA	NA	NA	NA
AWQ48052.1|2544737_2545121_-	hypothetical protein	NA	NA	NA	NA	NA
AWQ48053.1|2545117_2545756_-	endolysin	NA	Q8HA86	Salmonella_phage	61.1	1.4e-69
AWQ50412.1|2545759_2546095_-|holin	phage holin, lambda family	holin	Q2A0C6	Sodalis_phage	44.2	3.2e-17
AWQ48054.1|2546662_2547352_-	antitermination protein	NA	NA	NA	NA	NA
AWQ48055.1|2547351_2547633_-	hypothetical protein	NA	K7P7Q1	Enterobacteria_phage	86.8	9.1e-42
AWQ48056.1|2547637_2548234_-	hypothetical protein	NA	K7PKS6	Enterobacteria_phage	85.2	4.0e-95
AWQ48057.1|2548276_2548465_-	hypothetical protein	NA	H6WRY6	Salmonella_phage	66.0	5.9e-13
AWQ48058.1|2548558_2548792_-	DNA damage-inducible protein I	NA	H6WRY5	Salmonella_phage	54.5	4.0e-19
AWQ48059.1|2548920_2549538_-	hypothetical protein	NA	Q8HAA7	Salmonella_phage	53.3	3.9e-13
AWQ48060.1|2549534_2549735_-	hypothetical protein	NA	NA	NA	NA	NA
AWQ48061.1|2549731_2550154_-	hypothetical protein	NA	Q9MCR3	Enterobacteria_phage	50.0	6.4e-15
AWQ48062.1|2550150_2550555_-	hypothetical protein	NA	NA	NA	NA	NA
AWQ48063.1|2550570_2551311_-	DNA replication protein DnaC	NA	S4TNF5	Salmonella_phage	72.6	1.2e-98
AWQ48064.1|2551325_2552069_-	hypothetical protein	NA	A0A2H4JCW9	uncultured_Caudovirales_phage	65.7	5.4e-17
AWQ48065.1|2552216_2552459_-	hypothetical protein	NA	NA	NA	NA	NA
AWQ48066.1|2552474_2552936_-	hypothetical protein	NA	NA	NA	NA	NA
AWQ48067.1|2552947_2553193_-	Rha family transcriptional regulator	NA	A0A0M4QX15	Salmonella_phage	52.6	2.1e-18
AWQ48068.1|2553295_2553682_+	transcriptional regulator	NA	A0A0M4R5D1	Salmonella_phage	64.0	1.9e-34
AWQ48069.1|2553837_2554206_+	hypothetical protein	NA	NA	NA	NA	NA
AWQ48070.1|2554528_2554726_+	hypothetical protein	NA	NA	NA	NA	NA
AWQ48071.1|2554801_2555107_+	hypothetical protein	NA	NA	NA	NA	NA
AWQ48072.1|2555625_2558868_+	hypothetical protein	NA	H6WRX1	Salmonella_phage	37.4	4.0e-141
AWQ48073.1|2558864_2559920_+	enterohemolysin	NA	A0A2R9YJJ1	Escherichia_phage	63.6	1.4e-82
AWQ50413.1|2559925_2560105_+	hypothetical protein	NA	NA	NA	NA	NA
AWQ50414.1|2560178_2560364_+	excisionase	NA	A0A1I9KF80	Aeromonas_phage	58.2	7.1e-11
AWQ48074.1|2560336_2561608_+	hypothetical protein	NA	A0A1I9KF78	Aeromonas_phage	46.1	1.9e-94
>prophage 3
CP021164	Serratia marcescens strain 332 chromosome, complete genome	5059456	2882712	2915413	5059456	head,tail,transposase,plate	Vibrio_phage(66.67%)	44	NA	NA
AWQ48376.1|2882712_2884257_-	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	45.2	2.7e-18
AWQ48377.1|2885163_2885745_-	hypothetical protein	NA	A0A2D1GNR8	Pseudomonas_phage	50.9	1.2e-35
AWQ48378.1|2885908_2886157_+	DNA-binding protein	NA	A0A2D1GNH1	Pseudomonas_phage	85.2	1.0e-33
AWQ48379.1|2886159_2888253_+|transposase	transposase	transposase	A0A2D1GNK9	Pseudomonas_phage	51.0	2.9e-185
AWQ48380.1|2888289_2889237_+	DNA transposition protein	NA	A0A0C4UQR3	Shigella_phage	78.8	2.9e-140
AWQ48381.1|2889241_2889439_+	hypothetical protein	NA	NA	NA	NA	NA
AWQ48382.1|2889441_2889654_+	hypothetical protein	NA	NA	NA	NA	NA
AWQ48383.1|2889661_2890276_+	sulfate transporter	NA	A0A2I7S9B0	Vibrio_phage	59.7	6.3e-64
AWQ50429.1|2890286_2890478_+	hypothetical protein	NA	NA	NA	NA	NA
AWQ48384.1|2890641_2891196_+	hypothetical protein	NA	A0A2I7S9B8	Vibrio_phage	33.9	3.3e-19
AWQ48385.1|2891192_2891720_+	hypothetical protein	NA	F6MIJ5	Haemophilus_phage	40.5	2.2e-28
AWQ48386.1|2891712_2892105_+	transcriptional regulator	NA	A0A0C4UR27	Shigella_phage	64.8	2.5e-37
AWQ48387.1|2892112_2892592_+	hypothetical protein	NA	NA	NA	NA	NA
AWQ48388.1|2892752_2893283_+	peptidoglycan-binding protein	NA	A0A2I7S9B9	Vibrio_phage	47.9	1.1e-37
AWQ48389.1|2893285_2893519_+	hypothetical protein	NA	A0A0C4UQR6	Shigella_phage	62.9	1.5e-21
AWQ48390.1|2893505_2893838_+	hypothetical protein	NA	NA	NA	NA	NA
AWQ48391.1|2893825_2894431_+	hypothetical protein	NA	NA	NA	NA	NA
AWQ48392.1|2894430_2894664_+	conjugal transfer protein TraR	NA	NA	NA	NA	NA
AWQ48393.1|2894644_2894947_+	hypothetical protein	NA	M1Q558	Vibrio_phage	42.6	1.9e-13
AWQ50430.1|2894957_2895245_+	hypothetical protein	NA	A0A0C4UR00	Shigella_phage	61.7	4.2e-26
AWQ48394.1|2895248_2895524_+	hypothetical protein	NA	NA	NA	NA	NA
AWQ48395.1|2895513_2896089_+	hypothetical protein	NA	M4MCR3	Vibrio_phage	56.8	9.2e-49
AWQ50431.1|2896088_2897657_+	hypothetical protein	NA	A0A2I7S9C5	Vibrio_phage	72.4	7.0e-200
AWQ48396.1|2897656_2899234_+	hypothetical protein	NA	A0A2I7S9K0	Vibrio_phage	55.6	5.8e-162
AWQ48397.1|2899226_2900066_+	hypothetical protein	NA	M1PVV7	Vibrio_phage	55.9	3.7e-91
AWQ48398.1|2900277_2901234_+	peptidase	NA	M1Q578	Vibrio_phage	54.4	2.0e-88
AWQ48399.1|2901239_2902157_+|head	phage head protein	head	M4MB71	Vibrio_phage	57.1	1.2e-98
AWQ48400.1|2902235_2902778_+	hypothetical protein	NA	NA	NA	NA	NA
AWQ48401.1|2902774_2903212_+	hypothetical protein	NA	M1PVU7	Vibrio_phage	56.6	3.8e-39
AWQ48402.1|2903211_2903754_+	phage virion morphogenesis protein	NA	A0A2I7S9D7	Vibrio_phage	64.8	3.8e-60
AWQ48403.1|2903750_2904371_+	hypothetical protein	NA	M1PJ94	Vibrio_phage	40.8	3.0e-37
AWQ50432.1|2904351_2904567_+	hypothetical protein	NA	NA	NA	NA	NA
AWQ48404.1|2904570_2906049_+|tail	phage tail protein	tail	M1Q565	Vibrio_phage	57.4	7.9e-161
AWQ48405.1|2906058_2906409_+|tail	phage tail protein	tail	NA	NA	NA	NA
AWQ48406.1|2906412_2906796_+	hypothetical protein	NA	M4MB64	Vibrio_phage	46.2	1.6e-20
AWQ48407.1|2906894_2908775_+|tail	phage tail protein	tail	M4MHE6	Vibrio_phage	29.5	9.4e-58
AWQ48408.1|2908774_2910031_+	multidrug DMT transporter	NA	M4M9N2	Vibrio_phage	43.5	1.6e-90
AWQ48409.1|2910023_2911115_+|tail	phage tail protein	tail	M4M9L5	Vibrio_phage	49.7	2.3e-93
AWQ48410.1|2911105_2911645_+|plate	phage baseplate protein	plate	A0A2I7S9F6	Vibrio_phage	41.8	2.1e-31
AWQ48411.1|2911641_2912091_+	hypothetical protein	NA	A0A2I7S9F0	Vibrio_phage	46.1	9.8e-30
AWQ48412.1|2912080_2913154_+|plate	phage baseplate protein	plate	M4MHE1	Vibrio_phage	52.3	6.4e-104
AWQ48413.1|2913138_2913723_+	hypothetical protein	NA	A0A2I7S9L6	Vibrio_phage	47.7	1.1e-46
AWQ48414.1|2913725_2914538_+|tail	phage tail protein	tail	A9DEM1	Yersinia_phage	37.0	4.4e-28
AWQ48415.1|2914537_2915413_+|tail	phage tail protein	tail	A0A0A0YSY3	Erwinia_phage	50.0	2.0e-07
>prophage 4
CP021164	Serratia marcescens strain 332 chromosome, complete genome	5059456	3110243	3143356	5059456	integrase,capsid,plate,portal,lysis,tail	Salmonella_phage(45.45%)	42	3110088:3110127	3143033:3143072
3110088:3110127	attL	TAACAAGGAACTTTTGCCCGCAGACTTGCGGGCTTTTTTT	NA	NA	NA	NA
AWQ48579.1|3110243_3111257_-|integrase	integrase	integrase	A0A0F7LBR0	Escherichia_phage	48.3	5.7e-86
AWQ48580.1|3111259_3111823_-	hypothetical protein	NA	NA	NA	NA	NA
AWQ48581.1|3111909_3112203_-	transcriptional regulator	NA	Q1JS37	Enterobacteria_phage	62.9	5.9e-28
AWQ48582.1|3112406_3112649_+	hypothetical protein	NA	NA	NA	NA	NA
AWQ48583.1|3112663_3112864_+	hypothetical protein	NA	NA	NA	NA	NA
AWQ48584.1|3112860_3113133_+	hypothetical protein	NA	NA	NA	NA	NA
AWQ48585.1|3113418_3113616_+	hypothetical protein	NA	NA	NA	NA	NA
AWQ48586.1|3113762_3113981_+	hypothetical protein	NA	A0A0M3LQ09	Mannheimia_phage	38.9	6.6e-08
AWQ48587.1|3113984_3114836_+	hypothetical protein	NA	K7RFY5	Vibrio_phage	62.8	5.7e-55
AWQ48588.1|3114832_3115657_+	adenine methylase	NA	A0A0M4QWR0	Salmonella_phage	47.3	1.2e-65
AWQ48589.1|3115649_3115997_+	hypothetical protein	NA	NA	NA	NA	NA
AWQ48590.1|3115993_3116263_+	hypothetical protein	NA	C9E2N9	Enterococcus_phage	46.9	5.1e-10
AWQ48591.1|3116400_3116796_+	hypothetical protein	NA	NA	NA	NA	NA
AWQ48592.1|3116795_3119396_+	hypothetical protein	NA	F1BUS0	Erwinia_phage	60.1	1.8e-221
AWQ48593.1|3119397_3119742_+	hypothetical protein	NA	A0A193GYX4	Enterobacter_phage	42.6	7.2e-17
AWQ48594.1|3120448_3121486_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	68.2	3.6e-136
AWQ48595.1|3121486_3123256_-	oxidoreductase	NA	A0A1S6KZW3	Salmonella_phage	65.9	1.2e-232
AWQ48596.1|3123443_3124244_+	hypothetical protein	NA	A0A1S6KZW9	Salmonella_phage	49.3	8.3e-48
AWQ48597.1|3124304_3125399_+|capsid	phage major capsid protein, P2 family	capsid	A0A1S6KZZ3	Salmonella_phage	63.8	1.4e-125
AWQ48598.1|3125402_3126059_+	hypothetical protein	NA	F1BUQ7	Erwinia_phage	45.0	2.0e-39
AWQ48599.1|3126150_3126672_+	hypothetical protein	NA	A0A1S6KZW8	Salmonella_phage	49.0	5.8e-34
AWQ48600.1|3126671_3126875_+|tail	phage tail protein	tail	F1BUQ5	Erwinia_phage	55.2	3.3e-17
AWQ48601.1|3126898_3127165_+|lysis	lysis protein	lysis	NA	NA	NA	NA
AWQ48602.1|3127164_3127650_+	lysozyme	NA	A0A1R3Y5W5	Salmonella_virus	59.3	1.7e-51
AWQ48603.1|3127646_3128084_+|lysis	lysis protein	lysis	A0A2H4JHL8	uncultured_Caudovirales_phage	46.6	8.9e-20
AWQ48604.1|3128092_3128560_+|tail	phage tail protein	tail	F1BUP9	Erwinia_phage	53.0	1.1e-39
AWQ48605.1|3128547_3129003_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	46.6	2.9e-29
AWQ48606.1|3129084_3129723_+|plate	baseplate assembly protein	plate	S4TUB5	Salmonella_phage	58.8	3.7e-59
AWQ48607.1|3129719_3130067_+|plate	baseplate assembly protein	plate	F1BUP4	Erwinia_phage	57.3	5.2e-31
AWQ48608.1|3130066_3130975_+|plate	baseplate assembly protein	plate	A0A218M4K5	Erwinia_phage	67.5	1.4e-107
AWQ48609.1|3130967_3131573_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	59.0	2.5e-60
AWQ48610.1|3131569_3134677_+	hypothetical protein	NA	NA	NA	NA	NA
AWQ48611.1|3134698_3135778_+|tail	phage tail protein	tail	A0A0M3ULH6	Salmonella_phage	49.4	1.4e-37
AWQ48612.1|3135950_3137123_+|tail	phage tail protein	tail	A0A1S6KZY7	Salmonella_phage	80.9	1.4e-181
AWQ48613.1|3137133_3137649_+|tail	phage major tail tube protein	tail	A0A218M4J0	Erwinia_phage	66.3	1.5e-58
AWQ48614.1|3137720_3138047_+|tail	phage tail protein	tail	E5G6P9	Salmonella_phage	54.5	2.8e-18
AWQ50445.1|3138058_3138181_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	73.7	5.1e-10
AWQ50444.1|3138173_3141092_+|tail	phage tail tape measure protein	tail	Q9ZXK0	Pseudomonas_virus	39.3	2.2e-154
AWQ50446.1|3141103_3141568_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	61.9	5.7e-49
AWQ48615.1|3141564_3142656_+	late control protein D	NA	E5G6Q3	Salmonella_phage	58.6	7.0e-114
AWQ48616.1|3142730_3142952_+	transcriptional regulator	NA	Q53ZE7	Salmonella_virus	66.7	5.7e-23
AWQ48617.1|3143143_3143356_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	77.1	7.6e-25
3143033:3143072	attR	TAACAAGGAACTTTTGCCCGCAGACTTGCGGGCTTTTTTT	NA	NA	NA	NA
>prophage 5
CP021164	Serratia marcescens strain 332 chromosome, complete genome	5059456	3696857	3704081	5059456		Salmonella_phage(33.33%)	10	NA	NA
AWQ49116.1|3696857_3697211_+	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	47.0	5.5e-20
AWQ49117.1|3697411_3697642_+	hypothetical protein	NA	J9Q735	Salmonella_phage	48.0	2.7e-12
AWQ49118.1|3697655_3698201_+	DNA-binding protein	NA	J9Q7G7	Salmonella_phage	57.7	8.2e-47
AWQ49119.1|3698208_3698910_-	DnaA regulatory inactivator Hda	NA	NA	NA	NA	NA
AWQ49120.1|3699182_3699698_+	E3 ubiquitin--protein ligase	NA	NA	NA	NA	NA
AWQ49121.1|3699730_3699979_+	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
AWQ49122.1|3700026_3701316_-	uracil permease	NA	Q9KX94	Enterobacteria_phage	38.2	2.7e-64
AWQ49123.1|3701523_3702153_-	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
AWQ49124.1|3702405_3703443_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	41.9	3.8e-69
AWQ49125.1|3703442_3704081_+	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	39.8	8.4e-27
>prophage 6
CP021164	Serratia marcescens strain 332 chromosome, complete genome	5059456	3787359	3794462	5059456		Klebsiella_phage(28.57%)	10	NA	NA
AWQ49191.1|3787359_3787620_-	hypothetical protein	NA	A0A248XCT8	Klebsiella_phage	54.7	1.9e-14
AWQ49192.1|3787616_3787991_-	hypothetical protein	NA	A0A248XD11	Klebsiella_phage	43.5	2.5e-10
AWQ49193.1|3787975_3788491_-	glycoside hydrolase	NA	I6PBN2	Cronobacter_phage	64.0	6.3e-49
AWQ49194.1|3788487_3788721_-	hypothetical protein	NA	G0ZNC7	Cronobacter_phage	60.5	6.0e-07
AWQ49195.1|3789064_3791518_-	hypothetical protein	NA	W8CZM5	Erwinia_phage	34.9	2.5e-87
AWQ49196.1|3791613_3791955_+	hypothetical protein	NA	NA	NA	NA	NA
AWQ50466.1|3791990_3792230_-	hypothetical protein	NA	NA	NA	NA	NA
AWQ49197.1|3792324_3792513_-	hypothetical protein	NA	NA	NA	NA	NA
AWQ49198.1|3792954_3793680_+	hypothetical protein	NA	G9L6E2	Escherichia_phage	39.5	3.5e-37
AWQ49199.1|3793757_3794462_-	transcriptional regulator	NA	A0A0P0ZD96	Stx2-converting_phage	62.7	4.7e-39
>prophage 7
CP021164	Serratia marcescens strain 332 chromosome, complete genome	5059456	3798509	3831468	5059456	integrase,terminase,tail	Salmonella_phage(20.0%)	43	3806465:3806480	3839020:3839035
AWQ49201.1|3798509_3801266_-	hypothetical protein	NA	Q858G0	Salmonella_phage	34.7	3.1e-102
AWQ49202.1|3801826_3802312_-	hypothetical protein	NA	Q858G2	Salmonella_phage	65.4	1.5e-52
AWQ49203.1|3802311_3804807_-	hypothetical protein	NA	A0A0F6TJD3	Escherichia_coli_O157_typing_phage	60.3	1.6e-302
AWQ49204.1|3804806_3805415_-	hypothetical protein	NA	A0A0F6TJN5	Escherichia_coli_O157_typing_phage	61.4	7.7e-62
AWQ49205.1|3805414_3805738_-	hypothetical protein	NA	T1SBJ0	Salmonella_phage	54.9	2.7e-21
AWQ50467.1|3805777_3806056_-	hypothetical protein	NA	NA	NA	NA	NA
AWQ49206.1|3806082_3806529_-	hypothetical protein	NA	A0A193GYT9	Enterobacter_phage	58.8	1.2e-32
3806465:3806480	attL	GTAGAAGGCGCGGTTG	NA	NA	NA	NA
AWQ49207.1|3806582_3807566_-	hypothetical protein	NA	A0A193GZ49	Enterobacter_phage	73.4	4.3e-139
AWQ49208.1|3807572_3808283_-	peptidase	NA	G9L6C4	Escherichia_phage	67.2	1.6e-50
AWQ49209.1|3808293_3808560_-	hypothetical protein	NA	V5KSC6	Escherichia_phage	88.1	2.6e-22
AWQ50468.1|3808525_3808822_-	hypothetical protein	NA	Q2A090	Sodalis_phage	71.8	1.2e-28
AWQ49210.1|3808821_3810507_-|tail	phage tail protein	tail	T1S9Z7	Salmonella_phage	58.3	1.4e-185
AWQ49211.1|3810509_3810713_-	hypothetical protein	NA	NA	NA	NA	NA
AWQ49212.1|3811044_3811233_+	hypothetical protein	NA	NA	NA	NA	NA
AWQ49213.1|3811241_3811619_+	hypothetical protein	NA	J9QM70	Pectobacterium_phage	69.8	2.1e-46
AWQ49214.1|3811709_3813182_-|terminase	terminase	terminase	G9L6B8	Escherichia_phage	77.8	2.2e-235
AWQ49215.1|3813178_3813727_-|terminase	terminase small subunit	terminase	G9L6B7	Escherichia_phage	66.9	8.5e-60
AWQ49216.1|3813835_3814222_-	hypothetical protein	NA	H9C172	Pectobacterium_phage	35.1	1.0e-11
AWQ49217.1|3814214_3814826_-	hypothetical protein	NA	R9W0X9	Serratia_phage	40.3	6.0e-22
AWQ49218.1|3814822_3815152_-	hypothetical protein	NA	G8C7S4	Escherichia_phage	77.8	3.9e-44
AWQ50469.1|3815153_3815675_-	hypothetical protein	NA	A0A1R3Y5U4	Salmonella_virus	49.3	1.2e-07
AWQ49219.1|3815712_3816147_-	hypothetical protein	NA	A0A1I9LJM5	Stx_converting_phage	43.7	4.7e-13
AWQ49220.1|3816143_3816332_-	hypothetical protein	NA	NA	NA	NA	NA
AWQ49221.1|3816644_3817061_-	hypothetical protein	NA	NA	NA	NA	NA
AWQ49222.1|3817057_3817414_-	hypothetical protein	NA	R9W085	Serratia_phage	58.0	2.1e-11
AWQ49223.1|3817424_3817637_-	hypothetical protein	NA	A2I309	Vibrio_virus	54.5	2.9e-08
AWQ50470.1|3817639_3817939_-	hypothetical protein	NA	A0A0F6R8N5	Escherichia_coli_O157_typing_phage	72.7	7.1e-37
AWQ49224.1|3818202_3818901_-	hypothetical protein	NA	A0A0U2JGJ0	Escherichia_phage	37.8	1.2e-21
AWQ49225.1|3819624_3819831_-	hypothetical protein	NA	A0A193GYW4	Enterobacter_phage	45.0	2.5e-09
AWQ49226.1|3819973_3820192_-	hypothetical protein	NA	Q858D6	Salmonella_phage	58.0	1.5e-15
AWQ49227.1|3820340_3820937_+	transcriptional regulator	NA	G9L6A6	Escherichia_phage	51.8	7.3e-49
AWQ49228.1|3820933_3821200_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	59.0	2.9e-21
AWQ49229.1|3821452_3822265_+	chromosome partitioning protein ParB	NA	K7PKM7	Enterobacterial_phage	57.8	3.9e-77
AWQ49230.1|3822465_3823512_+	hypothetical protein	NA	M9P0E1	Enterobacteria_phage	59.5	5.1e-37
AWQ49231.1|3823519_3823825_+	hypothetical protein	NA	NA	NA	NA	NA
AWQ49232.1|3823824_3824646_+	exodeoxyribonuclease VIII	NA	A0A193GYK2	Enterobacter_phage	78.3	3.5e-126
AWQ49233.1|3824642_3825542_+	recombinase RecT	NA	T1SBJ5	Salmonella_phage	69.0	2.0e-111
AWQ49234.1|3825582_3825834_+	transcriptional regulator	NA	A0A193GYW1	Enterobacter_phage	48.8	4.2e-14
AWQ49235.1|3825951_3826614_+	DNA methyltransferase	NA	A0A248SKY3	Klebsiella_phage	66.0	4.3e-82
AWQ49236.1|3826610_3826895_+	hypothetical protein	NA	NA	NA	NA	NA
AWQ49237.1|3826898_3828101_-|integrase	integrase	integrase	T1S9J3	Salmonella_phage	68.5	4.0e-155
AWQ49238.1|3828325_3829903_-	GMP synthase (glutamine-hydrolyzing)	NA	NA	NA	NA	NA
AWQ49239.1|3830004_3831468_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.5	1.2e-87
3839020:3839035	attR	CAACCGCGCCTTCTAC	NA	NA	NA	NA
