The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP021162	Enterobacter hormaechei strain 234 chromosome, complete genome	4656282	1155279	1197780	4656282	terminase,tail,integrase,head,lysis,coat	Enterobacteria_phage(26.42%)	66	1155220:1155278	1202891:1202949
1155220:1155278	attL	CTTCTAAGCCGTAGGTCGTAGGTTCGAATCCTACAGGGCGTGCCATTTAAAAACAGGCG	NA	NA	NA	NA
AWQ45648.1|1155279_1156323_-|integrase	integrase	integrase	G8C7S0	Escherichia_phage	98.8	3.4e-203
AWQ45647.1|1156319_1156655_-	excisionase	NA	NA	NA	NA	NA
AWQ42454.1|1156761_1157064_-	hypothetical protein	NA	NA	NA	NA	NA
AWQ42455.1|1157073_1157313_-	hypothetical protein	NA	M1FPC8	Enterobacteria_phage	71.8	2.4e-27
AWQ45649.1|1157290_1157947_-	hypothetical protein	NA	M1F3E2	Salmonella_phage	47.5	9.5e-42
AWQ45650.1|1157958_1158417_-	hypothetical protein	NA	A0A142IE12	Pseudomonas_phage	46.3	2.3e-26
AWQ42456.1|1158619_1158838_-	hypothetical protein	NA	A0A0N7C211	Escherichia_phage	60.6	1.1e-15
AWQ42457.1|1158929_1159160_-	hypothetical protein	NA	S4TRP7	Salmonella_phage	39.7	6.5e-06
AWQ42458.1|1159156_1159378_-	hypothetical protein	NA	NA	NA	NA	NA
AWQ42459.1|1159374_1159593_-	hypothetical protein	NA	NA	NA	NA	NA
AWQ42460.1|1159589_1161503_-	phage N-6-adenine-methyltransferase	NA	A0A1B0V7P0	Salmonella_phage	48.3	5.9e-116
AWQ42461.1|1161499_1161652_-	cruciferin	NA	T1SAR0	Salmonella_phage	44.2	2.8e-05
AWQ42462.1|1161648_1162077_-	regulator	NA	G8C7S8	Escherichia_phage	95.1	2.2e-71
AWQ42463.1|1162085_1162568_-	hypothetical protein	NA	G8C7S9	Escherichia_phage	98.1	5.5e-79
AWQ42464.1|1162564_1163479_-	DNA recombinase	NA	G8C7T0	Escherichia_phage	97.7	3.2e-168
AWQ42465.1|1163488_1163767_-	hypothetical protein	NA	A0A0P0ZFG3	Escherichia_phage	77.4	3.1e-34
AWQ42466.1|1163774_1164746_-	hypothetical protein	NA	M9P0E1	Enterobacteria_phage	98.2	6.7e-84
AWQ42467.1|1164816_1165026_-	cell division protein FtsZ	NA	M9NZE2	Enterobacteria_phage	91.3	8.2e-32
AWQ42468.1|1165177_1165687_-	hypothetical protein	NA	G8C7T4	Escherichia_phage	97.0	1.1e-88
AWQ42469.1|1165846_1166284_-	hypothetical protein	NA	K7P7N6	Enterobacteria_phage	97.2	1.4e-76
AWQ42470.1|1166785_1167139_-	hypothetical protein	NA	NA	NA	NA	NA
AWQ42471.1|1167163_1167802_-	LexA family transcriptional repressor	NA	K7PH71	Enterobacterial_phage	78.2	1.6e-94
AWQ42472.1|1167906_1168122_+	transcriptional regulator	NA	K7PMD5	Enterobacterial_phage	81.7	1.7e-27
AWQ42473.1|1168152_1168698_+	hypothetical protein	NA	G8C7U3	Escherichia_phage	82.3	2.1e-79
AWQ42474.1|1168926_1169826_+	DNA replication protein	NA	A0A0N7C1Z7	Escherichia_phage	55.0	1.4e-80
AWQ42475.1|1169815_1171249_+	helicase DnaB	NA	Q716D2	Shigella_phage	87.1	1.8e-231
AWQ42476.1|1171248_1171548_+	protein ren	NA	M1FPD5	Enterobacteria_phage	53.7	7.4e-18
AWQ42477.1|1171544_1172081_+	hypothetical protein	NA	A0A0F6N6A6	Escherichia_phage	35.2	1.5e-05
AWQ42478.1|1172077_1172305_+	hypothetical protein	NA	NA	NA	NA	NA
AWQ42479.1|1172301_1172670_+	hypothetical protein	NA	NA	NA	NA	NA
AWQ42480.1|1173328_1173583_+	hypothetical protein	NA	A0A1B0V7L5	Salmonella_phage	45.6	1.0e-07
AWQ42481.1|1173728_1174010_+	hypothetical protein	NA	A0A0K2FIU9	Enterobacteria_phage	53.8	3.2e-23
AWQ42482.1|1174220_1174670_+	protein ninB	NA	I6R9D0	Salmonella_phage	47.5	2.5e-33
AWQ42483.1|1174662_1174833_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	89.3	4.5e-20
AWQ42484.1|1174829_1175498_+	serine/threonine protein phosphatase	NA	K7P6H8	Enterobacteria_phage	91.9	1.9e-122
AWQ42485.1|1175490_1176132_+	NinG family protein	NA	M9NYX8	Enterobacteria_phage	93.9	2.7e-105
AWQ42486.1|1176128_1176329_+	hypothetical protein	NA	NA	NA	NA	NA
AWQ42487.1|1176428_1177118_+	antiterminator	NA	I6PDF8	Cronobacter_phage	53.6	1.3e-57
AWQ42488.1|1177850_1178075_+|lysis	lysis protein	lysis	M9NZI9	Enterobacteria_phage	90.5	2.0e-31
AWQ42489.1|1178052_1178547_+	lysozyme	NA	M9P0E5	Enterobacteria_phage	96.3	1.6e-89
AWQ42490.1|1178543_1179005_+|lysis	lysis protein	lysis	M9NYX9	Enterobacteria_phage	70.6	8.7e-50
AWQ42491.1|1179039_1179312_+	hypothetical protein	NA	K7P6G5	Enterobacteria_phage	67.8	6.7e-26
AWQ42492.1|1179462_1179681_+	hypothetical protein	NA	NA	NA	NA	NA
AWQ42493.1|1179677_1179884_+	hypothetical protein	NA	NA	NA	NA	NA
AWQ42494.1|1179887_1180538_+	hypothetical protein	NA	G8C7P2	Escherichia_phage	97.7	1.1e-111
AWQ42495.1|1180534_1182097_+|terminase	terminase	terminase	G8C7P3	Escherichia_phage	92.5	1.3e-302
AWQ42496.1|1182107_1183583_+	DUF1073 domain-containing protein	NA	F1C5D7	Cronobacter_phage	61.6	5.3e-157
AWQ42497.1|1183509_1184520_+|head	phage head morphogenesis protein	head	F1C5D8	Cronobacter_phage	67.3	2.7e-112
AWQ42498.1|1184520_1184868_-	hypothetical protein	NA	NA	NA	NA	NA
AWQ42499.1|1184920_1186291_+	DUF2213 domain-containing protein	NA	F1C5D9	Cronobacter_phage	51.9	1.8e-122
AWQ42500.1|1186290_1186752_+	hypothetical protein	NA	R9TR06	Aeromonas_phage	47.6	2.2e-29
AWQ42501.1|1186748_1187804_+|coat	phage coat protein	coat	A0A291AXD4	Shigella_phage	53.8	1.2e-102
AWQ42502.1|1187836_1188070_+	hypothetical protein	NA	NA	NA	NA	NA
AWQ42503.1|1188072_1188453_+	hypothetical protein	NA	F1C5E2	Cronobacter_phage	55.3	3.1e-29
AWQ42504.1|1188452_1188626_+	50S ribosomal protein L13	NA	Q5G8X7	Enterobacteria_phage	47.4	5.1e-11
AWQ42505.1|1188625_1188982_+	hypothetical protein	NA	G0ZNE2	Cronobacter_phage	56.4	2.7e-27
AWQ42506.1|1188984_1189353_+	hypothetical protein	NA	F1C5E3	Cronobacter_phage	77.0	1.6e-46
AWQ42507.1|1189349_1189733_+	hypothetical protein	NA	F1C5E4	Cronobacter_phage	60.6	1.1e-37
AWQ42508.1|1189797_1190577_+	hypothetical protein	NA	F1C5E5	Cronobacter_phage	62.4	1.2e-54
AWQ42509.1|1190637_1191309_+	hypothetical protein	NA	G0ZNE7	Cronobacter_phage	46.9	1.7e-49
AWQ42510.1|1191350_1193684_+|tail	phage tail tape measure protein	tail	A0A1B1W284	Salmonella_phage	51.2	2.0e-150
AWQ42511.1|1193694_1193922_+	hypothetical protein	NA	NA	NA	NA	NA
AWQ42512.1|1193963_1194467_+	hypothetical protein	NA	F1C5F0	Cronobacter_phage	85.0	2.5e-82
AWQ42513.1|1194466_1194937_+	hypothetical protein	NA	F1C5F1	Cronobacter_phage	80.1	1.0e-66
AWQ42514.1|1194950_1195316_+	hypothetical protein	NA	F1C5F2	Cronobacter_phage	86.6	3.3e-60
AWQ42515.1|1195302_1197780_+|tail	phage tail protein	tail	F1C5A7	Cronobacter_phage	92.8	0.0e+00
1202891:1202949	attR	CTTCTAAGCCGTAGGTCGTAGGTTCGAATCCTACAGGGCGTGCCATTTAAAAACAGGCG	NA	NA	NA	NA
>prophage 2
CP021162	Enterobacter hormaechei strain 234 chromosome, complete genome	4656282	1819703	1884683	4656282	capsid,terminase,tail,integrase,head,portal,tRNA	Enterobacterial_phage(32.08%)	78	1813386:1813403	1892452:1892469
1813386:1813403	attL	TTTTGTAGGCCGGGTAAG	NA	NA	NA	NA
AWQ43074.1|1819703_1820816_-|tRNA	tRNA(5-methylaminomethyl-2-thiouridine)- methyltransferase	tRNA	NA	NA	NA	NA
AWQ43075.1|1820856_1821330_-	NUDIX hydrolase	NA	NA	NA	NA	NA
AWQ43076.1|1821329_1821992_-	23S rRNA pseudouridine(2457) synthase	NA	NA	NA	NA	NA
AWQ43077.1|1822109_1823360_+	isocitrate dehydrogenase (NADP(+))	NA	Q77Z09	Phage_21	94.4	7.9e-21
AWQ43078.1|1823435_1823681_+	hypothetical protein	NA	NA	NA	NA	NA
AWQ43079.1|1823685_1825185_-	diguanylate phosphodiesterase	NA	NA	NA	NA	NA
AWQ43080.1|1825309_1825402_-	hypothetical protein	NA	NA	NA	NA	NA
AWQ43081.1|1825772_1826021_+	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
AWQ43082.1|1826293_1827322_-	GGDEF domain-containing protein	NA	G3MA91	Bacillus_virus	32.1	5.0e-13
AWQ43083.1|1827417_1827630_-	hypothetical protein	NA	NA	NA	NA	NA
AWQ43084.1|1827634_1827889_+	hemolysin	NA	NA	NA	NA	NA
AWQ43085.1|1827969_1828275_+	hypothetical protein	NA	NA	NA	NA	NA
AWQ43086.1|1828275_1828620_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AWQ43087.1|1828770_1829478_+	hypothetical protein	NA	NA	NA	NA	NA
AWQ43088.1|1829509_1830697_-	cyanate MFS transporter	NA	NA	NA	NA	NA
AWQ43089.1|1830796_1831588_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AWQ43090.1|1831571_1832018_-	DUF441 family protein	NA	NA	NA	NA	NA
AWQ43091.1|1832124_1834161_-	family 31 glucosidase	NA	NA	NA	NA	NA
AWQ43092.1|1834176_1835508_-	MFS transporter	NA	NA	NA	NA	NA
AWQ43093.1|1835917_1836418_-	hypothetical protein	NA	NA	NA	NA	NA
AWQ43094.1|1836637_1837780_-|integrase	integrase	integrase	O21929	Phage_21	49.0	1.4e-93
AWQ43095.1|1837754_1838018_-	hypothetical protein	NA	NA	NA	NA	NA
AWQ43096.1|1838053_1838323_-	hypothetical protein	NA	M9NZE4	Enterobacteria_phage	86.7	6.5e-13
AWQ43097.1|1838333_1838597_-	hypothetical protein	NA	A0A220NQU8	Salmonella_phage	85.1	4.3e-38
AWQ43098.1|1839107_1840130_-	chromosome partitioning protein ParB	NA	K7PKM7	Enterobacterial_phage	90.4	2.7e-168
AWQ43099.1|1840129_1840543_-	hypothetical protein	NA	K7PJS4	Enterobacterial_phage	81.6	1.1e-51
AWQ43100.1|1840816_1841008_-	hypothetical protein	NA	NA	NA	NA	NA
AWQ43101.1|1841348_1842005_-	LexA family transcriptional repressor	NA	K7PLZ5	Enterobacterial_phage	98.6	7.9e-121
AWQ45665.1|1842104_1842302_+	hypothetical protein	NA	K7PHB1	Enterobacterial_phage	96.9	1.4e-28
AWQ43102.1|1842327_1842798_+	hypothetical protein	NA	K7PJS5	Enterobacterial_phage	92.9	1.4e-74
AWQ43103.1|1843038_1843245_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	67.3	3.8e-13
AWQ43104.1|1843207_1844134_+	transcriptional regulator	NA	K7PLZ7	Enterobacterial_phage	83.4	4.9e-68
AWQ43105.1|1844130_1844625_+	hypothetical protein	NA	NA	NA	NA	NA
AWQ43106.1|1844624_1845377_+	hypothetical protein	NA	M1FN76	Enterobacteria_phage	90.0	2.0e-136
AWQ43107.1|1845381_1846047_+	DNA methyltransferase	NA	I6PDF5	Cronobacter_phage	78.8	5.6e-98
AWQ43108.1|1846043_1846271_+	hypothetical protein	NA	NA	NA	NA	NA
AWQ43109.1|1846267_1846588_+	LexA family transcriptional regulator	NA	K7PHB4	Enterobacterial_phage	77.4	1.9e-43
AWQ43110.1|1846584_1846974_+	hypothetical protein	NA	K7PKN5	Enterobacterial_phage	96.0	1.9e-66
AWQ43111.1|1846989_1847715_+	phage regulatory protein/antirepressor Ant	NA	G0ZND1	Cronobacter_phage	52.7	2.2e-55
AWQ43112.1|1847711_1848701_+	hypothetical protein	NA	K7PJS6	Enterobacterial_phage	89.1	1.2e-178
AWQ43113.1|1848713_1849292_+	hypothetical protein	NA	A0A0U2S606	Escherichia_phage	53.9	7.3e-46
AWQ43114.1|1849513_1849939_+	tellurite/colicin resistance protein	NA	Q71TK7	Escherichia_phage	84.4	6.6e-60
AWQ43115.1|1850201_1850588_+	hypothetical protein	NA	A0A192Y8P2	Salmonella_phage	89.8	1.2e-52
AWQ43116.1|1850574_1850856_+	hypothetical protein	NA	K7PKN9	Enterobacterial_phage	48.4	2.6e-20
AWQ43117.1|1850855_1851485_+	endolysin	NA	G8C7W0	Escherichia_phage	88.5	3.5e-102
AWQ45666.1|1851492_1851762_+	hypothetical protein	NA	G8C7W1	Escherichia_phage	80.5	3.2e-28
AWQ43118.1|1851718_1851898_+	hypothetical protein	NA	K7PM01	Enterobacterial_phage	90.2	2.7e-15
AWQ43119.1|1852750_1853617_+	hypothetical protein	NA	NA	NA	NA	NA
AWQ43120.1|1854647_1854875_+	hypothetical protein	NA	NA	NA	NA	NA
AWQ43121.1|1854891_1856349_+	glycosyltransferase	NA	K7PKP3	Enterobacterial_phage	90.3	4.6e-270
AWQ43122.1|1856360_1856696_+	hypothetical protein	NA	NA	NA	NA	NA
AWQ43123.1|1856649_1856907_-	hypothetical protein	NA	K7P7V5	Enterobacteria_phage	95.1	2.7e-32
AWQ43124.1|1857072_1857666_+	hypothetical protein	NA	S4TR53	Salmonella_phage	79.7	5.1e-95
AWQ43125.1|1857658_1858027_+	HNH endonuclease	NA	S4TTG9	Salmonella_phage	87.7	5.9e-57
AWQ43126.1|1858132_1858627_+|terminase	terminase	terminase	S4TNN3	Salmonella_phage	100.0	1.7e-83
AWQ43127.1|1858626_1860285_+|terminase	terminase	terminase	S4TSQ6	Salmonella_phage	98.7	0.0e+00
AWQ43128.1|1860343_1862278_+|capsid	phage major capsid protein	capsid	S4TNE3	Salmonella_phage	93.5	0.0e+00
AWQ43129.1|1862480_1863839_+|portal	phage portal protein	portal	S4TTG7	Salmonella_phage	97.8	4.6e-256
AWQ43130.1|1863835_1864879_+|portal	phage portal protein	portal	S4TNN1	Salmonella_phage	77.8	9.7e-89
AWQ43131.1|1864875_1865202_+	DNA-packaging protein	NA	S4TSQ3	Salmonella_phage	86.1	1.9e-46
AWQ43132.1|1865210_1865561_+|head,tail	head-tail adaptor protein	head,tail	S4TND9	Salmonella_phage	93.1	6.8e-55
AWQ43133.1|1865557_1866007_+	hypothetical protein	NA	K7PH84	Enterobacterial_phage	97.3	3.8e-74
AWQ43134.1|1866003_1866351_+	hypothetical protein	NA	K7PKL6	Enterobacterial_phage	94.8	2.1e-56
AWQ43135.1|1866405_1866876_+|tail	phage tail protein	tail	A0A220NRQ0	Escherichia_phage	98.1	9.7e-81
AWQ43136.1|1866930_1867332_+|tail	phage tail protein	tail	K7P7C2	Enterobacteria_phage	94.7	2.9e-65
AWQ43137.1|1867355_1867619_+|tail	phage tail protein	tail	K7P7L5	Enterobacteria_phage	93.1	2.7e-40
AWQ43138.1|1867654_1870936_+|tail	phage tail tape measure protein	tail	A0A220NRN7	Escherichia_phage	93.8	0.0e+00
AWQ43139.1|1870938_1871277_+|tail	phage tail protein	tail	K7PHL4	Enterobacterial_phage	98.2	1.5e-62
AWQ43140.1|1871273_1872032_+|tail	phage minor tail protein L	tail	G8C7J7	Escherichia_phage	95.6	6.5e-143
AWQ43141.1|1872033_1872744_+	peptidase P60	NA	K7PGV2	Enterobacterial_phage	97.5	6.5e-145
AWQ43142.1|1872776_1873124_+	hypothetical protein	NA	Q5G8W9	Enterobacteria_phage	47.3	1.5e-06
AWQ43143.1|1873130_1873466_+	hypothetical protein	NA	Q6UAW3	Klebsiella_phage	48.6	5.6e-22
AWQ43144.1|1874173_1877755_+	host specificity protein	NA	Q9MCR7	Enterobacteria_phage	91.6	0.0e+00
AWQ43145.1|1877756_1878722_+	hypothetical protein	NA	G1CSU0	Cronobacter_virus	39.9	2.2e-58
AWQ43146.1|1880298_1882278_+	acyltransferase	NA	C6ZR20	Salmonella_phage	31.0	8.9e-67
AWQ45667.1|1882578_1882818_+	hypothetical protein	NA	K7P7E2	Enterobacteria_phage	70.5	1.1e-24
AWQ43147.1|1882817_1883138_+	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	56.6	5.5e-27
AWQ43148.1|1883399_1884683_-	hypothetical protein	NA	A0A140HLI1	Bacillus_phage	28.3	1.1e-09
1892452:1892469	attR	CTTACCCGGCCTACAAAA	NA	NA	NA	NA
>prophage 3
CP021162	Enterobacter hormaechei strain 234 chromosome, complete genome	4656282	2452872	2488293	4656282	terminase,tail	Cronobacter_phage(22.22%)	42	NA	NA
AWQ43654.1|2452872_2453073_+	hypothetical protein	NA	A0A0U2JGI6	Escherichia_phage	71.7	1.1e-20
AWQ43655.1|2454175_2454493_-	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	48.1	1.5e-21
AWQ43656.1|2454492_2454732_-	hypothetical protein	NA	K7P7E2	Enterobacteria_phage	69.2	2.1e-23
AWQ43657.1|2455031_2457011_-	hypothetical protein	NA	C6ZR20	Salmonella_phage	30.7	1.7e-65
AWQ43658.1|2458586_2458820_-	cor protein	NA	E4WL42	Enterobacteria_phage	78.9	3.9e-30
AWQ43659.1|2458927_2459599_-	hypothetical protein	NA	A0A2P0WA07	Enterobacter_phage	73.1	9.9e-87
AWQ43660.1|2459599_2459914_-	hypothetical protein	NA	A0A2P0WA17	Enterobacter_phage	68.6	7.8e-34
AWQ43661.1|2459956_2463508_-	host specificity protein	NA	Q9MCU0	Escherichia_phage	87.7	0.0e+00
AWQ43662.1|2463560_2464184_-|tail	phage tail protein	tail	K7PGY0	Enterobacteria_phage	57.4	2.1e-54
AWQ43663.1|2464271_2464931_-	hypothetical protein	NA	NA	NA	NA	NA
AWQ43664.1|2464968_2465682_-	peptidase P60	NA	K7PJV6	Enterobacteria_phage	84.1	6.8e-126
AWQ43665.1|2465683_2466439_-|tail	phage minor tail protein L	tail	K7PJS0	Enterobacterial_phage	79.2	5.0e-119
AWQ43666.1|2466435_2466783_-|tail	phage tail protein	tail	I6PBN7	Cronobacter_phage	63.5	2.9e-37
AWQ43667.1|2466844_2467201_-	hypothetical protein	NA	NA	NA	NA	NA
AWQ43668.1|2467321_2470234_-|tail	phage tail tape measure protein	tail	I6PCW3	Cronobacter_phage	38.7	3.1e-153
AWQ43669.1|2470230_2470545_-	hypothetical protein	NA	I6PD79	Cronobacter_phage	66.7	5.1e-17
AWQ43670.1|2470541_2470853_-	hypothetical protein	NA	I6PDG2	Cronobacter_phage	67.0	5.3e-35
AWQ43671.1|2470918_2471590_-|tail	phage tail protein	tail	I6PBN6	Cronobacter_phage	47.7	2.6e-50
AWQ43672.1|2471658_2472069_-	hypothetical protein	NA	I6PDJ8	Cronobacter_phage	51.4	2.5e-32
AWQ43673.1|2472065_2472650_-	hypothetical protein	NA	G8C7Q1	Escherichia_phage	53.7	1.2e-48
AWQ43674.1|2472651_2473002_-	hypothetical protein	NA	I6PD77	Cronobacter_phage	57.8	1.6e-32
AWQ43675.1|2473003_2473486_-	hypothetical protein	NA	A0A2I7RR81	Vibrio_phage	31.3	5.1e-08
AWQ43676.1|2473803_2474757_-	hypothetical protein	NA	A0A1B0VMF8	Pseudomonas_phage	75.0	2.6e-133
AWQ43677.1|2474768_2475539_-	hypothetical protein	NA	A0A1B0VMG1	Pseudomonas_phage	59.6	6.3e-69
AWQ43678.1|2475619_2476717_-	hypothetical protein	NA	I6PD76	Cronobacter_phage	57.9	2.3e-117
AWQ43679.1|2476718_2478107_-	hypothetical protein	NA	A0A1B0VMH0	Pseudomonas_phage	49.9	1.5e-124
AWQ43680.1|2478108_2479416_-|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	57.5	1.3e-143
AWQ43681.1|2479393_2480392_-|terminase	terminase small subunit	terminase	I6X6R5	Burkholderia_virus	43.4	1.1e-38
AWQ43682.1|2480438_2480888_-	hypothetical protein	NA	NA	NA	NA	NA
AWQ43683.1|2481669_2481858_+	hypothetical protein	NA	NA	NA	NA	NA
AWQ45687.1|2482608_2482884_-	hypothetical protein	NA	G8C7W1	Escherichia_phage	84.4	3.7e-32
AWQ43684.1|2482891_2483521_-	endolysin	NA	G8C7W0	Escherichia_phage	87.6	4.6e-102
AWQ43685.1|2483520_2483802_-	hypothetical protein	NA	K7PKN9	Enterobacterial_phage	46.2	1.3e-19
AWQ43686.1|2483788_2484175_-	hypothetical protein	NA	A0A192Y8P2	Salmonella_phage	78.1	3.2e-45
AWQ43687.1|2484268_2484457_-	hypothetical protein	NA	NA	NA	NA	NA
AWQ43688.1|2484960_2485152_-	hypothetical protein	NA	NA	NA	NA	NA
AWQ43689.1|2485677_2486511_-	antitermination protein	NA	K7PKS8	Enterobacteria_phage	78.3	2.8e-123
AWQ45688.1|2486507_2486870_-	hypothetical protein	NA	K7PM48	Enterobacteria_phage	83.1	5.2e-50
AWQ43690.1|2486872_2487073_-	hypothetical protein	NA	H6WRY8	Salmonella_phage	78.8	9.0e-28
AWQ43691.1|2487077_2487680_-	hypothetical protein	NA	A0A0M4QX23	Salmonella_phage	82.0	4.4e-94
AWQ45689.1|2487719_2487917_-	hypothetical protein	NA	K7PHG9	Enterobacteria_phage	70.5	1.4e-20
AWQ43692.1|2488068_2488293_-	DinI family protein	NA	H6WRY5	Salmonella_phage	62.3	1.8e-21
>prophage 4
CP021162	Enterobacter hormaechei strain 234 chromosome, complete genome	4656282	2492368	2506090	4656282	integrase,tRNA	Escherichia_phage(46.15%)	14	2501289:2501304	2515656:2515671
AWQ43698.1|2492368_2493055_-	phage replication protein	NA	G8C7U6	Escherichia_phage	63.0	1.2e-82
AWQ45690.1|2493051_2493909_-	hypothetical protein	NA	K7PGZ0	Enterobacteria_phage	70.8	9.1e-101
AWQ43699.1|2494053_2494596_-	regulator	NA	M9NZI6	Enterobacteria_phage	85.6	1.6e-82
AWQ43700.1|2494625_2494877_-	transcriptional regulator	NA	G8C7U2	Escherichia_phage	53.3	9.9e-16
AWQ43701.1|2495004_2495697_+	hypothetical protein	NA	G8C7U1	Escherichia_phage	53.3	4.1e-59
AWQ43702.1|2495710_2496085_-	hypothetical protein	NA	NA	NA	NA	NA
AWQ43703.1|2496662_2497154_-	hypothetical protein	NA	A0A077K9U2	Edwardsiella_phage	29.3	5.3e-13
AWQ43704.1|2497657_2500795_+	exodeoxyribonuclease	NA	K7P6V4	Enterobacteria_phage	62.8	0.0e+00
AWQ43705.1|2500804_2501890_+	enterohemolysin	NA	K7PKR8	Enterobacteria_phage	63.6	7.4e-124
2501289:2501304	attL	TGCTGGCTCAGGCCCG	NA	NA	NA	NA
AWQ43706.1|2501928_2502171_+	hypothetical protein	NA	K7PHF4	Enterobacteria_phage	93.6	1.3e-33
AWQ43707.1|2502235_2502448_+	hypothetical protein	NA	A0A0U2RY08	Escherichia_phage	64.8	4.3e-20
AWQ43708.1|2502449_2503688_+|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	70.5	3.5e-170
AWQ43709.1|2503737_2504673_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	95.7	3.0e-142
AWQ43710.1|2504716_2506090_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	31.9	3.6e-51
2515656:2515671	attR	CGGGCCTGAGCCAGCA	NA	NA	NA	NA
>prophage 5
CP021162	Enterobacter hormaechei strain 234 chromosome, complete genome	4656282	2990903	2997181	4656282		Enterobacteria_phage(50.0%)	6	NA	NA
AWQ44131.1|2990903_2991440_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	59.6	1.4e-51
AWQ44132.1|2991443_2992322_-	glucose-1-phosphate thymidylyltransferase	NA	I7I009	Enterobacteria_phage	64.5	3.9e-107
AWQ44133.1|2992374_2993274_-	NAD(P)-dependent oxidoreductase	NA	A0A140G5S3	Enterobacteria_phage	35.0	9.7e-29
AWQ44134.1|2993273_2994359_-	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	51.5	3.7e-99
AWQ44135.1|2994718_2995615_-	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	1.8e-43
AWQ44136.1|2995789_2997181_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	32.3	4.8e-19
>prophage 6
CP021162	Enterobacter hormaechei strain 234 chromosome, complete genome	4656282	3435508	3514652	4656282	capsid,tail,integrase,head,portal,tRNA,plate	Salmonella_phage(70.59%)	86	3480450:3480499	3514861:3514910
AWQ44511.1|3435508_3436246_-|tRNA	tRNA (adenosine(37)-N6)-methyltransferase TrmM	tRNA	NA	NA	NA	NA
AWQ44512.1|3436378_3437707_+	ATP-dependent RNA helicase SrmB	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.5	4.7e-48
AWQ44513.1|3437759_3438143_-	autonomous glycyl radical cofactor GrcA	NA	A0A193GZ98	Escherichia_phage	71.8	2.1e-33
AWQ44514.1|3438458_3439148_+	uracil-DNA glycosylase	NA	A0A077BCN4	Equid_alphaherpesvirus	51.6	1.8e-54
AWQ44515.1|3439187_3440273_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
AWQ44516.1|3440477_3440897_+	thiol disulfide reductase thioredoxin	NA	A0A0K2FIM3	Achromobacter_phage	37.2	1.2e-13
AWQ44517.1|3440967_3441666_+	DTW domain-containing protein	NA	NA	NA	NA	NA
AWQ44518.1|3441701_3444365_+	protein acetyltransferase	NA	NA	NA	NA	NA
AWQ44519.1|3444474_3445830_+	phosphatidylserine synthase	NA	NA	NA	NA	NA
AWQ44520.1|3445876_3446200_+	hypothetical protein	NA	NA	NA	NA	NA
AWQ44521.1|3446196_3447504_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	29.6	2.7e-43
AWQ44522.1|3447655_3448108_-	hypothetical protein	NA	M4QHR1	Cyanophage	50.0	3.9e-34
AWQ44523.1|3453640_3456214_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.5	2.6e-127
AWQ44524.1|3456343_3457075_-	hypothetical protein	NA	NA	NA	NA	NA
AWQ44525.1|3457071_3458052_-	23S rRNA pseudouridine(1911/1915/1917) synthase	NA	NA	NA	NA	NA
AWQ44526.1|3458183_3458921_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
AWQ44527.1|3459188_3459530_+	ribosomal subunit interface protein	NA	NA	NA	NA	NA
AWQ44528.1|3459790_3460951_+	chorismate mutase	NA	NA	NA	NA	NA
AWQ44529.1|3460947_3461820_-	gluconolactonase	NA	NA	NA	NA	NA
AWQ44530.1|3461880_3463002_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
AWQ44531.1|3463012_3464083_-	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.5	3.4e-89
AWQ44532.1|3464295_3464670_+	hypothetical protein	NA	NA	NA	NA	NA
AWQ44533.1|3464823_3465360_+	hypothetical protein	NA	NA	NA	NA	NA
AWQ44534.1|3465352_3466573_+	diguanylate cyclase	NA	A0A2K8I9Y5	Pseudomonas_phage	39.8	1.2e-05
AWQ44535.1|3466585_3467071_+	hypothetical protein	NA	NA	NA	NA	NA
AWQ44536.1|3467073_3468444_-	hypothetical protein	NA	NA	NA	NA	NA
AWQ44537.1|3468482_3468887_-	hypothetical protein	NA	NA	NA	NA	NA
AWQ44538.1|3469019_3469367_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
AWQ44539.1|3469410_3470178_-|tRNA	tRNA (guanine(37)-N(1))-methyltransferase	tRNA	NA	NA	NA	NA
AWQ44540.1|3470209_3470749_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
AWQ44541.1|3470764_3471013_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
AWQ44542.1|3471129_3472491_-	signal recognition particle protein	NA	NA	NA	NA	NA
AWQ45712.1|3472657_3473449_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
AWQ44543.1|3473468_3474755_+	magnesium/cobalt efflux protein	NA	NA	NA	NA	NA
AWQ44544.1|3474807_3475425_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
AWQ44545.1|3475523_3476402_+	NAD(+) kinase	NA	NA	NA	NA	NA
AWQ44546.1|3476487_3478149_+	DNA repair protein RecN	NA	NA	NA	NA	NA
AWQ44547.1|3478123_3478306_+	hypothetical protein	NA	NA	NA	NA	NA
AWQ44548.1|3478287_3478626_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
AWQ44549.1|3478687_3478975_-	RnfH family protein	NA	NA	NA	NA	NA
AWQ44550.1|3478964_3479441_-	ubiquinone-binding protein	NA	NA	NA	NA	NA
AWQ44551.1|3479558_3480041_+	SsrA-binding protein	NA	W5RAM5	Staphylococcus_phage	46.8	6.8e-29
3480450:3480499	attL	ATGTAGAAATTTCGGACGCGGGTTCAACTCCCGCCAGCTCCACCAAATAA	NA	NA	NA	NA
AWQ45713.1|3480611_3480830_-	levansucrase regulator	NA	Q53ZE7	Salmonella_virus	94.4	5.7e-36
AWQ44552.1|3480898_3481999_-	late control protein D	NA	A0A1S6KZZ5	Salmonella_phage	91.5	4.6e-182
AWQ44553.1|3481995_3482481_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	91.9	1.0e-72
AWQ44554.1|3482483_3485924_-|tail	phage tail tape measure protein	tail	A0A1S6L010	Salmonella_phage	72.0	0.0e+00
AWQ44555.1|3485916_3486036_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	92.3	3.3e-14
AWQ44556.1|3486050_3486353_-	hypothetical protein	NA	A0A1S6KZZ9	Salmonella_phage	90.0	3.1e-40
AWQ44557.1|3486407_3486923_-|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	93.0	7.6e-87
AWQ44558.1|3486932_3488105_-|tail	phage tail protein	tail	A0A1S6KZY7	Salmonella_phage	92.8	9.5e-210
AWQ44559.1|3488185_3488743_-	DNA-invertase	NA	A0A1S6L009	Salmonella_phage	87.2	5.9e-85
AWQ44560.1|3489289_3489763_-|tail	phage tail protein	tail	F1BUP0	Erwinia_phage	59.6	6.6e-53
AWQ44561.1|3489858_3491250_-|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	73.5	2.9e-141
AWQ44562.1|3491246_3491852_-|tail	phage tail protein I	tail	E5G6N9	Salmonella_phage	93.5	2.3e-111
AWQ44563.1|3491844_3492753_-|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	90.4	1.6e-143
AWQ44564.1|3492739_3493099_-|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	89.8	2.9e-53
AWQ44565.1|3493095_3493674_-|plate	baseplate assembly protein	plate	E5G6N6	Salmonella_phage	96.4	1.6e-104
AWQ44566.1|3493794_3494898_+	hypothetical protein	NA	A0A0R6PKN1	Moraxella_phage	27.7	1.9e-18
AWQ44567.1|3494900_3495386_+	hypothetical protein	NA	NA	NA	NA	NA
AWQ44568.1|3495406_3495856_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	73.9	2.4e-52
AWQ44569.1|3495848_3496280_-|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	86.7	1.5e-67
AWQ44570.1|3496242_3496446_-	hypothetical protein	NA	A0A1S6KZX6	Salmonella_phage	88.1	5.9e-27
AWQ44571.1|3496375_3496804_-	hypothetical protein	NA	A0A1S6KZX8	Salmonella_phage	82.9	4.4e-56
AWQ44572.1|3496800_3497316_-	glycoside hydrolase	NA	E5G6N1	Salmonella_phage	75.3	4.5e-71
AWQ44573.1|3497296_3497512_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	64.8	4.4e-20
AWQ44574.1|3497515_3497719_-|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	98.5	2.5e-33
AWQ44575.1|3497718_3498183_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.6	6.4e-77
AWQ44576.1|3498276_3498927_-	hypothetical protein	NA	A0A1S6KZX1	Salmonella_phage	96.3	1.1e-111
AWQ44577.1|3498930_3500013_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	94.6	3.4e-185
AWQ44578.1|3500029_3500863_-|capsid	capsid protein	capsid	A0A1S6KZW9	Salmonella_phage	83.4	2.5e-111
AWQ44579.1|3501005_3502772_+	oxidoreductase	NA	A0A1S6KZW3	Salmonella_phage	94.4	0.0e+00
AWQ44580.1|3502771_3503806_+|portal	phage portal protein	portal	E5G6M3	Salmonella_phage	90.7	2.2e-173
AWQ44581.1|3503808_3504513_-	hypothetical protein	NA	NA	NA	NA	NA
AWQ44582.1|3505858_3506101_-	hypothetical protein	NA	A0A1S6L006	Salmonella_phage	89.8	4.0e-22
AWQ44583.1|3506252_3508646_-	endonuclease	NA	A0A1S6L028	Salmonella_phage	87.7	0.0e+00
AWQ44584.1|3508642_3509494_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	71.6	4.8e-118
AWQ44585.1|3509490_3509718_-	hypothetical protein	NA	E5G6L7	Salmonella_phage	66.7	2.4e-21
AWQ44586.1|3509717_3509945_-	hypothetical protein	NA	A0A0M3UL87	Salmonella_phage	65.3	1.6e-17
AWQ44587.1|3510012_3510354_-	hypothetical protein	NA	E5G6L5	Salmonella_phage	82.3	1.5e-46
AWQ44588.1|3510317_3510518_-	hypothetical protein	NA	A0A1S6L005	Salmonella_phage	78.5	2.1e-24
AWQ44589.1|3510525_3511035_-	hypothetical protein	NA	A0A1S6L008	Salmonella_phage	92.9	6.0e-84
AWQ44590.1|3511067_3511310_-	Rha family transcriptional regulator	NA	A0A1S6KZZ6	Salmonella_phage	97.5	4.0e-38
AWQ44591.1|3511429_3512062_+	phage repressor protein	NA	A0A1S6KZZ7	Salmonella_phage	91.9	1.1e-106
AWQ44592.1|3512063_3513089_+|integrase	integrase	integrase	A0A1S6L016	Salmonella_phage	93.2	2.6e-187
AWQ44593.1|3513109_3513892_+	hypothetical protein	NA	NA	NA	NA	NA
AWQ44594.1|3513884_3514652_+	thymidylate synthase (FAD)	NA	A0A0E3T7Y3	Gordonia_phage	34.0	2.5e-25
3514861:3514910	attR	ATGTAGAAATTTCGGACGCGGGTTCAACTCCCGCCAGCTCCACCAAATAA	NA	NA	NA	NA
>prophage 1
CP021163	Enterobacter hormaechei strain 234 plasmid p234, complete sequence	68573	2236	47738	68573	transposase	Escherichia_phage(30.0%)	52	NA	NA
AWQ45743.1|2236_3778_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
AWQ45744.1|4242_5151_+	NAD(P)-dependent oxidoreductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	52.3	2.5e-77
AWQ45811.1|5242_5887_-	quinolone resistance pentapeptide repeat protein QnrB6	NA	NA	NA	NA	NA
AWQ45745.1|6117_6465_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
AWQ45746.1|6458_7298_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
AWQ45747.1|7227_7407_-	hypothetical protein	NA	NA	NA	NA	NA
AWQ45748.1|7425_7926_+	N-acetyltransferase	NA	NA	NA	NA	NA
AWQ45749.1|8231_8345_-	NTP-binding protein	NA	NA	NA	NA	NA
AWQ45750.1|8432_9197_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
AWQ45751.1|9238_9451_+	resolvase	NA	NA	NA	NA	NA
AWQ45752.1|9463_10672_+	restriction endonuclease	NA	E5E3X4	Burkholderia_phage	42.5	1.2e-34
AWQ45753.1|10705_12139_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	50.6	7.0e-106
AWQ45754.1|12520_12727_-	hypothetical protein	NA	NA	NA	NA	NA
AWQ45755.1|12731_13244_-	restriction endonuclease	NA	NA	NA	NA	NA
AWQ45756.1|13268_13973_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	9.9e-138
AWQ45757.1|13918_14179_-	hypothetical protein	NA	NA	NA	NA	NA
AWQ45758.1|14735_15122_+	hypothetical protein	NA	NA	NA	NA	NA
AWQ45759.1|15130_15322_+	plasmid stabilization protein	NA	NA	NA	NA	NA
AWQ45760.1|16319_17075_+	RepB family plasmid replication initiator protein	NA	I3WF20	Macacine_betaherpesvirus	96.0	4.5e-136
AWQ45761.1|17075_17270_+	hypothetical protein	NA	NA	NA	NA	NA
AWQ45762.1|18741_19923_-	hypothetical protein	NA	NA	NA	NA	NA
AWQ45763.1|21239_22286_+	hypothetical protein	NA	NA	NA	NA	NA
AWQ45764.1|22282_24091_+	ATPase	NA	NA	NA	NA	NA
AWQ45765.1|24715_25066_+	hypothetical protein	NA	NA	NA	NA	NA
AWQ45766.1|25116_25860_+	hypothetical protein	NA	NA	NA	NA	NA
AWQ45767.1|25856_26633_+	resolvase	NA	I3WFA4	Macacine_betaherpesvirus	92.9	6.4e-53
AWQ45768.1|26690_26948_-	hypothetical protein	NA	NA	NA	NA	NA
AWQ45769.1|27715_28582_+	RepB family plasmid replication initiator protein	NA	A0A222YYK1	Escherichia_phage	31.1	1.5e-23
AWQ45770.1|28938_29208_-	hypothetical protein	NA	NA	NA	NA	NA
AWQ45771.1|29622_30828_+	chromosome partitioning protein ParA	NA	A0A077SL49	Escherichia_phage	69.6	2.4e-163
AWQ45772.1|30827_31802_+	chromosome partitioning protein ParB	NA	Q38420	Escherichia_phage	54.4	2.6e-88
AWQ45773.1|31883_33155_-	DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	63.3	4.9e-151
AWQ45774.1|33154_33586_-	peptidase	NA	A0A1W6JNS2	Morganella_phage	53.3	1.6e-29
AWQ45775.1|33743_33995_+	hypothetical protein	NA	NA	NA	NA	NA
AWQ45776.1|33994_35479_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
AWQ45777.1|35471_35741_+	hypothetical protein	NA	NA	NA	NA	NA
AWQ45778.1|35948_36914_+	DNA primase	NA	A0A1V0EEV1	Caulobacter_phage	42.7	1.6e-58
AWQ45779.1|37393_37825_+	hypothetical protein	NA	NA	NA	NA	NA
AWQ45780.1|37857_38385_-	endonuclease	NA	A0A1B2LRT6	Wolbachia_phage	39.5	5.7e-21
AWQ45781.1|38644_39100_-	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
AWQ45782.1|39171_39537_+	mercuric transport protein	NA	NA	NA	NA	NA
AWQ45783.1|39552_39828_+	mercuric transporter periplasmic component	NA	NA	NA	NA	NA
AWQ45784.1|39855_40281_+	mercury transport protein MerC	NA	NA	NA	NA	NA
AWQ45785.1|40319_42005_+	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	29.1	1.8e-39
AWQ45786.1|42022_42388_+	transcriptional regulator	NA	NA	NA	NA	NA
AWQ45787.1|42384_42621_+	mercury resistance protein	NA	NA	NA	NA	NA
AWQ45812.1|42604_42742_-	mercury resistance protein	NA	NA	NA	NA	NA
AWQ45788.1|42686_42899_+|transposase	transposase	transposase	NA	NA	NA	NA
AWQ45789.1|43024_43585_+|transposase	transposase	transposase	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
AWQ45790.1|43587_46539_+|transposase	DDE transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.5	0.0e+00
AWQ45813.1|46547_46949_+	hypothetical protein	NA	NA	NA	NA	NA
AWQ45791.1|47033_47738_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	85.8	1.9e-120
