The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP020647	Bordetella holmesii strain F028 chromosome, complete genome	3696624	180350	230165	3696624	transposase	Ralstonia_virus(25.0%)	48	NA	NA
AWP65600.1|180350_181571_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
AWP65601.1|181686_182430_-	hypothetical protein	NA	NA	NA	NA	NA
AWP65602.1|182599_183706_+	S-(hydroxymethyl)glutathione dehydrogenase	NA	A0A0K0KVL7	Prochlorococcus_phage	28.1	1.4e-32
AWP65603.1|183716_184556_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
AWP65604.1|184613_185303_+	hypothetical protein	NA	NA	NA	NA	NA
AWP65605.1|185399_185852_+	hypothetical protein	NA	NA	NA	NA	NA
AWP65606.1|185855_187076_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
AWP65607.1|187299_188187_+	RNA polymerase factor sigma-32	NA	A0A248SJA5	Salicola_phage	38.5	2.1e-39
AWP65608.1|188501_189287_-	phosphodiesterase	NA	NA	NA	NA	NA
AWP65609.1|192129_192906_-	NUDIX hydrolase	NA	NA	NA	NA	NA
AWP65610.1|193398_193659_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
AWP65611.1|193697_194252_+	hypothetical protein	NA	S5WIU1	Leptospira_phage	50.3	1.1e-43
AWP65612.1|194286_194556_+	cytochrome c oxidase subunit II	NA	NA	NA	NA	NA
AWP65613.1|194527_194878_+	bifunctional protein GlmU	NA	NA	NA	NA	NA
AWP65614.1|194976_195927_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
AWP65615.1|196028_197645_+	cytochrome c oxidase subunit I	NA	R9VX24	Flavobacterium_phage	38.2	1.5e-08
AWP68596.1|197710_197935_+	hypothetical protein	NA	NA	NA	NA	NA
AWP65616.1|197968_198844_+	cytochrome c oxidase subunit 3	NA	NA	NA	NA	NA
AWP65617.1|198896_199097_-	hypothetical protein	NA	NA	NA	NA	NA
AWP65618.1|199131_199890_+	hypothetical protein	NA	NA	NA	NA	NA
AWP65619.1|199802_200489_+	hypothetical protein	NA	NA	NA	NA	NA
AWP68597.1|200493_201507_+	heme A synthase	NA	NA	NA	NA	NA
AWP65620.1|201534_202431_+	protoheme IX farnesyltransferase	NA	NA	NA	NA	NA
AWP68598.1|202454_203063_+	SCO family protein	NA	NA	NA	NA	NA
AWP68599.1|203075_203303_-	hypothetical protein	NA	NA	NA	NA	NA
AWP65621.1|204014_204779_+	transcriptional regulator	NA	NA	NA	NA	NA
AWP65622.1|204844_206218_+	bifunctional N-acetylglucosamine-1-phosphate uridyltransferase/glucosamine-1-phosphate acetyltransferase	NA	A0A0N7G7I9	Chrysochromulina_ericina_virus	35.1	6.7e-29
AWP68600.1|206316_207609_+	MFS transporter	NA	NA	NA	NA	NA
AWP68601.1|207700_209023_+	UDP-glucose 6-dehydrogenase	NA	A0A127AXI2	Bacillus_phage	37.8	1.3e-74
AWP65623.1|209019_210075_+	glycosyl transferase	NA	NA	NA	NA	NA
AWP65624.1|210075_210597_-	AsnC family transcriptional regulator	NA	NA	NA	NA	NA
AWP65625.1|210744_212577_+	glutamine--fructose-6-phosphate aminotransferase	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	48.4	5.0e-157
AWP65626.1|212743_212941_+	serum resistance protein BrkB	NA	NA	NA	NA	NA
AWP65627.1|215516_215807_-	hypothetical protein	NA	NA	NA	NA	NA
AWP68602.1|215803_217285_-	peptidase	NA	NA	NA	NA	NA
AWP65628.1|217412_218444_-	histidine kinase	NA	NA	NA	NA	NA
AWP65629.1|218517_219108_-	RNA polymerase subunit sigma	NA	NA	NA	NA	NA
AWP65630.1|219660_220578_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AWP65631.1|220721_221756_+	4-hydroxythreonine-4-phosphate dehydrogenase	NA	NA	NA	NA	NA
AWP65632.1|221785_222958_+	L-rhamnonate dehydratase	NA	Q6A202	Oenococcus_phage	29.6	1.5e-34
AWP65633.1|222954_223893_+	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
AWP65634.1|224117_224957_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AWP65635.1|224953_226417_+	sulfatase	NA	NA	NA	NA	NA
AWP65636.1|226430_227201_+	cytochrome B	NA	NA	NA	NA	NA
AWP65637.1|227214_227694_+	gluconolactonase	NA	NA	NA	NA	NA
AWP65638.1|227717_227978_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
AWP65639.1|228016_228571_+	hypothetical protein	NA	S5WIU1	Leptospira_phage	50.3	1.1e-43
AWP65640.1|228944_230165_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
>prophage 2
CP020647	Bordetella holmesii strain F028 chromosome, complete genome	3696624	631708	677049	3696624	transposase,tRNA	Ralstonia_virus(36.36%)	41	NA	NA
AWP65985.1|631708_632929_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.6	4.2e-184
AWP65986.1|635938_636673_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	42.4	2.6e-40
AWP65987.1|636841_638062_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
AWP65988.1|638436_639423_+	HlyD family secretion protein	NA	NA	NA	NA	NA
AWP65989.1|639426_642150_+	ABC transporter ATP-binding protein/permease	NA	A0A2H4PQG7	Staphylococcus_phage	29.2	6.6e-20
AWP65990.1|642150_643278_+	hypothetical protein	NA	NA	NA	NA	NA
AWP65991.1|643290_644703_+	RND transporter	NA	NA	NA	NA	NA
AWP65992.1|644877_645534_-	N-acetyltransferase	NA	NA	NA	NA	NA
AWP65993.1|645554_646601_+	glycosyltransferase	NA	F1C5B0	Cronobacter_phage	39.5	1.4e-58
AWP65994.1|646597_648187_+	dolichyl-phosphate-mannose--protein mannosyltransferase	NA	NA	NA	NA	NA
AWP68622.1|648122_648632_-	sugar translocase	NA	NA	NA	NA	NA
AWP68623.1|648557_649451_+	hypothetical protein	NA	NA	NA	NA	NA
AWP65995.1|649440_650337_-	alpha/beta hydrolase	NA	A0A1C9C5K3	Heterosigma_akashiwo_virus	33.1	6.5e-09
AWP65996.1|650383_651016_-	hypothetical protein	NA	NA	NA	NA	NA
AWP65997.1|651040_651925_-	EamA family transporter	NA	NA	NA	NA	NA
AWP65998.1|652052_653534_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AWP65999.1|653606_653951_+	TIGR01244 family protein	NA	NA	NA	NA	NA
AWP66000.1|654036_654501_+	universal stress protein	NA	NA	NA	NA	NA
AWP66001.1|654658_654919_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
AWP66002.1|654957_655512_+	hypothetical protein	NA	S5WIU1	Leptospira_phage	49.7	3.3e-43
AWP66003.1|655664_657779_+	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	28.1	6.0e-61
AWP66004.1|657811_658609_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
AWP66005.1|658820_659771_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
AWP66006.1|659803_660250_+|tRNA	cys-tRNA(pro)/cys-tRNA(cys) deacylase	tRNA	NA	NA	NA	NA
AWP66007.1|660298_660988_-	tol-pal system protein YbgF	NA	NA	NA	NA	NA
AWP66008.1|661075_661570_-	peptidoglycan-associated lipoprotein	NA	NA	NA	NA	NA
AWP66009.1|661601_662918_-	Tol-Pal system beta propeller repeat protein TolB	NA	NA	NA	NA	NA
AWP66010.1|662934_663855_-	protein TolA	NA	NA	NA	NA	NA
AWP66011.1|663889_664351_-	protein TolR	NA	NA	NA	NA	NA
AWP66012.1|664350_665025_-	protein TolQ	NA	NA	NA	NA	NA
AWP66013.1|665027_665450_-	tol-pal system-associated acyl-CoA thioesterase	NA	NA	NA	NA	NA
AWP66014.1|665503_667234_-|tRNA	proline--tRNA ligase	tRNA	A0A2K9L3R9	Tupanvirus	28.6	1.2e-11
AWP66015.1|667299_667869_+	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
AWP66016.1|667849_668536_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AWP66017.1|668555_670061_+	sensor histidine kinase	NA	NA	NA	NA	NA
AWP66018.1|670289_670739_+	tripartite tricarboxylate transporter TctB	NA	NA	NA	NA	NA
AWP66019.1|670744_672265_+	hypothetical protein	NA	NA	NA	NA	NA
AWP66020.1|672318_673539_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
AWP66021.1|673635_674565_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AWP66022.1|674723_675629_-	oxidoreductase	NA	NA	NA	NA	NA
AWP66023.1|675828_677049_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
>prophage 4
CP020647	Bordetella holmesii strain F028 chromosome, complete genome	3696624	1095261	1192889	3696624	tRNA,transposase,protease	Leptospira_phage(20.0%)	92	NA	NA
AWP66375.1|1095261_1096482_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
AWP66376.1|1096569_1097160_+	EamA family transporter	NA	NA	NA	NA	NA
AWP66377.1|1097147_1097459_+	EamA family transporter	NA	NA	NA	NA	NA
AWP66378.1|1097510_1098500_+	quinone oxidoreductase	NA	NA	NA	NA	NA
AWP66379.1|1098620_1099502_-|protease	zinc metalloprotease HtpX	protease	NA	NA	NA	NA
AWP66380.1|1099675_1100530_+	hypothetical protein	NA	NA	NA	NA	NA
AWP66381.1|1100561_1101410_+	sulfurtransferase	NA	NA	NA	NA	NA
AWP66382.1|1101537_1102758_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	74.9	1.1e-181
AWP66383.1|1102776_1103343_-	phosphohydrolase	NA	NA	NA	NA	NA
AWP66384.1|1103540_1104692_-	Rieske (2Fe-2S) protein	NA	NA	NA	NA	NA
AWP66385.1|1104830_1105835_-	hypothetical protein	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	25.9	3.9e-18
AWP66386.1|1105991_1106963_-	MFS transporter	NA	NA	NA	NA	NA
AWP66387.1|1107041_1107830_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
AWP66388.1|1107901_1108138_+	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
AWP66389.1|1108146_1109058_+	geranyl transferase	NA	NA	NA	NA	NA
AWP66390.1|1109101_1110973_+	1-deoxy-D-xylulose-5-phosphate synthase	NA	NA	NA	NA	NA
AWP66391.1|1111133_1111931_+	GTP cyclohydrolase I FolE2	NA	NA	NA	NA	NA
AWP66392.1|1112162_1112537_+	30S ribosomal protein S6	NA	NA	NA	NA	NA
AWP66393.1|1112613_1112937_+	primosomal replication protein N	NA	NA	NA	NA	NA
AWP66394.1|1113020_1113293_+	30S ribosomal protein S18	NA	NA	NA	NA	NA
AWP66395.1|1113307_1113763_+	50S ribosomal protein L9	NA	NA	NA	NA	NA
AWP66396.1|1113884_1114721_+	hypothetical protein	NA	NA	NA	NA	NA
AWP66397.1|1114717_1116091_+	replicative DNA helicase	NA	C7BGG1	Burkholderia_phage	57.7	1.1e-132
AWP66398.1|1116167_1117124_-	bile acid:sodium symporter	NA	NA	NA	NA	NA
AWP66399.1|1117211_1118189_-	4-hydroxythreonine-4-phosphate dehydrogenase PdxA	NA	NA	NA	NA	NA
AWP66400.1|1118313_1119969_-	ribonuclease	NA	A0A1L2CUJ9	Pectobacterium_phage	33.7	1.2e-69
AWP66401.1|1120017_1120482_-	peroxiredoxin	NA	NA	NA	NA	NA
AWP66402.1|1120478_1120940_-	hypothetical protein	NA	NA	NA	NA	NA
AWP66403.1|1121165_1122353_+	alanine transaminase	NA	NA	NA	NA	NA
AWP66404.1|1122349_1123654_+	homoserine dehydrogenase	NA	NA	NA	NA	NA
AWP66405.1|1123650_1125060_+	threonine synthase	NA	NA	NA	NA	NA
AWP66406.1|1125253_1125514_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
AWP66407.1|1125552_1126374_+	hypothetical protein	NA	S5WIU1	Leptospira_phage	43.7	7.2e-55
AWP66408.1|1126508_1127528_-	fructose-bisphosphatase class I	NA	A0A1V0SKX4	Klosneuvirus	34.8	3.0e-50
AWP66409.1|1127536_1130242_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	25.1	6.8e-17
AWP66410.1|1130381_1131035_+	hypothetical protein	NA	NA	NA	NA	NA
AWP66411.1|1131097_1131460_-	DNA-binding protein	NA	NA	NA	NA	NA
AWP66412.1|1132026_1133487_+|protease	metalloprotease TldD	protease	NA	NA	NA	NA
AWP66413.1|1133749_1134823_+	3-deoxy-7-phosphoheptulonate synthase	NA	A0A2I6UFP9	Klebsiella_phage	46.4	7.9e-78
AWP66414.1|1134907_1136128_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	3.5e-183
AWP66415.1|1137885_1138707_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	44.0	1.9e-55
AWP66416.1|1138745_1139006_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
AWP68637.1|1139033_1140479_+	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
AWP66417.1|1140492_1141596_+	glycolate oxidase subunit GlcE	NA	NA	NA	NA	NA
AWP66418.1|1141600_1142851_+	glycolate oxidase iron-sulfur subunit	NA	NA	NA	NA	NA
AWP66419.1|1142847_1144293_-	NAD synthetase	NA	NA	NA	NA	NA
AWP66420.1|1144289_1144604_-	NAD(P) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
AWP66421.1|1144605_1145724_-	NAD(P) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
AWP66422.1|1145906_1147127_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.6	5.5e-184
AWP66423.1|1147226_1148093_-	N-formylglutamate amidohydrolase	NA	NA	NA	NA	NA
AWP66424.1|1148153_1149134_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AWP66425.1|1149280_1150201_+	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	30.8	2.1e-26
AWP66426.1|1150209_1151322_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
AWP66427.1|1151403_1152225_+	anion permease	NA	NA	NA	NA	NA
AWP66428.1|1152300_1152909_-	glutathione S-transferase	NA	NA	NA	NA	NA
AWP68638.1|1153046_1154423_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	46.1	7.2e-108
AWP66429.1|1154484_1154928_+	cytochrome C	NA	NA	NA	NA	NA
AWP68639.1|1154994_1155651_-	cytochrome B	NA	NA	NA	NA	NA
AWP66430.1|1155693_1155954_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
AWP66431.1|1155992_1156814_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	44.0	1.9e-55
AWP66432.1|1156982_1157264_-	hypothetical protein	NA	NA	NA	NA	NA
AWP66433.1|1157974_1158763_+	hypothetical protein	NA	NA	NA	NA	NA
AWP66434.1|1158759_1159866_+	AI-2E family transporter	NA	NA	NA	NA	NA
AWP66435.1|1160540_1161899_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	38.3	2.1e-19
AWP66436.1|1162013_1162211_-	gas vesicle protein	NA	NA	NA	NA	NA
AWP66437.1|1162228_1163050_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	44.0	1.9e-55
AWP66438.1|1163088_1163349_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
AWP66439.1|1163442_1163997_+	hypothetical protein	NA	W5R8L2	Staphylococcus_phage	43.7	1.3e-31
AWP68640.1|1164584_1165901_-	ergothioneine biosynthesis protein EgtB	NA	NA	NA	NA	NA
AWP66440.1|1165913_1166927_-	L-histidine N(alpha)-methyltransferase	NA	NA	NA	NA	NA
AWP66441.1|1167473_1168424_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
AWP66442.1|1168503_1168803_+	hypothetical protein	NA	NA	NA	NA	NA
AWP66443.1|1170163_1171822_-	FMN-binding glutamate synthase family protein	NA	NA	NA	NA	NA
AWP66444.1|1171970_1173191_-	hypothetical protein	NA	NA	NA	NA	NA
AWP66445.1|1173308_1174592_-	arsenical efflux pump membrane protein ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	68.4	4.6e-157
AWP66446.1|1174595_1175537_-	transporter	NA	NA	NA	NA	NA
AWP66447.1|1175646_1176105_+	N-acetyltransferase	NA	NA	NA	NA	NA
AWP68641.1|1176485_1177187_+	DTW domain-containing protein	NA	NA	NA	NA	NA
AWP66448.1|1177594_1180015_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	32.1	3.9e-64
AWP66449.1|1180122_1180860_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
AWP66450.1|1180906_1182151_+	hypothetical protein	NA	A0A0B5JD48	Pandoravirus	27.1	1.3e-10
AWP66451.1|1182473_1182746_+	DNA-binding protein HU	NA	A4JWM7	Burkholderia_virus	56.2	4.2e-20
AWP66452.1|1183329_1184058_+	energy transducer TonB	NA	NA	NA	NA	NA
AWP66453.1|1184079_1184997_+	flagellar motor protein MotA	NA	NA	NA	NA	NA
AWP66454.1|1184996_1185506_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
AWP66455.1|1185622_1186294_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AWP66456.1|1186403_1187471_+	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	27.7	2.8e-14
AWP66457.1|1187454_1189335_+	potassium transporter Kup	NA	A7K9V6	Acanthocystis_turfacea_chlorella_virus	30.0	3.5e-65
AWP66458.1|1189471_1190659_+	hypothetical protein	NA	NA	NA	NA	NA
AWP66459.1|1190959_1191745_+	hypothetical protein	NA	NA	NA	NA	NA
AWP66460.1|1191768_1192029_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
AWP66461.1|1192067_1192889_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	44.0	1.9e-55
>prophage 5
CP020647	Bordetella holmesii strain F028 chromosome, complete genome	3696624	1200910	1263324	3696624	tRNA,transposase,protease	Ralstonia_virus(28.57%)	53	NA	NA
AWP66469.1|1200910_1202131_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
AWP66470.1|1202206_1202488_+	malate dehydrogenase	NA	NA	NA	NA	NA
AWP66471.1|1204319_1205315_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AWP66472.1|1205357_1206128_+	5-keto-4-deoxy-D-glucarate aldolase	NA	NA	NA	NA	NA
AWP66473.1|1206253_1206517_-	30S ribosomal protein S20	NA	NA	NA	NA	NA
AWP66474.1|1206718_1206865_-	transmembrane sensor protein	NA	NA	NA	NA	NA
AWP66475.1|1206918_1207869_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
AWP66476.1|1207950_1208430_-	transmembrane sensor protein	NA	NA	NA	NA	NA
AWP66477.1|1209323_1209584_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
AWP66478.1|1209641_1210841_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	74.9	1.2e-178
AWP66479.1|1210986_1211364_-	cytochrome c family protein	NA	NA	NA	NA	NA
AWP66480.1|1211387_1213169_-	GMC family oxidoreductase	NA	NA	NA	NA	NA
AWP66481.1|1213177_1213915_-	hypothetical protein	NA	NA	NA	NA	NA
AWP66482.1|1214199_1215759_-	lipid II flippase MurJ	NA	NA	NA	NA	NA
AWP66483.1|1215818_1216577_-	3-hydroxyacyl-CoA dehydrogenase	NA	NA	NA	NA	NA
AWP66484.1|1216673_1217330_-	adenylate kinase	NA	NA	NA	NA	NA
AWP66485.1|1217483_1218248_-	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
AWP66486.1|1218262_1218442_-	hypothetical protein	NA	NA	NA	NA	NA
AWP66487.1|1218467_1219502_-	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
AWP66488.1|1219498_1219912_-	biopolymer transporter ExbD	NA	NA	NA	NA	NA
AWP66489.1|1219908_1220493_-	flagellar motor protein MotA	NA	NA	NA	NA	NA
AWP66490.1|1220845_1222204_+	exodeoxyribonuclease VII large subunit	NA	A0A1V0SD82	Indivirus	33.6	1.0e-29
AWP66491.1|1222297_1222876_+	superoxide dismutase [Fe]	NA	NA	NA	NA	NA
AWP66492.1|1223000_1223822_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	44.0	1.9e-55
AWP66493.1|1223860_1224121_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
AWP66494.1|1224193_1225450_+	chloride channel protein-related protein	NA	NA	NA	NA	NA
AWP66495.1|1225553_1226759_+	3-oxoadipyl-CoA thiolase	NA	NA	NA	NA	NA
AWP66496.1|1226822_1227272_-	hypothetical protein	NA	A0A1B1IUW8	uncultured_Mediterranean_phage	42.2	6.8e-15
AWP66497.1|1227404_1227650_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	75.0	6.5e-20
AWP66498.1|1227874_1228189_+|protease	ATP-dependent Clp protease adaptor ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	43.9	8.4e-12
AWP66499.1|1233442_1235548_+	penicillin-binding protein 1C	NA	NA	NA	NA	NA
AWP66500.1|1235601_1237911_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	9.1e-164
AWP66501.1|1239264_1240932_+	paraquat-inducible protein B	NA	NA	NA	NA	NA
AWP66502.1|1240934_1241600_+	hypothetical protein	NA	NA	NA	NA	NA
AWP66503.1|1241732_1245539_+	trifunctional transcriptional regulator/proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
AWP66504.1|1245764_1246910_+	branched chain amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AWP66505.1|1247028_1247958_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
AWP66506.1|1247954_1249031_+	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
AWP66507.1|1249027_1249834_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	23.9	7.2e-15
AWP66508.1|1249830_1250562_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.3	2.6e-16
AWP66509.1|1250765_1250948_+	hypothetical protein	NA	NA	NA	NA	NA
AWP66510.1|1250938_1252177_-	ammonia channel protein	NA	H8ZJB2	Ostreococcus_tauri_virus	28.3	6.2e-26
AWP66511.1|1252224_1252563_-	transcriptional regulator	NA	NA	NA	NA	NA
AWP66512.1|1252810_1253761_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
AWP66513.1|1254079_1254262_+	hypothetical protein	NA	NA	NA	NA	NA
AWP66514.1|1254327_1255548_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
AWP66515.1|1255641_1256862_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.6	4.2e-184
AWP66516.1|1256858_1257185_+	hypothetical protein	NA	NA	NA	NA	NA
AWP66517.1|1257306_1258806_+|protease	ATP-dependent protease	protease	NA	NA	NA	NA
AWP66518.1|1259226_1259424_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
AWP66519.1|1259439_1259799_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
AWP66520.1|1259871_1260894_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2H4UW22	Bodo_saltans_virus	38.8	6.1e-27
AWP66521.1|1260906_1263324_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
>prophage 6
CP020647	Bordetella holmesii strain F028 chromosome, complete genome	3696624	1586862	1646203	3696624	transposase	Ralstonia_virus(10.0%)	55	NA	NA
AWP66808.1|1586862_1588083_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
AWP66809.1|1588437_1588914_+	transcription elongation factor GreA	NA	NA	NA	NA	NA
AWP66810.1|1589172_1589781_-	hypothetical protein	NA	NA	NA	NA	NA
AWP66811.1|1589799_1590471_+	rRNA methyltransferase	NA	NA	NA	NA	NA
AWP66812.1|1590644_1592531_+	cell division protein FtsH	NA	E5ESM9	Bathycoccus_sp._RCC1105_virus	42.5	6.2e-110
AWP66813.1|1592558_1593401_+	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	32.5	6.5e-27
AWP66814.1|1593397_1594741_+	phosphoglucosamine mutase	NA	A0A1X9I671	Streptococcus_phage	27.1	2.7e-06
AWP66815.1|1594925_1595741_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AWP66816.1|1595806_1597288_-	exopolyphosphatase	NA	NA	NA	NA	NA
AWP66817.1|1597486_1599559_+	RNA degradosome polyphosphate kinase	NA	NA	NA	NA	NA
AWP66818.1|1599778_1600816_+	phosphate ABC transporter substrate-binding protein PstS	NA	E3SKK5	Synechococcus_phage	40.2	8.5e-53
AWP66819.1|1600937_1602860_+	hypothetical protein	NA	NA	NA	NA	NA
AWP66820.1|1602887_1603664_+	phosphate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.7	5.6e-17
AWP66821.1|1604491_1605001_+	hypothetical protein	NA	NA	NA	NA	NA
AWP66822.1|1606078_1606849_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.6	2.8e-77
AWP68660.1|1606845_1607856_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	4.4e-78
AWP66823.1|1609163_1609424_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
AWP66824.1|1609462_1610284_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	44.0	1.1e-55
AWP66825.1|1610284_1611028_+	hypothetical protein	NA	A0A1B0VBP7	Salmonella_phage	47.2	8.0e-53
AWP66826.1|1611032_1611404_-	hypothetical protein	NA	NA	NA	NA	NA
AWP66827.1|1611464_1611710_+	hypothetical protein	NA	NA	NA	NA	NA
AWP66828.1|1611816_1613316_-	2-aminoadipate aminotransferase	NA	NA	NA	NA	NA
AWP66829.1|1613443_1613713_-	hypothetical protein	NA	NA	NA	NA	NA
AWP66830.1|1613937_1614273_+	hypothetical protein	NA	NA	NA	NA	NA
AWP66831.1|1614531_1614663_+	entericidin	NA	NA	NA	NA	NA
AWP66832.1|1614692_1615190_+	hypothetical protein	NA	NA	NA	NA	NA
AWP66833.1|1615199_1615574_+	hypothetical protein	NA	NA	NA	NA	NA
AWP68661.1|1615664_1616957_+	aspartate carbamoyltransferase	NA	Q84489	Paramecium_bursaria_Chlorella_virus	37.2	2.2e-42
AWP66834.1|1617073_1617973_-	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	32.5	5.9e-42
AWP66835.1|1618124_1618343_+	hypothetical protein	NA	NA	NA	NA	NA
AWP66836.1|1618816_1620493_-	MFS transporter	NA	NA	NA	NA	NA
AWP66837.1|1620677_1622201_-	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	27.3	2.2e-20
AWP66838.1|1622172_1622868_-	DNA-binding response regulator	NA	NA	NA	NA	NA
AWP66839.1|1623208_1624270_+	DNA recombination/repair protein RecA	NA	A0A0S2MVG1	Bacillus_phage	64.0	5.7e-113
AWP66840.1|1624315_1624867_+	recombination regulator RecX	NA	NA	NA	NA	NA
AWP66841.1|1624873_1625794_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AWP66842.1|1625933_1628231_+	5-methyltetrahydropteroyltriglutamate-- homocysteine methyltransferase	NA	NA	NA	NA	NA
AWP66843.1|1628286_1629507_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
AWP66844.1|1629765_1630371_+	hypothetical protein	NA	NA	NA	NA	NA
AWP66845.1|1630381_1631542_+	succinate--CoA ligase subunit beta	NA	NA	NA	NA	NA
AWP66846.1|1631563_1632445_+	succinate--CoA ligase subunit alpha	NA	A0A2K9L1S3	Tupanvirus	31.4	1.1e-19
AWP66847.1|1632741_1633440_+	hypothetical protein	NA	W8EBD0	Pseudomonas_phage	33.8	8.9e-22
AWP66848.1|1633581_1634304_+	hypothetical protein	NA	A0A2R2YAT9	Pseudomonas_phage	43.8	8.0e-42
AWP66849.1|1634422_1635361_+	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
AWP66850.1|1635391_1636171_+	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
AWP66851.1|1636157_1637381_+	heme biosynthesis operon protein HemX	NA	NA	NA	NA	NA
AWP66852.1|1637385_1638933_+	heme biosynthesis protein HemY	NA	NA	NA	NA	NA
AWP66853.1|1638968_1639502_+	inorganic pyrophosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	55.5	1.8e-51
AWP68662.1|1639745_1640441_+	5-carboxymethyl-2-hydroxymuconate isomerase	NA	NA	NA	NA	NA
AWP66854.1|1640455_1640587_+	entericidin	NA	NA	NA	NA	NA
AWP66855.1|1640634_1641759_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
AWP66856.1|1641764_1644104_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	40.3	6.9e-151
AWP66857.1|1644100_1644508_-	heat-shock protein Hsp20	NA	NA	NA	NA	NA
AWP66858.1|1644769_1645030_+	hypothetical protein	NA	NA	NA	NA	NA
AWP66859.1|1645252_1646203_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 7
CP020647	Bordetella holmesii strain F028 chromosome, complete genome	3696624	1670669	1718156	3696624	transposase,tRNA	Leptospira_phage(33.33%)	53	NA	NA
AWP66882.1|1670669_1670930_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
AWP66883.1|1670987_1671287_-	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
AWP66884.1|1671856_1673260_+	3-isopropylmalate dehydratase large subunit	NA	NA	NA	NA	NA
AWP66885.1|1673272_1673923_+	3-isopropylmalate dehydratase small subunit	NA	NA	NA	NA	NA
AWP66886.1|1674064_1675285_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
AWP66887.1|1675315_1676392_+	3-isopropylmalate dehydrogenase	NA	NA	NA	NA	NA
AWP66888.1|1676538_1677669_+	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
AWP66889.1|1677855_1679481_+	hypothetical protein	NA	NA	NA	NA	NA
AWP66890.1|1679487_1680303_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
AWP68665.1|1680350_1681388_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AWP66891.1|1681439_1682099_+	N-(5'-phosphoribosyl)anthranilate isomerase	NA	NA	NA	NA	NA
AWP66892.1|1682557_1682746_-	hypothetical protein	NA	NA	NA	NA	NA
AWP66893.1|1683942_1684320_-	hypothetical protein	NA	S5WIU1	Leptospira_phage	53.4	4.5e-28
AWP66894.1|1684240_1684627_-	hypothetical protein	NA	NA	NA	NA	NA
AWP66895.1|1684665_1684926_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
AWP66896.1|1685324_1686014_+	anion permease	NA	NA	NA	NA	NA
AWP66897.1|1686113_1686275_-	hypothetical protein	NA	NA	NA	NA	NA
AWP66898.1|1686716_1686953_-	hypothetical protein	NA	NA	NA	NA	NA
AWP66899.1|1687142_1687391_-	hypothetical protein	NA	NA	NA	NA	NA
AWP66900.1|1687504_1688875_+	oxygen-independent coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
AWP66901.1|1688875_1689616_-	DNA-binding response regulator	NA	NA	NA	NA	NA
AWP66902.1|1690123_1692076_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	35.9	7.1e-125
AWP66903.1|1692096_1692645_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	29.3	3.8e-12
AWP66904.1|1692810_1693767_+	glutathione synthase	NA	NA	NA	NA	NA
AWP68666.1|1693780_1694179_+	PTS mannose transporter subunit IIA	NA	NA	NA	NA	NA
AWP68667.1|1694241_1694511_+	phosphocarrier protein HPr	NA	NA	NA	NA	NA
AWP66905.1|1694539_1696315_+	phosphoenolpyruvate--protein phosphotransferase	NA	NA	NA	NA	NA
AWP66906.1|1696362_1696572_-	hypothetical protein	NA	NA	NA	NA	NA
AWP66907.1|1696618_1697041_-	OsmC family peroxiredoxin	NA	NA	NA	NA	NA
AWP66908.1|1697160_1698138_+	ornithine cyclodeaminase	NA	NA	NA	NA	NA
AWP66909.1|1698206_1699370_+	branched-chain amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AWP66910.1|1699538_1700426_+	ectoine/hydroxyectoine ABC transporter substrate-binding protein EhuB	NA	NA	NA	NA	NA
AWP66911.1|1700436_1701078_+	ectoine/hydroxyectoine ABC transporter permease subunit EhuC	NA	NA	NA	NA	NA
AWP66912.1|1701074_1701746_+	ectoine/hydroxyectoine ABC transporter permease subunit EhuD	NA	NA	NA	NA	NA
AWP66913.1|1702618_1703068_-	deoxyuridine 5'-triphosphate nucleotidohydrolase	NA	Q2NP83	Xanthomonas_phage	62.8	2.3e-47
AWP66914.1|1703109_1703568_-	hypothetical protein	NA	NA	NA	NA	NA
AWP66915.1|1703588_1704221_-	hypothetical protein	NA	NA	NA	NA	NA
AWP66916.1|1704330_1704798_+	hydrolase	NA	NA	NA	NA	NA
AWP66917.1|1704819_1705362_+	hydrolase	NA	NA	NA	NA	NA
AWP66918.1|1705374_1706079_+	dipeptidase E	NA	NA	NA	NA	NA
AWP66919.1|1706097_1706568_-	AsnC family transcriptional regulator	NA	NA	NA	NA	NA
AWP66920.1|1706660_1707401_+	permease	NA	NA	NA	NA	NA
AWP66921.1|1707444_1707705_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
AWP66922.1|1707743_1708040_+	hypothetical protein	NA	NA	NA	NA	NA
AWP66923.1|1707874_1708300_+	hypothetical protein	NA	S5WIU1	Leptospira_phage	53.3	3.3e-19
AWP66924.1|1708580_1709792_-	phosphopantothenate synthase	NA	Q9HH70	Methanothermobacter_phage	30.4	2.2e-36
AWP66925.1|1709852_1710368_-	signal peptidase II	NA	NA	NA	NA	NA
AWP66926.1|1710370_1713232_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A1V0SJ93	Klosneuvirus	25.4	1.0e-71
AWP68668.1|1713221_1714187_-	bifunctional riboflavin kinase/FMN adenylyltransferase	NA	NA	NA	NA	NA
AWP66927.1|1714943_1716419_+	rRNA methyltransferase	NA	NA	NA	NA	NA
AWP68669.1|1716423_1716699_-	hypothetical protein	NA	NA	NA	NA	NA
AWP66928.1|1717035_1717296_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
AWP66929.1|1717334_1718156_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	44.0	1.9e-55
>prophage 8
CP020647	Bordetella holmesii strain F028 chromosome, complete genome	3696624	1730889	1780523	3696624	integrase,transposase,holin	Escherichia_phage(22.22%)	46	1718090:1718149	1767148:1767226
1718090:1718149	attL	GCAATTCGTGCAGGCTCATCAGAAAGAAGGTCTTTTACCCCTGGGCTCTATGTCGGTGCC	NA	NA	NA	NA
AWP66938.1|1730889_1731171_+|integrase	integrase	integrase	NA	NA	NA	NA
AWP68670.1|1731336_1731657_+	hypothetical protein	NA	NA	NA	NA	NA
AWP66939.1|1732979_1733240_+	hypothetical protein	NA	NA	NA	NA	NA
AWP66940.1|1733318_1733579_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
AWP66941.1|1733732_1734503_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.6	2.8e-77
AWP68671.1|1734499_1735510_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	4.4e-78
AWP66942.1|1735544_1736387_+	hypothetical protein	NA	S5WIU1	Leptospira_phage	46.0	1.3e-54
AWP66943.1|1736849_1737635_-	exodeoxyribonuclease III	NA	NA	NA	NA	NA
AWP66944.1|1738494_1738755_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
AWP66945.1|1738793_1739615_+	hypothetical protein	NA	S5WIU1	Leptospira_phage	43.7	7.2e-55
AWP66946.1|1740680_1741685_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
AWP66947.1|1741760_1742573_+	nucleotide pyrophosphatase	NA	NA	NA	NA	NA
AWP66948.1|1742800_1744972_+|holin	phospholipase C, phosphocholine-specific	holin	NA	NA	NA	NA
AWP66949.1|1745025_1746345_-	MFS transporter	NA	NA	NA	NA	NA
AWP66950.1|1746433_1747654_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
AWP66951.1|1747872_1748733_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AWP66952.1|1748729_1749953_-	MFS transporter	NA	NA	NA	NA	NA
AWP66953.1|1750251_1750749_+	osmotically inducible protein Y	NA	NA	NA	NA	NA
AWP66954.1|1750787_1751570_-	hydrolase	NA	NA	NA	NA	NA
AWP66955.1|1751595_1751814_-	SlyX protein	NA	NA	NA	NA	NA
AWP66956.1|1751888_1752158_+	hypothetical protein	NA	NA	NA	NA	NA
AWP66957.1|1752377_1752842_+	N-acetyltransferase	NA	NA	NA	NA	NA
AWP66958.1|1752915_1753197_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
AWP68672.1|1753313_1754297_-|integrase	integrase	integrase	NA	NA	NA	NA
AWP66959.1|1754540_1755539_+	cointegrate resolution protein	NA	NA	NA	NA	NA
AWP66960.1|1755641_1756073_+	energy transducer TonB	NA	NA	NA	NA	NA
AWP66961.1|1756137_1757049_+	3-phosphoglycerate dehydrogenase	NA	M1HBE3	Paramecium_bursaria_Chlorella_virus	30.7	3.7e-20
AWP66962.1|1757181_1759263_+	bifunctional diguanylate cyclase/phosphodiesterase	NA	NA	NA	NA	NA
AWP66963.1|1759301_1760006_-	fumarylacetoacetate hydrolase	NA	NA	NA	NA	NA
AWP66964.1|1760098_1760983_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AWP66965.1|1761057_1761459_-	hypothetical protein	NA	NA	NA	NA	NA
AWP66966.1|1761549_1761696_-	50S ribosomal protein L36	NA	NA	NA	NA	NA
AWP66967.1|1761957_1762893_-	transcriptional regulator	NA	NA	NA	NA	NA
AWP66968.1|1762974_1763628_+	short-chain dehydrogenase	NA	NA	NA	NA	NA
AWP66969.1|1764244_1764721_-	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
AWP66970.1|1764745_1765540_-	ABC transporter permease	NA	NA	NA	NA	NA
AWP66971.1|1765556_1766537_-	taurine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AWP66972.1|1766709_1766922_-	hypothetical protein	NA	NA	NA	NA	NA
AWP66973.1|1767335_1769111_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	25.4	3.5e-38
1767148:1767226	attR	GCAATTCGTGCAGGCTCATCAGAAAGAAGGTCTTTTACCCCTGGGCTCTATGTCGGTGCCGTACTAAATCTGGGGGCAG	NA	NA	NA	NA
AWP66974.1|1769126_1770791_-	dihydrolipoyllysine-residue acetyltransferase	NA	NA	NA	NA	NA
AWP66975.1|1770803_1773515_-	pyruvate dehydrogenase (acetyl-transferring), homodimeric type	NA	NA	NA	NA	NA
AWP68673.1|1774060_1775815_+	PAS domain-containing sensor histidine kinase	NA	NA	NA	NA	NA
AWP66976.1|1775811_1776438_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AWP66977.1|1776434_1777289_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase	NA	A0A249XZQ2	Enterococcus_phage	37.8	1.4e-29
AWP66978.1|1777408_1779463_+	oligopeptidase A	NA	NA	NA	NA	NA
AWP66979.1|1779572_1780523_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 9
CP020647	Bordetella holmesii strain F028 chromosome, complete genome	3696624	1793288	1842300	3696624	transposase	Ralstonia_virus(33.33%)	46	NA	NA
AWP66992.1|1793288_1794509_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
AWP66993.1|1794584_1795706_-	transporter	NA	NA	NA	NA	NA
AWP66994.1|1795743_1796457_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.1	1.7e-12
AWP66995.1|1796467_1797688_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	4.6e-183
AWP66996.1|1797770_1798325_-	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
AWP66997.1|1798470_1799421_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
AWP68674.1|1799380_1799542_-	branched-chain amino acid ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
AWP66998.1|1799582_1800509_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
AWP66999.1|1800522_1801395_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
AWP67000.1|1801557_1802505_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AWP68675.1|1802843_1803425_+	PIN domain-containing protein	NA	NA	NA	NA	NA
AWP68676.1|1803418_1803928_-	threonine dehydratase	NA	NA	NA	NA	NA
AWP67001.1|1804002_1804953_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
AWP67002.1|1804932_1805685_-	serine/threonine dehydratase	NA	NA	NA	NA	NA
AWP67003.1|1805697_1806429_-	hypothetical protein	NA	NA	NA	NA	NA
AWP67004.1|1806585_1808751_-	polyribonucleotide nucleotidyltransferase	NA	NA	NA	NA	NA
AWP67005.1|1808840_1809110_-	30S ribosomal protein S15	NA	NA	NA	NA	NA
AWP68677.1|1809198_1809405_-	hypothetical protein	NA	NA	NA	NA	NA
AWP67006.1|1809403_1809922_+	hypothetical protein	NA	NA	NA	NA	NA
AWP67007.1|1809940_1810720_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
AWP67008.1|1810887_1811904_-	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
AWP67009.1|1811976_1812468_-	acetolactate synthase small subunit	NA	NA	NA	NA	NA
AWP67010.1|1812478_1814194_-	acetolactate synthase, large subunit, biosynthetic type	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	30.3	3.1e-60
AWP67011.1|1814664_1815276_+	hypothetical protein	NA	NA	NA	NA	NA
AWP68678.1|1815357_1816308_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
AWP67012.1|1817959_1819201_-	MFS transporter	NA	NA	NA	NA	NA
AWP67013.1|1819212_1819986_-	peroxide stress protein YaaA	NA	NA	NA	NA	NA
AWP67014.1|1820012_1820963_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
AWP67015.1|1821061_1821844_-	3-hydroxybutyrate dehydrogenase	NA	NA	NA	NA	NA
AWP67016.1|1823885_1825271_+	alcaligin biosynthesis enzyme	NA	NA	NA	NA	NA
AWP67017.1|1825289_1825895_+	siderophore biosynthesis protein	NA	NA	NA	NA	NA
AWP67018.1|1825891_1827748_+	IucA/IucC family protein	NA	NA	NA	NA	NA
AWP67019.1|1827744_1828545_+	siderophore ferric iron reductase	NA	NA	NA	NA	NA
AWP67020.1|1828559_1829753_+	Rieske (2Fe-2S) protein	NA	NA	NA	NA	NA
AWP67021.1|1829820_1830795_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AWP67022.1|1830917_1832141_+	MFS transporter	NA	S4TR35	Salmonella_phage	29.4	9.8e-24
AWP67023.1|1832251_1834456_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
AWP67024.1|1834750_1835380_+	antibiotic resistance protein	NA	NA	NA	NA	NA
AWP67025.1|1835387_1835594_-	hypothetical protein	NA	NA	NA	NA	NA
AWP67026.1|1836531_1836792_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
AWP68679.1|1836834_1837575_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AWP67027.1|1837558_1838539_+	hydroxyacid dehydrogenase	NA	M1HUT5	Acanthocystis_turfacea_Chlorella_virus	29.2	5.6e-14
AWP67028.1|1838681_1839176_+	RNA polymerase subunit sigma-70	NA	NA	NA	NA	NA
AWP67029.1|1839177_1840095_+	iron dicitrate transport regulator FecR	NA	NA	NA	NA	NA
AWP67030.1|1840174_1841359_+	TonB-dependent receptor	NA	NA	NA	NA	NA
AWP67031.1|1841349_1842300_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 10
CP020647	Bordetella holmesii strain F028 chromosome, complete genome	3696624	1962618	2019228	3696624	integrase,transposase	Leptospira_phage(22.22%)	49	1957302:1957317	1987463:1987478
1957302:1957317	attL	GGCTGTTGCCGGCAAG	NA	NA	NA	NA
AWP67146.1|1962618_1962879_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
AWP67147.1|1962902_1963097_-	hypothetical protein	NA	NA	NA	NA	NA
AWP67148.1|1963096_1965304_-	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
AWP67149.1|1965576_1966374_+	enterobactin-dependent positive regulator	NA	NA	NA	NA	NA
AWP67150.1|1966419_1967475_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
AWP67151.1|1967509_1967704_-|integrase	integrase	integrase	A0A1W6JTA0	Pseudomonas_phage	52.8	1.1e-06
AWP67152.1|1967700_1968642_-	LD-carboxypeptidase	NA	NA	NA	NA	NA
AWP67153.1|1969144_1970029_+	hypothetical protein	NA	NA	NA	NA	NA
AWP67154.1|1970453_1972682_+	isocitrate dehydrogenase, NADP-dependent	NA	NA	NA	NA	NA
AWP67155.1|1972966_1973431_+	hypothetical protein	NA	NA	NA	NA	NA
AWP67156.1|1973437_1974955_+	hypothetical protein	NA	NA	NA	NA	NA
AWP67157.1|1975003_1975756_-	polar amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	42.3	4.3e-30
AWP67158.1|1975763_1976417_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
AWP67159.1|1976453_1977218_-	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AWP67160.1|1977359_1977941_-	polyisoprenoid-binding protein	NA	NA	NA	NA	NA
AWP67161.1|1978223_1978607_-	hypothetical protein	NA	NA	NA	NA	NA
AWP67162.1|1979191_1979521_+	hypothetical protein	NA	NA	NA	NA	NA
AWP67163.1|1979892_1980699_+	EamA family transporter	NA	NA	NA	NA	NA
AWP67164.1|1980700_1981429_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	23.1	1.8e-09
AWP67165.1|1981425_1982190_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	31.2	2.3e-18
AWP67166.1|1982189_1984073_-	ABC transporter permease	NA	NA	NA	NA	NA
AWP68685.1|1984085_1985291_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AWP67167.1|1985358_1986213_-	EAL domain-containing protein	NA	NA	NA	NA	NA
AWP67168.1|1986228_1986924_-	hypothetical protein	NA	NA	NA	NA	NA
AWP67169.1|1987007_1987742_-	hypothetical protein	NA	NA	NA	NA	NA
1987463:1987478	attR	GGCTGTTGCCGGCAAG	NA	NA	NA	NA
AWP67170.1|1987918_1988710_+	hydratase	NA	NA	NA	NA	NA
AWP67171.1|1988732_1990277_-	hypothetical protein	NA	A0A0R6PEZ3	Moraxella_phage	42.9	8.8e-38
AWP67172.1|1991021_1992221_+	diguanylate phosphodiesterase	NA	NA	NA	NA	NA
AWP67173.1|1992657_1993281_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AWP68686.1|1993286_1996943_+	virulence sensor protein	NA	Q8QKV7	Ectocarpus_siliculosus_virus	32.0	6.5e-39
AWP67174.1|1999131_2000829_+	MFS transporter	NA	NA	NA	NA	NA
AWP67175.1|2001213_2001474_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
AWP67176.1|2001512_2002334_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	44.0	1.9e-55
AWP67177.1|2002366_2002681_+	glutamate decarboxylase	NA	NA	NA	NA	NA
AWP67178.1|2002782_2004471_+	transporter	NA	NA	NA	NA	NA
AWP67179.1|2004550_2004928_+	hypothetical protein	NA	NA	NA	NA	NA
AWP67180.1|2005064_2005790_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AWP67181.1|2005922_2006909_+	C4-dicarboxylate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AWP67182.1|2006911_2007385_+	TRAP transporter permease DctQ	NA	NA	NA	NA	NA
AWP67183.1|2007389_2008673_+	TRAP transporter permease DctM	NA	NA	NA	NA	NA
AWP67184.1|2008669_2009560_+	CoA ester lyase	NA	NA	NA	NA	NA
AWP67185.1|2009556_2011254_+	thiamine pyrophosphate-binding protein	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	25.7	4.0e-31
AWP67186.1|2012578_2014078_+	aldehyde dehydrogenase PuuC	NA	NA	NA	NA	NA
AWP67187.1|2014150_2014669_+	hypothetical protein	NA	NA	NA	NA	NA
AWP67188.1|2014742_2015633_+	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
AWP67189.1|2015747_2016944_+	alpha-hydroxy-acid oxidizing enzyme	NA	NA	NA	NA	NA
AWP67190.1|2016978_2017743_-	iron ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AWP67191.1|2018107_2018929_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	44.0	1.1e-55
AWP67192.1|2018967_2019228_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
>prophage 11
CP020647	Bordetella holmesii strain F028 chromosome, complete genome	3696624	2330133	2426982	3696624	protease,transposase,tRNA	Escherichia_phage(14.29%)	89	NA	NA
AWP67454.1|2330133_2331648_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.9	8.8e-83
AWP67455.1|2331660_2331948_+	hypothetical protein	NA	NA	NA	NA	NA
AWP68703.1|2331968_2332856_-	methylglyoxal synthase	NA	NA	NA	NA	NA
AWP67456.1|2333006_2333513_+	RNA polymerase subunit sigma	NA	NA	NA	NA	NA
AWP67457.1|2333509_2334466_+	iron dicitrate transport regulator FecR	NA	NA	NA	NA	NA
AWP67458.1|2334653_2336000_+	protein FpvAIII	NA	NA	NA	NA	NA
AWP67459.1|2336945_2337716_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.6	3.7e-77
AWP68704.1|2337712_2338723_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	4.4e-78
AWP67460.1|2338792_2339038_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
AWP67461.1|2339025_2339484_+	hypothetical protein	NA	NA	NA	NA	NA
AWP67462.1|2339539_2339734_-	Fe-S assembly protein IscX	NA	NA	NA	NA	NA
AWP67463.1|2339735_2340077_-	ferredoxin, 2Fe-2S type, ISC system	NA	NA	NA	NA	NA
AWP67464.1|2340086_2341949_-	molecular chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	38.7	1.4e-98
AWP67465.1|2341988_2342495_-	Fe-S protein assembly co-chaperone HscB	NA	NA	NA	NA	NA
AWP67466.1|2342498_2342822_-	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	54.2	6.8e-25
AWP67467.1|2342823_2343228_-	iron-sulfur cluster scaffold-like protein	NA	A0A218MKD1	uncultured_virus	79.8	1.9e-53
AWP67468.1|2343264_2344476_-	IscS subfamily cysteine desulfurase	NA	NA	NA	NA	NA
AWP67469.1|2344497_2345046_-	Fe-S cluster assembly transcriptional regulator IscR	NA	NA	NA	NA	NA
AWP67470.1|2345270_2345762_-	protein tyrosine phosphatase	NA	NA	NA	NA	NA
AWP67471.1|2345976_2348007_-	excinuclease ABC subunit B	NA	NA	NA	NA	NA
AWP67472.1|2348081_2349284_+	aromatic amino acid aminotransferase	NA	NA	NA	NA	NA
AWP67473.1|2349826_2350762_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AWP67474.1|2351795_2352077_+	hypothetical protein	NA	NA	NA	NA	NA
AWP67475.1|2352163_2352337_+	osmotically inducible protein OsmC	NA	NA	NA	NA	NA
AWP67476.1|2352448_2352793_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
AWP67477.1|2352864_2353533_+	anti-sigma factor	NA	NA	NA	NA	NA
AWP67478.1|2354948_2355992_+	alcohol dehydrogenase	NA	A0A2K9L339	Tupanvirus	29.2	1.4e-31
AWP68705.1|2355988_2356090_+	hypothetical protein	NA	NA	NA	NA	NA
AWP67479.1|2356181_2356442_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
AWP67480.1|2356480_2357302_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	44.0	1.9e-55
AWP67481.1|2357551_2358205_+	repressor LexA	NA	A0A2H4JG58	uncultured_Caudovirales_phage	50.7	1.9e-10
AWP67482.1|2358320_2359541_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	7.9e-183
AWP67483.1|2359591_2362021_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	51.4	3.6e-219
AWP67484.1|2362186_2363485_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	54.3	3.1e-129
AWP67485.1|2363589_2364243_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	55.9	2.0e-55
AWP67486.1|2364245_2365556_-	trigger factor	NA	NA	NA	NA	NA
AWP67487.1|2365783_2366323_+	TIGR00645 family protein	NA	K4K6D8	Caulobacter_phage	35.8	4.3e-24
AWP67488.1|2366383_2366764_+	hypothetical protein	NA	A4PE56	Ralstonia_virus	71.6	2.0e-44
AWP67489.1|2366807_2367068_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
AWP68706.1|2367353_2368364_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	4.4e-78
AWP67490.1|2368360_2369131_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.6	2.8e-77
AWP67491.1|2369375_2369876_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	50.3	9.5e-42
AWP67492.1|2369843_2370335_-	SpoVR like family protein	NA	NA	NA	NA	NA
AWP67493.1|2370444_2370648_-	cold-shock protein CspA	NA	A0A2H4N7Y6	Lake_Baikal_phage	66.7	6.6e-18
AWP67494.1|2370965_2371286_-	hypothetical protein	NA	NA	NA	NA	NA
AWP67495.1|2371269_2371605_-	hypothetical protein	NA	NA	NA	NA	NA
AWP67496.1|2371659_2371872_-	autotransporter	NA	NA	NA	NA	NA
AWP67497.1|2371947_2372286_+|transposase	transposase	transposase	A0A218MNG9	uncultured_virus	50.0	3.7e-05
AWP67498.1|2372680_2374252_+|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	47.5	2.0e-125
AWP67499.1|2375045_2375357_+	hypothetical protein	NA	NA	NA	NA	NA
AWP67500.1|2375549_2376371_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	44.0	1.9e-55
AWP67501.1|2376409_2376670_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
AWP67502.1|2376797_2376992_-	hypothetical protein	NA	NA	NA	NA	NA
AWP67503.1|2384621_2386085_+	ribonuclease E/G	NA	NA	NA	NA	NA
AWP67504.1|2386217_2387768_+	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	32.9	4.1e-19
AWP67505.1|2388079_2388901_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	44.0	1.9e-55
AWP67506.1|2388939_2389200_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
AWP67507.1|2390313_2391171_+	EamA family transporter	NA	NA	NA	NA	NA
AWP67508.1|2391223_2391721_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AWP67509.1|2391841_2393257_+	hypothetical protein	NA	NA	NA	NA	NA
AWP67510.1|2393266_2394451_+	EmrA/EmrK family multidrug efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AWP67511.1|2394447_2396046_+	MFS transporter	NA	NA	NA	NA	NA
AWP67512.1|2397228_2397474_-	hypothetical protein	NA	NA	NA	NA	NA
AWP67513.1|2397884_2398070_+	hypothetical protein	NA	NA	NA	NA	NA
AWP67514.1|2398225_2399137_+	EamA family transporter	NA	NA	NA	NA	NA
AWP67515.1|2399150_2400101_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
AWP67516.1|2400307_2401150_-	glyoxylate/hydroxypyruvate reductase A	NA	NA	NA	NA	NA
AWP67517.1|2401352_2402726_+	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
AWP67518.1|2403035_2404547_-	ATP-binding protein	NA	A0A248XCZ8	Klebsiella_phage	45.9	2.5e-77
AWP67519.1|2404699_2405431_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
AWP67520.1|2405537_2406839_+	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
AWP67521.1|2406846_2407755_+	coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
AWP67522.1|2407751_2408345_+	nicotinate-nicotinamide nucleotide adenylyltransferase	NA	NA	NA	NA	NA
AWP67523.1|2408388_2408802_+	ribosome silencing factor RsfS	NA	NA	NA	NA	NA
AWP67524.1|2408798_2409269_+	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
AWP67525.1|2409275_2409881_+	septum formation inhibitor Maf	NA	NA	NA	NA	NA
AWP67526.1|2411682_2413467_+	two-component sensor histidine kinase	NA	NA	NA	NA	NA
AWP67527.1|2413463_2414849_+	Fis family transcriptional regulator	NA	NA	NA	NA	NA
AWP67528.1|2414834_2415797_-	serine/threonine dehydratase	NA	NA	NA	NA	NA
AWP67529.1|2415866_2416496_-	DNA-binding protein	NA	NA	NA	NA	NA
AWP67530.1|2416533_2417742_-	MFS transporter	NA	NA	NA	NA	NA
AWP67531.1|2417863_2418433_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AWP67532.1|2418564_2420118_+	methyltransferase	NA	NA	NA	NA	NA
AWP67533.1|2420421_2421642_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
AWP67534.1|2422049_2422952_+	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AWP67535.1|2422948_2423818_+	manganese/iron transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.8	1.5e-10
AWP67536.1|2423814_2424666_+	hypothetical protein	NA	NA	NA	NA	NA
AWP67537.1|2424662_2425487_+	hypothetical protein	NA	NA	NA	NA	NA
AWP67538.1|2425761_2426982_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
>prophage 12
CP020647	Bordetella holmesii strain F028 chromosome, complete genome	3696624	2600192	2654118	3696624	transposase,tRNA	Leptospira_phage(50.0%)	57	NA	NA
AWP67678.1|2600192_2600453_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
AWP67679.1|2601167_2601584_-	transcriptional repressor	NA	NA	NA	NA	NA
AWP68712.1|2601854_2602352_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
AWP67680.1|2602367_2603159_+	4-hydroxy-tetrahydrodipicolinate reductase	NA	NA	NA	NA	NA
AWP68713.1|2603216_2604203_-	UDP-N-acetylenolpyruvoylglucosamine reductase	NA	NA	NA	NA	NA
AWP67681.1|2605137_2605398_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
AWP67682.1|2605436_2605991_+	hypothetical protein	NA	S5WIU1	Leptospira_phage	49.7	4.3e-43
AWP67683.1|2606507_2607161_+	thiol:disulfide interchange protein DsbG	NA	NA	NA	NA	NA
AWP67684.1|2607342_2608050_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AWP67685.1|2608046_2610662_+	Fe/S-dependent 2-methylisocitrate dehydratase AcnD	NA	NA	NA	NA	NA
AWP67686.1|2610718_2611903_+	2-methylaconitate cis-trans isomerase PrpF	NA	NA	NA	NA	NA
AWP67687.1|2611963_2612572_+	lysine transporter LysE	NA	NA	NA	NA	NA
AWP67688.1|2612694_2613720_-	LacI family transcriptional regulator	NA	NA	NA	NA	NA
AWP67689.1|2613783_2614314_-	short-chain dehydrogenase	NA	NA	NA	NA	NA
AWP67690.1|2614193_2614535_-	hypothetical protein	NA	NA	NA	NA	NA
AWP67691.1|2614531_2615239_-	short-chain dehydrogenase	NA	NA	NA	NA	NA
AWP67692.1|2615248_2616142_-	carboxyvinyl-carboxyphosphonate phosphorylmutase	NA	NA	NA	NA	NA
AWP67693.1|2616125_2616884_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AWP67694.1|2617175_2619851_+	aconitate hydratase 1	NA	NA	NA	NA	NA
AWP67695.1|2619867_2621229_+	dihydroorotase	NA	NA	NA	NA	NA
AWP67696.1|2621248_2621971_+	hydrolase	NA	NA	NA	NA	NA
AWP67697.1|2621975_2622974_+	GTP-binding protein	NA	NA	NA	NA	NA
AWP67698.1|2623394_2623703_+	hypothetical protein	NA	NA	NA	NA	NA
AWP67699.1|2623750_2624323_+	hypothetical protein	NA	NA	NA	NA	NA
AWP67700.1|2624300_2624705_-	hypothetical protein	NA	NA	NA	NA	NA
AWP67701.1|2624823_2625741_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AWP67702.1|2625750_2626332_+	NUDIX hydrolase	NA	NA	NA	NA	NA
AWP67703.1|2626328_2627081_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
AWP67704.1|2627123_2627843_+	arginyltransferase	NA	NA	NA	NA	NA
AWP67705.1|2627885_2628941_+	dihydroorotate dehydrogenase (quinone)	NA	NA	NA	NA	NA
AWP67706.1|2629950_2630211_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
AWP67707.1|2630249_2631071_+	hypothetical protein	NA	S5WIU1	Leptospira_phage	43.7	7.2e-55
AWP67708.1|2631630_2632209_-	Phasin (PHA-granule associated protein)	NA	NA	NA	NA	NA
AWP67709.1|2632351_2633572_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.6	4.2e-184
AWP67710.1|2633876_2634854_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AWP67711.1|2635002_2635833_-	IclR family transcriptional regulator	NA	NA	NA	NA	NA
AWP67712.1|2635946_2636762_-	competence/damage-inducible protein A	NA	NA	NA	NA	NA
AWP67713.1|2636784_2637639_-	hypothetical protein	NA	NA	NA	NA	NA
AWP67714.1|2637637_2638021_+	thiol reductase thioredoxin	NA	NA	NA	NA	NA
AWP67715.1|2638127_2639501_-	ATP-dependent RNA helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.6	1.8e-50
AWP67716.1|2639572_2640064_-	hypothetical protein	NA	NA	NA	NA	NA
AWP67717.1|2640063_2640816_-	hypothetical protein	NA	NA	NA	NA	NA
AWP67718.1|2641163_2641367_+	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
AWP67719.1|2641396_2641819_+	DUF4440 domain-containing protein	NA	NA	NA	NA	NA
AWP67720.1|2641830_2642928_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
AWP68714.1|2642940_2644410_-	peptidase	NA	NA	NA	NA	NA
AWP67721.1|2644531_2645371_+	UTP--glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	46.2	1.6e-62
AWP67722.1|2645392_2646250_-	hypothetical protein	NA	NA	NA	NA	NA
AWP67723.1|2646322_2647441_-	porin	NA	NA	NA	NA	NA
AWP67724.1|2647427_2648042_-	magnesium transporting ATPase, P-type 1	NA	NA	NA	NA	NA
AWP67725.1|2648071_2648893_-	hypothetical protein	NA	S5WIU1	Leptospira_phage	43.7	7.2e-55
AWP67726.1|2648931_2649192_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
AWP67727.1|2649235_2649865_-	calcium:sodium antiporter	NA	NA	NA	NA	NA
AWP67728.1|2650022_2651366_+	peptidase M24 family protein	NA	NA	NA	NA	NA
AWP67729.1|2651374_2651758_-	hypothetical protein	NA	NA	NA	NA	NA
AWP67730.1|2651917_2653069_+	monooxygenase	NA	NA	NA	NA	NA
AWP67731.1|2653167_2654118_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 13
CP020647	Bordetella holmesii strain F028 chromosome, complete genome	3696624	2936440	2991239	3696624	transposase,tRNA	Ralstonia_virus(16.67%)	43	NA	NA
AWP67965.1|2936440_2937220_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
AWP67966.1|2937242_2938190_+	prolyl aminopeptidase	NA	NA	NA	NA	NA
AWP67967.1|2938191_2938392_+	thiamine biosynthesis protein ThiS	NA	NA	NA	NA	NA
AWP67968.1|2938726_2938987_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
AWP67969.1|2940169_2940886_-	phosphoserine phosphatase SerB	NA	NA	NA	NA	NA
AWP67970.1|2940882_2941776_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AWP67971.1|2941939_2943160_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
AWP67972.1|2943312_2944395_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.1	1.5e-31
AWP67973.1|2946074_2947058_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AWP67974.1|2947120_2948533_-	signal recognition particle protein	NA	NA	NA	NA	NA
AWP67975.1|2948650_2949493_+	hypothetical protein	NA	NA	NA	NA	NA
AWP67976.1|2949771_2950380_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1W6DX33	Sphingobium_phage	46.8	1.0e-05
AWP67977.1|2950395_2951016_+	glutathione S-transferase	NA	NA	NA	NA	NA
AWP68724.1|2951081_2951789_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.3	1.2e-13
AWP67978.1|2951793_2952516_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	28.6	1.9e-11
AWP67979.1|2952502_2952793_-	inner-membrane translocator	NA	NA	NA	NA	NA
AWP67980.1|2952868_2954089_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	5.5e-184
AWP68725.1|2954813_2955665_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
AWP67981.1|2955716_2956970_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AWP67982.1|2957146_2957935_-	DUF1445 domain-containing protein	NA	NA	NA	NA	NA
AWP67983.1|2958054_2958969_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AWP67984.1|2959101_2960994_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	37.9	4.6e-121
AWP67985.1|2961179_2962559_+	xanthine permease XanP	NA	H9YQ34	environmental_Halophage	50.7	4.1e-26
AWP67986.1|2963003_2963300_+	site-specific recombinase	NA	NA	NA	NA	NA
AWP67987.1|2963343_2963604_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
AWP67988.1|2963642_2964197_+	hypothetical protein	NA	S5WIU1	Leptospira_phage	50.3	1.1e-43
AWP67989.1|2964210_2964435_-	hypothetical protein	NA	NA	NA	NA	NA
AWP67990.1|2967100_2967703_-	3-methyladenine DNA glycosylase	NA	NA	NA	NA	NA
AWP67991.1|2967836_2968295_+	zinc/iron-chelating domain-containing protein	NA	NA	NA	NA	NA
AWP67992.1|2968296_2968896_-	iron transport sensor protein	NA	NA	NA	NA	NA
AWP67993.1|2968904_2969714_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AWP67994.1|2969748_2970603_+	anion permease	NA	NA	NA	NA	NA
AWP67995.1|2970722_2971310_+	histidine utilization protein HutD	NA	NA	NA	NA	NA
AWP67996.1|2971306_2972686_+	formimidoylglutamate deiminase	NA	NA	NA	NA	NA
AWP67997.1|2981007_2982348_+	8-amino-7-oxononanoate synthase	NA	G9E4Q1	Emiliania_huxleyi_virus	32.3	2.9e-45
AWP67998.1|2982361_2983213_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	40.4	4.4e-47
AWP67999.1|2983224_2984490_-	capsule biosynthesis protein CapA	NA	NA	NA	NA	NA
AWP68000.1|2984551_2986582_-	beta-3-deoxy-D-manno-oct-2-ulosonic acid transferase	NA	NA	NA	NA	NA
AWP68001.1|2987581_2987842_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
AWP68002.1|2987880_2988435_+	hypothetical protein	NA	S5WIU1	Leptospira_phage	50.3	1.1e-43
AWP68003.1|2988431_2989286_-	sulfatase	NA	NA	NA	NA	NA
AWP68004.1|2989278_2990073_-	short-chain dehydrogenase	NA	NA	NA	NA	NA
AWP68005.1|2990288_2991239_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 14
CP020647	Bordetella holmesii strain F028 chromosome, complete genome	3696624	3011864	3045179	3696624	tRNA,transposase,protease	Ralstonia_virus(33.33%)	33	NA	NA
AWP68020.1|3011864_3012125_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
AWP68021.1|3012280_3013501_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	1.0e-182
AWP68022.1|3013562_3014450_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
AWP68023.1|3014467_3015772_-|protease	protease modulator HflK	protease	NA	NA	NA	NA
AWP68024.1|3015737_3016844_-	GTPase HflX	NA	NA	NA	NA	NA
AWP68025.1|3016931_3017168_-	RNA-binding protein Hfq	NA	NA	NA	NA	NA
AWP68026.1|3017351_3018425_-	histidinol-phosphate transaminase	NA	NA	NA	NA	NA
AWP68027.1|3018421_3019777_-	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
AWP68028.1|3019801_3020959_-	outer membrane protein assembly factor BamB	NA	NA	NA	NA	NA
AWP68029.1|3020964_3021603_-	hypothetical protein	NA	NA	NA	NA	NA
AWP68030.1|3021606_3022902_-|tRNA	histidine--tRNA ligase	tRNA	NA	NA	NA	NA
AWP68031.1|3022934_3024221_-	4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase	NA	NA	NA	NA	NA
AWP68032.1|3024233_3024722_-	transcriptional regulator	NA	NA	NA	NA	NA
AWP68033.1|3024718_3025867_-	23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN	NA	NA	NA	NA	NA
AWP68034.1|3025896_3026322_-	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	42.9	2.4e-22
AWP68035.1|3026641_3029521_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	37.1	1.1e-137
AWP68036.1|3029574_3030795_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	1.0e-182
AWP68037.1|3030843_3031707_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
AWP68038.1|3031706_3032300_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
AWP68039.1|3032591_3032852_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
AWP68040.1|3033351_3033603_-	hypothetical protein	NA	NA	NA	NA	NA
AWP68041.1|3033589_3036211_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	39.5	2.8e-84
AWP68042.1|3036294_3037320_-	pilus assembly protein	NA	NA	NA	NA	NA
AWP68043.1|3037316_3037901_-	prepilin-type cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
AWP68044.1|3037924_3039025_-	pilus assembly protein	NA	NA	NA	NA	NA
AWP68045.1|3039017_3039272_-	pilus assembly protein	NA	NA	NA	NA	NA
AWP68046.1|3039368_3040244_-	pilus assembly protein	NA	NA	NA	NA	NA
AWP68047.1|3040236_3040686_-	pilus assembly protein	NA	NA	NA	NA	NA
AWP68048.1|3040663_3041788_-	pilus assembly protein	NA	NA	NA	NA	NA
AWP68049.1|3041780_3043367_-	hypothetical protein	NA	NA	NA	NA	NA
AWP68050.1|3043363_3044122_-	pilus assembly protein	NA	NA	NA	NA	NA
AWP68051.1|3044058_3044880_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	44.0	1.9e-55
AWP68052.1|3044918_3045179_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
>prophage 15
CP020647	Bordetella holmesii strain F028 chromosome, complete genome	3696624	3095068	3150719	3696624	protease,transposase,tRNA	Ralstonia_virus(25.0%)	41	NA	NA
AWP68091.1|3095068_3096289_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
AWP68728.1|3096330_3097587_-	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AWP68092.1|3097827_3098973_+	Bcr/CflA family drug resistance efflux transporter	NA	NA	NA	NA	NA
AWP68093.1|3099279_3099516_+	50S ribosomal protein L28	NA	NA	NA	NA	NA
AWP68094.1|3099596_3099764_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
AWP68095.1|3099920_3101009_+	hypothetical protein	NA	NA	NA	NA	NA
AWP68096.1|3101034_3102255_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	1.0e-182
AWP68097.1|3104473_3104905_+	DNA-binding protein	NA	NA	NA	NA	NA
AWP68098.1|3105031_3105544_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AWP68729.1|3105576_3106737_+	MFS transporter	NA	NA	NA	NA	NA
AWP68099.1|3106808_3109466_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	38.7	7.5e-170
AWP68100.1|3109477_3110155_+	hypothetical protein	NA	NA	NA	NA	NA
AWP68101.1|3110154_3111204_+	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
AWP68102.1|3111227_3112487_+	gamma-glutamyl-phosphate reductase	NA	A0A1X9I5D4	Streptococcus_phage	46.2	1.9e-94
AWP68103.1|3112493_3112883_+	hypothetical protein	NA	NA	NA	NA	NA
AWP68104.1|3113034_3113319_+	N-acetyltransferase	NA	NA	NA	NA	NA
AWP68105.1|3113315_3113705_+	hypothetical protein	NA	NA	NA	NA	NA
AWP68106.1|3113717_3114911_-	secretion protein	NA	NA	NA	NA	NA
AWP68107.1|3114907_3116668_-|protease	protease/lipase ABC transporter ATP-binding protein	protease	F2Y2R6	Organic_Lake_phycodnavirus	28.5	3.5e-14
AWP68108.1|3116664_3117966_-	hypothetical protein	NA	NA	NA	NA	NA
AWP68109.1|3118203_3118464_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
AWP68110.1|3118502_3119324_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	44.0	1.9e-55
AWP68111.1|3125724_3127242_-	propionyl-CoA--succinate CoA transferase	NA	NA	NA	NA	NA
AWP68112.1|3128509_3130867_+	mechanosensitive ion channel protein	NA	NA	NA	NA	NA
AWP68113.1|3130868_3131639_-	hypothetical protein	NA	NA	NA	NA	NA
AWP68114.1|3131635_3132514_-	EamA family transporter	NA	NA	NA	NA	NA
AWP68115.1|3132697_3132988_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
AWP68116.1|3133003_3133546_-	DNA polymerase III subunit epsilon	NA	A0A0A7RWA3	Clostridium_phage	29.7	7.2e-11
AWP68117.1|3133769_3136361_+	aconitate hydratase B	NA	NA	NA	NA	NA
AWP68118.1|3139025_3139628_+	hypothetical protein	NA	NA	NA	NA	NA
AWP68730.1|3139876_3142582_+	aconitate hydratase	NA	NA	NA	NA	NA
AWP68119.1|3142647_3143430_-	dioxygenase	NA	NA	NA	NA	NA
AWP68120.1|3143591_3144797_+	hypothetical protein	NA	NA	NA	NA	NA
AWP68121.1|3144803_3145892_+	hypothetical protein	NA	NA	NA	NA	NA
AWP68122.1|3146049_3146607_+	elongation factor P	NA	NA	NA	NA	NA
AWP68123.1|3146688_3147123_-	hypothetical protein	NA	NA	NA	NA	NA
AWP68124.1|3147196_3147901_-	hypothetical protein	NA	NA	NA	NA	NA
AWP68125.1|3148002_3149385_-	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
AWP68126.1|3149394_3149847_-	hypothetical protein	NA	NA	NA	NA	NA
AWP68127.1|3149865_3150420_-	hypothetical protein	NA	S5WIU1	Leptospira_phage	50.3	1.1e-43
AWP68128.1|3150458_3150719_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
>prophage 16
CP020647	Bordetella holmesii strain F028 chromosome, complete genome	3696624	3350450	3417119	3696624	transposase,tRNA	Leptospira_phage(22.22%)	60	NA	NA
AWP68301.1|3350450_3352586_+|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
AWP68302.1|3352582_3353122_+	D-glycero-beta-D-manno-heptose-1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
AWP68303.1|3353125_3353854_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
AWP68304.1|3353840_3354674_+	hypothetical protein	NA	NA	NA	NA	NA
AWP68305.1|3354678_3355605_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AWP68742.1|3355683_3357099_+	FAD-binding dehydrogenase	NA	NA	NA	NA	NA
AWP68306.1|3357085_3358168_+	tricarballylate utilization protein B	NA	NA	NA	NA	NA
AWP68307.1|3358281_3358677_+	lactoylglutathione lyase	NA	NA	NA	NA	NA
AWP68308.1|3358682_3359216_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	35.6	7.5e-13
AWP68309.1|3361606_3362836_+	hypothetical protein	NA	NA	NA	NA	NA
AWP68310.1|3362836_3364279_-	pyruvate kinase	NA	NA	NA	NA	NA
AWP68311.1|3364374_3365517_+	glycerate kinase	NA	W6LM47	Streptococcus_phage	38.0	3.2e-37
AWP68312.1|3365535_3366015_+	thioesterase	NA	NA	NA	NA	NA
AWP68313.1|3366043_3366832_-	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase	NA	NA	NA	NA	NA
AWP68314.1|3366845_3368384_-	molecular chaperone SurA	NA	NA	NA	NA	NA
AWP68743.1|3368380_3370789_-	LPS biosynthesis protein	NA	NA	NA	NA	NA
AWP68315.1|3370942_3372010_+	aminoglycoside phosphotransferase	NA	NA	NA	NA	NA
AWP68316.1|3372009_3372690_+	mannose-1-phosphate guanylyltransferase	NA	NA	NA	NA	NA
AWP68317.1|3372831_3373557_+	hypothetical protein	NA	NA	NA	NA	NA
AWP68318.1|3373565_3373889_-	4a-hydroxytetrahydrobiopterin dehydratase	NA	NA	NA	NA	NA
AWP68319.1|3373942_3374590_-	hypothetical protein	NA	NA	NA	NA	NA
AWP68320.1|3374725_3375139_+	hypothetical protein	NA	NA	NA	NA	NA
AWP68321.1|3375224_3376274_+	NADP(H)-dependent aldo-keto reductase	NA	NA	NA	NA	NA
AWP68322.1|3376419_3377370_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
AWP68323.1|3377408_3378116_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AWP68324.1|3378083_3378905_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	44.0	1.1e-55
AWP68325.1|3378943_3379204_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
AWP68326.1|3379261_3380770_-	sulfite reductase	NA	NA	NA	NA	NA
AWP68327.1|3380926_3382450_-	phospholipase D family protein	NA	NA	NA	NA	NA
AWP68328.1|3382504_3383152_-	carbonic anhydrase	NA	NA	NA	NA	NA
AWP68329.1|3383294_3383636_-	hypothetical protein	NA	NA	NA	NA	NA
AWP68330.1|3383793_3384126_+	PsiF repeat family protein	NA	NA	NA	NA	NA
AWP68331.1|3384174_3385215_-	cyclase	NA	NA	NA	NA	NA
AWP68332.1|3385218_3385998_-	3-oxoadipate enol-lactonase	NA	NA	NA	NA	NA
AWP68333.1|3386033_3386330_-	hypothetical protein	NA	NA	NA	NA	NA
AWP68334.1|3386344_3386620_-	muconolactone delta-isomerase	NA	NA	NA	NA	NA
AWP68335.1|3386687_3387332_-	3-oxoadipate CoA-transferase	NA	NA	NA	NA	NA
AWP68336.1|3387334_3387424_-	3-oxoadipate CoA-transferase	NA	NA	NA	NA	NA
AWP68337.1|3387614_3388400_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
AWP68338.1|3388437_3389163_-	short-chain dehydrogenase	NA	NA	NA	NA	NA
AWP68339.1|3389176_3390517_-	short-chain fatty acid transporter	NA	NA	NA	NA	NA
AWP68340.1|3390611_3391544_-	3-hydroxybutyryl-CoA dehydrogenase	NA	NA	NA	NA	NA
AWP68341.1|3391772_3394544_-	peptidase S8	NA	NA	NA	NA	NA
AWP68342.1|3394983_3397830_-	phosphoenolpyruvate carboxylase	NA	NA	NA	NA	NA
AWP68343.1|3397976_3398690_+	7-cyano-7-deazaguanine synthase	NA	A0A0A0RPC6	Escherichia_phage	41.4	1.6e-47
AWP68344.1|3398702_3399245_-	N-acetyltransferase	NA	A0A2H4J136	uncultured_Caudovirales_phage	45.8	1.1e-27
AWP68345.1|3399350_3400259_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	25.7	4.4e-05
AWP68346.1|3400350_3402207_+	dihydroxy-acid dehydratase	NA	NA	NA	NA	NA
AWP68347.1|3402390_3403431_-	GntR family transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	28.2	4.3e-20
AWP68348.1|3403573_3404479_+	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
AWP68349.1|3407174_3407942_-	trans-aconitate 2-methyltransferase	NA	NA	NA	NA	NA
AWP68350.1|3408059_3408704_+	hypothetical protein	NA	NA	NA	NA	NA
AWP68351.1|3408967_3409264_+	polysaccharide deacetylase	NA	NA	NA	NA	NA
AWP68352.1|3409410_3410481_+	rRNA methyltransferase	NA	NA	NA	NA	NA
AWP68353.1|3410713_3410908_-	hypothetical protein	NA	NA	NA	NA	NA
AWP68354.1|3411176_3412031_+	hypothetical protein	NA	NA	NA	NA	NA
AWP68355.1|3412056_3413277_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	1.0e-182
AWP68744.1|3414176_3415526_+	autotransporter	NA	NA	NA	NA	NA
AWP68356.1|3415998_3416259_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
AWP68357.1|3416297_3417119_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	44.0	1.9e-55
>prophage 17
CP020647	Bordetella holmesii strain F028 chromosome, complete genome	3696624	3610009	3661109	3696624	transposase,holin,tRNA	Catovirus(18.18%)	42	NA	NA
AWP68529.1|3610009_3611800_-|tRNA	aspartate--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	24.5	5.5e-07
AWP68530.1|3611841_3612477_-	hypothetical protein	NA	A0A2I7S9X1	Vibrio_phage	29.0	1.2e-12
AWP68531.1|3612479_3612794_-	FmdB family transcriptional regulator	NA	NA	NA	NA	NA
AWP68532.1|3614344_3615967_-|holin	choline dehydrogenase	holin	A0A1V0S9J5	Catovirus	29.6	5.4e-46
AWP68533.1|3616137_3616242_-	dihydrodipicolinate synthase	NA	NA	NA	NA	NA
AWP68534.1|3616234_3616945_-	dihydrodipicolinate synthase	NA	NA	NA	NA	NA
AWP68535.1|3617219_3617708_-	diguanylate cyclase	NA	NA	NA	NA	NA
AWP68536.1|3617849_3619049_+	2-aminoadipate aminotransferase	NA	NA	NA	NA	NA
AWP68537.1|3619124_3620048_+	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
AWP68538.1|3620382_3620763_+	hypothetical protein	NA	NA	NA	NA	NA
AWP68752.1|3620906_3621680_-	transcriptional regulator GlcC	NA	NA	NA	NA	NA
AWP68753.1|3621876_3624048_+	malate synthase G	NA	NA	NA	NA	NA
AWP68539.1|3624105_3625179_-	lipase	NA	G9BWD6	Planktothrix_phage	37.1	2.6e-28
AWP68540.1|3625171_3626941_-	spermidine/putrescine ABC transporter permease	NA	NA	NA	NA	NA
AWP68541.1|3626955_3628065_-	iron ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AWP68542.1|3628180_3630670_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
AWP68543.1|3630656_3631328_-	DNA-binding response regulator	NA	NA	NA	NA	NA
AWP68544.1|3631851_3632898_+	oxidoreductase	NA	NA	NA	NA	NA
AWP68545.1|3632906_3633476_+	N-acetyltransferase	NA	NA	NA	NA	NA
AWP68546.1|3633884_3634577_+	aminotransferase DegT	NA	NA	NA	NA	NA
AWP68547.1|3634573_3635656_+	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A0N9R0B2	Chrysochromulina_ericina_virus	33.2	1.1e-45
AWP68548.1|3635680_3636934_+	glycosyltransferase WbuB	NA	NA	NA	NA	NA
AWP68549.1|3636938_3638126_+	UDP-4-amino-4, 6-dideoxy-N-acetyl-beta-L-altrosamine transaminase	NA	NA	NA	NA	NA
AWP68550.1|3638122_3638716_+	sugar transferase	NA	NA	NA	NA	NA
AWP68551.1|3639102_3641040_+	polysaccharide biosynthesis protein	NA	A0A2P1ELS8	Moumouvirus	27.9	2.2e-25
AWP68552.1|3641173_3642124_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
AWP68553.1|3642205_3642913_-	hypothetical protein	NA	NA	NA	NA	NA
AWP68554.1|3642976_3645613_+	DNA topoisomerase III	NA	A0A0G2YA05	Acanthamoeba_polyphaga_mimivirus	26.3	8.0e-23
AWP68555.1|3645742_3646963_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	1.1e-181
AWP68556.1|3647041_3648097_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AWP68557.1|3648096_3648867_+	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
AWP68558.1|3649434_3650235_+	gluconate 5-dehydrogenase	NA	NA	NA	NA	NA
AWP68559.1|3650323_3651751_+	aldehyde dehydrogenase	NA	NA	NA	NA	NA
AWP68560.1|3651845_3652400_-	hypothetical protein	NA	S5WIU1	Leptospira_phage	50.3	1.1e-43
AWP68561.1|3652438_3652699_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
AWP68754.1|3652764_3653463_+	3-oxoacyl-ACP reductase	NA	NA	NA	NA	NA
AWP68562.1|3655426_3655906_+	AsnC family transcriptional regulator	NA	NA	NA	NA	NA
AWP68563.1|3655893_3656820_-	bestrophin	NA	NA	NA	NA	NA
AWP68564.1|3656936_3657464_+	SET domain-containing protein-lysine N-methyltransferase	NA	NA	NA	NA	NA
AWP68565.1|3657489_3658710_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	3.5e-183
AWP68755.1|3659105_3659774_+	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	40.7	2.3e-35
AWP68566.1|3660848_3661109_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
